DESIGN APPARATUS, DESIGN METHOD, APTAMER PRODUCTION METHOD, AND PROGRAM

Abstract

To provide a design device capable of easily downsizing an aptamer sequence.SOLUTION: In a design device 1 of the present invention, candidate aptamer sequence acquisition means 11 acquires a candidate aptamer sequence, the candidate aptamer sequence includes a specified motif sequence, estimation means 12 estimates a structure of candidate aptamer from the candidate aptamer sequence, design means 13 deletes a base outside the motif sequence, and designs a plurality of downsized aptamer sequences having different lengths from the single candidate aptamer sequence, the estimation means 12 further estimates a structure of the downsized aptamer from the downsized aptamer sequence, calculation means 14 calculates a score for each of the downsized aptamer sequences, the score shows a degree where a structure of a motif in the structure of the downsized aptamer forms a motif in the candidate aptamer, and extraction means 15 extracts a downsized aptamer sequence having a value preset by the score or more.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to a design device, a design method, an aptamer production method, and a program. [Background technology]

[0002] Aptamers are nucleic acid ligands that bind to target molecules, and the most common method for producing them is the SELEX (Systematic Evolution of Ligands by Exponential enrichment) method (Patent Document 1). In the SELEX method, contact between a nucleic acid pool and the target molecule and amplification of the nucleic acid bound to the target molecule are treated as one set of selection processes, and multiple rounds are repeated. In this way, a sequence capable of binding to the target molecule is selected as the desired aptamer from the initial nucleic acid pool. [Prior art documents] [Patent documents]

[0003] [Patent Document 1] Patent No. 2763958 Summary of the Invention [Problem to be solved by the invention]

[0004] There is a demand for miniaturizing aptamers due to factors such as reduced binding to target molecules due to structural diversity, the occurrence of errors during artificial synthesis of nucleic acids, and increased costs involved in synthesizing nucleic acids.

[0005] An object of the present invention is to provide a design device, a design method, an aptamer production method, and a program that can easily miniaturize an aptamer sequence. [Means for solving the problem]

[0006] In order to achieve the above object, the design device of the present invention comprises: An apparatus for designing a base sequence of an aptamer using a computer, comprising: The apparatus includes a candidate aptamer sequence acquisition means, a prediction means, a design means, a calculation means, and an extraction means, The candidate aptamer sequence acquisition means acquires a candidate aptamer sequence, the candidate aptamer sequence comprises a specified motif sequence; The estimation means estimates a structure of a candidate aptamer from the acquired candidate aptamer sequence, the design means designs a plurality of shortened aptamer sequences having different lengths from one of the candidate aptamer sequences by deleting bases outside the motif sequence; The prediction means further predicts a structure of a shortened aptamer from the designed shortened aptamer sequence, The calculation means calculates a score for each of the designed miniaturized aptamer sequences, the score indicates the degree to which the structure of the motif in the miniaturized aptamer forms the structure of the motif in the candidate aptamer; The extraction means is a device that extracts, from the plurality of shortened aptamer sequences, shortened aptamer sequences whose scores are equal to or greater than a predetermined value.

[0007] The design method of the present invention comprises the steps of: The method includes a step of obtaining a candidate aptamer sequence, a step of estimating, a step of designing, a step of calculating, and a step of extracting, The candidate aptamer sequence obtaining step includes obtaining a candidate aptamer sequence, the candidate aptamer sequence comprises a specified motif sequence; The prediction step includes predicting a structure of a candidate aptamer from the obtained candidate aptamer sequence, The designing step includes designing a plurality of shortened aptamer sequences having different lengths from one of the candidate aptamer sequences by deleting bases outside the motif sequence; The prediction step further includes predicting a structure of a miniaturized aptamer from the designed miniaturized aptamer sequence, The calculation step includes calculating a score for each of the designed miniaturized aptamer sequences, the score indicates the degree to which the structure of the motif in the miniaturized aptamer forms the structure of the motif in the candidate aptamer; The extraction step is a method for extracting, from the plurality of shortened aptamer sequences, shortened aptamer sequences having a score equal to or greater than a predetermined value.

[0008] The method for producing an aptamer of the present invention comprises the steps of: The method includes a design process and a synthesis process, The design process is a design method of the present invention, The synthesis step is a production method in which an aptamer sequence is synthesized based on the miniaturized aptamer sequence extracted in the design step. Effect of the Invention

[0009] According to the present invention, for example, an aptamer sequence can be easily reduced in size. [Brief description of the drawings]

[0010] [Figure 1] FIG. 1 is a block diagram showing a configuration of an example of the apparatus according to the first embodiment. [Diagram 2] FIG. 2 is a block diagram showing an example of a hardware configuration of the apparatus according to the first embodiment. [Diagram 3] FIG. 3 is a flowchart showing an example of processing in the device of the first embodiment. [Figure 4] FIG. 4 is a diagram showing an example of miniaturization of a candidate aptamer sequence in the device of embodiment 1. In FIG. [Diagram 5] FIG. 5 shows an example of the acquired candidate aptamer sequences and the predicted structures of the candidate aptamers in the device of embodiment 1. As shown in FIG. [Figure 6] FIG. 6 shows an example of a plurality of miniaturized aptamer sequences designed in the device of embodiment 1. As shown in FIG. [Figure 7] FIG. 7 is a heat map showing an example of the correspondence between size reduction and score in the device of the first embodiment. [Figure 8]FIG. 8 shows an example of a minimized aptamer sequence selected by the device of embodiment 1. As shown in FIG. [Figure 9] FIG. 9 is a graph showing the binding affinity to a target molecule for each of the candidate aptamer sequences and each of the miniaturized aptamer sequences. [Figure 10] FIG. 10 is a block diagram showing a configuration of an example of the apparatus according to the second embodiment. [Figure 11] FIG. 11 is a flowchart showing an example of processing in the device of the second embodiment. [Figure 12] FIG. 12 is a heat map showing the scores of the miniaturized sequences in Example 1. [Figure 13] FIG. 13 is a heat map showing the scores of the miniaturized sequences in Example 1. [Figure 14] FIG. 14 is a graph showing the binding of truncated sequences to VEGF165 in Example 2. [Figure 15] FIG. 15 is a heat map showing the scores of the miniaturized sequences in Example 3. [Figure 16] FIG. 16 is a heat map showing the scores of the miniaturized sequences in Example 3. [Figure 17] FIG. 17 is a graph showing the binding of truncated sequences to VEGF165 in Example 4. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] In the design device of the present invention, the extraction means may further extract the shortened aptamer sequence having the shortest length.

[0012] In the design device of the present invention, the design means may be configured to delete the base from at least one of the 3'-terminus and 5'-terminus of the candidate aptamer sequence.

[0013] In the design device of the present invention, the design means may determine whether it is possible or impossible to delete the base from at least one of the directions from the 5' end of the motif sequence to the 5' end of the candidate aptamer sequence and from the 3' end of the motif sequence to the 3' end of the candidate aptamer sequence, and if it is possible, delete the base, and if it is not possible, do not delete the base.

[0014] In the design device of the present invention, the calculation means may calculate a high score when the predicted structure of the candidate aptamer includes a specific structure.

[0015] In the design device of the present invention, the calculation means may calculate a high score in proportion to the shortness of the single-stranded structure in the estimated candidate aptamer structure.

[0016] The design device of the present invention may further include an output means for outputting information, and the output means may output the extracted minimized aptamer sequence.

[0017] The design apparatus of the present invention may further include a candidate aptamer group acquisition means and an identification means, wherein the candidate aptamer group acquisition means acquires sequence information of the candidate aptamer group contained in the nucleic acid pool, the identification means identifies the motif sequence and the candidate aptamer sequence containing the motif sequence from the candidate aptamer group, and the candidate aptamer sequence acquisition means acquires the candidate aptamer sequence containing the identified motif sequence.

