Modified aminoacyl-tRNA synthetase and its uses

Abstract

To provide modified aminoacyl-tRNA synthetases having increased reactivity with N-methyl amino acids compared to natural aminoacyl-tRNA synthetases, and provide a production method that enables more efficient production of polypeptides containing N-methylphenylalanine.SOLUTION: A polypeptide comprises an amino acid sequence of a PheRS α subunit with an amino acid at a site corresponding to glutamic acid at position 169 of a wild-type PheRS α subunit from Escherichia coli having been substituted with another amino acid and has the activity of acylating tRNA with N-methylphenylalanine.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to an aminoacyl-tRNA synthetase (ARS) that is more efficient at aminoacylation of N-methyl amino acids to corresponding tRNAs than natural aminoacyl-tRNA synthetases, and uses thereof. More specifically, the present invention relates to an aminoacyl-tRNA synthetase with an altered amino acid sequence that can aminoacylate six N-methyl-substituted amino acids, N-methyl-phenylalanine, N-methyl-valine, N-methyl-serine, N-methyl-threonine, N-methyl-tryptophan, and N-methyl-leucine, with corresponding tRNAs more efficiently than natural ARSs, and uses thereof. By using the aminoacyl-tRNA synthetase with an altered amino acid sequence of the present invention, peptides containing N-methyl amino acids selectively and regioselectively can be produced with high efficiency. [Background technology]

[0002] In general, in living organisms on Earth, information in DNA (information storage substance) determines the structure of proteins (functional substances) and the functions that result from that structure via RNA (information transmitter). Polypeptides and proteins are made up of 20 types of amino acids, and information is transcribed from DNA, which is made up of four types of nucleotides, into RNA, which then translates that information into amino acids that make up polypeptides and proteins.

[0003] During translation, tRNA acts as an adapter that converts a sequence of three-letter nucleotides into a single amino acid, and aminoacyl-tRNA syathetase (ARS) is involved in binding between tRNA and amino acids.

[0004] ARS is an enzyme that specifically bonds amino acids to tRNA, and in each organism, with some exceptions, there are 20 types of ARS corresponding to each of the 20 naturally occurring amino acids, and tRNA with an anticodon corresponding to an arbitrary codon is accurately acylated with a specific amino acid that is assigned to the codon among the 20 proteinogenic amino acids. In other words, a tRNA synthetase corresponding to a specific amino acid distinguishes the tRNA of that amino acid from the tRNAs of other amino acids and bonds it only to that amino acid, but not to other amino acids.

[0005] In the translation of mRNA into a polypeptide chain, tRNA (aminoacyl-tRNA) bound to a corresponding amino acid forms hydrogen bonds with mRNA on the ribosome in order starting from the start codon of the mRNA, and transfers peptidyl to the amino acid on the adjacent aminoacyl-tRNA bound to the next codon. After the amino acid is removed by the transfer, the previous tRNA is released from the mRNA, and ARS catalyzes binding to the corresponding amino acid again. When the mRNA stop codon is reached, a protein called a release factor arrives, terminating the translation, and the polypeptide chain is released from the ribosome. Proteins in the body are manufactured through these processes. Each protein performs an important physiological function in the body.

[0006] Meanwhile, in the field of pharmaceuticals that also exert physiological activity in the body, it is expected that new pharmaceuticals will be created using medium-sized compounds with molecular weights of 500 to 2000, a field that has been considered difficult to discover using conventional small-molecular-weight compounds with a molecular weight of less than 500. For example, cyclosporine A, a medium-molecule drug derived from natural products, is a representative example. It is an orally administrable peptide that consists of 11 residues and is produced by microorganisms, and inhibits the intracellular target cyclophilin.

