How to Measure the pH of a Sample

Abstract

The present invention provides a more sensitive and accurate method of monitoring the pH of a solution, the pH of which is quantified according to the electrochemical response of the solution in a two-electrode or three-electrode electrochemical cell, the solution containing a compound that can undergo a change in its oxidation state and / or structural conformation according to the pH of the solution. The present invention also provides highly accelerated methods and processes that allow for the analysis of specific polynucleotide sequences in a sample, e.g., a biological sample. The methods of the present invention are useful, for example, for the rapid screening of large numbers of samples in a point-of-care environment.

Description

[Technical field]

[0001] The present invention provides a more sensitive and accurate method of monitoring the pH of a solution, which is quantified according to the electrochemical response of the solution in a two-electrode or three-electrode electrochemical cell, the solution containing a compound that can undergo a change in its oxidation state and / or structural conformation depending on the pH of the solution.

[0002] The present invention also provides highly accelerated methods and processes that allow for the analysis of specific polynucleotide sequences in a sample, such as a biological sample. The methods of the present invention are useful, for example, for the rapid screening of large numbers of samples in a point-of-care environment. [Background technology]

[0003] Nucleic acid amplification methods are important for medical and environmental diagnostics and are often considered the gold standard for several diagnostic applications. Traditional methods, such as polymerase chain reaction, quantitative polymerase chain reaction, reverse transcriptase polymerase chain reaction, and quantitative reverse transcriptase polymerase chain reaction, rely heavily on thermal cycling to operate the amplification due to the different temperatures required for denaturation, annealing, and extension by the commonly used polymerases. Technical challenges and the resulting high implementation costs of these methods prevent their use at the point of care. Isothermal amplification methods such as branched rolling circle amplification and loop-mediated isothermal amplification are alternatives.

[0004] Quantification of nucleic acid amplicons and real-time monitoring of amplification requires labels that are indirect and not essential to the amplification reaction. These may include fluorescent dyes or chromophores attached to oligonucleotides or primers, DNA intercalating dyes, groove binders, dyes that bind to nucleotides, phosphate groups, ribose or deoxyribose groups, and nitrogenous bases intrinsic to nucleic acids. These dyes or complexes exhibit a spectral shift when bound to DNA and undergo fluorescence resonance energy transfer and / or a change in the magnitude of fluorescence when excited by light of a suitable wavelength, thereby facilitating optical detection. This quantification method requires expensive and sensitive optical systems, which further limits the use of molecular diagnostics in point-of-care applications.

[0005] Some of these DNA-binding molecules, such as Hoechst 33258, methylene blue, and nucleic acid-binding transition metal complexes such as ruthenium, osmium, or platinum-containing complexes, are also electroactive, and upon successful amplification, these molecules may be continuously sequestered to the newly generated amplicons, thereby facilitating indirect electrochemical detection by decreasing the conductivity of the reaction mixture.

[0006] Alternative electrochemical detection methodologies involve the immobilization of enzymes, primers or probe oligonucleotides to an electrode surface, thereby activating the quantification of amplicons or by-products. Most of these methods are indirect or require expensive devices.

[0007] Recent developments in loop-mediated isothermal amplification techniques include colorimetric detection of RNA and DNA targets in weakly buffered reaction mixtures, mediated by pH-sensitive dyes (WO2017 / 209920, WO2014 / 031783). The weak buffering effect of low concentrations of Tris is overcome by protons released during amplification, resulting in detection of an end point indicated by a color change in a pH indicator. This method has been deployed for point-of-care testing, but has drawbacks including long reaction times, low sensitivity at low nucleic acid concentrations, and the need for expensive optical equipment for quantification. Summary of the Invention

[0008] The present invention provides a more sensitive and accurate method of monitoring the pH of a solution, the pH of which is quantified in response to the electrochemical response of the solution in a three-electrode electrochemical cell, the solution comprising a quinone, a quinone derivative, and / or a pH indicator, which has been found to provide rapid and accurate results in determining whether a target polynucleotide is present in a sample, and in quantifying the target polynucleotide present in a sample.

[0009] Therefore, the present invention also provides a method for quantifying target polynucleotide in sample.This method can be carried out with high sensitivity and short reaction time without needing optical device for quantification.In particular, the quantification of target polynucleotide can be derived from the rate of change of electrochemical response (e.g., current and / or potential and / or impedance) of electrochemical cell such as three-electrode electrochemical cell.

[0010] Thus, the present invention provides a highly accelerated method and process that allows for the analysis of specific polynucleotide sequences in a sample, which is practically useful for the rapid screening of large numbers of samples in a point-of-care environment.

[0011] This is made possible by the ingenious investigation of nucleic acid amplification techniques (e.g., LAMP) combined with electrochemical quantification of signaling substances using electrochemical cells, such as three-electrode electrochemical cells or electrochemical cells with multiple film electrodes.

[0012] The invention is defined in the appended claims.

[0013] According to a first aspect of the present invention there is provided a method for measuring the pH of a solution, the method comprising the steps of: - providing a solution comprising a quinone, a quinone derivative, and / or a pH indicator; - applying the solution to a three-electrode electrochemical cell; - measuring the electrochemical response of the electrochemical cell; - Quantifying the pH of the solution as a function of the electrochemical response of the electrochemical cell.

[0014] According to another aspect of the present invention there is provided a use of a three-electrode electrochemical cell for measuring the pH of a solution, the use comprising: providing a solution comprising a quinone, a quinone derivative, a pH indicator, or a combination thereof; applying the solution to a three-electrode electrochemical cell; -Measuring the electrochemical response of the electrochemical cell; - Quantifying the pH of the solution as a function of the electrochemical response of the electrochemical cell.

[0015] According to another aspect of the present invention there is provided a use of a three-electrode electrochemical cell for monitoring a nucleic acid amplification reaction, the use comprising: providing a solution comprising a quinone, a quinone derivative, a pH indicator, or a combination thereof; - providing a LAMP mixture comprising a target polynucleotide, a sample comprising at least two, e.g. at least four, primers, each flanking the target polynucleotide, and a LAMP reagent; applying the solution and the LAMP mixture to a three-electrode electrochemical cell; -Measuring the electrochemical response of the electrochemical cell; - Quantifying the pH of the solution as a function of the electrochemical response of the electrochemical cell.

[0016] According to another aspect of the present invention, there is provided a system for measuring pH of a solution, the system comprising: a. An apparatus including a potentiostat; and i. a first container containing a three-electrode electrochemical cell and a second container containing a quinone, a quinone derivative, and / or a pH indicator; or ii. a three-electrode electrochemical cell and a first container containing a quinone, a quinone derivative, and / or a pH indicator; The potentiostat is configured to measure the electrochemical response of the electrochemical cell. [Brief description of the drawings]

[0017] [Figure 1] FIG. 1 shows a schematic of LAMP primers and the polynucleotide sequences to which they anneal. Arrows indicate where the primers anneal and reverse shading of grey indicates complementarity. FIP: forward inner primer. BIP: backward inner primer. F3: forward outer primer. B3: backward outer primer. FL: forward loop primer. BL: backward loop primer. [Diagram 2](A) Fluid or fluidized or resuspended biological sample in suitable carrier or transport medium (if present) after suitable processing (if present) is mixed with (B) LAMP primer and (C) WarmStart Colorimetric LAMP 2X Master Mix (New England Biolabs Inc,) and immediately added to (D) a pH-sensing screen-printed electrode, or a screen-printed electrode connected to a potentiostat at 59-75 °C, and voltammetry or other electrochemical measurements are performed for 1-90 min. The signal change over time (E) is measured. A zero signal change over 1-90 min compared to a parallelized or pre-calibrated no-template control indicates the absence of template nucleic acid (F). A significant non-zero change in signal indicates the presence of template nucleic acid (G), and the rate of change of this value is used to quantify the amount of template nucleic acid in the biological sample using a pre-determined calibration curve that is specific to the LAMP primer and the biological sample and its processing. [Diagram 3] FIG. 1 shows the cyclic voltammogram of phenol red, where three peaks are identified at −0.35 V, 0.2 V, and 0.55 V, respectively. [Figure 4] FIG. 1 shows cathodic cyclic voltammetry scans of a solution containing 1.0 mM phenol red buffered at pH 7.9 in 0.1 M PBS on a bare glassy carbon electrode starting from 1.5 V vs. Ag / AgCl at scan rates of 100, 300, 500, 700, and 900 mV / s. The inset plots show the current dependence on scan rate and the square root of the scan rate, respectively. [Diagram 5] Figure 1 shows cathodic cyclic voltammetry scans of a solution containing 1.0 mM phenol red (buffered with 0.1 M PBS, pH 7.9) on a bare glassy carbon electrode at various switching potentials at a scan rate of 100 mV / s starting from 1.5 V vs. Ag / AgCl. The inset plot shows that the ratio of ipc / ipa around -0.75 V changes with switching potential. [Figure 6]Anodic cyclic voltammetry scans of solutions containing 1.0 mM phenol red buffered with 0.1 M PBS on a bare glassy carbon electrode at pH (a) 3.9, (b) 7.9, and (c) 11.9, respectively. (d) represents the scan of solution (b) started from a more positive potential. The cathodic cyclic voltammetry scans of these corresponding pH solutions are shown as a', b', and c'. [Figure 7a] Examples of square wave voltammetry of phenol red over the pH range 6.5-8.5 and different concentrations of phenol red. Figures 7b and 7d show the peak position (voltage) and height (current) versus concentration of phenol red. [Figure 7b] Examples of square wave voltammetry of phenol red over the pH range 6.5-8.5 and different concentrations of phenol red. Figures 7b and 7d show the peak position (voltage) and height (current) versus concentration of phenol red. [Figure 7c] Examples of square wave voltammetry of phenol red over the pH range 6.5-8.5 and different concentrations of phenol red. Figures 7b and 7d show the peak position (voltage) and height (current) versus concentration of phenol red. [Figure 7d] Examples of square wave voltammetry of phenol red over the pH range 6.5-8.5 and different concentrations of phenol red. Figures 7b and 7d show the peak position (voltage) and height (current) versus concentration of phenol red. [Figure 8] 1 is an example of an in-house algorithm for correlating pH with phenol red output signal. An optimized algorithm is used to nest both the peak potential (peak identified at approximately 0.5 V vs Ag / AgCl) and the peak current. [Figure 9] FIG. 1 shows a voltammogram illustrating peaks observed in cyclic voltammetry of a phenol red solution. [Figure 10] FIG. 1 is a schematic diagram showing the design of a sensor environment controller. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0018] definition As used herein, the term "nucleotide sense strand" refers to the DNA or RNA strand that is complementary to the nucleotide antisense strand. As used herein, the term "nucleotide antisense strand" refers to a DNA or RNA strand that is complementary to the nucleotide sense strand.

[0019] The term "forward inner primer" or "FIP" as used herein refers to an oligonucleotide having a 3' end and a 5' end, the oligonucleotide comprising a first portion at the 3' end of the oligonucleotide and a second portion at the 5' end of the oligonucleotide. Generally, the first portion is complementary to a nucleotide sequence in the antisense strand of the target polynucleotide, and the second portion is complementary to a nucleotide sequence in the sense strand of the target polynucleotide. In other words, the first portion can be an F2 region and the second portion can be an F1c region. The F2 region is complementary to an F2c region in the target DNA sequence, and the F1c region is complementary to an F1 region in the target DNA sequence (Figure 1).

[0020] The term "backward inner primer" or "BIP" as used herein refers to an oligonucleotide having a 3' end and a 5' end, the oligonucleotide comprising a first portion at the 3' end of the oligonucleotide and a second portion at the 5' end of the oligonucleotide. Generally, the first portion is complementary to a nucleotide sequence in the sense strand of the target polynucleotide, and the second portion is complementary to a nucleotide sequence in the antisense strand of the target polynucleotide. In other words, the first portion can be the B2 region and the second portion can be the B1c region. The B2 region is complementary to the B2c region in the target DNA sequence, and the B1c region is complementary to the B1 region in the target DNA sequence (Figure 1).

[0021] As used herein, the term "forward outer primer" or "F3" refers to an oligonucleotide that is complementary to a nucleotide sequence in the antisense strand of a target polynucleotide. Thus, F3 may contain a region that is complementary to the F3c region in the target DNA sequence (Figure 1).

[0022] As used herein, the term "backward outer primer" or "B3" refers to an oligonucleotide that is complementary to a nucleotide sequence in the sense strand of a target polynucleotide. Thus, B3 may contain a region that is complementary to the B3c region in the target DNA sequence (Figure 1).

[0023] As used herein, the term "forward loop primer" or "FL" refers to an oligonucleotide that is complementary to a polynucleotide sequence in the sense strand of a target polynucleotide. Thus, the FL is complementary to a section of the target DNA sequence designated as FLc (Figure 1).

[0024] As used herein, the term "backward loop primer" or "BL" refers to an oligonucleotide that is complementary to a polynucleotide sequence in the antisense strand of a target polynucleotide. Thus, the BL is complementary to a section of the target DNA sequence designated BLc (Figure 1).

[0025] As used herein, the term "nucleic acid amplification" refers to any nucleic acid step / method / protocol used to replicate and amplify specific nucleic acid sequences in a sample.