[0018] In the design method of the present invention, the extraction step may further comprise extracting the shortened aptamer sequence having the shortest length.

[0019] In the designing method of the present invention, the designing step may be implemented by deleting the base from at least one of the 3'-terminus and 5'-terminus of the candidate aptamer sequence.

[0020] In the design method of the present invention, the design step may comprise determining whether it is possible or impossible to delete the base from at least one of the directions from the 5' end of the motif sequence toward the 5' end of the candidate aptamer sequence and from the 3' end of the motif sequence toward the 3' end of the candidate aptamer sequence, and if it is possible, deleting the base, and if it is not possible, not deleting the base.

[0021] In the design method of the present invention, the calculation step may be configured to calculate a high score when the predicted structure of the candidate aptamer includes a specific structure.

[0022] In the design method of the present invention, the calculation step may be implemented in such a way that a higher score is calculated in proportion to the shortness of the single-stranded structure in the predicted candidate aptamer structure.

[0023] The design method of the present invention may further include an output step of outputting information, and the output step may be an embodiment in which the extracted minimized aptamer sequence is output.

[0024] The design method of the present invention may further include a candidate aptamer group obtaining step and an identification step, in which the candidate aptamer group obtaining step obtains sequence information of the candidate aptamer group contained in the nucleic acid pool, the identification step identifies the motif sequence and the candidate aptamer sequence containing the motif sequence from the candidate aptamer group, and the candidate aptamer sequence obtaining step obtains the candidate aptamer sequence containing the identified motif sequence.

[0025] The program of the present invention is a program capable of executing the method of the present invention on a computer.

[0026] The recording medium of the present invention is a computer-readable recording medium having the program of the present invention recorded thereon.

[0027] In the present invention, the term "candidate aptamer sequence" refers to a nucleic acid sequence capable of specifically binding to any target molecule (e.g., protein, nucleic acid, cell, cell tissue, microorganism, small molecule, peptide, hormone, ion, etc.). In addition, in the present invention, the term "miniaturized aptamer sequence" refers to a nucleic acid sequence obtained by deleting one or more bases from the candidate aptamer sequence to make it smaller. In the present invention, "miniaturization" can also be referred to as "shortening". In the present invention, the "nucleic acid" can be, for example, a single-stranded nucleic acid such as single-stranded RNA and single-stranded DNA, a double-stranded nucleic acid such as double-stranded RNA and double-stranded DNA, or the like, and may include a peptide nucleic acid such as PNA. In addition, the nucleic acid may include, for example, natural nucleic acids (non-artificial nucleic acids) such as A, C, G, T, and U, or may include artificial nucleic acids such as 2'-fluorouracil, 2'-aminouracil, 2'-O-methyluracil, and 2-thiouracil.

[0028] The embodiments of the present invention will be described with reference to the drawings. The present invention is not limited to the following embodiments. In each of the drawings, the same parts are given the same reference numerals. In addition, the explanations of each embodiment can be mutually incorporated unless otherwise specified, and the configurations of each embodiment can be combined unless otherwise specified.

[0029] [Embodiment 1] Fig. 1 is a block diagram showing an example of the configuration of a design device 1 according to the present embodiment. As shown in Fig. 1, the device 1 is a device for designing a desired miniaturized aptamer sequence using a computer, and includes a candidate aptamer sequence acquisition means 11, an estimation means 12, a design means 13, a calculation means 14, and an extraction means 15.

[0030] The device 1 may be, for example, a single device including each of the above-mentioned units, or a device to which each of the above-mentioned units can be connected via a communication line network. Although not shown, the device 1 may be connected to an external device described later via the communication line network. The communication line network is not particularly limited, and a known network may be used, for example, wired or wireless. Examples of the communication line network include an Internet line, a WWW (World Wide Web), a telephone line, a LAN (Local Area Network), a SAN (Storage Area Network), and a DTN (Delay Tolerant Networking). Examples of wireless communication include WiFi (Wireless Fidelity) and Bluetooth (registered trademark). The wireless communication may be either a form in which each device directly communicates (Ad Hoc communication) or an indirect communication via an access point. The device 1 may be, for example, incorporated in a server as a system. The device 1 may be, for example, a personal computer (PC, for example, desktop type or notebook type) in which the program of the present invention is installed.

[0031] 2 illustrates a block diagram of the hardware configuration of the present device 1. The present device 1 includes, for example, a central processing unit (CPU, GPU, etc.) 101, a memory 102, a bus 103, a storage device 104, an input device 105, a display device 106, and a communication device 107. Each part of the present device 1 is connected to each other via the bus 103 by its respective interface (I / F).

[0032] A central processing unit (central processing device) 101 is responsible for overall control of the present device 1. In the present device 1, the central processing unit 101 executes, for example, the program of the present invention and other programs, and also reads and writes various information. Specifically, for example, the central processing unit 101 functions as candidate aptamer sequence acquisition means 11, estimation means 12, design means 13, calculation means 14, and extraction means 15.

[0033] The bus 103 can also be connected to, for example, an external device. Examples of the external device include an external storage device (external database, etc.), a printer, etc. The present device 1 can be connected to a communication network, for example, by a communication device 107 connected to the bus 103, and can also be connected to an external device via the communication network.

[0034] An example of the memory 102 is a main memory (primary storage device). When the central processing unit 101 performs processing, the memory 102 reads various operation programs, such as the program of the present invention, stored in the storage device 104 described below, and the central processing unit 101 receives data from the memory 102 and executes the programs. The main memory is, for example, a RAM (random access memory). The memory 102 may also be, for example, a ROM (read only memory).

[0035] The storage device 104 is also called an auxiliary storage device, for example, in contrast to the main memory (primary storage device). As described above, the storage device 104 stores an operation program including the program of the present invention. The storage device 104 may be, for example, a combination of a recording medium and a drive for reading and writing from and to the recording medium. The recording medium is not particularly limited, and may be, for example, an internal or external type, such as a hard disk (HD), CD-ROM, CD-R, CD-RW, MO, DVD, flash memory, or memory card. The storage device 104 may be, for example, a hard disk drive (HDD) in which a recording medium and a drive are integrated, or a solid state drive (SSD).

[0036] In this device 1, the memory 102 and storage device 104 can also store access information and log information from an administrator, as well as information acquired from an external database (not shown).

[0037] The device 1 further includes, for example, an input device 105 and a display device 106. The input device 105 is, for example, a touch panel, a keyboard, a mouse, etc. The display device 106 is, for example, an LED display, a liquid crystal display, etc.

[0038] Next, an example of the design method of this embodiment will be described with reference to the flowchart of Fig. 3. The design method of this embodiment is implemented as follows, for example, using the design device 1 of Fig. 1. Note that the design method of this embodiment is not limited to use of the design device 1 of Fig. 1. Also, all of the steps in the design method of this embodiment are executed on a computer.

[0039] First, a candidate aptamer sequence is acquired by the candidate aptamer sequence acquisition means 11 (S1). The candidate aptamer sequence includes a specified motif sequence. The motif sequence refers to, for example, a motif sequence that is important for binding to the target molecule. The method for identifying the motif sequence is not particularly limited, but for example, as described in embodiment 2, the device 1 can identify the motif sequence by including a candidate aptamer group acquisition means and an identification means. The format of the acquisition is not particularly limited, and may be, for example, acquired via an input device 105 or a communication device 107.

[0040] Next, the estimation means 12 estimates the structure of the candidate aptamer from the acquired candidate aptamer sequence (S2). That is, the estimation means 12 also estimates, for example, the structure of a motif contained in the candidate aptamer sequence. The candidate aptamer is a nucleic acid molecule consisting of the candidate aptamer sequence. The structure is not particularly limited, and may be, for example, a secondary structure or a tertiary structure. Specifically, the structure of the candidate aptamer can be estimated using known techniques such as RNAfold, Mfold, and IPknot. The estimation means 12 may, for example, estimate the Gibbs free energy (MFE) of the structure of the candidate aptamer in addition to estimating the structure of the candidate aptamer.