[0007] A characteristic of cyclosporine A peptides is that they contain non-natural amino acids called "N-methylamino acids" as constituents. In recent years, several studies have been reported that introduce N-methylamino acids into peptides to enhance their drug-likeness and further apply this to drug discovery (Non-Patent Documents 1, 2, 3). In particular, it has become known that the introduction of N-methylamino acids leads to a decrease in hydrogen bond donor hydrogen, acquisition of protease resistance, and fixation of conformation, and contributes to membrane permeability and metabolic stability (Non-Patent Documents 1, 4, Patent Document 1). This has led to the idea of ​​a drug discovery method in which candidate pharmaceutical substances are selected from libraries of diverse peptides containing multiple N-methyl amino acids. In particular, mRNA display libraries of peptides containing N-methyl amino acids that utilize cell-free translation systems are attracting attention due to their diversity and ease of screening (Non-Patent Documents 9, 10, Patent Document 1). First, a display library is constructed, which is a collection of molecules in which a huge variety of RNA or DNA (genotype) and the peptides (phenotype) they code for form a one-to-one correspondence. Next, a binding reaction is carried out with a target protein, etc., and after washing to remove unbound molecules, extremely rare desired molecules contained in the library are selected, and the sequence of the RNA (DNA) is decoded to easily obtain sequence information of the bound peptide. In particular, mRNA display libraries and ribosome display libraries that utilize cell-free translation systems have been used for over 10 12-14 It is possible to easily handle libraries containing a wide variety of molecules such as those listed above (Non-Patent Document 11). Recently, a method for preparing peptides containing non-proteinogenic amino acids has been developed by utilizing a reconstituted cell-free translation system, and by combining this with display technology, it has become possible to construct a peptide display library containing N-methyl amino acids (Non-Patent Document 10).

[0008] Several methods have been known to prepare N-methylamino acid-containing peptides by translation of mRNA. These methods involve separately preparing "N-methylaminoacyl-tRNA" in advance and adding this to the translation system.

[0009] First, in the pdCpA method developed by Hecht et al. (Non-Patent Document 5), pdCpA (5'-phospho-2'-deooxyribocytidylriboadenosine) acylated with a chemically synthesized non-natural N-methyl amino acid is linked to a tRNA lacking a 3'-terminus CA obtained by transcription using T4 RNA ligase to prepare an N-methylaminoacyl-tRNA in advance. Amino acids such as N-methylalanine and N-methylphenylalanine have been introduced using this method (Non-Patent Document 6). However, when the present inventors prepared conjugates of several non-natural N-methyl amino acids and tRNA using the pdCpA method and added them to a cell-free translation system, the translation efficiency decreased when multiple N-methyl amino acids were introduced, and in particular, N-methylvaline could not be introduced (unpublished data).

[0010] As an alternative method, Suga et al. have reported a method in which N-methyl amino acids activated in advance by esterification are aminoacylated into tRNA using an artificial RNA catalyst (flexizyme) (Patent Document 2), and have succeeded in translationally introducing several types of N-methyl amino acids. Although this method can be applied to various side chain structures, the aminoacylation efficiency of non-aromatic side chain amino acids is often only 40-60%, which is not very high, and in particular, translational introduction of N-methylvaline has not been confirmed, as with the pdCpA method (Non-Patent Document 3).

[0011] Furthermore, in the method of Szostak et al., aminoacyl-tRNA is obtained from tRNA extracted from E. coli using wild-type ARS, and then N-methylaminoacyl-tRNA is prepared through a three-step chemical N-methylation reaction. However, the side chains for which translation proceeds efficiently using this method are limited to three types: valine, leucine, and threonine. In addition, this method requires complicated procedures, and the N-methylation reaction does not proceed completely, resulting in the contamination of the starting material, natural amino acid, in trace amounts, and the difficulty of reaction control directly affects the purity of the product (Non-Patent Document 2).

[0012] Furthermore, in these methods, N-methylaminoacyl tRNA prepared outside the translation system is added to the translation reaction solution, so N-methylaminoacyl tRNA is not regenerated in the translation system, and N-methylaminoacyl tRNA is consumed during the translation process. This requires the addition of a large amount of N-methylaminoacyl tRNA, but the addition of a large amount of tRNA itself is a factor in reducing peptide yields (Non-Patent Document 7). Furthermore, the instability of aminoacyl tRNA in the translation solution is a problem. Since amino acids and tRNA are linked by ester bonds, it has been shown that aminoacyl tRNA is hydrolyzed under physiological conditions at pH 7.5 (Non-Patent Paper 12), and its half-life is as short as 30 minutes depending on the amino acid side chain. Furthermore, hydrolysis of aminoacyl tRNA is suppressed by forming a complex with aminoacyl-tRNA-elongation factor Tu (EF-Tu), but aminoacyl tRNA that exceeds the concentration of EF-Tu in the translation system is hydrolyzed. In other words, as the translation reaction proceeds, the deacylation of the aminoacyl-tRNA added at the start of translation progresses, and eventually the aminoacyl-tRNA with N-methylamino is depleted. In fact, Szostak et al. have taken issue with this, and when synthesizing a polypeptide containing multiple N-methyl amino acids, they add N-methylaminoacyl-tRNA twice, at the start of translation and during the reaction (Non-Patent Document 2).

