Genetically engineered microorganisms expressing acetoacetyl-CoA reductase variants and methods for increasing the proportion of 3-hydroxyhexanoic acid in PHA

Abstract

The present invention relates to the technical field of microorganisms, specifically to a genetically engineered microorganism expressing an acetoacetyl-CoA reductase variant and a method for increasing the proportion of 3-hydroxyhexanoic acid in PHA. The acetoacetyl-CoA reductase variant and its coding gene provided by the present invention can significantly increase the proportion of 3-hydroxyhexanoic acid in PHA produced from a strain, and the proportion of 3-hydroxyhexanoic acid in PHA produced from a genetically engineered Ralstonia eutropha constructed with the acetoacetyl-CoA reductase variant and its coding gene provided by the present invention is significantly increased, providing novel gene and strain resources for the development of a genetically engineered strain producing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) with a high proportion of 3-hydroxyhexanoic acid.

Description

[Technical field]

[0001] The present invention relates to the field of microorganisms, and in particular to genetically engineered microorganisms expressing acetoacetyl-CoA reductase variants and methods for increasing the proportion of 3-hydroxyhexanoic acid in PHA. [Background technology]

[0002] Polyhydroxyalkanoates (PHAs) are macromolecular polymers synthesized by microorganisms that are renewable and degradable and have multiple material properties, and are expected to be widely applied in the fields of medicine, materials, and environmental protection. PHAs are widely present in microbial cells, mainly as a carbon source and energy storage carrier. Depending on the type of monomer and the polymerization method, PHAs have a series of diverse material properties, such as hard and brittle rigid plastics or flexible elastomers. Polyhydroxybutyrate (PHB, or P(3HB)), a type of PHA, is a complex biopolymer produced by bacteria. As a thermoplastic, its mechanical and physical properties are comparable to those of conventional plastics such as polystyrene. On the other hand, P(3HB) is highly crystalline and therefore brittle and hard compared to conventional plastics, and therefore has no practical value as a replacement for product plastics. Therefore, in order to improve the thermal and physical properties, it is necessary to produce copolymers containing a combination of 3HB and monomers with longer chains. Poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) (P(3HB-co-3HHx)) is a copolymer with mixed chain lengths and is more flexible than P(3HB) homopolymer, in which the 3HHx (3-hydroxyhexanoic acid) monomer moiety greatly affects the properties of the polymer. P(3HB-co-3HHx) copolymers with a high 3HHx molar fraction (abbreviated as H fraction) can exhibit properties similar to those of common product plastics such as low-density polyethylene (LDPE). Therefore, it is of great significance to increase the proportion of 3HHx in 3HB-co-3HHx produced from microorganisms.

[0003] Ralstonia eutropha (also known as Cupriavidus necator) is an important model bacterium for studying the synthesis of PHA and is currently the most widely studied strain used to produce PHB. When there is an excess of carbon and a shortage of nitrogen, Ralstonia eutropha can accumulate PHB. On the other hand, when the metabolism of other carbon sources in the cell becomes active, the synthesis of PHB is affected. Summary of the Invention

[0004] An object of the present invention is to provide an acetoacetyl-CoA reductase variant and its coding gene capable of increasing the proportion of 3-hydroxyhexanoic acid in PHA produced from a microorganism, as well as a genetically engineered microorganism for producing PHA.

[0005] Specifically, the present invention provides the following technical solutions:

[0006] First, the present invention provides an acetoacetyl-CoA reductase variant having an amino acid sequence as shown in any one of SEQ ID NOs:9 to 15.

[0007] Secondly, the present invention provides a variant of the coding gene for acetoacetyl-CoA reductase, the nucleotide sequence of which is as set forth in any one of SEQ ID NOs: 1-7.

[0008] In the present invention, experiments have demonstrated that all of the above gene variants can significantly increase the proportion of 3-hydroxyhexanoic acid in the PHA produced by the strain.

[0009] Thirdly, the present invention provides a biomaterial, which is an expression cassette, a vector or a host cell, comprising the above-mentioned gene variant.

[0010] In some embodiments of the present invention, the expression cassette containing the gene variant as described above comprises a promoter, the gene variant as described above, and a terminator operably linked thereto. Depending on the expression requirements and differences in the sequences upstream and downstream of the expression cassette, the expression cassette may not contain a terminator, or may contain other transcriptional and translational regulatory elements such as enhancers.

[0011] In some embodiments of the present invention, the vector containing the gene mutation is a plasmid vector, including replicative and non-replicative vectors. The vector carrying the nucleic acid molecule is not limited to a plasmid vector, but may be a phage, virus, or other vector.

[0012] In some embodiments of the present invention, there are provided Escherichia coli cells and Ralstonia eutropha cells containing the above-mentioned gene variants, expression cassettes or vectors, however, the type of host cell is not limited thereto and may be any microbial cell or animal cell that can be used for protein expression.

[0013] Fourth, the present invention provides use of an acetoacetyl-CoA reductase variant or its encoding gene for increasing the proportion of 3-hydroxyhexanoic acid in PHA produced from a genetically engineered microorganism, wherein the amino acid sequence of the acetoacetyl-CoA reductase variant is as shown in any of SEQ ID NOs: 9 to 15.

[0014] Based on the amino acid sequences of the acetoacetyl-CoA reductase variants provided above and the codon rules, those skilled in the art can obtain the sequences of the genes encoding the above acetoacetyl-CoA reductase variants. The sequences of genes encoding the same amino acid sequence are not unique, and any gene capable of encoding the above acetoacetyl-CoA reductase variants is within the scope of protection of the present invention.

[0015] In some embodiments of the invention, the nucleotide sequence of the coding gene is as set forth in any of SEQ ID NOs: 1-7.

[0016] The above use, (1) introducing a plasmid containing a gene encoding the acetoacetyl-CoA reductase variant into the microorganism; and (2) inserting one or more copies of the gene encoding the acetoacetyl-CoA reductase variant into the genome of the microorganism; The above-mentioned features may be realized by one or more of the above.