[0041] Next, the design means 13 deletes bases outside the motif sequence to design multiple shortened aptamer sequences of different lengths from one of the candidate aptamer sequences (S3). The deletion may be one base at a time, two bases at a time, three bases at a time, four or more bases at a time, and is preferably one base at a time. Hereinafter, deleting bases from the candidate aptamer sequence is also referred to as "minimization". FIG. 4 shows an example of minimizing the candidate aptamer sequence. As shown in FIG. 4, the design means 13 may delete the bases from at least one of the 3'-end and 5'-end of the candidate aptamer sequence (first minimization format), for example. Moreover, the design means 13, for example, determines whether it is possible or impossible to delete the base from at least one of the direction from the 5'-end side of the motif sequence toward the 5'-end side of the candidate aptamer sequence and the direction from the 3'-end side of the motif sequence toward the 3'-end side of the candidate aptamer sequence, and if it is possible, the base may be deleted (also called deletion: second miniaturization format). On the other hand, if it is impossible, the base is not deleted. Whether it is possible or impossible to delete the base can be determined, for example, by whether the candidate aptamer sequence after deleting the base can maintain the structure of the motif contained in the estimated candidate aptamer sequence. Specifically, for example, if the structure of the motif can be maintained, it is determined that the base can be deleted, and if the structure of the motif cannot be maintained, it is determined that the base cannot be deleted. In other words, it can be said that the base determined to be impossible to delete is an important part for maintaining the structure of the motif. Furthermore, the design means 13, for example, may combine the first miniaturization format and the second miniaturization format to miniaturize the candidate aptamer sequence.

[0042] Next, the estimation means 12 further estimates the structure of the miniaturized aptamer from the designed miniaturized aptamer sequence (S4). That is, the estimation means 12 also estimates the structure of the motif contained in the miniaturized aptamer sequence. The miniaturized aptamer is a nucleic acid molecule composed of the miniaturized aptamer. The estimation means 12 may, for example, estimate the Gibbs free energy (MFE) of the miniaturized aptamer structure in addition to estimating the structure of the miniaturized aptamer.

[0043] Next, the calculation means 14 calculates a score for each of the designed miniaturized aptamer sequences (S5). The score indicates the degree to which the structure of the motif in the miniaturized aptamer forms the structure of the motif in the candidate aptamer. Specifically, the score may be, for example, a probability, or a ratio to the probability of the presence of the motif sequence may be used as the score. The probability may be calculated using, for example, the Gibbs free energy (MFE) estimated by the estimation means 12 or a weighting factor (such as the Boltzmann factor) that determines the relative probability of a specific state occurring. Specifically, for example, when the probability of the structure that the motif in the miniaturized aptamer can have is the same as the probability of the structure that the motif in the candidate aptamer can have, the score (probability) is 1. In this case, the ratio is, for example, "1 (probability of the structure that the motif in the miniaturized aptamer can have) / 1 (probability of the structure that the motif in the miniaturized aptamer can have)" to be "1". The score may be calculated for one motif structure, or may be calculated in combination for multiple motif structures.

[0044] The calculation means 14 may calculate a high score, for example, when the estimated candidate aptamer sequence includes a specific structure. The specific structure is not particularly limited, and may be, for example, a stem-loop structure, a G-quadruplex structure, a pseudoknot structure, or the like. The calculation means 14 may also calculate a high score, for example, in proportion to the shortness of the single-stranded structure in the estimated candidate aptamer sequence. Specifically, for example, if the score for a full-length single-stranded structure is 0.3 (30%), the score calculated when the single-stranded structure is shortened is higher than 0.3 (30%) (for example, 1 (100%)).

[0045] Then, the extraction means 15 extracts from the plurality of shortened aptamer sequences those whose scores are equal to or greater than a predetermined value (S6), and ends the process (END). When a plurality of shortened aptamer sequences are extracted, the extraction means 15 may, for example, further extract the shortened aptamer sequence having the shortest length.

[0046] Furthermore, the present device 1 may further include, for example, an output means for outputting information. In this case, the output means may, for example, output the extracted miniaturized aptamer sequence after the step (S6). The output means may, for example, display and output the miniaturized aptamer sequence on a display device 106. The output means may, for example, output to an external device (for example, a printer, a PC, etc.) via a communication device 107.

[0047] Here, the present device 1 will be specifically described with reference to Figs. 5 to 8. Figs. 5 to 8 are merely examples and are not limited thereto. Fig. 5 shows a candidate aptamer sequence A capable of binding to a target molecule A acquired by the candidate aptamer sequence acquisition means 11 and a secondary structure (estimated secondary structure) of the candidate aptamer sequence A estimated by the estimation means 12. In the candidate aptamer sequence A shown in Fig. 5, the motif sequence is enclosed in parentheses. Then, the design means 13 designs a plurality of miniaturized aptamer sequences having different lengths of nucleic acid sequence by miniaturization from the candidate aptamer sequence A. An example of the secondary structure (estimated secondary structure) of the miniaturized aptamer estimated by the estimation means 12 from the plurality of miniaturized aptamer sequences is shown in Fig. 6. In Fig. 6, s1-3, s1-4, s1-6, and s1-7 are miniaturized aptamers designed by miniaturizing the candidate aptamer sequence A by the first miniaturization format. On the other hand, s1-4-1 is a miniaturized aptamer designed by further miniaturizing the candidate aptamer sequence A by the second miniaturization format with respect to s1-4. Then, the calculation means 14 calculates the score for each of the miniaturized aptamer sequences designed. Here, FIG. 7 shows an example of the correspondence between the miniaturization and the score calculated by the calculation means 14. In FIG. 7, the vertical axis shows, from top to bottom, a sequence in which one base is deleted from the 5' end of the candidate aptamer sequence A to the 5' end of the motif sequence, with one scale. In addition, the horizontal axis shows, from left to right, a sequence in which one base is deleted from the 3' end of the candidate aptamer sequence A to the 3' end of the motif sequence, with one scale. In the heat map of FIG. 7, as shown on the right side of the heat map, the darker the color, the closer the score is to "1", and the lighter the color, the closer the score is to "0".

[0048] FIG. 8 shows an example of a shortened aptamer sequence extracted by the extraction means 15. "Original" in FIG. 8 means the candidate aptamer sequence A shown in FIG. 5. As shown in FIG. 8, the length of each shortened aptamer sequence is shorter than the length of the candidate aptamer sequence A. In addition, in the base sequences of the candidate aptamer sequence A and each of the extracted shortened aptamer sequences shown in FIG. 8, the motif is enclosed in parentheses. As shown in FIG. 8, the scores (Probability) of each of the shortened aptamer sequences in FIG. 6 were all equal to or greater than a predetermined value (e.g., 0.5, etc.). That is, the extraction means 15 may extract all of the shortened aptamer sequences, or may extract only the shortened aptamer sequence s1-4-1 having the shortest length among the shortened aptamer sequences. Here, the Gibbs free energy (MFE) is, for example, the MFE when the most stable structure is formed, and the lower the energy, the more stable the structure. The MFE is calculated by software such as RNAfold, Mfold, and IPknot. As shown in FIG. 8, the shortened aptamer sequences (s1-4-1, s1-3, s1-4, s1-6, and s1-7) have low MFEs and are stable structures.

[0049] According to this embodiment, the aptamer sequence can be easily miniaturized. In addition, according to this embodiment, the aptamer sequence is miniaturized by deleting bases outside the motif sequence, so that, for example, the binding ability with the target molecule does not decrease due to structural diversity. Furthermore, according to this embodiment, the aptamer sequence can be miniaturized, so that, for example, the occurrence of errors during artificial synthesis of nucleic acid can be suppressed, and the cost of synthesis is also reduced. In the conventional method, for example, a person intuitively miniaturized the aptamer from the secondary structure of the estimated candidate aptamer. However, the conventional method was accompanied by uncertainty such as not binding to the target molecule, and the work efficiency was poor. On the other hand, according to this embodiment, miniaturization is performed outside the motif sequence, so that it is highly reliable and has good work efficiency.