[0013] On the other hand, the above problems regarding the introduction of N-methyl amino acids could be solved if there were an ARS corresponding to N-methyl amino acids that had the same function as the natural ARS for natural amino acids, but the ARS has a strict substrate recognition ability and is limited. As an exception, Murakami et al. reported that N-methylhistidine and N-methylphenylalanine can be introduced into peptides in a cell-free translation system using natural HisRS and PheRS (Non-Patent Documents 8 and 13). In addition, Szostak et al. identified the aminoacylation of six types of N-methyl amino acids, N-methylvaline, N-methylleucine, N-methylaspartic acid, N-methylhistidine, N-methyllysine, and N-methyltryptophan, using natural ARS (Non-Patent Document 14). However, in a later report using a cell-free translation system and natural ARS, the translational synthesis of peptides containing N-methylhistidine and N-methylaspartic acid was identified by mass spectrometry, and a certain degree of yield was reported, but in the case of N-methylvaline, N-methylleucine, N-methyllysine, and N-methyltryptophan, the efficiency of translational synthesis was shown to be very low (Non-patent paper 8). From these reports, the aminoacylation of N-methylamino acids using natural ARS and their translational incorporation into peptides have been confirmed in only three cases: N-methylphenylalanine, N-methylhistidine, and N-methylaspartic acid.

[0014] In view of this, there are several prior art techniques for modifying a natural ARS to have the function of catalyzing the binding of a non-natural amino acid to tRNA (Patent Documents 3, 4, and 5). These are modified ARSs that catalyze the binding of a non-natural amino acid to tRNA, but these use amino acids, mainly side chain derivatives of phenylalanine or tyrosine, as substrates, and no modified ARSs that use N-methyl amino acids as substrates or that can introduce N-methyl amino acids into a multi-residue peptide are known. [Prior art documents] [Patent documents]

[0015]

Patent Document 1

Patent document 2

Patent document 3

Patent document 4

Patent document 5

Non-licensed literature

[0016] [Non-licensed document 1] RSLokey et al.,Nat.Chem.Biol.2011,7(11),810-817. [Non-licensed document 2] JWSzostak et al.,J.Am.Chem.Soc.2008,130,6131-6136. [Non-licensed document 3] T.Kawakami et al.,Chemistry & Biology,2008,Vol.15,32-42.

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

Non-licensed Document 7

Non-licensed literature 9

[0017] The present invention aims to provide a modified ARS modified to enhance reactivity with N-methylamino acids as substrates. More specifically, the present invention aims to provide a novel modified ARS that catalyzes an acylation reaction in which N-methyl unnatural amino acids, particularly N-methyl-phenylalanine, N-methyl-valine, N-methyl-serine, N-methyl-threonine, N-methyltryptophan, and N-methylleucine, are bound to tRNA without using a large amount of tRNA in order to efficiently produce a peptide containing multiple N-methylamino acids, and uses thereof. [Means for solving the problem]

[0018] In order to obtain an ARS with enhanced reactivity to N-methyl amino acids, the present inventors obtained multiple ARS genes that use different amino acids as substrates, and constructed mutant ARS genes encoding ARSs with modified amino acid sequences by introducing mutations into the genes. These modified ARSs were expressed and collected, and incubated with tRNA in the presence of unmodified or N-methyl amino acids to evaluate the aminoacylation reaction. As a result of estimating the three-dimensional structure of the interaction between N-methyl amino acids and ARSs and repeated trial and error, the present inventors succeeded in obtaining modified ARSs with increased activity in the aminoacylation reaction of N-methyl amino acids compared to wild-type ARSs for multiple ARSs such as phenylalanyl-tRNA synthetase (PheRS), seryl-tRNA synthetase (SerRS), valyl-tRNA synthetase (ValRS), threonyl-tRNA synthetase (ThrRS), leucyl-tRNA synthetase (LeuRS), and tryptophanyl-tRNA synthetase (TrpRS).