[0017] In some embodiments of the invention, the phaB gene in situ in the genome of the microorganism is not inactivated.

[0018] In some embodiments of the invention, the phaB gene in situ in the genome of the microorganism is retained entirely.

[0019] In the above use, the genetically engineered microorganism further comprises: (1) modification to express a PHA polymerase variant capable of synthesizing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate); and (2) Modifications to improve the expression and / or enzyme activity of (R)-enoyl-CoA hydratase Includes one or more of the following.

[0020] In some embodiments of the present invention, the PHA polymerase variant capable of synthesizing the poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) comprises a mutation from asparagine 149 to serine and a mutation from aspartic acid 171 to glycine relative to the original PHA polymerase.

[0021] In some embodiments of the invention, the amino acid sequence of the PHA polymerase variant is as set forth in SEQ ID NO:16.

[0022] In some embodiments of the present invention, improved expression and / or enzymatic activity of (R)-enoyl-CoA hydratase is achieved by initiating transcription of the (R)-enoyl-CoA hydratase-encoding gene in the genome with the promoter shown in SEQ ID NO:17.

[0023] In the above uses, the microorganism is preferably Ralstonia eutropha, Escherichia coli or Halomonas.

[0024] In some embodiments of the present invention, increasing the proportion of 3-hydroxyhexanoic acid in the PHA produced from the genetically engineered microorganism means increasing the proportion of 3-hydroxyhexanoic acid in the PHA produced by the genetically engineered microorganism when lipids are used as a carbon source.

[0025] In some embodiments of the present invention, increasing the proportion of 3-hydroxyhexanoic acid in the PHA produced from the genetically engineered microorganism means increasing the proportion of 3-hydroxyhexanoic acid in the PHA produced by the genetically engineered microorganism when vegetable oil is used as a carbon source.

[0026] The above vegetable oils include one or a mixture of more than one selected from palm oil, peanut oil, soybean oil, linseed oil, rapeseed oil, castor oil, and corn oil. Fifth, the present invention provides a use of an acetoacetyl-CoA reductase variant, its coding gene, or a biomaterial containing said coding gene for constructing a microorganism that produces polyhydroxyalkanoate or a derivative thereof.

[0027] Based on the function of the acetoacetyl-CoA reductase variants provided by the present invention in increasing the proportion of 3-hydroxyhexanoic acid in PHA produced by microorganisms, the coding genes of these variants and biological materials containing these genes can be used to construct strains that produce PHA.

[0028] In the above uses, the microorganism is preferably Ralstonia eutropha, Escherichia coli or Halomonas.

[0029] In some embodiments of the present invention, a gene shown in any one of SEQ ID NOs: 1 to 7 is introduced into Ralstonia eutropha to construct a strain that produces PHA.

[0030] Sixth, the present invention provides a genetically engineered Ralstonia eutropha expressing the acetoacetyl-CoA reductase variant, wherein the amino acid sequence of the acetoacetyl-CoA reductase variant is as shown in any of SEQ ID NOs:9 to 15.

[0031] In the present invention, the expression of an acetoacetyl-CoA reductase variant is (1) a method for introducing a plasmid containing a gene encoding an acetoacetyl-CoA reductase variant; and (2) Inserting one or more copies of the gene encoding the acetoacetyl-CoA reductase variant into the genome The above-mentioned configuration may be realized by any one or more of the above.

[0032] In some embodiments of the invention, the acetoacetyl-CoA reductase variant is expressed by inserting a copy of the gene encoding the acetoacetyl-CoA reductase variant into the genome.

[0033] In some embodiments of the invention, the insertion position of the coding gene for the acetoacetyl-CoA reductase variant in the genome is at the position of the phaC gene.

[0034] In some embodiments of the present invention, the coding gene of the acetoacetyl-CoA reductase variant is as shown in any of SEQ ID NOs: 1 to 7. The sequences of these coding genes are obtained by combining artificial optimization and selection according to the codon bias of Ralstonia eutropha, and are sequences that can efficiently and accurately express the acetoacetyl-CoA reductase variant in Ralstonia eutropha. The use of these sequences is advantageous in promoting the acetoacetyl-CoA reductase variant to better exert the effect of increasing the proportion of 3-hydroxyhexanoic acid in PHA in Ralstonia eutropha.

[0035] In some embodiments of the invention, the phaB gene in situ in the genome of the microorganism is not inactivated.

[0036] In some embodiments of the invention, the phaB gene in situ in the genome of the microorganism is retained in its entirety.

[0037] In some embodiments of the present invention, the engineered Ralstonia eutropha to promote synthesis of poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) may further comprise: (1) modification to express a PHA polymerase variant capable of synthesizing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate); and (2) Modifications to improve the expression and / or enzyme activity of (R)-enoyl-CoA hydratase Includes one or more of the following.

[0038] Here, for a PHA polymerase variant capable of synthesizing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate), a mutation may be induced in the amino acid sequence of a bacterial PHA polymerase so that it can polymerize C6 fatty acid (3-hydroxyhexanoic acid). A PHA polymerase variant capable of polymerizing C6 fatty acid (3-hydroxyhexanoic acid) in the prior art may be used, but a new PHA polymerase variant with higher efficiency may be obtained by combining the mutation sites of a PHA polymerase variant capable of synthesizing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) in the prior art.

[0039] In some embodiments of the present invention, the PHA polymerase variant capable of synthesizing the poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) comprises a mutation from asparagine 149 to serine and a mutation from aspartic acid 171 to glycine relative to the original PHA polymerase.

[0040] In some embodiments of the invention, the amino acid sequence of the PHA polymerase variant is as set forth in SEQ ID NO:16.

[0041] Expression of the PHA polymerase variants capable of synthesizing the above poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) (1) introducing a plasmid containing a coding gene of a PHA polymerase variant capable of synthesizing the poly(3-hydroxybutyrate-co-3-hydroxyhexanoate); and (2) Inserting one or more copies of a gene encoding a PHA polymerase variant capable of synthesizing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) into the genome This is realized by one or more of the following:

[0042] In some embodiments of the invention, a PHA polymerase variant capable of synthesizing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) is expressed while the original PHA polymerase coding gene in the genome is inactivated.