[0026] The term "LAMP" refers to loop-mediated isothermal amplification. LAMP is a nucleic acid amplification reaction. LAMP uses 4 (or 6) primers that target 6 (or 8) regions within or surrounding the target sequence (Figure 1). The method relies on isothermal conditions; that is, it is performed at a constant temperature and does not require a thermal cycler. Briefly, LAMP amplification of a target gene occurs when incubated with target-specific primers FIP, BIP, F3, and B3, and a polymerase, at a constant temperature ranging from 59 to 75 °C. The inclusion of forward and backward loop primers, FL and BL, respectively, can be added to the LAMP amplification. The amplification products can be detected by any suitable method. The results of the method can be correlated with the number of DNA copies generated during the LAMP amplification and therefore serve as the basis for quantification of the amount of DNA present in the sample. Quantitative detection can be performed by both end-point and real-time measurements. The DNA may be cDNA.

[0027] The term "RT-LAMP" refers to reverse transcription loop-mediated isothermal amplification. RT-LAMP combines LAMP and reverse transcription steps to allow for the detection of RNA.

[0028] As used herein, the term "nucleic acid amplification reagent" refers to a reagent that is added to a sample to effect amplification of any target polynucleotide(s) within the sample.

[0029] The term "LAMP reagent" as used herein refers to agents added to LAMP in addition to the sample and at least four primers. The LAMP reagent includes at least nucleotides and a nucleic acid polymerase. In addition, the LAMP reagent may include other compounds such as salt(s) and buffer(s). The nucleic acid polymerase preferably has high strand displacement and replication activity.

[0030] The term "signal generator" as used herein refers to any physical quantity of an amplification reagent (such as a LAMP reagent) or sample that undergoes a change, or an agent that is produced, consumed, or undergoes a phase change during nucleic acid amplification, and that can be detected and thus used to demonstrate or quantify the amplification reaction, e.g., the production of H+ ions, or a decrease in pH or conductivity of the sample / reaction mixture.

[0031] The term "target sequence" as used herein refers to any nucleic acid sequence that is desired to be detected.In one embodiment, the target sequence is a nucleic acid sequence, preferably a nucleic acid sequence that can be amplified by any nucleic acid amplification technique, such as LAMP, and preferably the target nucleic acid sequence is amplified using at least four primers that flank the target sequence.

[0032] As used herein, the term "target polynucleotide" encompasses the term "target nucleic acid," and unless otherwise specified, the two definitions may be used interchangeably.

[0033] The term "electrochemical device" as used herein refers to any device capable of studying an analyte by measuring the potential (volts) and / or current (amperes) in an electrochemical cell containing the analyte. Typically, three main categories for measurements using electrochemical devices are potentiometry (measuring the difference in electrode potentials), coulometry (measuring the cell's current over time), and voltammetry (measuring the cell's current while actively varying the cell's potential). The term "electrochemical device" as used herein may be used synonymously with the term "three-electrode electrochemical cell" when referring to the first aspect of the invention. For the avoidance of doubt, unless expressly stated to the contrary, all embodiments described herein with respect to "electrochemical device" refer to both the electrochemical device of the second aspect of the invention and the three-electrode electrochemical cell of the first aspect of the invention.

[0034] The term "three-electrode electrochemical cell" as used herein refers to an electrochemical cell that includes three different electrodes: a working electrode, a counter electrode, and a reference electrode. In use, all three electrodes of the electrochemical cell are in contact with the solution to be analyzed. During a three-electrode experiment, charge flow (current) occurs primarily between the working and counter electrodes, while the potential of the working electrode relative to the reference electrode is measured.

[0035] As used herein, the term "two-electrode electrochemical cell" refers to an electrochemical cell that includes two electrodes, where one electrode is a working electrode and the second electrode is a combined reference and counter electrode, i.e., the second electrode is a variation of a three-electrode cell in which the reference and counter electrodes are shorted and act as one electrode, i.e., they are the same electrode.

[0036] As used herein, the term "electrode" refers to a conductive material (often made from carbon, metal, or composite materials) that provides a path for electrical current into or out of an electrochemical system. During an electrochemical measurement, a portion of the electrode surface is in direct contact with the ionically conductive medium, or electrolyte, through which charge is transferred between the other electrodes.

[0037] The term "quinone," as used herein, refers to an organic compound that is a cyclic organic compound containing two carbonyl (C=O) groups adjacent or separated by a vinylene (-CH=CH-) group.

[0038] The term "quinone derivative" as used herein refers to a compound derived from a quinone as defined above, in which one or more of the hydrogen atoms in the cyclic backbone of the compound have been replaced by other atoms or radicals.

[0039] As used herein, the term "square wave voltammetry" refers to a form of linear potential sweep voltammetry that uses a combination of a square wave and a step potential applied to a stationary electrode.

[0040] As used herein, the term "electrochemical response" refers to any measurable process that either causes or is accompanied by the passage of electric current. Such measurable electrochemical responses include measuring the potential, current, or impedance of a system, or indeed any combination of these measurements.

[0041] As used herein, the term "pH indicator" refers to a halochromic compound, which is a compound that changes color when a change in pH occurs and which, when added in small amounts to a solution, allows the pH (acidity or basicity) of the solution to be visually determined.

[0042] The term catechol as used herein includes all groups having a structural motif according to the following general formula I: [ka]

[0043] This results in residue R 1 , R 2 , R 3 and R 4 may be absent or may be hydrogen or any organic or organometallic residue. Preferred residues are aliphatic or aromatic chains (e.g., C1-C2) that can be optionally interrupted or substituted by moieties containing nitrogen, oxygen and / or sulfur atoms, e.g., -NH2, -NH-, -OH, =O, -O-, -SH, and / or -SS-. 10 Aliphatic chain or C6-C 20 Aromatic residues, etc. Residue R 1 , R 2 , R 3 and R 4 can have the same or different meanings independently of each other in each case. The term catechol as used herein also refers to substituted ortho-dihydroxybenzene derivatives. Two different isomeric conformations are represented by catechol, which is also known as pyrocatechol and benzene-1,2-diol.

[0044] The term "catechol group" also refers to the oxidized form of catechol and its derivatives, also known as quinones, which correspond to the following general formula II: [ka] residue R 1 , R 2 , R 3 and R 4 may have the same meaning as explained above.

[0045] The term "vessel" as used herein relates to a vessel, such as a container, suitable for holding a liquid, such as an aqueous solution. The vessel typically comprises an opening and a lid that can be used to close the opening. The vessel according to the present disclosure may also comprise a three-electrode electrochemical cell.

[0046] How to Measure the pH of a Solution According to one aspect of the invention there is provided a method for measuring the pH of a solution, the method comprising: - providing a solution comprising a compound capable of undergoing a change in its oxidation state and / or structural conformation depending on the pH of the solution; - applying the solution to a two-electrode or three-electrode electrochemical cell; - measuring the electrochemical response of the electrochemical cell; - Quantifying the pH of the solution as a function of the electrochemical response of the electrochemical cell.

[0047] According to another aspect of the present invention there is provided a method for measuring pH of a solution, the method comprising: - providing a solution comprising a quinone, a quinone derivative, and / or a pH indicator; - applying the solution to a three-electrode electrochemical cell; - measuring the electrochemical response of the electrochemical cell; - Quantifying the pH of the solution as a function of the electrochemical response of the electrochemical cell.

[0048] In one embodiment, the solution comprises a plurality of compounds that can undergo a change in their oxidation state and / or structural conformation depending on the pH of the solution. That is, the solution can comprise a plurality of structurally different compounds, e.g., two or more compounds, e.g., 3, 4, 5, 6, 7, 8, 9, or 10 or more compounds, that can undergo a change in their oxidation state and / or structural conformation depending on the pH of the solution.

[0049] In another embodiment, the compound capable of undergoing a change in its oxidation state and / or structural conformation depending on the pH of the solution is catechol, a catechol derivative and / or a compound containing a catechol group.

[0050] In another embodiment, the compound capable of undergoing a change in its oxidation state and / or structural conformation depending on the pH of the solution is a quinone, a quinone derivative, a pH indicator, or a combination thereof.

[0051] In a further embodiment, the compound capable of undergoing a change in its oxidation state and / or structural conformation depending on the pH of the solution is a quinone or a quinone derivative selected from the list consisting of 1,2-benzoquinone, 1,4-benzoquinone, 1,4-naphthoquinone, 9,10-anthraquinone, and derivatives thereof, and combinations thereof.

[0052] In another embodiment, the compound capable of undergoing a change in its oxidation state and / or structural conformation depending on the pH of the solution is malachite green oxalate, brilliant green, eosin yellow, erythrosin B, methyl green, methyl violet, picric acid, cresol red, crystal violet, m-cresol purple, thymol blue, p-xylenol blue, eosin (blue), quinaldine red, 2,4-dinitrophenol, 4-(dimethylamino)azobenzole, bromochlorophenol blue, bromophenol blue, Congo red, methyl orange, bromocresol green, 2, The pH indicator is selected from the list consisting of 5-dinitrophenol, alizarin sulfonic acid, methyl red, chlorophenol red, litmus, bromocresol purple, bromophenol red, 4-nitrophenol, bromoxylenol blue, bromothymol blue, phenol red, 3-nitrophenol, neutral red, cresol red, 1-naphtholphthalein, m-cresol purple, thymol blue, p-xylenol blue, phenolphthalein, thymolphthalein, alkaline blue, alizarin yellow GG, indigo carmine, epsilon blue, titanium yellow, and combinations thereof. In one embodiment, the solution comprises at least two of the compounds listed in this paragraph, e.g., at least three, four, or five of the compounds listed in this paragraph.

[0053] In one embodiment of the present disclosure, two or more compounds are provided in the same aqueous solution, where the compounds are catechol, catechol derivatives, compounds containing a catechol group, quinones, quinone derivatives or pH indicators. Thus, the measurement and quantification of pH can be performed over a larger pH scale, such as pH 5-8, such as pH 4-8, such as pH 3-8, such as pH 3-9, such as pH 4-9, such as pH 5-9, such as pH 6-9, over the entire pH range, etc.

[0054] In one embodiment of the present disclosure, the three-electrode electrochemical cell does not include a quinhydrone electrode. In fact, a quinhydrone electrode cannot effectively measure the pH of a solution where the test solution itself causes changes in open circuit potential (OCP) over time due to biochemical or chemical reactions. Furthermore, a quinhydrone electrode is subject to salt errors. The function of a quinhydrone electrode can be impaired by the presence of oxidizing and reducing agents, and the quinhydrone electrode is poisoned by traces of metals such as copper, silver, and other metals below antimony in the electromotive series, which may also interfere with pH measurements if complexing agents are present in the solution being analyzed.

[0055] More importantly, quinhydrone electrodes are not suitable for use in three-electrode electrochemical cells because three-electrode electrochemical cells cannot electrochemically analyze (e.g., distinguish) quinhydrone from its aqueous dissociation products. Thus, quinhydrone electrodes are not suitable for use in the methods and systems disclosed herein.

[0056] Thus, in one embodiment of the present disclosure, the quinone, quinone derivative, and / or pH indicator is not a quinhydrone.

[0057] The use of catechol, catechol derivatives, and / or compounds containing catechol groups, such as quinones or quinone derivatives, such as any one of the specific compounds listed, such as phenol red, provides several advantages in quantifying the pH of a solution. One advantage is high resolution in pH measurement, particularly compared to quantifying pH with a standard pH meter that measures hydrogen ion activity in an aqueous solution. This is due to the rich redox chemistry that characterizes catechol, catechol derivatives, and / or compounds containing catechol groups, such as quinones or quinone derivatives (such as any one of the specific compounds listed, such as phenol red), as provided in detail in Example 3 of the present disclosure.

[0058] Thus, the methods and systems disclosed in the present disclosure provide accurate and instantaneous pH measurements as the response time of the pH measurement does not depend on the diffusion of ions, e.g., protons, through a semipermeable or adsorbent membrane, but is instead based on the measurement of an electrochemical response that correlates with the electrochemical state of catechol, catechol derivatives and / or compounds containing a catechol group, such as quinones or quinone derivatives, or a pH indicator.

[0059] In a further embodiment, the compound capable of undergoing a change in its oxidation state and / or structural conformation depending on the pH of the solution is phenol red.

[0060] In another embodiment, the compound that can undergo a change in its oxidation state and / or structural conformation depending on the pH of the solution is a weak acid, e.g., a weak acid having a pKa of about 2 to about 14, such as a pKa of about 4 to about 12, e.g., a pKa of about 6 to about 10.

[0061] In one embodiment, the compound capable of undergoing a change in its oxidation state and / or structural conformation depending on the pH of the solution is dissolved in the solution, i.e., the compound capable of undergoing a change in its oxidation state and / or structural conformation depending on the pH of the sample solution is not bound, in particular is not irreversibly bound, either chemically or by any physical means, to any of the electrodes of the two-electrode or three-electrode chemical cell.

[0062] In another embodiment, the solution is an aqueous solution. In particular, the solution is an aqueous solution that contains at least 90% water by volume, such as at least 91, 92, 93, 94, 95, 96, 97, 98 or 99% water by volume. For example, the solution is an aqueous solution that contains more than 99% water by volume.