[0019] For example, when 0.1 μM wild-type PheRS was used, almost no incorporation into the translationally synthesized peptide was observed even when 1 mM N-methylphenylalanine was added, whereas when 0.1 μM modified PheRS was used, incorporation into the peptide was clearly observed even when 0.25 mM N-methylphenylalanine was added (Example 1). When the contents of phenylalanine and N-methylphenylalanine translated into the peptide were examined by mass spectrometry using MALDI-TOF MS, the peak value ratio (peak intensity of N-methylphenylalanine / peak intensity of phenylalanine) was 0.8 in the wild-type PheRS when 0.25 mM N-methylphenylalanine was added, whereas it dramatically increased to 12.4 when the modified PheRS α subunit was used (Example 1). In addition, when sequences containing two or three consecutive phenylalanines were translated, it was confirmed that peptides containing two or three consecutive N-methylphenylalanines were synthesized, respectively, and the efficiency was significantly higher than that when the pdCpA method was used. In addition, when ValRS was used for translation synthesis in the presence of 5 mM N-methylvaline, mass spectrometry of the peptide products was performed. In the case of wild-type ValRS, a peptide containing unmodified valine was detected as the main product, whereas in the case of modified ValRS, a peptide containing N-methylvaline was observed as the main product (Example 2). Then, by introducing a mutation into the editing domain of ValRS to reduce the aminoacylation activity of unmodified Val, the selectivity for N-methylvaline was successfully improved (Example 7). In addition, when a sequence containing two or three consecutive valines was translated, it was confirmed that a peptide containing two or three consecutive N-methylvalines was synthesized, respectively (Example 2). In addition, in the case of SerRS, under conditions in which a translation product containing unmodified serine was detected as the main product in the case of wild-type SerRS, a translation product containing N-methylserine was detected as the main product when modified SerRS was used (Example 3).In addition, in the case of ThrRS, under conditions where a translation product incorporating unmodified Thr was detected when wild-type ThrRS was used, a translation product incorporating N-methyl Thr was observed when modified ThrRS was used, whereas a translation product incorporating unmodified Thr was hardly observed, indicating that a peptide incorporating N-methyl Thr was synthesized with higher purity than when wild-type ThrRS was used (Example 4). In the case of TrpRS, unmodified Trp was detected as the main product when wild-type TrpRS was used, whereas a translation product incorporating N-methyl Trp was observed as the main product when modified TrpRS was used (Example 5). In the case of LeuRS, a translation product containing N-methyl Leu was not observed when wild-type LeuRS was used, whereas it was found that a translation product incorporating N-methyl Leu was generated at a level almost equal to that containing unmodified Leu when modified LeuRS was used (Example 6). In this way, when the modified ARS of the present invention is used, it becomes possible to introduce N-methyl amino acids into peptides with higher efficiency than when wild-type ARS is used.

[0020] Accordingly, the following invention is provided. The present invention provides an ARS that is reactive to N-methyl amino acids. Specifically, the present invention relates to ARSs with modified amino acid sequences that can incorporate N-methyl amino acids, particularly six N-methyl-substituted amino acids, N-methyl-phenylalanine, N-methyl-valine, N-methyl-serine, N-methyl-threonine, N-methyltryptophan, and N-methylleucine, more efficiently than natural aminoacyl-tRNA synthetase (ARS), and their uses. The ARSs with modified amino acid sequences of the present invention can produce peptides containing any N-methyl amino acid selectively and regioselectively from these N-methyl amino acids with high efficiency.

[0021] The present invention further relates to a method for producing a polypeptide containing an unnatural amino acid using the modified ARS of the present invention, more specifically, to a method for producing a polypeptide containing N-methylphenylalanine, N-methylvaline, N-methylserine, N-methylthreonine, N-methyltryptophan, and N-methylleucine using the ARS of phenylalanine, valine, serine, threonine, tryptophan, and leucine, respectively, whose amino acid sequences have been modified.