[0043] In some embodiments of the invention, a gene encoding a PHA polymerase variant capable of synthesizing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) is inserted into the genome.

[0044] In some embodiments of the invention, an expression plasmid containing a gene encoding a PHA polymerase variant capable of synthesizing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) is introduced.

[0045] In some embodiments of the invention, the expression plasmid is a stably expressed plasmid, and stable expression of the plasmid is achieved by including in the plasmid a synthetic gene for a metabolite required for strain growth and by inactivating the synthetic gene in the genome.

[0046] In some embodiments of the present invention, the plasmid comprising the coding gene of the PHA polymerase variant shown in SEQ ID NO: 16 further comprises a proC gene, and the genetically engineered genomic proC gene of Ralstonia eutropha is inactivated.

[0047] The above-mentioned improvement in the expression of the enzyme can be achieved by any one or more of the following methods (1) to (4). (1) A method of introducing a vector containing a gene encoding the enzyme; (2) increasing the copy number of the gene encoding said enzyme in the genome; (3) A method of changing the sequence of transcription and / or translation regulatory factors (including promoters, etc.) of the gene encoding the enzyme in the genome; and (4) A method of changing the nucleotide sequence of the gene encoding the enzyme.

[0048] The improvement in enzyme activity can be achieved by substitution, deletion or insertion of one or more amino acids in the enzyme.

[0049] In some embodiments of the present invention, improved expression and / or enzymatic activity of (R)-enoyl-CoA hydratase is achieved by initiating transcription of the (R)-enoyl-CoA hydratase-encoding gene in the genome with the promoter shown in SEQ ID NO:17.

[0050] In some embodiments of the present invention, initiating transcription of a gene encoding (R)-enoyl-CoA hydratase in a genome using the promoter shown in SEQ ID NO: 17 is achieved by inserting the promoter shown in SEQ ID NO: 17 into the intergenic region between the gene encoding (R)-enoyl-CoA hydratase and a gene upstream of it in the genome.

[0051] The expression of (R)-enoyl-CoA hydratase in wild-type Ralstonia eutropha is silenced. In the present invention, the promoter used for the expression and improvement of the enzyme activity of (R)-enoyl-CoA hydratase is not limited to the promoter shown in SEQ ID NO: 17, and any DNA fragment that can function as a promoter in Ralstonia eutropha can initiate the transcription of (R)-enoyl-CoA hydratase and improve the expression and / or enzyme activity of (R)-enoyl-CoA hydratase.

[0052] In some embodiments of the present invention, improved expression and / or enzymatic activity of (R)-enoyl-CoA hydratase is achieved by initiating transcription of the (R)-enoyl-CoA hydratase coding gene in the genome of the Ralstonia eutropha BPS-050 strain using an upstream promoter of the (R)-enoyl-CoA hydratase gene.

[0053] In the present invention, experiments have demonstrated that the function of the coding gene of the acetoacetyl-CoA reductase variant of the present invention to increase the proportion of 3-hydroxyhexanoic acid in PHA produced from a genetically engineered microorganism does not depend on the promoter sequence of a specific (R)-enoyl-CoA hydratase gene, but rather on the ability of the (R)-enoyl-CoA hydratase to be expressed in the genetically engineered microorganism.

[0054] In some embodiments of the present invention, the genetically engineered Ralstonia eutropha is modified from a wild-type Ralstonia eutropha, Ralstonia eutropha strain H16, or Ralstonia eutropha BPS-050 as a starting strain.

[0055] Here, Ralstonia eutropha BPS-050 was deposited at the China General Microbiological Culture Collection Center (abbreviated as CGMCC, address: No. 3, Hall 1, Beichen West Road, Chaoyang District, Beijing, 100101, Institute of Microbiology, Chinese Academy of Sciences) on October 13, 2021, with its taxonomic position as Ralstonia eutropha and the deposit number as CGMCC No. 23600.

[0056] Seventh, the present invention provides a library of genetically engineered Ralstonia eutropha transformants, comprising at least two strains of the genetically engineered Ralstonia eutropha.

[0057] In some embodiments of the present invention, the genetically engineered Ralstonia eutropha in the transformant library expresses an acetoacetyl-CoA reductase variant having an amino acid sequence as set forth in any one of SEQ ID NOs: 9 to 15, and the amino acid sequences of the acetoacetyl-CoA reductase variants expressed by each strain of genetically engineered Ralstonia eutropha in the transformant library are different.

[0058] In some embodiments of the present invention, the transformant library comprises 2, 3, 4, 5, 6 or 7 strains of the genetically engineered Ralstonia eutropha as described above.

[0059] Eighth, the present invention provides a method for constructing the genetically engineered Ralstonia eutropha, comprising the step of modifying Ralstonia eutropha to express the acetoacetyl-CoA reductase variant.

[0060] In some embodiments of the present invention, to enhance the ability of the genetically engineered Ralstonia eutropha to synthesize poly(3-hydroxybutyrate-co-3-hydroxyhexanoate), the method comprises: (1) modification to express a PHA polymerase variant capable of synthesizing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate); and (2) Modifications to improve the expression and / or enzyme activity of (R)-enoyl-CoA hydratase The method further includes performing one or more of the following:

[0061] In some embodiments of the invention, the amino acid sequence of the PHA polymerase variant capable of synthesizing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) is as set forth in SEQ ID NO:16.

[0062] In some embodiments of the invention, the method comprises initiating transcription of a gene encoding (R)-enoyl-CoA hydratase in the genome by the promoter set forth in SEQ ID NO:17.

[0063] In some embodiments of the invention, the method comprises inserting into the genome a gene encoding a PHA polymerase variant capable of synthesizing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate).

[0064] In some embodiments of the invention, the method comprises introducing a plasmid comprising a gene encoding a PHA polymerase variant capable of synthesizing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate).