[0063] In one embodiment, the potential of a two-electrode or three-electrode electrochemical cell is measured by potentiodynamic electrochemistry, such as cyclic square wave voltammetry, square wave voltammetry, linear potential sweep voltammetry, cyclic voltammetry, or open circuit potentiometry.

[0064] In a further embodiment, the electrochemical cell is a two-electrode chemical cell and the potential of the cell is measured by open circuit potentiometry.

[0065] In one embodiment, the electrochemical cell is a three-electrode chemical cell and the potential of the cell is measured by cyclic square wave voltammetry, square wave voltammetry, linear potential sweep voltammetry, or cyclic voltammetry.

[0066] In another embodiment, the square wave voltammetry step is performed with a scan range of about -2 to about 2 V vs. Ag / AgCl, about -1 to about 1 V vs. Ag / AgCl, for example about -0.6 to about 0.6 V vs. Ag / AgCl.

[0067] In a further embodiment, the square wave voltammetry step is carried out at a frequency of about 1 to about 50 Hz, such as, for example, about 5 to about 20 Hz.

[0068] In one embodiment, the square wave voltammetry step is carried out with a potential step of about 1 to about 20 mV, for example, about 1 to about 10 mV.

[0069] In another embodiment, the square wave voltammetry step is carried out at an amplitude of about 1 to about 50 mV, such as about 1 to about 25 mV, for example about 5 to about 20 mV.

[0070] In a further embodiment, the concentration of the compound capable of undergoing a change in its oxidation state and / or structural conformation depending on the pH of the solution in the solution is from about 1 μM to about 1000 μM, such as from about 1 μM to about 500 μM, for example, from about 5 μM to about 250 μM, in particular from about 50 μM to about 200 μM, such as from about 50 μM to about 150 μM, for example, from about 50 μM to about 100 μM.

[0071] In one embodiment, quantifying the pH of the solution as a function of the electrochemical response of the electrochemical cell is performed through application of a regression algorithm, such as a linear regression algorithm, which linearly correlates pH with the corresponding redox potential and current, without wishing to be bound by theory.

[0072] In another embodiment, the solution comprises a buffer.

[0073] In one embodiment, the buffer contains trisaminomethane in an amount of 20 to 450 μM.

[0074] In a further embodiment, the buffer comprises (NH4)2SO4 in an amount of 5-20 mM.

[0075] In another embodiment, the buffer comprises KCl in an amount of 25 to 100 mM.

[0076] In one embodiment, the buffer contains MgSO4 in an amount of 5-20 mM.

[0077] In one embodiment, the buffer comprises deoxynucleoside triphosphates in an amount of 1-5 mM.

[0078] In another embodiment, the buffer contains tween-20 in an amount of 0.05-1% v / v.

[0079] Another aspect of the present disclosure relates to the use of quinones, quinone derivatives, and / or pH indicators to quantify the pH of a solution, wherein the solution is in an electrochemical cell; The pH is quantified by measuring the electrochemical response in an electrochemical cell.

[0080] Methods for quantifying a target polynucleotide The method of the first aspect of the present invention may also include a step of providing a sample, as further defined below. In one embodiment, the sample is provided in a solution. That is, the solution may contain the sample. The sample may be any sample. In a preferred embodiment, the sample is a biological sample. A non-limiting example herein is a body fluid sample or a tissue sample, as further defined below.

[0081] It is envisaged that the sample may or may not contain target polynucleotide / target nucleic acid.Accordingly, in an embodiment of the first aspect of the present invention, the method allows to determine the presence of target polynucleotide in solution.That is, the method allows to measure the pH of the solution, thereby allowing to determine whether target polynucleotide is present in the solution.

[0082] In one embodiment, the solution further comprises primers and nucleic acid amplification reagents, preferably the nucleic acid amplification reagents are LAMP reagents.

[0083] In further embodiments, the nucleic acid amplification reagents include a signaling agent, or are capable of releasing a signaling agent, or include both a signaling agent and an agent capable of releasing a signaling agent.

[0084] In another embodiment, the signaling agent is H + and / or H3O + It is.

[0085] In another embodiment, the LAMP reagent comprises a reverse transcriptase.

[0086] In a further embodiment, the primers comprise a forward inner primer, a backward inner primer, a forward outer primer and a backward outer primer.

[0087] In one embodiment, LAMP amplification is performed with an additional pair of loop primers, such as a forward loop primer and / or a backward loop primer.

[0088] In one embodiment, FIP / BIP is present in solution in an amount of 1.6 μM, F3 / B3 is present in an amount of 0.2 μM, and Loop F / B is present in an amount of 0.4 μM.

[0089] In one embodiment, the Bst DNA polymerase is present in the solution in an amount of 0.32 U / μL and the reverse transcriptase is present in an amount of 0.3 U / μL.

[0090] In one embodiment, the method includes performing a nucleic acid amplification step (e.g., an isothermal nucleic acid amplification step), preferably a plurality of nucleic acid amplification steps. The nucleic acid amplification step(s) is advantageously performed after the solution is applied to a two-electrode or three-electrode electrochemical cell. In a further embodiment, the steps of performing nucleic acid amplification, measuring the electrochemical response of the electrochemical cell, and quantifying the pH of the solution in response to the electrochemical response of the electrochemical cell can be performed sequentially in this or other order, or simultaneously, or these steps can be performed simultaneously and consecutively.

[0091] It is envisaged that any nucleic acid amplification step / protocol / method may be used in the method of the first aspect of the invention, which may be selected from the list consisting of polymerase chain reaction (PCR) (such as nested (n), quantitative (q) or real-time reverse transcriptase (RT) PCR), LAMP as defined elsewhere herein, rolling circle amplification, and quantitative nucleic acid sequence-based amplification (QT-NASBA).

[0092] In certain embodiments, the nucleic acid amplification step / protocol / method is isothermal, e.g., the nucleic acid amplification is isothermal and carried out at a temperature in the range of 40-80°C, e.g., 50-70°C, e.g., 57-65°C.

[0093] In one embodiment, the nucleic acid isothermal amplification step is a LAMP step or a rolling circle amplification step.

[0094] In a further embodiment, the nucleic acid amplification step(s) is a LAMP step. For the avoidance of doubt, if only one nucleic acid amplification step is performed, in this embodiment only one LAMP step is performed. However, if multiple nucleic acid amplification steps are envisaged, multiple LAMP steps are performed.

[0095] In one embodiment, the method is for quantifying the amount of a target polynucleotide in a solution or in a sample provided in a solution.

[0096] In another embodiment, the step of measuring the electrochemical response of the electrochemical cell comprises measuring a change in current and / or impedance and / or potential of the electrochemical cell due to a change in concentration of the signaling agent.

[0097] In a further embodiment, the method comprises deriving the rate of amplification of the nucleic acid from the rate of change of the electrochemical response (eg, current and / or impedance and / or potential) of a two-electrode or three-electrode electrochemical cell.

[0098] In one embodiment, the step of deriving the amplification rate of the nucleic acid is performed simultaneously with the step of measuring the electrochemical response of a two-electrode or three-electrode electrochemical cell.

[0099] In a further embodiment, the nucleic acid amplification step comprises: +The signaling agent is produced or consumed, such as a signaling agent, which is based on the condition that the nucleic acid / polynucleotide is present in the solution in the first place. The signaling agent is produced or consumed, causing a change in the concentration of the signaling agent, which results in a change in the current and / or potential and / or impedance of the electrochemical cell. As a result of the change in the current and / or potential and / or impedance of the electrochemical cell, the quantified pH value also changes, and from this pH change the amplification factor of the nucleic acid / target polynucleotide can be derived. For the avoidance of doubt, a step of deriving an amplification factor is not required to determine whether the target polynucleotide is present in the solution, as any detectable change in the current and / or potential and / or impedance of the electrochemical cell, and then the quantified pH change, indicates the presence of the polynucleotide.

[0100] Thus, a first particular aspect of the present invention provides a method for measuring the pH of a solution and for determining the presence of a target polynucleotide in the solution, the method comprising: a. providing a solution containing a compound capable of undergoing a change in its oxidation state or structural conformation depending on the pH of the solution, and a sample; b. applying the solution to a two-electrode or three-electrode electrochemical cell; c. performing at least one or more nucleic acid amplification steps, where if the target polynucleotide is present, the nucleic acid amplification(s) produces or consumes a signal transduction agent; d. measuring an electrochemical response of the electrochemical cell, such as a change in current, and / or potential, and / or impedance of the electrochemical cell, in response to a change in concentration of the signal transduction substance; e. Quantifying the pH of the solution and / or the change in pH of the solution as a function of the electrochemical response of the electrochemical cell; f. Optionally, deriving an amplification rate of the target polynucleotide in the sample, if present, from the rate of change of the electrochemical response of the electrochemical cell, thereby quantifying the amount of the target polynucleotide in the sample.

[0101] Thus, a first particular aspect of the present invention provides a method for measuring the pH of a solution and for determining the presence of a target polynucleotide in the solution, the method comprising: a. providing a quinone, a quinone derivative, and / or a pH indicator; b. applying the solution to a three-electrode electrochemical cell; c. performing at least one or more nucleic acid amplification steps, where if the target polynucleotide is present, the nucleic acid amplification(s) produces or consumes a signal transduction agent; d. measuring an electrochemical response of the electrochemical cell, such as a change in current, and / or potential, and / or impedance of the electrochemical cell, in response to a change in concentration of the signal transduction substance; e. Quantifying the pH of the solution and / or the change in pH of the solution as a function of the electrochemical response of the electrochemical cell; f. Optionally, deriving an amplification rate of the target polynucleotide in the sample, if present, from the rate of change of the electrochemical response of the electrochemical cell, thereby quantifying the amount of the target polynucleotide in the sample.

[0102] Steps c, d, e and f of the above paragraph may be performed separately, either sequentially in the order specified or in another order, or may be performed simultaneously, e.g., simultaneously and consecutively.

[0103] For the avoidance of doubt, it is not envisaged that the present invention is limited to whether or not a target polynucleotide is originally present in the sample, i.e., the nucleic acid amplification step can be carried out in a solution containing a sample that does not contain a target polynucleotide, and in this scenario, this will result in zero or at least an undetectable change in the electrochemical response (e.g., current and / or potential and / or impedance of an electrochemical cell), thereby resulting in a negative result for the target polynucleotide.

[0104] Target Polynucleotide Target polynucleotide can be any polynucleotide sequence.Target polynucleotide can be specifically a viral or bacterial polynucleotide.Ideally, target polynucleotide is a stretch of DNA that is unique to a type of virus or a species and strand of a bacterial virus, and at the same time, is evolutionarily conserved enough to be stable in the genome of a particular virus or a bacterial virus.

[0105] In one embodiment, the virus is selected from the group consisting of a dsDNA virus, a ssDNA virus, a dsRNA virus, a (+)ssRNA viral RNA, a (-)ssRNA viral RNA, a ssRNA-RT viral RNA, and a dsDNA-RT viral DNA.

[0106] In a preferred embodiment, the virus is a (+)ssRNA viral RNA.

[0107] In one embodiment, the polynucleotide can be any polynucleotide present in an influenza A virus, an influenza B virus, a Zika virus, a SARS-CoV virus, or a MERS-CoV virus.

[0108] In one embodiment, the polynucleotide can be any polynucleotide present in a coronavirus.

[0109] In one embodiment, the target polynucleotide can be any polynucleotide present in a coronavirus, such as SARS-CoV-2 RNA.

[0110] In one embodiment, the target polynucleotide sequence is the sequence of SEQ ID NO:1 or SEQ ID NO:2.

[0111] In one embodiment, the target polynucleotide sequence comprises 70.0%, 71.0%, 72.0%, 73.0%, 74.0%, 75.0%, 76.0%, 77.0%, 78.0%, 79.0%, 80.0%, 81.0%, 82.0%, 83.0%, 84.0%, 85.0%, 86.0%, 87.0%, 88.0%, 89.0%, 90.0%, 91.0%, 92.0%, 93.0%, 94.0%, 95.0%, 96.0%, 97.0%, 98.0%, 99.0%, and 100.0% homology or sequence identity to SEQ ID NO:1 or SEQ ID NO:2.

[0112] The percent sequence identity (or homology) between two polypeptides can be determined using a suitable computer program, for example, the GAP program of the University of Wisconsin Genetic Computing Group, and it is understood that the percent identity is calculated with respect to the polypeptide whose sequence is optimally aligned.Alternatively, alignment can be performed using the Clustal W program (Thompson et al., (1994) Nucleic Acids Res 22, 4673-80).The parameters used can be as follows: fast pairwise alignment parameters: K-tuple (word) size; 1, window size; 5, gap penalty; 3, number of superdiagonals; 5.Scoring method: x percent.

[0113] Multiple alignment parameters: gap open penalty; 10, gap extension penalty; 0.05. Scoring matrix:BLOSUM.

[0114] sample In the second aspect of the present invention, the method comprises providing a sample. The sample can be any sample. In a preferred embodiment, the sample is a biological sample. The limiting examples herein are a body fluid sample or a tissue sample.