[0022] That is, the present invention provides the following inventions. [1] A polypeptide comprising a modified aminoacyl-tRNA synthetase (ARS), which is capable of incorporating N-methyl amino acids more efficiently than the original natural ARS. [2] A polypeptide having aminoacyl-tRNA synthetase (ARS) activity that has been modified to enhance aminoacylation reaction with N-methylamino acids, the modification including at least one substitution with an amino acid that reduces the molecular weight by 10 or more. [3] The polypeptide according to [1] or [2], wherein the N-methyl amino acid is selected from the group consisting of valine, serine, phenylalanine, threonine, tryptophan and leucine. [4] The polypeptide according to any one of [1] to [3], wherein the ARS is selected from the group consisting of ValRS, SerRS, the alpha subunit of PheRS, ThrRS, TrpRS and LeuRS. [5] The polypeptide described in any of [1] to [4], wherein the ValRS is modified at a position corresponding to asparagine 43 and / or threonine 45 and / or threonine 279 of ValRS derived from Escherichia coli. [6] The polypeptide according to any one of [1] to [4], wherein the SerRS is modified at a position corresponding to glutamic acid at position 239 and / or threonine at position 237 of SerRS derived from Escherichia coli. [7] The polypeptide according to any one of [1] to [4], wherein the PheRS α subunit is modified at a position corresponding to glutamine at position 169 of the PheRS α subunit derived from Escherichia coli. [8] The polypeptide according to any one of [1] to [4], wherein the ThrRS is modified at a position corresponding to methionine at position 332 and / or histidine at position 511 of ThrRS derived from Escherichia coli. [9] The polypeptide according to any one of [1] to [4], wherein the TrpRS is modified at a position corresponding to methionine at position 132, glutamine at position 150, and / or histidine at position 153 of TrpRS derived from Escherichia coli.

[10] The polypeptide according to any one of [1] to [4], wherein the LeuRS is modified at a position corresponding to tyrosine 43 of LeuRS derived from Escherichia coli.

[11] The polypeptide described in any of [1] to [4], wherein the ValRS is (a) glycine or alanine at the position corresponding to asparagine 43, and / or (b) serine at the position corresponding to threonine 45, and / or (c) glycine or alanine at the position corresponding to threonine 279 of the ValRS derived from Escherichia coli.

[12] The polypeptide described in any of [1] to [4], wherein the SerRS is (a) glycine or alanine at the position corresponding to glutamic acid at position 239 of Escherichia coli SerRS, and / or (b) serine at the position corresponding to threonine at position 237.

[13] The polypeptide according to any one of [1] to [4], wherein the PheRS α subunit has glycine or alanine at the position corresponding to glutamine 169 in the PheRS α subunit derived from Escherichia coli.

[14] The polypeptide according to any one of [1] to [4], wherein the ThrRS has glycine at positions corresponding to methionine at position 332 and / or histidine at position 511 of ThrRS derived from Escherichia coli.

[15] The polypeptide according to any one of [1] to [4], wherein the TrpRS is an Escherichia coli-derived TrpRS in which (a) the position corresponding to methionine 132 is alanine or valine, and / or (b) the position corresponding to glutamine 150 is alanine, and / or (c) the position corresponding to histidine 153 is alanine.

[16] The polypeptide according to any one of [1] to [4], wherein the LeuRS has glycine at the position corresponding to tyrosine 43 of LeuRS derived from Escherichia coli.

[17] The polypeptide according to any one of [1] to

[16] , wherein the ARS is derived from a bacterium.

[18] The polypeptide described in

[17] , wherein the bacterium is Escherichia coli.

[19] The polypeptide according to any one of [1] to

[18] , which is selected from the group consisting of the following (a) and (b): (a) a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-11 and 182-187; (b) a polypeptide comprising an amino acid sequence having at least 90% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 11 and 182 to 187.

[20] An isolated polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 11 and 182 to 187.

[21] A fusion polypeptide comprising the polypeptide according to any one of [1] to

[20] above and another polypeptide.

[22] A polynucleotide encoding the polypeptide according to any one of [1] to

[21] .

[23] A vector comprising the polynucleotide described in

[22] .

[24] A host cell comprising the polynucleotide described in

[22] or the vector described in

[23] .

[25] A method for producing the polypeptide according to any one of [1] to

[21] , comprising the step of culturing the host cell according to

[24] .

[26] A method for producing a tRNA acylated with an N-methylamino acid, comprising the step of contacting the N-methylamino acid with a tRNA in the presence of the polypeptide according to any one of [1] to

[20] .

[27] The method according to

[26] , wherein the contacting step is carried out in a cell-free translation system.

[28] A method for producing a polypeptide containing an N-methyl amino acid, comprising a step of translating in the presence of the polypeptide according to any one of [1] to

[20] and an N-methyl amino acid.