[0065] In some embodiments of the invention, the method includes introducing a plasmid containing a gene encoding a PHA polymerase variant capable of synthesizing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) and the proC gene, and inactivating the proC gene in the genome.

[0066] Here, gene inactivation can be achieved by methods such as gene knockout, expression silencing, and RNA interference.

[0067] Ninthly, the present invention provides any one of the following uses of the genetically engineered Ralstonia eutropha. (1) Use in the fermentation production of polyhydroxyalkanoates or their derivatives; and (2) Use in selecting and cultivating strains for the fermentative production of polyhydroxyalkanoates or their derivatives.

[0068] In the above-mentioned use, the selection and cultivation of the strain used for the fermentative production of polyhydroxyalkanoate or its derivatives may specifically be the selection and cultivation of the strain used for the fermentative production of polyhydroxyalkanoate or its derivatives by a method of genetic engineering, mutagenesis or habituation using the genetically engineered Ralstonia eutropha provided by the present invention as a starting strain.

[0069] Tenth, the present invention provides a fermentative production method for polyhydroxyalkanoate or a derivative thereof, comprising the step of culturing the genetically engineered Ralstonia eutropha to obtain a culture.

[0070] In some embodiments of the present invention, the method includes activating and culturing the genetically engineered Ralstonia eutropha, inoculating the activated cells into a seed medium to perform seed culture, obtaining a seed culture solution, and then inoculating the seed culture solution into a production medium to obtain the culture.

[0071] In the above culture, a normal medium for culturing Ralstonia eutropha may be selected. The medium may contain a carbon source, a nitrogen source, and inorganic salts. Here, the carbon source may include, but is not limited to, one or a combination of vegetable oil (e.g., palm oil), sucrose, glucose, molasses, maltose, fructose, and arabinose. The nitrogen source may include, but is not limited to, one or a combination of corn steep liquor, yeast extract, urea, ammonium sulfate, ammonium chloride, ammonium nitrate, and potassium nitrate. The inorganic salt may include, but is not limited to, one or a combination of phosphate, potassium salt, sodium salt, magnesium salt, zinc salt, iron salt, manganese salt, calcium salt, borate, cobalt salt, copper salt, nickel salt, and molybdenum salt.

[0072] In some embodiments of the invention, the method includes the step of subjecting the culture to separation and extraction to collect the polyhydroxyalkanoate or derivative thereof.

[0073] Eleventh, the present invention provides a method for increasing the proportion of 3-hydroxyhexanoic acid in PHA produced from a genetically engineered microorganism, comprising expressing an acetoacetyl-CoA reductase variant by modifying Ralstonia eutropha, wherein the amino acid sequence of the acetoacetyl-CoA reductase variant is as set forth in any of SEQ ID NOs: 9 to 15.

[0074] In the above method, the expression of the acetoacetyl-CoA reductase variant is (1) a method for introducing a plasmid containing a gene encoding an acetoacetyl-CoA reductase variant; and (2) Inserting one or more copies of the gene encoding the acetoacetyl-CoA reductase variant into the genome This can be achieved by one or more of the following:

[0075] In some embodiments of the present invention, the coding gene for the acetoacetyl-CoA reductase variant is as set forth in any of SEQ ID NOs: 1-7.

[0076] In some embodiments of the invention, the phaB gene in situ in the genome of the microorganism is not inactivated.

[0077] In some embodiments of the invention, the phaB gene in situ in the genome of the microorganism is retained in its entirety.

[0078] In the above method, the genetically engineered microorganism comprises: (1) modification to express a PHA polymerase variant capable of synthesizing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate); and (2) Modifications to improve the expression and / or enzyme activity of (R)-enoyl-CoA hydratase Further, the present invention includes one or more of the following:

[0079] In some embodiments of the present invention, a PHA polymerase variant capable of synthesizing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) contains an asparagine 149 to serine mutation and an aspartic acid 171 to glycine mutation relative to the original PHA polymerase.

[0080] In some embodiments of the invention, the amino acid sequence of the PHA polymerase variant is as set forth in SEQ ID NO:16.

[0081] In some embodiments of the present invention, improved expression and / or enzymatic activity of (R)-enoyl-CoA hydratase is achieved by initiating transcription of the (R)-enoyl-CoA hydratase-encoding gene in the genome with the promoter shown in SEQ ID NO:17.

[0082] In some embodiments of the present invention, increasing the proportion of 3-hydroxyhexanoic acid in the PHA produced from the genetically engineered microorganism means increasing the proportion of 3-hydroxyhexanoic acid in the PHA produced by the genetically engineered microorganism when lipids are used as a carbon source.

[0083] In some embodiments of the present invention, increasing the proportion of 3-hydroxyhexanoic acid in the PHA produced from the genetically engineered microorganism means increasing the proportion of 3-hydroxyhexanoic acid in the PHA produced by the genetically engineered microorganism when vegetable oil is used as a carbon source.

[0084] The above-mentioned vegetable oils include one or more mixtures selected from palm oil, peanut oil, soybean oil, linseed oil, rapeseed oil, castor oil, and corn oil.

[0085] In the present invention, the polyhydroxyalkanoate is preferably poly(3-hydroxybutyrate-co-3-hydroxyhexanoate), more preferably poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) having a high proportion of 3-hydroxyhexanoic acid.