[0050] FIG. 9 shows the results of evaluating the binding affinity of the candidate aptamer sequence A shown in FIG. 8 and each of the shortened aptamer sequences to the target molecule A. The binding affinity was evaluated by calculating the dissociation constant (KD (mol / L)) by SPR analysis. The smaller the dissociation constant, the higher the binding affinity. In the graph of FIG. 9, the dissociation constant is shown as a logarithm. As shown in FIG. 9, each of the shortened aptamer sequences was found to have better binding affinity than the candidate aptamer sequence A.

[0051] [Embodiment 2] In this embodiment, the design device 1 further identifies candidate aptamer sequences and the motif sequence.

[0052] Fig. 10 is a block diagram showing an example of the configuration of the design device 1 of this embodiment. As shown in Fig. 10, in this embodiment, the design device 1 is similar to the design device 1 of the first embodiment, except that it further includes a candidate aptamer group acquisition means 16 and an identification means 17. The hardware configuration in the design device 1 of this embodiment is similar to the design device 1 of the first embodiment shown in Fig. 2, except that the central processing unit 101 further includes a candidate aptamer group acquisition means 16 and an identification means 17. Unless otherwise specified, the description of the first embodiment can be used for this embodiment.

[0053] The design method in this embodiment will be described with reference to Fig. 11. First, sequence information of the candidate aptamer group contained in the nucleic acid pool is acquired by the candidate aptamer group acquisition means 16 (S1). Specifically, for example, the nucleic acid pool is acquired by the SELEX method, and a sequencer (next-generation sequencer or the like) is applied to the acquired nucleic acid pool, thereby making it possible to acquire sequence information of the candidate aptamer group.

[0054] Next, the motif sequence and the candidate aptamer sequence containing the motif are identified from the group of candidate aptamers by the identification means 17 (S2). Specifically, for example, by using the technology described in Japanese Patent No. 5441189, the motif can be identified and the candidate aptamer sequence containing the motif can be identified.

[0055] Next, the candidate aptamer sequence including the identified motif sequence is acquired (S3) by the candidate aptamer sequence acquisition means 11. Then, the process from step (S4) to step (S8) shown in Fig. 11 is performed in the same manner as the process from step (S2) to step (S6) shown in Fig. 3, and then the process ends (END).

[0056] According to this embodiment, an aptamer sequence can be easily designed, as in the first embodiment. In the conventional technology, a candidate aptamer sequence may not be selected because a large number of nucleic acid clones (candidate aptamer group) are included, such as in the nucleic acid pool of the initial round in the SELEX method. However, according to this embodiment, for example, a motif can be identified from the sequences of the large number of nucleic acid clones (candidate aptamer group) included in the nucleic acid pool, and a candidate aptamer sequence can be identified.

[0057] [Embodiment 3] The aptamer production method of this embodiment includes a design step and a synthesis step. The design step is the design method described in embodiments 1 and 2. The synthesis step synthesizes an aptamer sequence based on the miniaturized aptamer sequence extracted in the design step. The synthesis step can synthesize the aptamer sequence by using a technique of chemical synthesis from terminal bases using dNTPs or the like as materials using a DNA synthesizer or an RNA synthesizer, for example.

[0058] [Embodiment 4] The program of the present embodiment is a program for causing a computer to execute each step of the method of each of the above-mentioned embodiments as a procedure. In the present invention, the "procedure" may be read as "processing." The program of the present embodiment may be recorded, for example, in a computer-readable recording medium. The recording medium is not particularly limited, and examples thereof include a hard disk (HD), a CD-ROM, a CD-R, a CD-RW, an MO, a DVD, a flash memory, and a memory card. EXAMPLES

[0059] Next, examples of the present invention will be described. However, the present invention is not limited to the following examples. Commercially available reagents were used according to their protocols unless otherwise indicated.

[0060] [Example 1] As candidate aptamers, known aptamers with binding affinity to VEGF were used, and the structure of the candidate aptamers was predicted, a miniaturized aptamer sequence was designed, the structure of the miniaturized aptamers was predicted, a score was calculated, and miniaturized aptamer sequences having a score equal to or greater than a predetermined value were extracted.

[0061] (Candidate aptamer) An aptamer having binding properties to VEGF was used as the candidate aptamer 1 (SEQ ID NO: 1). The polynucleotide of SEQ ID NO: 1 is shown below.

[0062] Candidate aptamer 1 (SEQ ID NO:1) GGATTGCCCGATTCACCGTAAACAGTTCTGGTTCCT AGTTTAAAGTCACGTCTTAG TTTAAGGCATTCTGGAGCGGCATAAC

[0063] (Prediction of the structure of candidate aptamers) In SEQ ID NO: 1, the putative binding region (SEQ ID NO: 2) is underlined. The putative binding region was estimated by FSBC (fast string-based clustering) according to the method described in the literature (Kato S, Ono T, Minagawa H, Horii K, Shiratori I, Waga I, et al. FSBC: fast string-based clustering for HT-SELEX data. BMC Bioinformatics. 2020 Jun 24; 21 (1): 263.). The putative binding region can also be referred to as a motif sequence.

[0064] Putative binding region (SEQ ID NO:2) AGTTTAAAGTCACGTCTTAG

[0065] For the candidate aptamer 1, the secondary structure, free energy, existence probability, and secondary structure (motif structure) of the predicted binding region were each calculated.

[0066] The secondary structure was predicted by RNAsubopt according to the method described in Reference 1 below. The free energy was calculated from the thermal energy parameters of nucleic acids in RNAsubopt. References for the parameter file include, for example, References 2 and 3 below. Reference 1: Lorenz R, Bernhart SH, Hoener Zu Siederdissen C, Tafer H, Flamm C, Stadler PF, et al. ViennaRNA Package 2.0. Algorithms Mol Biol. 2011 Nov 24;6:26. Reference 2: DH Mathews, MD Disney, D. Matthew, JL Childs, SJ Schroeder, J. Susan, M. Zuker, DH Turner (2004), "Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure", Proc. Natl. Acad. Sci. USA: 101, pp 7287-7292 Reference 3: DH Turner, DH Mathews (2009), "NNDB: The nearest neighbor parameter database for predicting stability of nucleic acid secondary structure", Nucleic Acids Research: 38, pp 280-282

[0067] The existence probability was calculated using the free energy in the secondary structure and the Boltzmann distribution formula. The Boltzmann distribution formula is shown in the following formula (1). The existence probability of state i can be calculated using formula (1).

number

[0068] The results are shown in Tables 1A and 1B. Tables 1A and 1B are tables showing the secondary structure, free energy, existence probability, and secondary structure (motif structure) of the predicted binding region of the candidate aptamer 1. In the secondary structures shown in Tables 1A and 1B, "." (dot) indicates that the corresponding bases in the candidate aptamer 1 do not form a base pair, and "(" and ")" (brackets) indicate that they form a base pair (hereinafter the same). Note that "does not form a base pair" can be rephrased as "forms a loop", and "forms a base pair" can be rephrased as "forms a stem". As shown in Tables 1A and 1B, 12 types of secondary structures were predicted for the candidate aptamer 1. In addition, five types of motif structures were predicted.

[0069] [Table 1A] [Table 1B]

[0070] From the results of Tables 1A and 1B, the probability of occurrence of each of the five types of motif structures was further calculated.

[0071] The results are shown in Table 2. Table 2 is a table showing the probability of existence of each of the five types of motif structures (motif structures 1 to 5). As shown in Table 2, for candidate aptamer 1, the probability of existence of each of the five types of motif structures (motif structures 1 to 5) was calculated.