[29] The method according to

[28] , wherein the translation step is carried out in a cell-free translation system. The present invention also relates to the following inventions. [1] A polypeptide comprising a modified aminoacyl-tRNA synthetase (ARS), which is capable of incorporating N-methyl amino acids more efficiently than the original natural ARS. [2] A polypeptide having aminoacyl-tRNA synthetase (ARS) activity that has been modified to enhance aminoacylation reaction with N-methylamino acids, the modification including at least one substitution with an amino acid that reduces the molecular weight by 10 or more. [3] The polypeptide according to [1] or [2], wherein the N-methyl amino acid is selected from the group consisting of valine, serine, phenylalanine, threonine, tryptophan and leucine. [4] The polypeptide according to any one of [1] to [3], wherein the ARS is selected from the group consisting of ValRS, SerRS, the α subunit of PheRS, ThrRS, TrpRS and LeuRS. [5] The polypeptide according to any one of [1] to [4], wherein the ARS comprises any one of the ARSs selected from the following (a) to (l): (a) ValRS modified at the positions corresponding to asparagine at position 43 and / or threonine at position 45 and / or threonine at position 279 of ValRS derived from Escherichia coli; (b) SerRS modified at the positions corresponding to glutamic acid at position 239 and / or threonine at position 237 of SerRS derived from Escherichia coli; (c) a PheRSα subunit in which the position corresponding to glutamine 169 of the PheRSα subunit derived from Escherichia coli has been modified; (d) ThrRS modified at the positions corresponding to methionine at position 332 and / or histidine at position 511 of ThrRS derived from Escherichia coli; (e) TrpRS modified at the positions corresponding to methionine at position 132, glutamine at position 150, and / or histidine at position 153 of TrpRS derived from Escherichia coli; (f) LeuRS modified at the position corresponding to tyrosine 43 of LeuRS derived from Escherichia coli; (g) a ValRS derived from Escherichia coli in which (a) the position corresponding to asparagine 43 is glycine or alanine, and / or (b) the position corresponding to threonine 45 is serine, and / or (c) the position corresponding to threonine 279 is glycine or alanine; (h) SerRS derived from Escherichia coli, in which (a) the position corresponding to glutamic acid at position 239 is glycine or alanine, and / or (b) the position corresponding to threonine at position 237 is serine; (i) a PheRSα subunit in which the position corresponding to glutamine 169 in the PheRSα subunit derived from Escherichia coli is glycine or alanine; (j) ThrRS in which the positions corresponding to methionine at position 332 and / or histidine at position 511 of ThrRS derived from Escherichia coli are glycine, (k) TrpRS derived from Escherichia coli, in which (a) the position corresponding to methionine 132 is alanine or valine, and / or (b) the position corresponding to glutamine 150 is alanine, and / or (c) the position corresponding to histidine 153 is alanine. And, (l) LeuRS in which the position corresponding to tyrosine 43 of LeuRS derived from Escherichia coli is glycine. [6] The polypeptide according to any one of [1] to [5], wherein the ARS is derived from a bacterium. [7] The polypeptide according to [6], wherein the bacterium is Escherichia coli. [8] A polypeptide according to any one of [1] to [4], which is selected from the group consisting of the following (a) and (b): (a) a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-11 and 182-187; (b) a polypeptide comprising an amino acid sequence having at least 90% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 11 and 182 to 187. [9] A polynucleotide encoding the polypeptide according to any one of [1] to [8].

[10] A vector comprising the polynucleotide described in [9].

[11] A host cell comprising the polynucleotide described in [9] or the vector described in

[10] .

[12] A method for producing the polypeptide according to any one of [1] to [8], comprising a step of culturing the host cell according to

[11] .

[13] A method for producing a tRNA acylated with an N-methylamino acid, comprising the step of contacting the N-methylamino acid with a tRNA in the presence of the polypeptide according to any one of [1] to [8].

[14] A method for producing a polypeptide containing an N-methyl amino acid, comprising a step of translating in the presence of the polypeptide according to any one of [1] to [8] and an N-methyl amino acid.

[15] The method according to

[14] , wherein the translation step is carried out in a cell-free translation system. Effect of the Invention

[0023] The modified ARS of the present invention enables efficient linkage of N-methylphenylalanine, N-methylvaline, N-methylthreonine, N-methylserine, N-methyltryptophan, and N-methylleucine to natural tRNAs for phenylalanine, valine, threonine, serine, tryptophan, and leucine without complicated reactions.

[0024] Furthermore, according to the method using the modified ARS of the present invention, tRNA does not require a stoichiometric amount, and can be produced with high translation efficiency even in peptide synthesis in which multiple N-methyl amino acids are introduced, making it useful for creating a highly diverse peptide library.