[0086] The beneficial effects of the present invention are as follows: the acetoacetyl-CoA reductase variant and its coding gene provided by the present invention can significantly increase the proportion of 3-hydroxyhexanoic acid in PHA produced from the strain, and the proportion of 3-hydroxyhexanoic acid in PHA produced from the genetically engineered Ralstonia eutropha constructed by the acetoacetyl-CoA reductase variant and its coding gene provided by the present invention is significantly increased, providing novel gene and strain resources for the development of genetically engineered strains producing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) with a high proportion of 3-hydroxyhexanoate, which has important use value for the production of poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) with a high proportion of 3-hydroxyhexanoic acid. [Brief description of the drawings]

[0087] [Figure 1] FIG. 2 is a diagram showing the molar fraction of 3-hydroxyhexanoic acid in PHA obtained by fermentation production of each strain in Example 2 of the present invention. [Diagram 2] FIG. 2 is a diagram showing the PHA fermentation production capacity of each strain in Example 2 of the present invention. [Diagram 3] FIG. 1 shows the molar fraction of 3-hydroxyhexanoic acid in PHA obtained by fermentation production of each strain in Example 3 of the present invention. [Figure 4] FIG. 1 shows the PHA fermentation production capacity of each strain in Example 3 of the present invention. [Diagram 5] FIG. 1 shows the molar fraction of 3-hydroxyhexanoic acid in PHA obtained by fermentation production of each strain in Example 4 of the present invention. [Figure 6]Fig. 1 shows the fermentation production capacity of PHA for each strain in Example 4 of the present invention. In Fig. 1, Fig. 2, Fig. 3, Fig. 4, Fig. 5 and Fig. 6, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7 refer to genetically engineered Ralstonia eutropha expressing the coding genes of acetoacetyl-CoA reductase variants whose sequences are as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, respectively. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0088] The application of the present invention is not limited to the forms described or illustrated in the following specification. The present invention is applicable to other embodiments and can be practiced or carried out in various ways. Furthermore, the descriptions and terminology used herein are for the purpose of explanation and should not be considered as limiting. As used herein, the terms "including," "including," "having," "containing," "related to," and variations thereof are intended to include the items listed below and their equivalents as well as other items.

[0089] Some or all of the specific embodiments provided by the present invention are based on the discovery of acetoacetyl-CoA reductase variants and their coding genes that can significantly increase the proportion of 3-hydroxyhexanoic acid in PHA produced by a strain. The coding genes of these acetoacetyl-CoA reductase variants can be introduced into strains having other genes necessary for the synthesis of PHA (particularly P(3HB-co-3HHx)) to increase the proportion of 3-hydroxyhexanoic acid in PHA produced by the strain, thereby obtaining genetically engineered microorganisms. These genetically engineered microorganisms can be applied to the production of PHA (particularly P(3HB-co-3HHx)), and can improve the fermentation production ability of P(3HB-co-3HHx) with a high proportion of 3-hydroxyhexanoic acid of conventional PHA fermentation production strains. In addition to expressing the acetoacetyl-CoA reductase variants provided by the present invention, the genetically engineered microorganisms may be subjected to other modifications. The present invention has discovered that by combining the modification of expressing an acetoacetyl-CoA reductase mutant with modifications such as expressing at least a PHA polymerase (phaC) mutant and improving the expression of phaJ, the production amount of P(3HB-co-3HHx), which has a high proportion of 3-hydroxyhexanoic acid, can be further increased.

[0090] In some embodiments, the present invention provides acetoacetyl-CoA reductase variants having an amino acid sequence set forth in any of SEQ ID NOs: 9 to 15. These variants can significantly increase the proportion of 3-hydroxyhexanoic acid in PHA produced from the strain.

[0091] In some embodiments, the present invention provides genes encoding acetoacetyl-CoA reductase variants having a nucleotide sequence set forth in any of SEQ ID NOs: 1-7, which are optimized for expression in Ralstonia eutropha.

[0092] In some embodiments, the present invention provides engineered Ralstonia eutropha expressing a gene encoding an acetoacetyl-CoA reductase variant.

[0093] In some embodiments, the present invention provides a genetically engineered Ralstonia eutropha having an inserted gene encoding an acetoacetyl-CoA reductase variant as described above in the genome.

[0094] In some embodiments, the present invention provides engineered Ralstonia eutropha strains having a gene encoding an acetoacetyl-CoA reductase variant inserted into the genome of the Ralstonia eutropha strain BPS-050, and the proportion of 3-hydroxyhexanoic acid in P(3HB-co-3HHx) produced from the engineered Ralstonia eutropha strains is significantly increased compared to the Ralstonia eutropha strain BPS-050.

[0095] In some embodiments, the present invention provides a genetically engineered Ralstonia eutropha strain BPS-050 comprising a gene encoding an acetoacetyl-CoA reductase variant as described above inserted at the phaC gene position in the genome of the strain.

[0096] In some embodiments, the present invention provides engineered Ralstonia eutropha strains, in which the phaC gene in the genome of the strain H16 is replaced with a gene encoding a PHA polymerase variant (the sequence of which is shown in SEQ ID NO: 16) and the gene encoding the acetoacetyl-CoA reductase variant described above is inserted into the genome, and the proportion of 3-hydroxyhexanoic acid in P(3HB-co-3HHx) produced from these engineered Ralstonia eutropha strains is significantly increased.

[0097] In some embodiments, the present invention provides genetically engineered Ralstonia eutropha in which the upstream promoter of the phaJ4b gene in the genome of Ralstonia eutropha BPS-050 has been replaced with the promoter shown in SEQ ID NO: 17, and a gene encoding the acetoacetyl-CoA reductase variant described above has been inserted into the genome, and the proportion of 3-hydroxyhexanoic acid in P(3HB-co-3HHx) produced from these genetically engineered Ralstonia eutropha is significantly increased.

[0098] The following examples are intended to illustrate the present invention, but the scope of the present invention is not limited thereto.

[0099] Unless otherwise stated, all experimental methods used in the following examples are conventional methods.

[0100] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. The enzyme reagents used here were purchased from New England Biolabs (NEB), the kit for extracting plasmids was purchased from TIANGEN Biotech (Beijing) Co., Ltd., and the kit for recovering DNA fragments was purchased from Omega, USA, and the corresponding operating procedures were strictly performed in accordance with the product instructions. Unless otherwise specified, all media were prepared with deionized water.