[0072] [Table 2]

[0073] (Design of miniaturized aptamer sequences) Next, a shortened sequence was designed for each secondary structure that the putative binding region could have. In the following description, a shortened sequence in which m bases were deleted from the 5' end and n bases were deleted from the 3' end of candidate aptamer 1 is referred to as S VIn this specification and drawings, by describing "S(m,n)" and a combination of the values ​​of m and n, the corresponding sequence is uniquely determined and disclosed.

[0074] (Estimation of the structure of miniaturized aptamers) The miniaturized array (S V For each of the structures (m, n), the probability of the presence of the motif structures 1 to 5 was calculated in the same manner as described above.

[0075] (Score calculation) The calculated miniaturized sequence (S V The ratio (relative value of the existence probability) was calculated by dividing the existence probability of motif structures 1 to 5 in candidate aptamer 1 by the existence probability of motif structures 1 to 5 in candidate aptamer 1. The ratio was defined as score 1, which is the score for each of motif structures 1 to 5.

[0076] In addition, the miniaturized array (S V For each of the candidate aptamer 1 (m, n), the sum of the existence probabilities of the motif structures 1 to 5 was calculated. The sum was divided by the sum of the existence probabilities of the motif structures 1 to 5 in the candidate aptamer 1 to determine the ratio (relative value of the existence probability). The ratio was designated as score 2, which is the score for the combination of the motif structures 1 to 5.

[0077] These results are shown in Figures 12A to 12F and Figure 13. Figures 12A to 12E show the score 1 value for each of motif structures 1 to 5, Figure 12F shows the relationship between the length of the shortened sequence and the score 1 value, and Figure 13 shows the score 2 for the combination of motif structures 1 to 5. Figures 12A to 12E and Figure 13 show the relationship between the length of the shortened sequence and the score 1 value. V (m,n)), the vertical direction indicates the value of m (0 to 37), the horizontal direction indicates the value of n (0 to 26), and the shading of each square indicates the value of the miniaturized array (S V13 indicates the score of each of the cells (m,n). The shading of each cell is set so that the scores are darker in the following order: 0 or more and less than 0.5, 0.5 or more and less than 1, 1 or more and less than 2, 2 or more and less than 4, and 4 or more. In FIG. 13, "T" and "F" respectively indicate the results of the binding evaluation in Example 2 described below (T: binding, F: no binding).

[0078] As shown in Figures 12A to 12E, in any of the motif structures 1 to 5, the shortened aptamer having a score 1 value of 1 or more, that is, the shortened sequence (S V There were shortened aptamers in which the probability of existence of motif structures 1 to 5 in (m, n)) was equal to or higher than the probability of existence of motif structures 1 to 5 in candidate aptamer 1. In addition, as shown in Figures 12C to 12E, there were shortened aptamers in which the value of score 1 was 4 or more.

[0079] Furthermore, as shown in Figure 12F, motif structure 1 was commonly distributed in the range of miniaturized sequence lengths of approximately 50 to 80 and score 1 values ​​of 0.1 to 1.5, motif structure 2 was commonly distributed in the range of miniaturized sequence lengths of approximately 40 to 80 and score 1 values ​​of 0.05 to 1.5, motif structure 3 was commonly distributed in the range of miniaturized sequence lengths of approximately 20 to 80 and score 1 values ​​of 1.0 to 5.0 or more, motif structure 4 was commonly distributed in the range of miniaturized sequence lengths of approximately 25 to 80 and score 1 values ​​of 0.3 to 5.0 or more, and motif structure 5 was commonly distributed in the range of miniaturized sequence lengths of approximately 30 to 80 and score 1 values ​​of 1.0 to 7.0.

[0080] As shown in FIG. 13, in the combination of the motif structures 1 to 5, the shortened aptamer having a score 2 value of 1 or more, that is, the shortened sequence (S V There were miniaturized aptamers in which the total probability of the presence of motif structures 1 to 5 in (m, n)) was equal to or greater than the total probability of the presence of motif structures 1 to 5 in candidate aptamer 1. There were also miniaturized aptamers in which score 2 was 4 or greater.

[0081] (Extraction of miniaturized aptamer sequences) Furthermore, the miniaturized array (S V From the sequences (m, n), shortened aptamer sequences having the score equal to or greater than a predetermined value were extracted.

[0082] 12A to 12E, the shortest sequence was selected from among the shortened sequences that had a score of 1 (relative value of the probability of existence) of 1 or more for each of motif structures 1 to 5. The results are shown in Table 3.

[0083] [Table 3]

[0084] Furthermore, the shortest sequence was selected from the shortened sequences shown in Table 3. As a result, the shortened sequence (S V (37,23); sequence number 3) was extracted.

[0085] Furthermore, based on the results shown in FIG. 13, the shortest sequence was selected from among the truncated sequences for which the score 2 value was 1 or more in the combination of motif structures 1 to 5.

[0086] As a result, the miniaturized array (S V (37,23); sequence number 3) was extracted.

[0087] In this embodiment, the method for determining a compact sequence for each possible motif structure of the putative binding domain can be represented by the following formulas (2) to (4).

number

[0088] Moreover, a method for predicting a shortened sequence for each motif structure and determining the shortest shortened sequence among them can be expressed by the following formulas (5) to (7).

number

[0089] As described above, by using an aptamer having binding activity against VEGF as a candidate aptamer, it was possible to estimate the structure of the candidate aptamer, design a miniaturized aptamer sequence, estimate the structure of the miniaturized aptamer, calculate a score, and extract a miniaturized aptamer sequence whose score is equal to or greater than a predetermined value.

[0090] [Example 2] The miniaturized aptamer extracted in Example 1 was confirmed to have binding ability to VEGF.

[0091] (Miniaturized Array) The sequences shown in Table 4 were synthesized by a conventional method and used as the miniaturized sequences. In Table 4, miniaturized sequence 1 is the miniaturized sequence (S V(37,23); SEQ ID NO: 3). Minimized sequences 2 to 11 are minimized sequences having a score 2 of 1 or more in the results shown in FIG. 13 of Example 1. Minimized sequence 12 is a minimized sequence having a score 2 of less than 0.5 (0.000) in the results shown in FIG. 13 of Example 1. Minimized sequences 13 to 17 are sequences in which a portion of the bases constituting the putative binding region has been deleted (sequences that satisfy at least one of m>37 and n>16).

[0092] [Table 4]

[0093] (Combination Evaluation) The binding properties of the miniaturized sequences 1 to 17 were analyzed by SPR.

[0094] A 20-base long polydeoxyadenine (poly dA) was added to the 3' end of the shortened sequence, and the sequence was used as the poly dA added sequence in SPR described below.

[0095] A VEGF sample was prepared using VEGF165 as follows. VEGF165 (PeproTech, Cat: 100-20) was dissolved in sterilized distilled water to a concentration of 1 mg / mL, and the solution was used as a VEGF sample. In the analysis of binding properties described below, SB1T buffer was used to dilute the VEGF sample. The composition of the SB1T buffer was 40 mmol / L HEPES, 125 mmol / L NaCl, 5 mmol / L KCl, 1 mmol / L MgCl2, and 0.05% Tween (registered trademark) 20, and the pH was 7.5.

[0096] For binding analysis, ProteOn XPR36 (BioRad) was used according to the manufacturer's instructions.

[0097] First, a streptavidin-immobilized chip (trade name ProteOn NLC Sensor Chip, BioRad) was set in the ProteOn XPR36 as a sensor chip dedicated to the ProteOn. 5 μmol / L of biotinylated polydT was injected into the flow cell of the sensor chip using ultrapure water (DDW) and allowed to bind until the signal intensity (RU: Resonance Unit) was saturated. The biotinylated polydT was prepared by biotinylating the 5' end of a 20-base-long deoxythymidine. Then, 200 nmol / L of the polydA addition sequence was injected into the flow cell of the chip using SB1T buffer at a flow rate of 25 μL / min for 80 seconds and allowed to bind until the signal intensity was saturated. Next, 5 nmol / L of each sample was injected using SB1T buffer at a flow rate of 50 μL / min for 300 seconds, and then SB1T buffer was run under the same conditions to perform washing. The start of sample injection was set as 0 seconds, and the signal intensity after the sample injection was measured. The SPR was performed under conditions of 25°C.