[0025] In addition, in order to confirm the effect of the ARS characteristic of "constantly supplying aminoacyl-tRNA during the translation reaction" on the translation efficiency, the inventors of the present application compared the introduction efficiency of N-methylphenylalanine using two methods: the modified PheRS05 (SEQ ID NO: 2) obtained in the present invention and the pdCpA method, in which aminoacyl-tRNA regeneration during the translation reaction is not expected. As a result, the translation efficiency was higher when the modified ARS was used, and the target peptide was synthesized at a yield of about 4-8 times in the case of two or three consecutive introductions of N-methylphenylalanine (unpublished data). Thus, the present invention makes it possible to more efficiently produce polypeptides containing N-methylamino acids, which have been difficult to produce in the past. [Brief description of the drawings]

[0026] [Figure 1] This is a graph evaluating the aminoacylation activity of modified PheRS. Compared to wild-type PheRS, when PheRS04 and PheRS05 were used, the band of the synthetic peptide acylated with N-methylphenylalanine was observed to be stronger (lanes 8 and 9 vs. 12 and 13). [Diagram 2] Electrophoretic confirmation of peptides translated and synthesized using PheRS mutants. Compared to wild-type PheRS, when modified PheRS was used, the band of peptides containing N-methylphenylalanine was observed to be stronger (lanes 2 and 3 vs. 5 and 6). [Figure 3-1] 1 shows detection by mass spectrometry of peptides translationally synthesized using modified PheRS, (a) mass spectra obtained when translationally synthesized using 0.1 μM wt PheRS and 0.25 mM Phe, (b) 0.1 μM wt PheRS and 0.25 mM MePhe, and (c) 0.1 μM wt PheRS and 1 mM MePhe. [Figure 3-2] 1 shows detection by mass spectrometry of peptides translationally synthesized using modified PheRS, (d) mass spectra obtained by translational synthesis using 0.1 μM PheRS05 and 0.25 mM Phe, (e) 0.1 μM PheRS05 and 0.25 mM MePhe, and (f) 0.1 μM PheRS05 and 1 mM MePhe. [Figure 4] 1 shows aminoacylation reactions using modified ValRS, in which more tRNA acylated with N-methylvaline is observed in mutant 13 (ValRS13) than in the wild type (lane 10). [Diagram 5] Figure 1 shows mass spectrometry of peptides translated using modified ValRS (a) wild-type ValRS, (b) ValRS13, and (c) ValRS04. When ValRS13 was used, peptides containing MeVal were observed as the main product. [Figure 6] 1 shows an aminoacylation reaction using ValRS13-11. In the mutant 13-11 (ValRS13-11), a larger amount of tRNA acylated with N-methylvaline was observed compared to the wild type and mutant 13 (ValRS13). [Figure 7] Figure 1 shows a comparison of the activities of ValRS13 and ValRS13-11. Mass spectra of N-methyl peptide-containing peptides translated using ValRS13 ((a), (c), (e)) and ValRS13-11 ((b), (d), (f)). It can be seen that the purity of the target N-methylvaline-containing peptide is higher when translated using ValRS13-11. [Figure 8] 1 shows aminoacylation reactions using modified SerRS, in which tRNA acylated with N-methylserine is observed in mutants 03, 35, and 37 (lanes 3, 25, and 27). [Figure 9]Figure 1 shows mass spectrometry of peptides translated and synthesized using modified SerRS. Mass spectra of N-methylserine-containing peptides translated using (a) wild type, (b) SerRS03, (c) SerRS05, (d) SerRS35, and (e) SerRS37. The desired MeSer-containing peptides were synthesized with higher purity when each modified form was used compared to the wild type. [Figure 10] Figure 1 shows mass spectrometry of peptides translated and synthesized using modified ThrRS. Mass spectra of N-methylthreonine-containing peptides translated using (a) the wild type, (b) ThrRS03, and (c) ThrRS14. The target MeThr-containing peptides were synthesized with higher purity when each modified peptide was used compared to the wild type. [Figure 11] Figure 1 shows mass spectrometry of peptides translated and synthesized using modified TrpRS. (a) Mass spectra of peptides translated using wild-type TrpRS, (b) TrpRS04, (c) TrpRS05, and (d) TrpRS18. When TrpRS04, 05, and 18 were used, peptides containing MeW were observed as the main products. [Figure 12] Figure 1 shows mass spectrometry of peptides translated and synthesized using modified LeuRS (a) mass spectrum of peptides translated using wild-type LeuRS and (b) mass spectrum of peptides translated using LeuRS02. When LeuRS02 was used, peptides containing MeL were observed as the main product. [Figure 13] Fig. 1 shows the aminoacylation reaction of MeVal using modified ValRS with a mutation in the editing domain. There is no significant difference in activity among the three mutants 13-11, 66, and 67 (lanes 17, 18, and 19). [Figure 14] Fig. 1 shows the aminoacylation reaction of Val using a modified ValRS with a mutation in the editing domain. Compared to mutant 13-11, mutants 66 and 67 showed reduced activity (lanes 17 vs. 18 and 19). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0027] The present invention aims to provide an enzyme mutant having an altered enzyme-substrate specificity of aminoacyl-tRNA synthetase. More specifically, the present invention is characterized in that an aminoacyl-tRNA synthetase mutant capable of efficiently and selectively mass-producing a polypeptide containing an N-methyl amino acid is prepared by modifying the amino acid sequence of a natural aminoacyl-tRNA synthetase.