[0101] The media formulations used in the following examples are as follows: Seed medium I: peptone 10 g / L, yeast extract 5 g / L, glucose 3 g / L. Seed medium II: palm oil 0.15%, peptone 10 g / L, yeast extract 5 g / L. Production medium: Palm oil 1.0%, Na 2 HPO 4 12H 2 O 9.85g / L, KH 2 PO 4 1.5g / L, NH4 Cl 3.0g / L, trace element solution I 10mL / L, and trace element solution II 1mL / L. The composition of trace element solution I is MgSO 4 20g / L, CaCl 2 The composition of trace element solution II is ZnSO 4 7H 2 O 100 mg / L, MnCl 2 4H 2 Oxygen 30mg / L, H 3 BO 3 300mg / L CoCl 2 6H 2 O 200 mg / L, CuSO 4 5H 2 O 10mg / L, NiCl 2 6H 2 O 20 mg / L, NaMoO 4 2H 2 O 30 mg / L. All the above reagents were purchased from Sinopharm Chemical Reagent Co., Ltd. EXAMPLES

[0102] Example 1: Construction of a transformant library expressing acetoacetyl-CoA reductase variants using BPS-050 as the starting strain In this example, Ralstonia eutropha BPS-050 was used as the starting strain, and the starting strain was modified to express different acetoacetyl-CoA reductase variants.

[0103] Step 1: Construction of the base plasmid Using the genome of Ralstonia eutropha as a template, PCR amplification was performed to obtain fragments phaC-H1 and phaC-H2, which are homologous to the upstream and downstream of phaC. To facilitate subsequent manipulations, BsaI was added to the rear and front ends of phaC-H1 and phaC-H2. Using the modified plasmid pK18mob (Orita, I., Iwazawa, et al. J. Biosci. Bioeng. 113, 63-69) as a template, PCR amplification was performed to obtain a vector fragment. phaC-H1 and phaC-H2 were ligated to the vector fragment by the Gibson Assembly method to obtain the recombinant plasmid pKO-C. The primers used are shown in Table 1.

[0104] [Table 1]

[0105] Step 2: Gene synthesis The sequences of the coding genes of the different acetoacetyl-CoA reductase variants were optimized so as to be well expressed in Ralstonia eutropha. The sequences of the coding genes of the optimized acetoacetyl-CoA reductase variants are shown in SEQ ID NO: 1 to SEQ ID NO: 7.

[0106] When the coding gene for the above-mentioned optimized acetoacetyl-CoA reductase variant was subjected to synthesis, GGTCTCATC was added upstream and GTGAAGAGACC was added downstream of the DNA sequence to facilitate subsequent manipulation.

[0107] Step 3: Construction of the desired strain containing the target gene The plasmid pKO-C constructed in step 1 and the plasmid containing the coding gene of the optimized acetoacetyl-CoA reductase variant returned from the gene synthesis company were assembled by Golden Gate assembly to obtain the recombinant plasmid pKO-CN (N stands for the coding gene of the acetoacetyl-CoA reductase variant) carrying the coding gene of each different acetoacetyl-CoA reductase variant. Each plasmid was introduced into Escherichia coli S17-1 and then into Ralstonia eutropha BPS-050 by conjugative transfer. Taking advantage of the fact that the suicide plasmid cannot replicate in the host bacteria, the positive clones were screened on LB plates containing 500 μg / mL spectinomycin and 100 μg / mL apramycin at the same time. The positive clones in which the recombinant plasmid carrying the homologous fragment was integrated into the specific position on the genome where H1 and H2 existed were designated as the first homologous recombinant bacteria.

[0108] The first homologous recombinant bacteria were streaked on LB plates containing 100 mg / mL sucrose to grow single clones, and the single clones were screened for those lacking spectinomycin resistance, and the recombinant bacteria with the target gene inserted were identified by PCR using primers FphaCH1-F:tggtctggctggcggactgag and phaCH2-R:ggcgaactcatcctgcgcctc. The resulting recombinant bacteria was a plasmid-stable Ralstonia eutropha ReΔproCΔphaC::N (N is the inserted gene).

[0109] Step 4: Construction of recombinant strains overexpressing the original phaB gene of Ralstonia eutropha Referring to the recombinant plasmid construction method in step 3, a recombinant plasmid containing the original phaB gene of Ralstonia eutropha was constructed by Gibson assembly. The specific method is as follows:

[0110] The plasmid backbone fragment was obtained by PCR amplification using the plasmid obtained in step 1 as a template. The phaB gene fragment was obtained by amplification using the genome of Ralstonia eutropha BPS-050 as a template. The above two fragments were ligated by the Gibson Assembly method to obtain the recombinant plasmid pKO-C-phaB. The primers used are shown in Table 2.

[0111] [Table 2]

[0112] The pKO-C-phaB plasmid was introduced into E. coli S17-1, and the recombinant strain was constructed according to the method in step 3 above. Finally, an overexpression strain ReΔphaC::phaB (abbreviated as phaB overexpression) in which the phaB gene was integrated into the phaC gene position of the Ralstonia eutropha genome was obtained. EXAMPLES

[0113] Example 2: Determination of fermentation characteristics of strains (1) Ralstonia eutropha BPS-050 and the overexpressing strain ReΔphaC::phaB were used as controls, and the fermentation characteristics of the strains expressing different acetoacetyl-CoA reductase variants were measured, respectively.

[0114] First, each strain (1000 μL) constructed in Example 1 stored in a glycerol tube was inoculated into seed medium I (20 mL) and primary seed culture was performed for 12 hours. Next, 1% seed culture I was inoculated into seed medium II and secondary seed culture was performed. Then, 10 v / v% seed culture II was inoculated into a 2 L small fermentation tank (manufactured by T&J Bioengineering) containing 1.1 L of production medium. The operating conditions were a culture temperature of 30°C, a stirring speed of 800 rpm, aeration rate of 1 L / min, and pH of 6.7 to 6.8. A 28% aqueous ammonia solution was used for pH control. Palm oil was continuously used as a carbon source during the culture, and the culture time was 54 hours.