[0115] In an even more preferred embodiment, the sample comprises human, animal, plant, bacterial, fungal, or protozoan cells.

[0116] In the first aspect of the present invention, the method may also include a step of providing a sample. In one embodiment, the sample is provided in a solution. That is, the solution may contain the sample. The sample may be any sample. In a preferred embodiment, the sample is a biological sample. A limiting example herein is a body fluid sample or a tissue sample.

[0117] The sample may comprise target polynucleotide as defined above.Specifically, target polynucleotide may be any polynucleotide / nucleic acid sequence.The target polynucleotide in the sample may be specifically a virus or bacterial polynucleotide.The target polynucleotide in the sample is a stretch of DNA that is unique to a type of virus or a species and strand of bacteria, and at the same time, is evolutionarily conserved enough to be stable in the genome of a particular virus or bacteria.

[0118] In one embodiment, the sample may be an isolated DNA sample, an isolated RNA sample, a crude DNA extracted sample or a crude RNA extracted sample.

[0119] In one embodiment, the sample is a nasal sample, a throat sample, anal sample, a vaginal sample, an ear drainage sample, a skin surface swab sample, a urine sample, a whole blood sample, a serum sample, a plasma sample or a lymphatic drainage sample.

[0120] In another embodiment, the sample is a tissue sample. The tissue sample can be any tissue sample, such as an epithelial tissue sample, a connective tissue sample, a muscle tissue sample and / or a nerve tissue sample.

[0121] The method may further include one step of preparing the sample before applying it to the electrochemical device / two-electrode or three-electrode electrochemical cell. The sample may be prepared by any suitable method. An example of these is described in Example 1 below.

[0122] In general, the sample can be mixed with any suitable medium. Those skilled in the art will know the suitable medium for a particular sample. The medium can be a transport medium. The sample and transport medium can be added directly to the electrochemical device or can be heated at any suitable temperature for a suitable time before applying the sample and medium.

[0123] In one embodiment, the sample is inoculated into a transport medium. The transport medium can be any suitable medium for transporting the target polynucleotide sequence. In a preferred embodiment, the transport medium is a viral transport medium.

[0124] In another embodiment, the sample is mixed with an anticoagulant such as heparin, EDTA or sodium citrate.

[0125] The sample may be optionally mixed with a medium and lysed, for example, by mechanical lysis, thermal lysis, acoustic cavitation, osmotic shock, enzymatic lysis or chemical lysis.

[0126] In one embodiment, the sample is mixed with at least four primers and LAMP reagents before being applied to the electrochemical device.

[0127] In one embodiment the sample is heated to between 60 and 100°C, such as between 65 and 95°C, such as between 70 and 90°C, such as between 75 and 85°C.

[0128] In one embodiment the sample is heated for at least 1 minute, such as at least 2 minutes, such as at least 5 minutes.

[0129] In one embodiment, the method of the present invention is capable of detecting whether a target polynucleotide is present in a sample.

[0130] In another embodiment, the methods of the present invention are capable of quantifying the amount of a target polynucleotide in a sample.

[0131] Electrolytic Devices In a first aspect of the invention, the method comprises the step of adding the solution to a two-electrode or three-electrode electrochemical cell.

[0132] In a second aspect of the invention, the method includes providing an electrochemical device including an electrochemical cell having a plurality of film electrodes.

[0133] In both aspects of the present invention, the electrochemical device / two-electrode or three-electrode electrochemical cell may be a planar device with film electrodes arranged in a single layer. This allows the film electrodes to be patterned on a planar substrate with a thickness of less than 2 mm, such as by screen printing or thick film techniques. Screen-printed electrodes (SPEs) are commonly used to form low-cost disposable sensors and biosensors. The electrodes of such sensors can be manufactured in a variety of shapes and dimensions depending on the analytical needs, using a variety of conductive inks. In addition to manufacturing, these platforms are suitable for customization with a variety of materials, such as nanomaterials and bioelements. Thus, in one embodiment of the present disclosure, the electrodes are screen-printed electrodes, preferably printed on a planar substrate of an inert material.

[0134] In one embodiment of the present disclosure, the electrodes of the three-electrode electrochemical cell are wire electrodes.

[0135] Preferably, the area of ​​the electrochemical device / two-electrode or three-electrode electrochemical cell is 500 mm 2 and even more preferably less than 300 mm 2The dimensions of the electrochemical device / two-electrode or three-electrode electrochemical cell are less than 1 mm, making the electrochemical device / two-electrode or three-electrode electrochemical cell portable and suitable for point-of-care environments. The electrodes of the electrochemical device / two-electrode or three-electrode electrochemical cell can extend towards the edge of the planar substrate, thereby forming edge connections for electrical connection to a measurement setup such as a potentiostat. The potentiostat itself can be a portable potentiostat, such as a handheld potentiostat.

[0136] The electrochemical device in the second aspect of the invention may include a plurality of film electrodes, for example a working electrode, a reference electrode and a counter electrode, the electrodes preferably forming part of a three-electrode system, such as an electrochemical three-electrode system.

[0137] The working electrode in a three-electrode system is typically the electrode at which the redox process of interest occurs, and therefore the focus of an electroanalytical measurement is typically on the specific electrochemical reaction occurring at the working electrode.

[0138] A reference electrode typically has a stable and well-known thermodynamic potential. High stability of a reference electrode is usually achieved by employing a redox system that has a constant (buffer or saturation) concentration of the ions or molecules involved in the redox half-reaction. When used as part of a three-electrode system, no current passes through the reference electrode.

[0139] A counter electrode, also called an auxiliary electrode, is typically used in electrochemical systems to complete an electrical circuit with the working electrode. While the redox process of interest typically occurs at the working electrode, the counter electrode may act as a source or reservoir of current so as not to limit the electrochemical reaction at the working electrode.

[0140] The electrodes of the electrochemical device / two-electrode or three-electrode electrochemical cell can be made of suitable materials such as gold, silver, carbon, platinum, ruthenium dioxide, or combinations thereof. The material of the electrodes can be selected individually, whereby the material of multiple electrodes, such as each electrode, can be different. Alternatively, the electrodes can be provided with the same material. However, to provide simplicity, stability, and the ability for miniaturization, it may be preferred that the material of the reference electrode and the counter electrode is Ag / AgCl. In another embodiment of the present disclosure, the material of the electrodes can be the same.

[0141] Additionally, any or all of the electrodes may include an ion-selective membrane, and such electrodes may be referred to as ion-selective electrodes. The membrane may be used to convert the activity of a particular ion dissolved in the sample into an electric potential. The membrane may cover at least a portion of the electrode and may be positioned to form an interface with the solution during measurement. The membrane is preferably a glass membrane, typically an ion-exchange type glass (silicate or chalcogenide). Alternatively, the membrane may be a crystal membrane, an ion-exchange resin membrane, or an enzyme membrane.

[0142] Instead of, or in addition to, using an ion-selective membrane, the surface of either of the electrodes may be modified. For example, the surface of the working electrode may be chemically modified to allow the transfer of hydroxide OH - and / or hydronium H3O + In one embodiment of the present disclosure, either surface of the electrode may include a pH-sensitive layer of a solid-state membrane having a combination of cobalt oxide and iridium oxide. Preferably, the surface of the working electrode includes a pH-sensitive layer of a solid-state membrane having a combination of cobalt oxide and iridium oxide.

[0143] Further modifications of the electrode surface include chemical modification with ruthenium oxide, graphene platelets, exposed thiol groups, and / or exposed hydroxyl groups.

[0144] Preferably, the surface of any of the electrodes for forming contact with the sample / solution has any fixed concentration of chloride ions, such as for true reference electrode measurements, whereby any or all of the electrodes can include a surface with any fixed concentration of chloride ions.

[0145] In a preferred embodiment of the present disclosure, the material of the working electrode is carbon and the material of the counter and reference electrodes is Ag / AgCl.

[0146] The electrochemical device / two-electrode or three-electrode electrochemical cell can be formed by screen printing the electrodes onto a planar substrate. The electrodes may thereby be screen-printed electrodes, whereby the electrodes are in a single layer. The material of the planar substrate is preferably a chemically inert material, such as alumina, ceramic, glass, or inert plastic. The electrochemical device / two-electrode or three-electrode electrochemical cell preferably has a small form factor, making it portable and suitable for point-of-care measurements.

[0147] The electrochemical device / two-electrode or three-electrode electrochemical cell preferably comprises an inlet for receiving the solution to be analyzed. The inlet may be a microfluidic inlet and may further be connected to the electrochemical cell by a hydrophilic area. The hydrophilic area is ideally configured such that the solution provided to the microfluidic inlet is transported to the electrochemical cell by capillary action. Another means of storing and providing solutions to the electrochemical cell includes the use of microwells overlaid on the electrochemical cell. The microwells may be bonded to the electrochemical device and / or by lithography.

[0148] When a solution is delivered to an electrochemical cell, it may be advantageous to apply a vapor barrier to prevent evaporation of the solution. This may be particularly necessary during measurements of longer duration, such as at least several minutes. The vapor barrier may be formed by fluidically sealing the inlet of the electrochemical device or microwell with a physical lid, a heated lid, mineral oil, and / or paraffin wax. The vapor barrier thereby acts to form a fluid-tight device containing the solution.

[0149] In one embodiment of the present disclosure, the electrochemical device may include primers and LAMP reagents, in other words, the primers and LAMP reagents may be pre-loaded into the device prior to loading of the sample / solution.

[0150] In one aspect of the present disclosure, a system for measuring pH of a solution is provided, the system comprising: a. An apparatus including a potentiostat; and iii. a first container containing a three-electrode electrochemical cell and a second container containing a quinone, a quinone derivative, and / or a pH indicator; or iv. a three-electrode electrochemical cell and a first container containing a quinone, a quinone derivative, and / or a pH indicator; The potentiostat is configured to measure the electrochemical response of the electrochemical cell.

[0151] In one embodiment, the quinone, quinone derivative, and / or pH indicator of the system disclosed herein are dissolved in an aqueous solution in the first or second container.

[0152] In one embodiment, the quinone, quinone derivative, and / or pH indicator of the system disclosed herein are dissolved in an aqueous solution in a first container, which also contains at least two primers configured to flank a target sequence and a nucleic acid amplification reaction system, such as LAMP reagents.

[0153] In one embodiment, the quinone, quinone derivative, and / or pH indicator of the system disclosed herein is dissolved in an aqueous solution in the second container, and the first container contains another aqueous solution. Thus, prior to measuring the pH of the aqueous solution in the first container, a suitable amount of the aqueous solution containing the quinone, quinone derivative, and / or pH indicator is transferred to the first container.

[0154] In one embodiment, the potentiostat is configured to measure the electrochemical response of the electrochemical cell.

[0155] In one embodiment, the potentiostat is configured to measure an electrochemical response, the electrochemical response representative of an oxidation state of the quinone, quinone derivative, and / or pH indicator in the first container.

[0156] In one embodiment, the system further comprises a heating unit configured to heat the first and / or second container, such as to a temperature in the range of 59°C to 75°C.

[0157] In one embodiment, a first container contains at least two or at least four primers configured to flank a target polynucleotide sequence and a nucleic acid amplification reaction system, such as LAMP reagents.

[0158] In one embodiment, the first container comprises a microfluidic inlet for receiving a solution and / or a sample.

[0159] In one embodiment, the first and / or second container are replaced with a new first and / or second container after each use.

[0160] In one embodiment, the microfluidic inlet is connected to the electrochemical cell by a hydrophilic region, such as a porous / fibrous structure or a hydrophilic channel configured to transport the sample by capillary action.

[0161] In one embodiment, the first container and / or the second container is an Eppendorf tube, a microwell, or a culture flask.

[0162] In one embodiment, the electrodes in the system of the present disclosure are as defined herein.

[0163] LAMP amplification The method of the second aspect of the present invention comprises performing a plurality of LAMP amplifications, each of which comprises a sample (e.g., provided and / or prepared as described in the "Sample" section above) to amplify a target polynucleotide sequence. Each LAMP amplification comprises at least four primers, each set flanking the target sequence and the LAMP reagents. The LAMP amplifications are performed under isothermal conditions.

[0164] In an embodiment of the first aspect of the present invention, the method may also include performing a LAMP amplification or a plurality of LAMP amplifications, each of which includes a sample (e.g., provided and / or prepared as described in the "Sample" section above) to amplify a target polynucleotide sequence. Each LAMP amplification includes at least four primers, each set flanking the target sequence and the LAMP reagent. The LAMP amplification may be performed under isothermal conditions.

[0165] The entire LAMP amplification can be prepared in a number of different ways. Any LAMP amplification known to those skilled in the art may be used with the present invention.