[0098] The results are shown in FIG. 14 and Table 4. FIG. 14 is a graph showing the binding of the miniaturized sequences to VEGF165 at 2.4 nmol / L, 3.4 nmol / L, 4.9 nmol / L, 7 nmol / L, and 10 nmol / L, where (A) shows miniaturized sequence 11, (B) shows miniaturized sequence 1, (C) shows miniaturized sequence 12, (D) shows miniaturized sequence 17, (E) shows miniaturized sequence 16, and (F) shows the result of flowing the SB1T buffer instead of the miniaturized sequence. The horizontal axis shows the elapsed time (seconds) after the start of injection of the sample, and the vertical axis shows the signal intensity (RU). As shown in FIG. 14, miniaturized sequences 1 and 11 showed binding to VEGF165. On the other hand, miniaturized sequences 12, 17, and 16 all had signal intensity of almost 0, and did not show binding.

[0099] Furthermore, as shown in Table 4, miniaturized sequences 1 to 11 exhibited binding to VEGF165. On the other hand, miniaturized sequences 12 to 17 did not exhibit any binding.

[0100] These results demonstrated that miniaturized sequences 1 to 11 bind to VEGF165 with excellent specificity, and that the binding can be detected by measuring the signal intensity.

[0101] Similarly, the binding ability of the candidate aptamer 1 was analyzed by SPR. As a result, it was found that the candidate aptamer 1 binds to VEGF165 with excellent specificity, and that the binding can be detected by measuring the signal intensity.

[0102] As described above, it was confirmed that the miniaturized aptamer extracted in Example 1 has binding ability to VEGF.

[0103] [Example 3] As a candidate aptamer, an aptamer having binding ability to CRP (C-reactive protein) was used, and the structure of the candidate aptamer was predicted, a miniaturized aptamer sequence was designed, the structure of the miniaturized aptamer was predicted, a score was calculated, and miniaturized aptamer sequences having a score equal to or greater than a predetermined value were extracted.

[0104] (Candidate aptamer) An aptamer having binding properties to CRP was used as candidate aptamer 2 (SEQ ID NO: 22). The polynucleotide of SEQ ID NO: 22 is shown below.

[0105] Candidate aptamer 2 (SEQ ID NO: 22) GGTTACGCCGCACATCAGTTTAGTGATAAAAGCC CGGTTACAGATGATCA GGGGCATTCGACAGGCTGGACATATC

[0106] (Prediction of the structure of candidate aptamers) The putative binding region (SEQ ID NO: 23) is underlined in SEQ ID NO: 22. The putative binding region was predicted in the same manner as in Example 1.

[0107] Putative binding region (SEQ ID NO: 23) CGGTTACAGATGATCA

[0108] For the candidate aptamer 2, the secondary structure, free energy, existence probability, and secondary structure (motif structure) of the predicted binding region were each calculated in the same manner as in Example 1.

[0109] The results are shown in Tables 5A to 5C. Tables 5A to 5C are tables showing the secondary structure, free energy, existence probability, and secondary structure (motif structure) of the predicted binding region of candidate aptamer 1. As shown in Tables 5A to 5C, 27 types of secondary structures were predicted for candidate aptamer 2. In addition, five types of motif structures were predicted.

[0110] [Table 5A] [Table 5B] [Table 5C]

[0111] From the results in Tables 5A to 5C, the probability of occurrence of each of the five types of motif structures was further calculated.

[0112] The results are shown in Table 6. Table 6 is a table showing the probability of existence for each of the five types of motif structures (motif structures 6 to 10). As shown in Table 6, the probability of existence for each of the five types of motif structures (motif structures 6 to 10) for candidate aptamer 2 was calculated.

[0113] [Table 6]

[0114] (Design of miniaturized aptamer sequences) Next, a shortened sequence was designed for each secondary structure that the putative binding region could have. In the following description, a shortened sequence in which m bases were deleted from the 5' end and n bases were deleted from the 3' end of candidate aptamer 2 is referred to as S C Denote this as (m,n).

[0115] (Estimation of the structure of miniaturized aptamers) The miniaturized array (S C For each of the (m, n)), the probability of the presence of motif structures 6 to 10 was calculated in the same manner as described above.

[0116] (Score calculation) The calculated miniaturized sequence (S C The ratio (relative value of the existence probability) was calculated by dividing the existence probability of the motif structures 6 to 10 in candidate aptamer 2 by the existence probability of the motif structures 6 to 10 in candidate aptamer 2. The ratio was defined as score 1, which is the score for each of the motif structures 6 to 10.

[0117] In addition, the miniaturized array (S C For each of the combinations (m, n), the total probability of the presence of motif structures 6 to 10 was calculated. The total was divided by the total probability of the presence of motif structures 6 to 10 in candidate aptamer 2 to determine the ratio (relative value of the presence probability). The ratio was defined as score 2, which is the score for the combination of motif structures 6 to 10.

[0118] These results are shown in Figures 15A to 15F and Figure 16. Figures 15A to 15E show the score 1 value for each of the motif structures 6 to 10, Figure 15F shows the relationship between the length of the shortened sequence and the score 1 value, and Figure 16 shows the score 2 for the combination of the motif structures 6 to 10. Figures 15A to 15E and Figure 16 show the relationship between the length of the shortened sequence (S C(m,n)), the vertical direction indicates the value of m (0 to 34), the horizontal direction indicates the value of n (0 to 26), and the shading of each square indicates the value of the miniaturized array (S C 16 indicates the score of each of the cells (m,n). The shading of each cell is set so that the scores are darker in the following order: 0 or more and less than 0.5, 0.5 or more and less than 1, 1 or more and less than 2, 2 or more and less than 4, and 4 or more. In FIG. 16, "T" and "F" respectively indicate the results of the binding evaluation in Example 4 described below (T: binding, F: no binding).

[0119] As shown in Figures 15A to 15E, in any of the motif structures 6 to 10, the shortened aptamer having a score 1 value of 1 or more, that is, the shortened sequence (S C There was a miniaturized aptamer in which the probability of existence of motif structures 6 to 10 in (m, n)) was equal to or higher than the probability of existence of motif structures 6 to 10 in candidate aptamer 2.

[0120] As shown in FIG. 15F, motif structure 6 was distributed mainly in the range of about 20 to 75 for the length of the miniaturized sequence and 0.8 to 2.0 for the score 1, and was also distributed in the range of about 20 to 55 for the length of the miniaturized sequence and 0.05 to less than 0.8 for the score 1. Motif structure 7 was distributed mainly in the range of about 25 to 80 for the length of the miniaturized sequence and 0.8 to 1.5 for the score 1, and was also distributed in the range of about 25 to 35 and 60 to 75 for the length of the miniaturized sequence and 0.3 to less than 0.8 for the score 1. Motif structure 8 was distributed mainly in the range of about 60 to 70 for the length of the miniaturized sequence and 0.3 to 0.4 for the score 1. Motif structure 9 was distributed mainly in the range of about 25 to 80 for the length of the miniaturized sequence and 0.8 to 1.5 for the score 1, and was also distributed in the range of about 25 to 35 and 60 to 75 for the length of the miniaturized sequence and 0.3 to less than 0.8 for the score 1. The motif structure 10 was frequently distributed in the range of the length of the compacted sequence of about 45 to 75 and the score 1 value of 0.4 to 1.0.

[0121] As shown in FIG. 16, in the combination of the motif structures 6 to 10, the shortened aptamer having a score 2 value of 1 or more, that is, the shortened sequence (S C There was a miniaturized aptamer in which the total probability of the presence of motif structures 6 to 10 in (m, n)) was equal to or greater than the total probability of the presence of motif structures 6 to 10 in candidate aptamer 2.