[0115] The fermentation liquid was collected and centrifuged to obtain the cells. The cells were dried to a constant weight. The weight of the dried cells was measured and used as the dry weight. 100 mL of chloroform was added to the obtained dried cells and stirred at room temperature for a day and night to extract the polyester in the cells. After filtering off the cell residue, it was concentrated in an evaporator so that the total volume was about 30 mL, and then about 90 mL of hexane was slowly added and left for 1 hour with slow stirring. The precipitated polyester was filtered off and then vacuum dried at 5 CTC for 3 hours. The mass of the dried polyester was measured and the polyester content in the cells was calculated.

[0116] As a result, each strain expressing different acetoacetyl-CoA reductase variants showed a higher PHA ratio than the control strain. In addition, the ratio of H in the PHA produced by each strain expressing different acetoacetyl-CoA reductase variants was significantly increased compared to the control strain. The ratio of H in the PHA produced by each strain is shown in Figure 1, and the corresponding dry weight and PHA ratio are shown in Figure 2. EXAMPLES

[0117] Example 3: Construction of a transformant library expressing acetoacetyl-CoA reductase variants using BPS-050 as the starting strain and measurement of their fermentation characteristics In this example, BPS-050 was used as the starting strain, the upstream promoter of the phaJ4b gene was replaced with phaJ194 (SEQ ID NO: 17), and the coding genes of acetoacetyl-CoA reductase variants (SEQ ID NOs: 1 to 7) were expressed therein.

[0118] Step 1: Replacement of the upstream promoter of the phaJ4b gene of BPS-050 by homologous recombination (1) Using the genome of Ralstonia eutropha BPS-050 as a template, PCR amplification was performed to obtain fragment H1, which is homologous to the upstream promoter of the phaJ gene, using phaJ-H1 Fp and phaJ-H1 Rp. Fragment H2, which is homologous to the upstream promoter of the phaJ gene, was obtained using phaJ-H2 Fp and phaJ-H2 Rp. (2) The phaJ gene promoter phaJ194 (SEQ ID NO: 17) was synthesized by gene synthesis. (3) The H1, H2 and phaJ194 promoters obtained by PCR were ligated to a vector fragment by the Gibson Assembly method to obtain a recombinant plasmid pK18mob-phaJ194. The primers used are shown in Table 3.

[0119] [Table 3] (4) The recombinant plasmid pK18mob-phaJ194 was introduced into E. coli S17-1 and then introduced into the starting strain by conjugative transfer. Taking advantage of the fact that the suicide plasmid cannot replicate in the host bacteria, positive clones were screened on LB plates containing both 200 μg / mL kanamycin and 100 μg / mL apramycin. The positive clone in which the recombinant plasmid containing the homologous fragment was integrated into the specific position on the genome where H1 and H2 are present was determined as the first homologous recombinant bacterium.

[0120] The first homologous recombinant bacteria were streaked onto LB plates containing 100 mg / mL sucrose to grow single clones, and these single clones were screened for kanamycin-resistant clones and identified by PCR with primers phaJ Fp and phaJ Rp. The resulting recombinant bacteria was Ralstonia eutropha ReΔphaC::phaCac_phaJ194 (abbreviated as Re_phaJ194).

[0121] Step 2: Referring to the method of Example 1, the coding genes of different acetoacetyl-CoA reductase variants (SEQ ID NOs: 1 to 7) were respectively inserted into the genome of Ralstonia eutropha ReΔphaC::phaCac_phaJ194.

[0122] Step 3: The original phaB gene of Ralstonia eutropha was overexpressed in Ralstonia eutropha ReΔphaC::phaCac_phaJ194 to obtain a phaB overexpressing strain, phaB overexpression-2.

[0123] Step 4: Fermentation culture and PHA measurement were performed for the strains constructed in Steps 2 and 3 according to the method of Example 2. As a result, each strain expressing a different acetoacetyl-CoA reductase variant showed a higher PHA ratio than the control strain. In addition, the ratio of H in the PHA produced from each strain expressing a different acetoacetyl-CoA reductase variant was significantly increased compared to the control strain. The ratio of H in the PHA produced from each strain is shown in Figure 3, and the corresponding dry weight and PHA ratio are shown in Figure 4. EXAMPLES

[0124] Example 4: Construction of a transformant library expressing acetoacetyl-CoA reductase variants using H16 as the starting strain and measurement of their fermentation characteristics In this example, Ralstonia eutropha H16 was used as the starting strain, and the phaC gene in the genome of H16 was mutated to a phaC gene variant (the protein-encoding sequence is as shown in SEQ ID NO: 16) to confer the ability to synthesize 3HHx to the recombinant strain, and the coding gene for the acetoacetyl-CoA reductase variant (SEQ ID NOs: 1 to 7) was expressed in the resulting recombinant strain.

[0125] Step 1: Replacement of the phaC gene in the Ralstonia eutropha genome The sequence shown in SEQ ID NO:8 was synthesized by gene synthesis, and the sequence has approximately 600 bp fragments upstream and downstream of the phaC gene and a phaC gene variant. The plasmid constructed in step 1 of Example 1 was used to construct the plasmid, and GGTCTCATC was added upstream of the DNA sequence and GTGAAGAGACC was added downstream during gene synthesis. The synthetic gene was ligated to a vector fragment by the Golden Gate method to obtain a recombinant plasmid pK18mob-ΔphaC::phaCac.

[0126] The recombinant plasmid pK18mob-ΔphaC::phaCac was introduced into E. coli S17-1 and then introduced into R. eutropha by conjugative transfer. Positive clones were screened on LB plates containing 200 μg / mL kanamycin and 100 μg / mL apramycin, taking advantage of the fact that the suicide plasmid cannot replicate in the host. The positive clones in which the recombinant plasmid carrying the homologous fragment was integrated into the specific site on the genome where H1 and H2 are present were defined as the first homologous recombinant bacteria.

[0127] The first homologous recombinant bacteria were streaked onto LB plates containing 100 mg / mL sucrose to grow single clones, and the single clones were screened for kanamycin-resistant clones and identified by PCR using primers phaC-H1 FP and phaC-H2 RP. The resulting recombinant bacteria was Ralstonia eutropha ReΔphaC::phaCac (abbreviated as Re_H16).