[0166] A non-limiting example of LAMP amplification is described here: FIP anneals to the F2c region on the antisense nucleotide strand of the target DNA. DNA synthesis is initiated by the polymerase, which displaces and releases the DNA strand. Thus, the polymerase synthesizes a strand complementary to the target DNA sequence. F3 then anneals to the F3c region on this antisense strand, initiating a new round of DNA synthesis by the polymerase. F3-mediated displacement of the antisense strand forms a stem-loop structure connected by the complementary F1c and F1 regions. BIP then anneals to the DNA strand, and complementary DNA is synthesized by the polymerase. Thus, the DNA is converted from a loop to a double-stranded linear structure. The DNA strands separate, forming a dumbbell-like structure with two stem-loops, one at each end of the strand. This structure serves as the starting point for the amplification cycle. This structure is then converted to a stem-loop via self-priming DNA synthesis. FIP anneals to the single-stranded region in the stem loop and initiates synthesis. This releases the complementary strand, which forms a new dumbbell-like structure by complementarity with the B1c-B1 and F1-F1c regions, respectively. Starting from the 3' end of the B1 region, DNA synthesis initiates. This releases the FIP-linked complementary strand, which forms yet another double stem loop structure by complementarity with the F1-F1c and B1c-B1 regions, respectively. Self-priming DNA synthesis then initiates from the 3' end of the B1 region. This process produces an amplification structure consisting of alternating inverted repeats of the target sequence.

[0167] The sample may be mixed with the primers and LAMP reagents prior to applying the sample to the electrochemical device.

[0168] In contrast to conventional PCR amplification, LAMP amplification is carried out using isothermal conditions. In one embodiment, LAMP amplification may be carried out at a constant temperature of 59-75°C, such as 62-73°C, such as 64-70°C, such as 66-68°C.

[0169] LAMP Reagents Both the first and second aspects of the method of the present invention involve performing several LAMP amplifications. A LAMP amplification generally includes a sample, at least four primers flanking a target sequence, and a LAMP reagent. The LAMP reagent can be any of the LAMP reagents described in this section of the specification.

[0170] The LAMP reagent comprises at least nucleotides and a nucleic acid polymerase. The nucleotides may be deoxyribonucleotide triphosphate molecules, and preferably the LAMP reagent comprises at least dATP, dCTP, dGTP and dTTP. In some cases, the LAMP reagent also comprises dUTP. The LAMP reagent also comprises a signaling agent such as H+ ions and / or a fluorescent dye.

[0171] The nucleic acid polymerase can be any enzyme that can catalyze the template-dependent polymerization, i.e., replication, of nucleotides. The nucleic acid polymerase must be tolerant to the temperatures used in LAMP amplification and must have catalytic activity at the extension temperature. Several thermostable nucleic acid polymerases are known to those skilled in the art.

[0172] In some embodiments of both aspects of the invention, the nucleic acid polymerase has high strand displacement activity in addition to replication activity.

[0173] The nucleic acid polymerase may be a bacterial or archaeal polymerase. Specifically, the nucleic acid polymerase may be E. coli DNA polymerase I. The nucleic acid polymerase may be Taq DNA polymerase with strand dependent DNA synthesis replacing 5'-3' exonuclease activity. Other polymerases include, but are not limited to, Taq, Tfi, Tzi, Tth, Pwo, Pfu, Q5®, Phusion®, One Taq®, Vent®, Deep Vent®, Klenow (exo-), Bst2.0 and Bst3.0 (New England Biolabs, Ipswich, Mass.), PyroPhage® (Lucigen, Middleton, Wis.), Tin DNA polymerase, GspSSD LF DNA polymerase, Rsp (OptiGene, Horsham, UK) and phi29 polymerase.

[0174] For example, Taq DNA polymerase obtained from New England Biolabs can include Crimon LongAmp® Taq DNA polymerase, Crimson Taq DNA polymerase, Hemo KlenTaq™, or LongAmp® Taq.

[0175] The LAMP reagents may include reverse transcriptase (RT). RT is an enzyme that can generate complementary DNA (cDNA) from an RNA template, thus allowing the measurement of RNA. In one embodiment, the LAMP reagents include reverse transcriptase.

[0176] Furthermore, the LAMP reagent may include a salt, a buffer, and a detection means. The buffer may be any useful buffer, such as TRIS. The salt may be any useful salt, such as potassium chloride, magnesium chloride, or magnesium acetate or magnesium sulfate.

[0177] LAMP reagents may contain non-specific blocking agents such as BSA, gelatin from bovine skin, beta-lactoglobulin, casein, dry milk, salmon sperm DNA or other common blocking agents.

[0178] LAMP reagents may also include biological preservatives (e.g., NaN3), LAMP enhancers (e.g., betaine, trehalose, etc.) and inhibitors (e.g., RNase inhibitors). Other additives may include dimethyl sulfoxide (DMSO), glycerol, betaine (mono)hydrate, trehalose, 7-deaza-2'-deoxyguanosine triphosphate (7-deaza-2'-dGTP), bovine serum albumin (BSA), formamide (methanamide), tetramethylammonium chloride (TMAC), other tetraalkylammonium derivatives [e.g., tetraethylammonium chloride (TEA-Cl)]; tetrapropylammonium chloride (TPrA-Cl) or non-ionic detergents such as TritonX-100, Tween20, Nonidet P-40 (NP-40) or PREXCEL-Q.

[0179] In addition, the LAMP reagent may also include one or more additional means for detecting the LAMP amplification product(s). The means may be any detectable means, which may be added as an individual compound or may even be associated with or covalently linked to one of the primers. Detectable means include, but are not limited to, dyes, radioactive compounds, bioluminescent and fluorescent compounds. In a preferred embodiment, the means for detection is one or more probes.

[0180] In one embodiment, LAMP amplification is performed using the WarmStart® LAMP Kit (DNA & RNA). The kit includes Bst 2.0 DNA polymerase, reverse transcriptase, a nucleotide mix, a visible pH indicator, and a low buffer. The kit further includes a fluorescent dye.

[0181] In another example, LAMP amplification is performed using WarmStart® Colorimetric LAMP2X Master Mix (DNA&RNA). This kit includes Bst2.0 DNA polymerase, reverse transcriptase, nucleotide mix, and buffer. The kit further includes a fluorescent dye.

[0182] Primers flanking the target sequence The method of the second aspect of the invention involves the use of at least four primers which flank the target sequence.

[0183] In an embodiment of the first aspect of the invention, the method also comprises the use of at least four primers that flank the target sequence.

[0184] The four primers are - Forward inner primer (also called FIP), - Backward inner primer (also called BIP), - forward outer primer (also called F3), - backward outer primer (also called B3).

[0185] In one embodiment, the FIP has the sequence of SEQ ID NO:3.

[0186] In one embodiment, the BIP has the sequence of SEQ ID NO:4.

[0187] In one embodiment, F3 has the sequence of SEQ ID NO:5.

[0188] In one embodiment, B3 has the sequence of SEQ ID NO:6.

[0189] The four primers anneal to different portions of the sense and antisense strands of the target polypeptide (see the definition of primer in the section "Definitions" herein).

[0190] The primers are capable of amplifying a target polynucleotide when added to the LAMP reagents under conditions that allow amplification of the target polynucleotide.

[0191] In a preferred embodiment, the at least four primers consist of BIP, FIP, F3, and B3.

[0192] In one embodiment, the LAMP amplification is performed with an additional pair of loop primers. In one embodiment, the LAMP amplification is performed with FL and BL primers.

[0193] In one embodiment, the FL primer has the sequence of SEQ ID NO:7.

[0194] In one embodiment, the BL primer has the sequence of SEQ ID NO:8.

[0195] In one embodiment of both aspects of the invention, the LAMP amplification is carried out using at least 5 primers, such as at least 6 primers, such as at least 7 primers.

[0196] In one embodiment, LAMP amplification is performed using BIP, FIP, F3, B3, FL and BL primers.

[0197] The length of the BIP, FIP, F3, B3, FL and BL primers may depend on the sequence of the target polynucleotide. For example, the length of the primers may be adjusted to achieve the desired activity at a particular temperature, such as in the range of 59-75°C. Thus, the length of the primers may be individually in the range of 10-100 nucleotides, for example, in the range of 10-50 nucleotides in length, for example, in the range of 15-20 nucleotides, for example, in the range of 15-25 nucleotides, for example, in the range of 15-30 nucleotides, for example, in the range of 15-40 nucleotides, for example, in the range of 15-45 nucleotides, for example, in the range of 15-50 nucleotides. The Tm of the primers is typically adjusted to the range of 59-75°C.

[0198] The primer concentration in the aqueous phase of the LAMP amplification can be, for example, in the range of 0.05 to 4.0 μM, for example, in the range of 0.1 to 3.0 μM, in the range of 0.2 to 2.0 μM, etc. A non-limiting example herein is 1.6 μM FIP, 1.6 μM BIP, 0.2 μM F3, 0.2 μM B3, 0.4 μM FL, 0.4 μM BL.

[0199] Generally, the primer comprises or even consists of an oligonucleotide. However, in some cases, the primer may comprise a nucleotide analogue. Numerous nucleotide analogues are known to those skilled in the art, including derivatives with modified sugars, such as 2'-O-methyl, 2'-deoxy-2'-fluoro, and 2',3'-dideoxynucleoside derivatives, nucleic acid analogues based on other sugar backbones, such as threose, locked nucleic acid (LNA), LNA derivatives, peptide nucleic acid (PNA), glycol nucleic acid (GNA), threose nucleic acid (TNA), bicyclo sugars, or hexose, glycerol and glycol sugars, nucleic acid analogues based on non-ionic backbones, or nucleic acids and their analogues with non-linear topologies, such as dendrimers, comb structures, and nanostructures.

[0200] The primers may also be linked to various tags (eg, fluorescent tags, functionalized tags or binding tags), which may optionally be attached to their termini, sugars, or nucleobases.

[0201] Primers can be prepared by a variety of methods, including, but not limited to, cloning appropriate sequences and direct chemical synthesis using methods well known in the art [Narang et al., Methods Enzymol. 68:90 (1979); Brown et al., Methods Enzymol. 68:109 (1979)]. Primers can also be obtained from commercial sources.

[0202] In one embodiment, primers can be designed to specifically amplify a target polynucleotide sequence.

[0203] Measurement of electrochemical properties of solutions The method of the second aspect of the invention comprises the step of measuring the change in current and / or potential of an electrochemical cell.

[0204] As outlined above, in one embodiment the method of the first aspect of the invention comprises measuring an electrochemical response of the electrochemical cell, such as a change in current and / or potential and / or impedance of the electrochemical cell.

[0205] The change is preferably a signaling entity from the nucleic acid amplification process, e.g., H + , e.g., LAMP amplification products or by-products (e.g., H + ) or the result of changes in physical quantities as a result of LAMP amplification. In particular, H + The change in results in a change in the oxidation state of the quinone, quinone derivative, and / or pH indicator dissolved in the electrochemical cell, which is measured as a change in the electrochemical response of the electrochemical cell. The measurement of the change in the electrochemical response (e.g., current and / or potential and / or impedance) of the electrochemical cell of the electrochemical device is preferably performed after contacting the electrochemical device / two-electrode or three-electrode electrochemical cell with a measurement setup to form an electrochemical system.

[0206] An electrochemical system typically includes a film electrode, a solution, and a separate current path, typically a potentiostat, such as an electrochemical device / two- or three-electrode electrochemical cell. Thus, an electrochemical system includes multiple film electrodes, such as working, counter, and reference electrodes, that are spatially separated and distributed throughout one or more ionically conductive media or electrolytes, while in electrical contact with each other via separate current paths (preferably including or consisting of a potentiostat).

[0207] Electrodes in electrochemical systems undergo oxidation and reduction reactions with the simultaneous movement of ions through the medium creating an overall balance of charge transfer in the system, and the movement of electrons generating an electrical current moving down a current path.

[0208] A potentiostat is an instrument designed to control electrodes in an electrochemical system, typically by adjusting the potential (or current) and measuring the effect on the subsequent current (or potential). This task is typically performed by a variety of internal circuitry, operational amplifiers, and feedback loops. External cables are commonly used to physically connect to each electrode, typically including the working electrode, counter electrode, and reference electrode.

[0209] The measurements may be carried out according to any electroanalytical method, such as, for example, open circuit potential, potentiometry, impedance measurement, coulometry, voltage measurement, and / or amperometry. Typically, the measurements of the solution are carried out over a period of 1 to 90 minutes, for example, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, 30 minutes, 31 minutes, 32 minutes, 33 minutes, 34 minutes, 35 minutes, 36 minutes, 37 minutes, 38 minutes, 39 minutes, 40 minutes, 41 minutes, 42 minutes, 43 minutes, 44 minutes, 45 minutes, 46 minutes, 47 minutes, 48 ​​minutes, 49 minutes, 50 minutes, 51 minutes, 52 minutes, 53 minutes, 54 minutes, 55 minutes, 56 minutes, 57 minutes, 58 minutes, 59 minutes, 60 minutes, 61 minutes, 62 minutes, 63 minutes, 64 minutes, 65 minutes, 66 minutes, 67 minutes, 68 minutes, 69 minutes, 70 minutes, 71 minutes, 72 minutes, 73 minutes, 74 minutes, 75 minutes, 76 minutes, 77 minutes, 78 minutes, 79 minutes, 80 minutes, 81 minutes, 82 minutes, 83 minutes, 84 minutes, 85 minutes, 86 minutes, 87 minutes, 88 minutes, 89 minutes, 90 minutes , 45 minutes, 46 minutes, 47 minutes, 48 ​​minutes, 49 minutes, 50 minutes, 51 minutes, 52 minutes, 53 minutes, 54 minutes, 55 minutes, 56 minutes, 57 minutes, 58 minutes, 59 minutes, 60 minutes, 61 minutes, 62 minutes, 63 minutes, 64 minutes, 65 minutes, 66 minutes, 67 minutes, 68 minutes, 69 minutes, 70 minutes, 71 minutes, 72 minutes, 73 minutes, 74 minutes, 75 minutes, 76 minutes, 77 minutes, 78 minutes, 79 minutes, 80 minutes, 81 minutes, 82 minutes, 83 minutes, 84 minutes, 85 minutes, 86 minutes, 87 minutes, 88 minutes, 89 minutes or 90 minutes.