[0122] (Extraction of miniaturized aptamer sequences) Furthermore, the miniaturized array (S C From the sequences (m, n), shortened aptamer sequences having the score equal to or greater than a predetermined value were extracted.

[0123] 15A to 15E, the shortest sequence was selected from among the shortened sequences that had a score of 1 (relative value of the probability of existence) of 1 or more for each of motif structures 6 to 10. The results are shown in Table 7.

[0124] [Table 7]

[0125] Furthermore, the shortest sequence was selected from the shortened sequences shown in Table 7. As a result, the shortened sequence (S C (32,22); sequence number 24) was extracted.

[0126] Furthermore, based on the results shown in FIG. 16, the shortest sequence was selected from among the truncated sequences for which the score 2 value was 1 or more in the combination of motif structures 6 to 10.

[0127] As a result, the miniaturized array (S C (32,22); sequence number 24) was extracted.

[0128] As described above, by using an aptamer having binding activity against CRP as a candidate aptamer, it was possible to estimate the structure of the candidate aptamer, design a miniaturized aptamer sequence, estimate the structure of the miniaturized aptamer, calculate a score, and extract a miniaturized aptamer sequence whose score is equal to or greater than a predetermined value.

[0129] [Example 4] The miniaturized aptamer extracted in Example 3 was evaluated for its binding to CRP.

[0130] (Miniaturized Array) As the miniaturized sequences, polynucleotides (miniaturized sequences 13 to 18) shown in Table 8 below were synthesized. In the synthesis of miniaturized sequences 13 to 18, the nucleotide residue containing thymine shown underlined in Table 8 below was changed to the nucleotide residue (KS9) shown in formula (1) below. The KS9 is a thymidine nucleotide residue modified with an adenine residue. For details about the KS9, see, for example, International Publication No. WO 2017 / 081926. In Table 8, miniaturized sequence 13 is the miniaturized sequence (S C (32,22); SEQ ID NO: 24), in order to synthesize by an enzymatic method, the sequence (S C (22,22); SEQ ID NO: 27). The miniaturized sequence 14 is a sequence (S C (22,21; SEQ ID NO:28), and the miniaturized sequence 15 is a sequence (S C (8, 21); SEQ ID NO: 29). Minimized sequences 16 to 18 are sequences that are shorter than minimized sequence 13 by 1 to 3 bases, respectively. [ka]

[0131] [Table 8]

[0132] (Combination Evaluation) The binding properties of the miniaturized sequences 13 to 18 were analyzed by SPR.

[0133] Experiments and analyses were carried out in the same manner as in Example 2, except that a CRP sample was prepared using CRP (Human, manufactured by Acris Antibodies GmBH, product code: P100-0) and used in place of the VEGF sample.

[0134] The results are shown in FIG. 17 and Table 9. FIG. 17 is a graph showing the binding of the miniaturized sequences to 1.25 nmol / L, 2.5 nmol / L, 5 nmol / L, 10 nmol / L, and 20 nmol / L CRP, where (A) shows the results for miniaturized sequence 15, (B) for miniaturized sequence 14, (C) for miniaturized sequence 13, and (D) for miniaturized sequence 18. The horizontal axis indicates the elapsed time (seconds) after the start of injection of the sample, and the vertical axis indicates the signal intensity (RU). As shown in FIG. 17, miniaturized sequences 14 and 15 showed binding to CRP. On the other hand, miniaturized sequences 13 and 18 both had signal intensities of almost 0 and showed no binding.

[0135] Furthermore, as shown in Table 8, miniaturized sequences 14 and 15 exhibited binding ability to CRP, whereas miniaturized sequences 13 and 16 to 18 did not exhibit binding ability.

[0136] These results demonstrated that the miniaturized sequences 14 and 15 bind to CRP with excellent specificity, and that the binding can be detected by measuring the signal intensity.

[0137] As shown in Table 8, the miniaturized sequences 14 and 15, which showed binding to CRP, had a score 2 value of 1.873 in the combination of the motif structures 6 to 10 shown in Figure 16. On the other hand, the miniaturized sequences 13 and 16 to 18, which did not show binding to CRP, had score 2 values ​​of less than 1.873 and 1.080 or less in the combination of the motif structures 6 to 10 shown in Figure 16.

[0138] This suggests that in the extraction of the miniaturized aptamer sequences in Example 3, if miniaturized sequences having score 2 values ​​of, for example, 1.873 or more, 1.8 or more, 1.7 or more, 1.6 or more, 1.5 or more, 1.4 or more, 1.3 or more, 1.2 or more, 1.1 or more, and greater than 1.08 are extracted, it will be possible to design miniaturized sequences that exhibit binding to CRP.

[0139] Similarly, binding analysis by SPR was performed on the candidate aptamer 2. As a result, it was found that the candidate aptamer 2 binds to CRP with excellent specificity, and that the binding can be detected by measuring the signal intensity.

[0140] As described above, the binding of CRP was evaluated for the miniaturized aptamers extracted in Example 3. This suggests that if a miniaturized sequence having a score 2 value of 1.8 or more is extracted in the extraction of the miniaturized aptamer sequence in Example 3, it is possible to design a miniaturized sequence that exhibits binding ability to CRP.

[0141] Although the present invention has been described above with reference to the embodiments and examples, the present invention is not limited to the above-mentioned embodiments and examples. Various modifications that can be understood by those skilled in the art can be made to the configuration and details of the present invention within the scope of the present invention.

[0142] This application claims priority based on Japanese Patent Application No. 2020-004103, filed on January 15, 2020, the disclosure of which is incorporated herein in its entirety.