[0128] Step 2: Referring to the method of Example 1, the coding genes of different acetoacetyl-CoA reductase variants (SEQ ID NOs: 1 to 7) were respectively inserted into the genome of Ralstonia eutropha ReΔphaC::phaCac constructed in Step 1.

[0129] Step 3: The original phaB gene of R. eutropha H16 was overexpressed in the R. eutropha ReΔphaC::phaCac constructed in step 1 to obtain a phaB overexpressing strain, phaB overexpression-3.

[0130] Step 4: Fermentation culture and PHA measurement were performed for the strains constructed in Steps 2 and 3 according to the method of Example 2. As a result, each strain expressing a different acetoacetyl-CoA reductase variant showed a higher PHA ratio than the control strain. In addition, the ratio of H in the PHA produced from each strain expressing a different acetoacetyl-CoA reductase variant was significantly increased compared to the control strain. The ratio of H in the PHA produced from each strain is shown in Figure 5, and the corresponding dry weight and PHA ratio are shown in Figure 6.

[0131] Example 5: Measurement of fermentation characteristics of strains (2) Fermentation experiments were carried out using other vegetable oils as the carbon source for the strains constructed in Examples 1, 3, and 4 above. That is, the carbon source in the corresponding fermentation measurement method was changed from palm oil to soybean oil and linseed oil, respectively, and the fermentation characteristics were measured for the strains constructed in Examples 1, 3, and 4. As a result, when soybean oil or linseed oil was used as the carbon source, the proportion of H, the dry cell weight, and the proportion of PHA in the PHA produced from each strain tended to match the results of the fermentation characteristics measured when palm oil was used as the carbon source, and no significant differences were observed.

[0132] Although the present invention has been described in detail herein through general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made based on the present invention, and therefore, any modifications or improvements made within the scope of the present invention are within the scope of protection of the present invention. [Industrial Applicability]

[0133] The present invention provides a genetically engineered microorganism expressing an acetoacetyl-CoA reductase variant and its coding gene, the use of the acetoacetyl-CoA reductase variant and its coding gene for increasing the proportion of 3-hydroxyhexanoic acid in PHA produced by a microorganism, and a method for increasing the proportion of 3-hydroxyhexanoic acid in PHA produced by a microorganism. By expressing an acetoacetyl-CoA reductase variant in a microorganism, the proportion of 3-hydroxyhexanoic acid in PHA synthesized by a microorganism can be significantly increased and a high content of PHA in a microbial cell can be ensured. The acetoacetyl-CoA reductase variant, its coding gene, and genetically engineered microorganism provided by the present invention provide novel gene and strain resources for the development of strains producing PHA with a high proportion of 3-hydroxyhexanoic acid, and have important economic value and application prospects in the production of PHA with a high proportion of 3-hydroxyhexanoic acid.

Claims

1. Use of an acetoacetyl-CoA reductase variant or its encoding gene for increasing the proportion of 3-hydroxyhexanoic acid in PHA produced by genetically engineered Ralstonia eutropha when palm oil is used as a carbon source, wherein the amino acid sequence of the acetoacetyl-CoA reductase variant is as shown in SEQ ID NO:

10.

2. The use according to claim 1, characterized in that the nucleotide sequence of the coding gene is as shown in SEQ ID NO:

2.

3. The use includes: (1) A method of introducing a plasmid containing a coding gene of the acetoacetyl-CoA reductase variant into Ralstonia eutropha; and (2) Inserting one or more copies of the coding gene for the acetoacetyl-CoA reductase variant into the genome of Ralstonia eutropha 3. Use according to claim 1 or 2, characterized in that it is realized in one or more of the following ways:

4. The genetically engineered Ralstonia eutropha further comprises (1) modification to express a PHA polymerase variant capable of synthesizing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate); and (2) Modifications that improve the expression and / or enzymatic activity of (R)-enoyl-CoA hydratase Including one of the following: The amino acid sequence of the PHA polymerase variant is as set forth in SEQ ID NO: 16, The use according to claim 1 or 2, wherein the expression and / or enzyme activity of the (R)-enoyl-CoA hydratase is improved by initiating transcription of a gene encoding the (R)-enoyl-CoA hydratase in a genome using a promoter represented by SEQ ID NO:

17.

5. A genetically engineered Ralstonia eutropha expressing an acetoacetyl-CoA reductase variant, wherein the amino acid sequence of the acetoacetyl-CoA reductase variant is as set forth in SEQ ID NO:

10.

6. The expression is (1) introducing a plasmid containing a gene encoding the acetoacetyl-CoA reductase variant; and (2) Inserting one or more copies of the gene encoding the acetoacetyl-CoA reductase variant into the genome 6. The genetically modified Ralstonia eutropha according to claim 5, characterized in that it is realized by one or more of the following:

7. The genetically engineered Ralstonia eutropha of claim 6, wherein the coding gene of the acetoacetyl-CoA reductase variant is as shown in SEQ ID NO:

2.

8. The genetically engineered Ralstonia eutropha further comprises (1) modification to express a PHA polymerase variant capable of synthesizing poly(3-hydroxybutyrate-co-3-hydroxyhexanoate); and (2) Modifications that improve the expression and / or enzymatic activity of (R)-enoyl-CoA hydratase Including one of the following: The amino acid sequence of the PHA polymerase variant is as set forth in SEQ ID NO: 16, The genetically engineered Ralstonia eutropha according to any one of claims 5 to 7, characterized in that the expression and / or enzyme activity of the (R)-enoyl-CoA hydratase is improved by initiating transcription of a gene encoding the (R)-enoyl-CoA hydratase in the genome with a promoter represented by SEQ ID NO:

17.

9. 6. A method for constructing a genetically engineered Ralstonia eutropha according to claim 5, comprising the step of expressing said acetoacetyl-CoA reductase variant by modifying Ralstonia eutropha.

Images