[0210] In one embodiment, the measurement of the solution may take in the range of 1 to 45 minutes, such as 1 to 30 minutes, such as 1 to 15 minutes, such as 5 to 10 minutes.

[0211] Voltammetry is the study of current as a function of an applied potential. This produces a voltammogram I=f(E) curve. Typically in such measurements, the potential is varied arbitrarily, either stepwise or continuously, and the actual current value is measured as the dependent variable. The opposite is amperometry. The shape of the curve depends on the rate of potential change (nature of the driving force) and whether the solution is stirred or stationary (mass transfer).

[0212] For quantification, the analysis must consider kinetics in addition to thermodynamics due to the time component of voltammetry. Idealized theoretical electrochemical thermodynamic relationships, such as the Nernst equation, are modeled without a time component. While these models alone are insufficient to describe the dynamic aspects of voltammetry, models such as the Tafel equation and the Butler-Volmer equation provide the basis for modified voltammetric relationships that relate theory to observed results.

[0213] Specific embodiments of the first aspect of the invention

[0214] Particular embodiments of the first aspect of the invention are provided in the numbered paragraphs below.

[0215] X1. A method for measuring the pH of a solution, comprising: - providing a solution comprising a compound capable of undergoing a change in its oxidation state and / or structural conformation depending on the pH of the solution; - applying the solution to a two-electrode or three-electrode electrochemical cell; - measuring the electrochemical response of the electrochemical cell; - quantifying the pH of the solution in response to the electrochemical response of the electrochemical cell.

[0216] X2. The method of paragraph X1, wherein the compound capable of undergoing a change in its oxidation state and / or structural conformation depending on the pH of the solution is catechol, a catechol derivative and / or a compound containing a catechol group.

[0217] X3. The method of any of the preceding paragraphs, wherein the compound capable of undergoing a change in its oxidation state and / or structural conformation depending on the pH of the solution is a quinone, a quinone derivative, a pH indicator, or a combination thereof.

[0218] X4. The method of any of the preceding paragraphs, wherein the compound is a quinone or a quinone derivative selected from the list consisting of 1,2-benzoquinone, 1,4-benzoquinone, 1,4-naphthoquinone, 9,10-anthraquinone, and derivatives thereof, and combinations thereof.

[0219] X5. Compounds that can undergo a change in their oxidation state and / or structural conformation depending on the pH of the solution are: Malachite green oxalate, Brilliant green, Eosin yellow, Erythrosin B, Methyl green, Methyl violet, Picric acid, Cresol red, Crystal violet, m-Cresol purple, Thymol blue, p-Xylenol blue, Eosin (blue), Quinaldine red, 2,4-dinitrophenol, 4-(dimethylamino)azobenzole, Bromochlorophenol blue, Bromophenol blue, Congo red, Methyl orange, Bromocresol green, 2,5-dinitrophenol, The method of any of the preceding paragraphs, wherein the pH indicator is selected from the list consisting of alizarin sulfonic acid, methyl red, chlorophenol red, litmus, bromocresol purple, bromophenol red, 4-nitrophenol, bromoxylenol blue, bromothymol blue, phenol red, 3-nitrophenol, neutral red, cresol red, 1-naphtholphthalein, m-cresol purple, thymol blue, p-xylenol blue, phenolphthalein, thymolphthalein, alkaline blue, alizarin yellow GG, indigo carmine, epsilon blue, titanium yellow, and combinations thereof.

[0220] X6. The method of any of the preceding paragraphs, wherein a compound capable of undergoing a change in its oxidation state and / or structural conformation depending on the pH of the solution is dissolved in the solution.

[0221] X7. The method of any of the preceding paragraphs, wherein the electrochemical response of the electrochemical cell that is measured is the potential of the electrochemical cell, the current of the electrochemical cell, the impedance of the electrochemical cell, or a combination thereof.

[0222] X8. The method of paragraph X6, wherein the potential of the electrochemical cell is measured by cyclic square wave voltammetry, square wave voltammetry, linear potential sweep voltammetry, cyclic voltammetry, or open circuit potentiometry.

[0223] X9. The method according to any of the preceding paragraphs, wherein the concentration of the compound capable of undergoing a change in its oxidation state and / or structural conformation depending on the pH of the solution in the solution is from about 1 μM to about 1000 μM, for example from about 1 μM to about 500 μM, for example from about 5 μM to about 250 μM, in particular from about 50 μM to about 200 μM.

[0224] X10. The method according to any of the preceding paragraphs, wherein the step of quantifying the pH of the solution as a function of the electrochemical response of the electrochemical cell is carried out through the application of a regression algorithm.

[0225] X11. The method of any of the preceding paragraphs, wherein the solution comprises a buffer.

[0226] X12. The method of any of the preceding paragraphs, wherein the solution comprises a sample, and optionally the sample comprises human, animal, plant, bacterial, fungal, or protozoan cells.

[0227] X13. The method of any of the preceding paragraphs, wherein the solution further comprises a sample, preferably the sample is selected from the list consisting of a nasal sample, a throat sample, an anal sample, a vaginal sample, an ear drainage sample, a skin surface swab sample, a urine sample, a whole blood sample, a serum sample, a plasma sample or a lymphatic drainage sample.

[0228] X14. The method of any of the preceding paragraphs, wherein the solution further comprises primers and nucleic acid amplification reagents, preferably, the nucleic acid amplification reagents are LAMP reagents.

[0229] X15. The method of paragraph X13, wherein the nucleic acid amplification reagent comprises a signal transduction substance, or is capable of releasing a signal transduction substance, or comprises both a signal transduction substance and a substance capable of releasing a signal transduction substance.

[0230] X16. Signal transduction substance is H + The method according to paragraph X14,

[0231] X17. The method according to any one of paragraphs X13 to X15, comprising a nucleic acid amplification step, preferably a step of performing a plurality of nucleic acid amplification steps.

[0232] X18. The method of paragraph X16, wherein the nucleic acid amplification step(s) is a loop-mediated isothermal amplification (LAMP) step.

[0233] X19. The method according to any one of paragraphs X13 to X17, for determining the presence of a target polynucleotide in a solution.

[0234] X20. The method of paragraph X18, wherein the step of measuring the electrochemical response of the electrochemical cell includes measuring a change in current and / or potential of the electrochemical cell due to a change in concentration of the signal transduction substance.

[0235] X21. The method according to any one of paragraphs X13 to X19, wherein the LAMP reagent comprises a reverse transcriptase.

[0236] X22. The method of any one of paragraphs X13 to X20, wherein the primers include a forward inner primer, a backward inner primer, a forward outer primer and a backward outer primer.

[0237] X23. The method of paragraph X21, wherein the LAMP amplification is performed with an additional pair of loop primers, such as a forward loop primer and / or a backward loop primer.

[0238] X24. The method of any of the preceding paragraphs, wherein the three-electrode electrochemical cell includes a working electrode, a reference electrode, and a counter electrode.

[0239] X25. The method of paragraph X23, wherein the working electrode includes an ion selective membrane positioned to exclude selected ions of the solution from contacting the working electrode.

[0240] X26. The surface of the working electrode is OH - and H3O + The method of paragraph X23 or X24, wherein the compound is chemically modified to permit binding of ions or is sensitive to the pH of the solution.

[0241] X27. The method of any one of paragraphs X23 to X25, wherein the material of the reference electrode and the counter electrode is Ag / AgCl.

[0242] X28. The method of any one of paragraphs X23 to X26, wherein the material of the working electrode is carbon.

[0243] X29. The method of any of the preceding paragraphs, wherein the electrode comprises or consists of gold, silver, carbon, platinum, ruthenium dioxide, or a combination thereof.

[0244] X30. The method of any of the preceding paragraphs, wherein the materials of the electrodes are the same or different.

[0245] X31. The method according to any of the preceding paragraphs, wherein the electrodes of the two-electrode or three-electrode electrochemical cell are film electrodes, preferably screen-printed electrodes.

[0246] X32. The method of any of the preceding paragraphs, wherein the electrodes of the two-electrode or three-electrode electrochemical cell are wire electrodes.

[0247] X33. The method of any of the preceding paragraphs, wherein the two-electrode or three-electrode electrochemical cell includes a substrate on which the electrodes are disposed, the material of the substrate being a chemically inert material such as alumina, ceramic, glass, or an inert plastic.

[0248] X34. The method of any of the preceding paragraphs, wherein the two-electrode or three-electrode electrochemical cell comprises a microfluidic inlet in fluid communication with the electrochemical cell for receiving the solution.

[0249] X35. The method of any of the preceding paragraphs, wherein after application of the solution, a vapor barrier is added to prevent evaporation of the solution.

[0250] X36. The method of paragraph X33, wherein the vapor barrier is formed by fluidly sealing the inlet of the three-electrode electrochemical cell or microwell with a physical lid, a heated lid, mineral oil, and / or paraffin wax.

[0251] X37. The method of any of the preceding paragraphs, wherein the hydrophilic region connects a microfluidic inlet with a two-electrode or three-electrode electrochemical cell, such as for capillary filling of the two-electrode or three-electrode electrochemical cell.

[0252] X38. The method of any of the preceding paragraphs, wherein the measurements are performed by using a potentiostat or similar circuit.

[0253] X39. The method according to any of the preceding paragraphs, wherein the measurement is performed for 1 minute to 90 minutes.

[0254] X40. The method according to any one of the preceding paragraphs, wherein the nucleotide amplification is carried out at a constant temperature in the range of 59-75°C, such as 62-73°C, such as 64-70°C, such as 66-68°C.

[0255] Y. Use of a two-electrode or three-electrode electrochemical cell for measuring the pH of a solution, comprising: providing a solution comprising a compound capable of undergoing a change in its oxidation state and / or structural conformation depending on the pH of the solution; applying the solution to a two-electrode or three-electrode electrochemical cell; -Measuring the electrochemical response of the electrochemical cell; - Quantifying the pH of the solution in response to the electrochemical response of the electrochemical cell.

[0256] Y1. Use of a three-electrode electrochemical cell for measuring the pH of a solution, comprising: providing a solution comprising a compound capable of undergoing a change in its oxidation state and / or structural conformation depending on the pH of the solution; applying the solution to a three-electrode electrochemical cell; -Measuring the electrochemical response of the electrochemical cell; - Quantifying the pH of the solution in response to the electrochemical response of the electrochemical cell.

[0257] Y2. A system for measuring the pH of a solution, comprising: b. An apparatus including a potentiostat; and v. a first container containing a three-electrode electrochemical cell and a second container containing a quinone, a quinone derivative, and / or a pH indicator; or vi. a three-electrode electrochemical cell and a first container containing a quinone, a quinone derivative, and / or a pH indicator; The system, wherein the potentiostat is configured to measure an electrochemical response of the electrochemical cell.

[0258] Y3. The system of claim 39, wherein the quinone, quinone derivative, and / or pH indicator is dissolved in an aqueous solution in the first or second container.

[0259] Y4. The system of any one of the preceding claims, wherein the potentiostat is configured to measure an electrochemical response of the electrochemical cell.

[0260] Y5. The system of any one of the preceding claims, wherein the potentiostat is configured to measure an electrochemical response, the electrochemical response being indicative of an oxidation state of the quinone, quinone derivative, and / or pH indicator in the first container.

[0261] Y6. The system of any one of the preceding claims, wherein the system further comprises a heating unit configured to heat the first and / or second container, such as to a temperature in the range of 59°C to 75°C.

[0262] Y7. The system of any one of the preceding claims, wherein a first container contains at least four primers configured to flank a target polynucleotide sequence and a nucleic acid amplification reaction system, such as LAMP reagents.

[0263] Y8. The system of any one of the preceding claims, wherein the first container comprises a microfluidic inlet for receiving a solution and / or a sample.

[0264] Y9. The system of claim 44, wherein the microfluidic inlet is connected to the electrochemical cell by a hydrophilic area, such as a porous / fibrous structure or a hydrophilic channel configured to transport the sample by capillary action.

[0265] Y10. The system of any one of the preceding claims, wherein the first container and / or the second container is an Eppendorf tube, a microwell, or a culture flask.

[0266] Y11. A system according to any one of the preceding claims, wherein the electrodes are as defined herein.