[0143] <Additional Notes> Some or all of the above embodiments may be described as follows, but are not limited to the following supplementary notes. (Appendix 1) An apparatus for designing a base sequence of an aptamer using a computer, comprising: The apparatus includes a candidate aptamer sequence acquisition means, a prediction means, a design means, a calculation means, and an extraction means, The candidate aptamer sequence acquisition means acquires a candidate aptamer sequence, The candidate aptamer sequence comprises a specified motif sequence, The estimation means estimates a structure of a candidate aptamer from the acquired candidate aptamer sequence, the design means designs a plurality of shortened aptamer sequences having different lengths from one of the candidate aptamer sequences by deleting bases outside the motif sequence; The prediction means further predicts a structure of a shortened aptamer from the designed shortened aptamer sequence, The calculation means calculates a score for each of the designed miniaturized aptamer sequences, the score indicates the degree to which the structure of the motif in the miniaturized aptamer forms the structure of the motif in the candidate aptamer; The extracting means extracts, from the plurality of shortened aptamer sequences, a shortened aptamer sequence having a score equal to or greater than a predetermined value. Design equipment. (Appendix 2) The design device according to claim 1, wherein the extraction means further extracts the shortened aptamer sequence having the shortest length. (Appendix 3) 3. The design device according to claim 1 or 2, wherein the design means deletes the base from at least one of the 3'-end and 5'-end of the candidate aptamer sequence. (Appendix 4) the design means determines whether it is possible or impossible to delete the base from at least one of a direction from the 5'-end of the motif sequence to the 5'-end of the candidate aptamer sequence and a direction from the 3'-end of the motif sequence to the 3'-end of the candidate aptamer sequence; deleting said bases, if possible; A design device according to any one of appendix 1 to 3, wherein, if this is not possible, the base is not deleted. (Appendix 5) 5. The design device according to any one of claims 1 to 4, wherein the calculation means calculates a high score when the predicted structure of the candidate aptamer includes a specific structure. (Appendix 6) A design device described in any one of Appendices 1 to 5, wherein the calculation means calculates a high score in proportion to the shortness of the single-stranded structure in the estimated candidate aptamer structure. (Appendix 7) Further, the device includes an output unit for outputting information, 7. The design device according to any one of claims 1 to 6, wherein the output means outputs the extracted miniaturized aptamer sequence. (Appendix 8) Further, the method includes a candidate aptamer group acquisition means and a candidate aptamer identification means, the candidate aptamer group acquiring means acquires sequence information of the candidate aptamer group contained in the nucleic acid pool; The identification means identifies the motif sequence and the candidate aptamer sequence containing the motif sequence from the group of candidate aptamers; the candidate aptamer sequence acquisition means acquires the candidate aptamer sequence including the identified motif sequence; 8. A design device according to any one of appendixes 1 to 7. (Appendix 9) The method includes a step of obtaining a candidate aptamer sequence, a step of estimating, a step of designing, a step of calculating, and a step of extracting, The candidate aptamer sequence obtaining step includes obtaining a candidate aptamer sequence, The candidate aptamer sequence comprises a specified motif sequence, The prediction step includes predicting a structure of a candidate aptamer from the obtained candidate aptamer sequence, The designing step includes designing a plurality of shortened aptamer sequences having different lengths from one of the candidate aptamer sequences by deleting bases outside the motif sequence; The prediction step further includes predicting a structure of a miniaturized aptamer from the designed miniaturized aptamer sequence, The calculation step includes calculating a score for each of the designed miniaturized aptamer sequences, the score indicates the degree to which the structure of the motif in the miniaturized aptamer forms the structure of the motif in the candidate aptamer; The extracting step comprises extracting, from the plurality of shortened aptamer sequences, shortened aptamer sequences having a score equal to or greater than a predetermined value. Design method. (Appendix 10) The design method according to claim 9, wherein the extraction step further comprises extracting the shortened aptamer sequence having the shortest length. (Appendix 11) 11. The design method according to claim 9 or 10, wherein the design step deletes the base from at least one of the 3'-end and 5'-end of the candidate aptamer sequence. (Appendix 12) The design step includes determining whether it is possible to delete the base from at least one of a direction from the 5'-end of the motif sequence to the 5'-end of the candidate aptamer sequence and a direction from the 3'-end of the motif sequence to the 3'-end of the candidate aptamer sequence; deleting said bases, if possible; 12. The design method according to any one of appendix 9 to 11, wherein, if said inability occurs, said base is not deleted. (Appendix 13) A design method according to any one of Appendices 9 to 12, wherein the calculation step calculates a high score when the predicted candidate aptamer structure contains a specific structure. (Appendix 14) A design method according to any one of Appendices 9 to 13, wherein the calculation step calculates a higher score in proportion to the shortness of the single-stranded structure in the predicted candidate aptamer structure. (Appendix 15) Further, an output step of outputting information is included, A design method according to any one of Appendices 9 to 14, wherein the output step outputs the extracted miniaturized aptamer sequence. (Appendix 16) Further, the method includes a step of obtaining and identifying a group of candidate aptamers, The candidate aptamer obtaining step includes obtaining sequence information of the candidate aptamer group contained in the nucleic acid pool, The identifying step includes identifying the motif sequence and the candidate aptamer sequence containing the motif sequence from the group of candidate aptamers; The candidate aptamer sequence obtaining step obtains the candidate aptamer sequence including the identified motif sequence. 16. The design method according to any one of appendix 9 to 15. (Appendix 17) The method includes a design process and a synthesis process, The design process is a design method according to any one of Supplementary Notes 9 to 16, A method for producing an aptamer, wherein the synthesis step synthesizes an aptamer sequence based on the miniaturized aptamer sequence extracted in the design step. (Appendix 18) A program for causing a computer to execute each step of the design method described in any one of Appendix 9 to 16, or each step of the aptamer production method described in Appendix 17. (Appendix 19) 19. A computer-readable recording medium having the program according to claim 18 recorded thereon. [Industrial Applicability]

[0144] According to the present invention, for example, an aptamer sequence can be easily miniaturized. Therefore, the present invention is particularly useful in, for example, pharmaceuticals, biosensors, test kits, and the like that use aptamers. [Explanation of symbols]

[0145] 1 Design equipment 11. Method for obtaining candidate aptamer sequences 12 Estimation means 13 Design means 14 Calculation method 15 Extraction means 16 Means for acquiring candidate aptamer groups 17 Specific means 101 Central processing unit 102 Memory 103 Bus 104 Storage device 105 Input Device 106 Display device 107 Communication Devices

Claims

1. An apparatus for designing a base sequence of an aptamer using a computer, comprising: The apparatus includes a candidate aptamer sequence acquisition means, a prediction means, a design means, a calculation means, and an extraction means, The candidate aptamer sequence acquisition means acquires a candidate aptamer sequence, the candidate aptamer sequence comprises a specified motif sequence; The estimation means estimates a structure of a candidate aptamer from the acquired candidate aptamer sequence, the design means designs a plurality of shortened aptamer sequences having different lengths from one of the candidate aptamer sequences by deleting bases outside the motif sequence; The prediction means further predicts a structure of a shortened aptamer from the designed shortened aptamer sequence, The calculation means calculates a score for each of the designed miniaturized aptamer sequences, the score indicates the degree to which the structure of the motif in the miniaturized aptamer forms the structure of the motif in the candidate aptamer; The extraction means extracts, from the plurality of shortened aptamer sequences, a shortened aptamer sequence having a score equal to or greater than a predetermined value. Design equipment.

2. The design apparatus according to claim 1 , wherein the extraction means further extracts the shortened aptamer sequence having the shortest length.

3. The design device according to claim 1 or 2, wherein the design means deletes the base from at least one of the 3'-end and 5'-end of the candidate aptamer sequence.

4. the design means determines whether it is possible or impossible to delete the base from at least one of a direction from the 5'-end of the motif sequence to the 5'-end of the candidate aptamer sequence and a direction from the 3'-end of the motif sequence to the 3'-end of the candidate aptamer sequence; deleting said bases, if possible; The design device according to claim 1 , wherein, if the deletion is impossible, the base is not deleted.

5. The design device according to claim 1 , wherein the calculation means calculates a high score when the estimated structure of the candidate aptamer includes a specific structure.

6. The design device according to claim 1 , wherein the calculation means calculates a high score in proportion to the shortness of a single-stranded structure in the estimated candidate aptamer structure.

7. Further, the method includes a candidate aptamer group acquisition means and a candidate aptamer identification means, the candidate aptamer group acquiring means acquires sequence information of the candidate aptamer group contained in the nucleic acid pool; The identification means identifies the motif sequence and the candidate aptamer sequence containing the motif sequence from the group of candidate aptamers; the candidate aptamer sequence acquisition means acquires the candidate aptamer sequence including the identified motif sequence; The design device according to any one of claims 1 to 6.

8. The method includes a step of obtaining a candidate aptamer sequence, a step of estimating, a step of designing, a step of calculating, and a step of extracting, The candidate aptamer sequence obtaining step includes obtaining a candidate aptamer sequence, the candidate aptamer sequence comprises a specified motif sequence; The prediction step includes predicting a structure of a candidate aptamer from the obtained candidate aptamer sequence, The design step includes designing a plurality of shortened aptamer sequences having different lengths from one candidate aptamer sequence by deleting bases outside the motif sequence; The prediction step further includes predicting a structure of a miniaturized aptamer from the designed miniaturized aptamer sequence, The calculation step includes calculating a score for each of the designed miniaturized aptamer sequences, the score indicates the degree to which the structure of the motif in the miniaturized aptamer forms the structure of the motif in the candidate aptamer; The extracting step comprises extracting, from the plurality of shortened aptamer sequences, shortened aptamer sequences having a score equal to or greater than a predetermined value. Design method.

9. The method includes a design process and a synthesis process, The design process is a design method according to claim 8, A method for producing an aptamer, wherein the synthesis step synthesizes an aptamer sequence based on the miniaturized aptamer sequence extracted in the design step.

10. A program for causing a computer to execute each step of the design method according to claim 8 or each step of the aptamer production method according to claim 9.

Images