[0267] A specific method for quantifying a target polynucleotide in a sample using LAMP In a second aspect of the present invention, there is provided a method for quantifying a target polynucleotide in a sample, comprising the steps of: a. providing a sample; b. applying the sample to an electrochemical device including an electrochemical cell having a plurality of film electrodes; c. if a target polynucleotide is present in the sample, performing multiple isothermal LAMP amplifications, each comprising the sample, at least four primers each flanking a target polynucleotide, and LAMP reagents that contain and / or can release a signal transduction substance, each LAMP amplification releasing or consuming a signal transduction substance; d. simultaneously with step e, measuring a change in current and / or potential of the electrochemical cell due to a change in concentration of the signal transduction substance; e. Deriving an amplification factor from the rate of change of current and / or potential, thereby quantifying the target polynucleotide in the sample.

[0268] For the avoidance of doubt, any aspect of the second aspect of the invention may be combined with any aspect of the first aspect of the invention, as detailed in any of the sections above.

[0269] In an embodiment of the second aspect of the present invention, the sample is mixed with primers and LAMP reagents before applying the sample to the electrochemical device.

[0270] In another embodiment of the second aspect of the present invention, the electrochemical device comprises a primer and a LAMP reagent.

[0271] In a further embodiment of the second aspect of the invention, the plurality of film electrodes includes a working electrode, a reference electrode, and a counter electrode.

[0272] In an embodiment of the second aspect of the invention, the working electrode comprises an ion selective membrane positioned to exclude selected ions of the solution from contacting the working electrode.

[0273] In another embodiment of the second aspect of the present invention, the surface of the working electrode is chemically modified to include OH - and H3O + Allows for binding of ions or is sensitive to the pH of the solution.

[0274] In an embodiment of the second aspect of the invention, either surface of the electrode comprises or is chemically modified with ruthenium oxide, graphene platelets, or the electrode is chemically modified to have exposed thiol / hydroxyl groups.

[0275] In another embodiment of the second aspect of the invention, the material of the reference and counter electrodes is Ag / AgCl in a ratio of about 60 / 40 w / w.

[0276] In a further embodiment of the second aspect of the invention, the material of the working electrode is carbon.

[0277] In one embodiment of the second aspect of the invention, the electrodes comprise or consist of gold, silver, carbon, platinum, ruthenium dioxide, or combinations thereof.

[0278] In another embodiment of the second aspect of the present invention, the materials of the electrodes are the same or different.

[0279] In a further embodiment of the second aspect of the invention, the film electrode is a screen printed electrode.

[0280] In a further embodiment of the second aspect of the invention, the film electrode is a wire electrode.

[0281] In an embodiment of the second aspect of the present invention, the electrochemical device comprises a substrate on which the electrodes are disposed, the material of the substrate being a chemically inert material such as alumina, ceramic, glass, or an inert plastic.

[0282] In another embodiment of the second aspect of the present invention, the electrochemical device comprises a microfluidic inlet for receiving a sample, in fluid communication with the electrochemical cell.

[0283] In a further embodiment of the second aspect of the invention, a vapor barrier is added to prevent evaporation of the solution after application of the solution.

[0284] In an embodiment of the second aspect of the invention, the vapor barrier is formed by fluidically sealing the inlet of the electrochemical device or microwell with a physical lid, a heated lid, mineral oil, and / or paraffin wax.

[0285] In another embodiment of the second aspect of the invention, a hydrophilic region connects a microfluidic inlet and an electrochemical cell, such as for capillary filling of an electrochemical device.

[0286] In a further embodiment of the second aspect of the invention, the measurement is carried out by using a potentiostat or similar circuit.

[0287] In an embodiment of the second aspect of the invention the measurements comprise or consist of potentiometric, impedance, coulometric, voltammetric and / or amperometric measurements.

[0288] In another embodiment of the second aspect of the invention, the solution is measured for a period of between 1 minute and 90 minutes.

[0289] In a further embodiment of the second aspect of the invention, the LAMP reagents comprise a reverse transcriptase.

[0290] In an embodiment of the second aspect of the present invention, the nucleotide amplification is carried out at a constant temperature in the range of 59-75°C, such as 62-73°C, such as 64-70°C, such as 66-68°C.

[0291] In another embodiment of the second aspect of the invention, the primers comprise a forward inner primer, a backward inner primer, a forward outer primer and a backward outer primer.

[0292] In a further embodiment of the second aspect of the invention, the LAMP amplification is carried out with an additional pair of loop primers, such as a forward loop primer and / or a backward loop primer.

[0293] In another embodiment, the present invention relates to a method for determining the presence of a target polynucleotide in a sample, comprising distinguishing between target polynucleotide positive and target polynucleotide negative samples by quantifying and / or measuring polynucleotide amplification rates.

[0294] array SEQ ID NO:1 ORF1 fragment of SARS-CoV-2 CCCTATTGTGTTCATCAAACGTTCGGATGCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTCGTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGT GGGCGAAATACCAGTGGCTTACCGCAAGGTTCTTCTTCGTAAGAACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTAGGCGACGAGCTTGGCACTGATCCTTATGAAGA SEQ ID NO:2 SARS-CoV-2 gene N fragment ATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTAC SEQ ID NO:3 Forward Inner Primer (FIP) AGGTGAGGGTTTTCTACATCACTATATTGGAACAAGCAAATTCTATGG SEQ ID NO:4 Backward Inner Primer (BIP) ATGGGTTGGGATTATCCTAAATGTGTGCGAGCAAGAACAAGTG SEQ ID NO:5 Forward outer primer (F3) CCACTAGAGGAGCTACTGTA SEQ ID NO:6 Backward outer primer (B3) TGACAAGCTACACACGT SEQ ID NO:7 Forward Loop Primer (FL) CAGTTTTTAACATGTTGTGCCAACC SEQ ID NO:8 Backward Loop Primer (BL) TAGAGCCATGCCTAACATGCT Working Example

[0295] Example 1 Quantitative electroanalytical measurements of nasal swab samples by LAMP amplification material and method Screen Printed Electrodes Use a pH-sensitive screen-printed three-electrode system, including three screen-printed electrodes that function as working, reference, and auxiliary electrodes, printed on chemically inert alumina. 1. The reference electrode material is Ag / AgCl (60 / 40 ratio) with an additional layer that provides an arbitrary fixed concentration of chloride ions for a true reference electrode measurement. 2. The material of the working electrode is carbon with a pH-sensitive layer of a solid membrane combination of cobalt oxide and iridium oxide. 3. The counter electrode material is an Ag / AgCl electrode (60 / 40 ratio) with an additional layer that provides an arbitrary fixed concentration of chloride ions for a true reference electrode measurement. ii. The electrodes are overlaid with microfluidic sample ports in the form of microwells. iii. An evaporation barrier to the microwells in the form of a physical lid is used.

[0296] Primer 10x primer mix containing 16 µM FIP, 16 µM BIP, 2 µM F3, 2 µM B3, 4 µM Loop F, 4 µM Loop B and nuclease free water (not TE). Final concentrations of the amplification reaction mix before starting the reaction are 1.6 µM FIP, 1.6 µM BIP, 0.2 µM F3, 0.2 µM B3, 0.4 µM Loop F, 0.4 µM Loop B.

[0297] sample Nasal swab samples inoculated in viral transport medium are used after heat treatment for 1 minute at 80° C. An example of a viral transport medium used is sterile Hank's Balanced Salt Solution (HBSS) 1x, containing calcium and magnesium ions, with or without phenol red, 2% v / v fetal bovine serum, 100 μg / mL gentamicin sulfate and 0.5 μg / mL amphotericin B.

[0298] Amplification reaction i. 2 μL sample, a. 2.5 μL 25X LAMP Primer Mix targeting the genomic region of interest (final concentrations 1.6 μM FIP, 1.6 μM BIP, 0.2 μM F3, 0.2 μM B3, 0.4 μM Loop F, 0.4 μM Loop B); b. 12.5 μL WarmStart Colorimetric LAMP 2X Master Mix (New England Biolabs Inc.) and c. Mix with nuclease-free water to a final volume of 25 μL.

[0299] Amplification conditions and assay design 1. Add the amplification reaction mix (containing the sample) immediately after mixing on a pH sensor pre-heated at 65°C, already connected to the potentiostat. 2. A vapor barrier is placed to avoid evaporation. 3. Potentiometric measurements are performed in real time and voltage is measured continuously for 30 minutes.

[0300] interpretation The presence of the nucleic acid template is indicated by a decrease in pH over a 30 minute period (pH sensing). The time lag of the change correlates with the amount of nucleic acid template.

[0301] Example 2 Continuous electrochemical real-time quantitative monitoring of loop-mediated isothermal amplification in low Tris buffer using screen-printed electrodes. material and method Screen Printed Electrodes i. A pH-sensitive screen-printed three-electrode system that consists of three screen-printed electrodes that function as working, reference, and auxiliary electrodes and are printed onto a chemically inert substrate such as alumina, ceramic, glass, or an inert plastic substrate. ii. The electrodes may be made of the same or different materials, such as gold, silver, carbon, platinum, ruthenium dioxide, etc. iii. The working electrode may incorporate a layer of an ion selective membrane and / or the electrode surface may be coated with OH - and H3O+ They may be modified to allow for the binding of ions or be sensitive to the pH of a solution when exposed to the solution via direct contact. Such modifications may include ruthenium oxide, graphene platelets, exposed thiol groups, exposed hydroxyl groups, etc. iv. Settings: 1. The reference electrode consists of a Ag / AgCl electrode (60 / 40 ratio) with an optional additional layer that provides a fixed concentration of chloride ions for a true reference electrode measurement. 2. The working electrode is made of carbon. 3. The counter electrode consists of a Ag / AgCl electrode (60 / 40 ratio) with an optional additional layer to provide a fixed concentration of chloride ions for a true reference electrode measurement. v. Overlaid on the electrode is a microfluidic sample port in the form of a microwell (preferred) or other sample introduction / containment method. vi. A vapor barrier for the microwells may be used. Alternatives may include physical lids, heated lids, mineral oil vapor barriers, paraffin wax vapor barriers.

[0302] Primer 10X primer mix containing 16 μM FIP, 16 μM BIP, 2 μM F3, 2 μM B3, 4 μM Loop F, 4 μM Loop B and nuclease free water (not TE). Final concentrations of the amplification reaction mix before starting the reaction are 1.6 μM FIP, 1.6 μM BIP, 0.2 μM F3, 0.2 μM B3, 0.4 μM Loop F, 0.4 μM Loop B.

[0303] sample ii. Nasal or throat swab samples inoculated with viral transport medium can be used directly or after heat treatment at 70-90°C for 1 min. iii. Anal or vaginal or ear discharge or skin surface swab samples inoculated with viral transport medium can be used directly or after heat treatment at 70-90°C for 1 minute. iv. Urine samples can be used directly or after heat treatment at 70-90°C for 1 min. v. Whole blood samples mixed with anticoagulants such as heparin, EDTA, sodium citrate, etc. are subjected to optional additional lysis by mechanical lysis, thermal lysis, acoustic cavitation, osmotic shock, enzymatic lysis, or chemical lysis. vi. Lymphatic drainage or serum samples may be used directly or after heat treatment at 70-90°C for 1 minute. vii. Purified nucleic acid content from biological samples or crude nucleic acid extracts

[0304] Amplification reaction i. A typical amplification reaction includes primers (e.g., 4, 5, or 6 primers), a sample (which may or may not include a template to which the primers bind), nucleotides (corresponding to G, A, T, and C), a buffer (1 mM-5 mM Tris or 1.5 mM-5 mM Tris or equivalent buffers), one or more salts (e.g., (NH)2SO4, NaCl, MgSO4, MgCl2, etc.), a bacterial or archaeal polymerase (which may or may not be thermostable and which may or may not have strand displacement activity) and any necessary cofactors, and any detergents, etc. Examples of thermostable polymerases that can be used in PCR or polymerases for use in isothermal amplification reactions include, but are not limited to, Taq, Tfi, Tzi, Tth, Pwo, Pfu, Q5®, Phusion®, One Taq®, Vent®, Deep Vent®, Klenow (exo-), Bst2.0 and Bst3.0 (New England Biolabs, Ipswich, Mass.), PyroPhage® (Lucigen, Middleton, Wis.), Tin DNA polymerase, GspSSDLF DNA polymerase, Rsp (OptiGene, Horsham, UK), and phi29 polymerase.

[0305] ii. Preferred reaction mixture: 2 µL samples (containing DNA / RNA or no-template control; range: 1-5 µL; if transport medium is used, samples larger than 2 µL will inhibit the reaction; less than 2 µL means there may be too little template) should be a. 2.5 μL of 25X LAMP Primer Mix targeting the genomic region of interest (final concentrations 1.6 μM FIP, 1.6 μM BIP, 0.2 μM F3, 0.2 μM B3, 0.4 μM Loop F, 0.4 μM Loop B); b. 12.5 μL WarmStart Colorimetric LAMP2X Master Mix (New England Biolabs Inc.), which also contains reverse transcriptase; and c. Mix with nuclease-free water to a final volume of 25 μL.

[0306] iii. Alternative reaction mixture: Add 2 μL of sample (containing DNA / RNA or no template control; up to 5 μL possible) a. 2.5 μL of 25X LAMP Primer Mix targeting the genomic region of interest (final concentrations 1.6 μM FIP, 1.6 μM BIP, 0.2 μM F3, 0.2 μM B3, 0.4 μM Loop F, 0.4 μM Loop B); b. 12.5 μL WarmStart LAMP 2X Master Mix (New England Biolabs Inc.) and c. Mix with nuclease-free water to a final volume of 25 μL.

[0307] Amplification conditions and assay design i. Preferred 1. Add the amplification reaction mixture (containing sample) immediately after mixing on a pH sensor pre-heated at 59-75 °C, already connected to a potentiostat or equivalent circuit. 2. A vapor barrier is placed to avoid evaporation. 3. Potentiometric measurements are performed in real time and voltage is measured continuously for 1 to 90 minutes. 4. The assay can be parallelized for multiple samples. ii. Alternative 1. Mixing of the sample with the remaining components can occur directly on the chip, using a pipette or microfluidic mixing. 2. The amplification reaction mixture (including sample) is added to a PCR or microcentrifuge tube and heated to 59-75°C. Samples are removed after 1-90 minutes, or 2-5 aliquots at 1-5 minute intervals, and the pH is measured at room temperature with a pH sensor already connected to a potentiostat or equivalent circuit. 3. Instead of pH, impedance measurements, coulometry, amperometry can be performed without the use of additional redox probes or DNA intercalating dyes.

[0308] interpretation i. the presence of the nucleic acid template is indicated between 1 and 90 minutes by: i. Decrease in pH (pH sensing) ii. Decrease in conductivity (amperometry) iii. Increase in impedance (impedance measurement) iv. Change in net charge (Coulometry) ii. Furthermore, the time lag of this change correlates with the amount of nucleic acid template.

[0309] Example 3 A three-electrode system method for monitoring the pH of solutions containing phenol red. Parameters used In this example, 50 μL of aqueous solution containing PBS, NaOH or HCl (for pH adjustment), 0.1 M KCl (as supporting electrolyte), and 100 μM phenol red (as pH probe) was analyzed.

[0310] The aqueous solution was introduced into a three-electrode electrochemical cell and square wave voltammetry was performed in the electrochemical cell using the following parameters: a. Peak at 0.5 V vs. Ag / AgCl. Scan range: 0–0.6 V vs. Ag / AgCl; Frequency: 10 Hz; Potential step: 5 mV; Amplitude: 10 mV. b. Peak at -0.4~-0.55 V vs. Ag / AgCl. Scan range: 0~0.7 V vs. Ag / AgCl; frequency: 10 Hz; potential step: 5 mV; amplitude: 10 mV. N2O3-Au disposable electrodes were used with an Anapot potentiostat.

[0311] The pH change was analyzed according to the peak position defined by the peak height (i) and the potential (E):

number

[0312] Analysis results Phenol red is a triquinone structure chemical that undergoes three electron transfer in a potential window of -1 V to 1 V (vs Ag / AgCl, see Figure 3 for an overview of the redox peaks of phenol red). Both the peak current and the peak potential are pH dependent. Despite the limited visible light spectrum from pH 6 to pH 8, the redox potential of phenol red and the corresponding peak current allow discrimination of the complete pH range.

[0313] Phenol red is the simplest form of the sulfonphthalein group, a weak acid with a pKa of 7.9, and one of the most commonly used pH indicators. Its chemical structure and dissociation in aqueous solution can be seen in the following scheme: [ka]

[0314] The ionizable moiety of quinone methide in the triaromatic structure of phenol red confers rich redox properties that exhibit advantageous characteristics for various applications. The quinone methide moiety in the structure is the center of rich redox chemistry. Cyclic voltammograms of phenol red scanned at various scan rates using a bare GC electrode in a solution buffered to pH 7.9 in PBS are shown in Figure 4. Six significant waves can be observed in Figure 4. By correlating the peak current with the values ​​of the scan rate and the square root of the scan rate, as shown in the inset plot of Figure 4, it was found that waves (b), (c), (d), and (f) can be classified as redox reactions of phenol red at the electrode interface. This is due to the fact that the peak current, which shows a proportionality to the square root of the scan rate, is characteristic of a diffusion-controlled reaction. In contrast, waves (a) and (e) are classified as the adsorption process of phenol red on the electrode surface due to the linear relationship between the peak current and the scan rate.

[0315] To identify the redox couple of phenol red, cyclic voltammetry scans of phenol red were performed at various switching potentials, and the results are shown in Figure 5. The scans were initiated cathodically from 1.5 V to switching potentials of 0.4, -0.2, -1.0, and -1.5 V, respectively. Looking at the right end of the curves in the inset graph of Figure 5, curve (a) shows two reduction peaks and only one significant oxidation peak, while curve (b) shows only one redox couple. The IPC / IPA ratio of curve (a) is about 2.8, and the IPC / IPA ratio of curve (b) is 2.3, which indicates that the reduced species is decreasing in the process of curve (a).

[0316] The following two-step reduction can explain the following observations: [ka]

[0317] The first reduction peak occurs at -0.75 V, followed by a second reduction at -1.12 V in the inset curve (a) of Figure 5. Further disproportionation consumes some of the free radical products of the first reduction [C] to the carbanion [D] and the initiating oxonium ion [A]. [ka]

[0318] This reduces the oxidation peaks in both curves (a) and (b), thus eliminating the i from a general reversible process. pc / i pa Deviations in the ratio occur. Moreover, since the protonation of the carbanion species is an irreversible reaction, the second reduction peak at -1.12 V is much smaller compared to the peak of its first counterpart at -0.75 V. This explains the relatively lower ipc / ipa of curve (a) compared to curve (b), based on what has been said before. The effect of pH value on the reduction and oxidation of phenol red is shown in Figure 6. Solutions of pH 3.9 (curves (a) and (a'), [A] being the predominant species), pH 7.9 (curves (b) and (b'), equal amounts of both forms), and 11.9 containing phenol red (curves (c) and (c'), predominantly [B]) were buffered with PBS, and CV scans of these solutions were carried out in both anodic and cathodic directions. Note that, as the peak potential depends on the pH variation, the first reduction from (a') to (c') involves the transfer of one electron and one proton, while the second reduction proceeds without the transfer of a proton.

[0319] The corresponding anodic scans of solutions (a) to (c) exhibit two oxidation peaks in curves (a) and (b), even though there is only one in (c). In the cases of (a) and (b), the unprotonated phenol red [B] undergoes oxidation first, and then its protonated counterpart [A] undergoes another oxidation at a more positive potential accompanied by deprotonation. To clarify the relationship between both oxidations, a further scan was performed starting before the potential of the second oxidation (0.90 V), as shown in curve (d). This result suggests that the second oxidation does not originate from the product of the first oxidation. In contrast, in curve (c), the absence of a second oxidation is due to the lack of [A] in the alkaline environment. Thus, the oxidation of phenol red from both species leads to the radical cation [E], as is evident in the following pathway: [ka]

[0320] Square wave voltammetry is used for signal discrimination and benefits from superior signal enhancement compared to cyclic voltammetry, which facilitates simple signal processing. The optimal concentration of phenol red was observed to be around 100 μM. Without wishing to be bound by theory, 100 μM gives a clear redox peak without inhibiting nuclear amplification. However, signal discrimination is still achieved using a wide range of phenol red concentrations.

[0321] The results of square wave voltammetry performed on phenol red at various concentrations of phenol red over the pH range 6.5-8.5 can be seen in Figure 7. The bottom two graphs in Figure 7 show the peak position (voltage) and height (current) versus the concentration of phenol red.

[0322] A linear regression algorithm was then applied to obtain the accurate pH value. That is, the output signal obtained was correlated with the pH value by applying a linear regression algorithm. The algorithm was validated by fitting the predicted values ​​to the actual measured values, within an error of 0.05 pH, and the results can be seen in Figure 8.

[0323] In addition to the peak in the 0–800 mV scan, two other peaks were also observed (see Figure 9 ).

[0324] Peaks a), b), and c), highlighted in Figure 9, are pH dependent. Peak c) is too close to hydrolysis, which is an irreversible EC peak, so we focused on peaks a) and b) in this study. Peak a): From high to low pH: Shift to positive potentials; 1 electron transfer in the entire pH range (~50-60 mV / pH). Peak b): From high to low pH: Shift to negative potentials; the number of electron transfers is pH (~30-60 mV / pH) dependent.

[0325] Despite the very small sample sizes required, the extremely accurate pH quantification that this method provides has many applications, including highly accelerated monitoring and quantification of nucleic acid amplification from small samples, as shown in Example 4.

Claims

1. 1. A method for measuring the pH of a solution, comprising the steps of: - providing a solution comprising a quinone, a quinone derivative, and / or a pH indicator; - applying said solution to a three-electrode electrochemical cell; - measuring the electrochemical response of said electrochemical cell; - quantifying the pH of the solution in response to the electrochemical response of the electrochemical cell.

2. 2. The method of claim 1, wherein the quinone or quinone derivative is selected from the list consisting of 1,2-benzoquinone, 1,4-benzoquinone, 1,4-naphthoquinone, 9,10-anthraquinone, and derivatives thereof, and combinations thereof.

3. The pH indicator is, for example, malachite green oxalate, brilliant green, eosin yellow, erythrosin B, methyl green, methyl violet, picric acid, cresol red, crystal violet, m-cresol purple, thymol blue, p-xylenol blue, eosin (blue), quinaldine red, 2,4-dinitrophenol, 4-(dimethylamino)azobenzole, bromochlorophenol blue, bromophenol blue, Congo red, methyl orange, bromocresol green, 2,5-dinitrophenol, alizarin sulfonic acid, methyl red 2. The method of claim 1, wherein the pigment is selected from the list consisting of: chlorophenol red, litmus, bromocresol purple, bromophenol red, 4-nitrophenol, bromoxylenol blue, bromothymol blue, phenol red, 3-nitrophenol, neutral red, cresol red, 1-naphtholphthalein, m-cresol purple, thymol blue, p-xylenol blue, phenolphthalein, thymolphthalein, alkaline blue, alizarin yellow GG, indigo carmine, epsilon blue, titanium yellow, and combinations thereof.

4. The method according to any one of claims 1 to 3, wherein the quinone, quinone derivative and / or pH indicator is dissolved in the solution.

5. The method of any one of claims 1 to 4, wherein the electrochemical response of the electrochemical cell that is measured is the potential of the electrochemical cell, the current of the electrochemical cell, the impedance of the electrochemical cell, or a combination thereof.

6. 6. The method of claim 1, wherein the electrochemical response of the electrochemical cell that is measured comprises the potential of the electrochemical cell, the current of the electrochemical cell, the impedance of the electrochemical cell, or a combination thereof.

7. 7. The method of claim 1, wherein the concentration of the quinone, quinone derivative, and / or pH indicator in the solution is from 1 μM to 1000 μM, from 1 μM to 500 μM, from 5 μM to 250 μM, or from 50 μM to 200 μM.

8. 8. The method of any one of claims 1 to 7, wherein the solution further comprises a sample, the sample being selected from the list consisting of a nasal sample, a throat sample, an anal sample, a vaginal sample, an ear drainage sample, a skin surface swab sample, a urine sample, a whole blood sample, a serum sample, a plasma sample or a lymphatic drainage sample.

9. The method according to any one of claims 1 to 8, wherein the solution further comprises a primer and a nucleic acid amplification reagent, the nucleic acid amplification reagent being a LAMP reagent.

10. The method of any one of claims 1 to 9, wherein the three-electrode electrochemical cell comprises a working electrode, a reference electrode, and a counter electrode.

11. 11. The method of claim 10, wherein the working electrode includes an ion selective membrane positioned to exclude selected ions of the solution from contacting the working electrode.

12. The method of any one of claims 1 to 11, wherein a hydrophilic region connects a microfluidic inlet with the three-electrode electrochemical cell for capillary filling of the three-electrode electrochemical cell.

13. 1. Use of a three-electrode electrochemical cell for measuring the pH of a solution, comprising: - providing a solution comprising a quinone, a quinone derivative, a pH indicator, or a combination thereof; - applying said solution to said three-electrode electrochemical cell; - measuring the electrochemical response of said electrochemical cell; - quantifying the pH of the solution as a function of the electrochemical response of the electrochemical cell.

14. 1. Use of a three-electrode electrochemical cell for monitoring a nucleic acid amplification reaction, comprising: - providing a solution comprising a quinone, a quinone derivative, a pH indicator, or a combination thereof; - providing a LAMP mixture comprising a target polynucleotide, a sample comprising at least two primers, each flanking said target polynucleotide, and a LAMP reagent; - applying said solution and said LAMP mixture to said three-electrode electrochemical cell; - measuring the electrochemical response of said electrochemical cell; - quantifying the pH of said solution in response to said electrochemical response of said electrochemical cell.

15. 1. A system for measuring pH of a solution, comprising: a. a potentiostat; b. A measurement kit comprising: i. a first container containing a three-electrode electrochemical cell and a second container containing a quinone, a quinone derivative, and / or a pH indicator; or ii. A measurement kit comprising a three-electrode electrochemical cell and a first container containing a quinone, a quinone derivative, and / or a pH indicator.

Images