[0028] The present invention provides a polypeptide comprising an ARS capable of reacting with an N-methyl amino acid. More specifically, the present invention provides a polypeptide comprising a modified ARS, which is capable of reacting with an N-methyl amino acid more efficiently than the original natural ARS. The present invention also provides a polypeptide comprising a modified ARS, which is an ARS capable of reacting to incorporate an N-methyl amino acid more efficiently than the original natural ARS. The polypeptide of the present invention is a polypeptide having aminoacyl-tRNA synthetase activity, which is modified so as to enhance the aminoacylation reaction by an N-methyl amino acid. Here, the incorporation of an N-methyl amino acid refers to, for example, aminoacylation of a corresponding tRNA with an N-methyl amino acid, and may be the binding of an N-methyl amino acid to the tRNA, or the incorporation of an N-methyl amino acid into a synthetic protein in a translation reaction using an aminoacyl-tRNA produced by the acylation reaction. In addition, the term "a polypeptide having aminoacyl-tRNA synthetase activity" includes not only the case where the polypeptide alone exhibits aminoacyl-tRNA synthetase activity, but also the case where the polypeptide exhibits aminoacyl-tRNA synthetase activity in cooperation with other factors. For example, when an aminoacyl-tRNA synthetase is composed of multiple subunits, the polypeptide of the present invention may be one of the subunits, or may be a complex with other subunits that exhibits aminoacyl-tRNA synthetase activity. In such a case, when the modified polypeptide of the present invention is allowed to form an aminoacyl-tRNA synthetase complex together with other wild-type subunits, the aminoacylation reaction with N-methyl amino acids is enhanced compared to an aminoacyl-tRNA synthetase complex composed of wild-type subunits. That is, in the present invention, the polypeptide having aminoacyl-tRNA synthetase activity and modified so as to enhance the aminoacylation reaction with N-methyl amino acids includes a polypeptide in which one subunit of an aminoacyl-tRNA synthetase complex composed of multiple subunits is modified, and the polypeptide modified so as to enhance the aminoacylation reaction with N-methyl amino acids possessed by the aminoacyl-tRNA synthetase complex.

[0029] Furthermore, a polypeptide containing a modified ARS refers to a polypeptide containing a polypeptide chain of a modified ARS, and specifically, the polypeptide is a polypeptide containing the amino acid sequence of a modified ARS. Furthermore, the original natural ARS refers to a natural ARS from which the modified ARS is derived, and may be, for example, a wild-type ARS, and also includes naturally occurring polymorphisms. Furthermore, being capable of reacting with an N-methyl amino acid means that the modified ARS can carry out an enzymatic reaction using an N-methyl amino acid as a substrate. The reaction may be, for example, a reaction of acylation of a tRNA with an N-methyl amino acid, and specifically, a reaction of catalyzing a binding reaction between an N-methyl amino acid and a tRNA. For example, depending on the amino acid that the ARS uses as a substrate, the reaction may be carried out in the presence of the corresponding N-methyl amino acid and the corresponding tRNA, and the binding between the N-methyl amino acid and the tRNA may be detected. Alternatively, the reaction with an N-methyl amino acid may be the incorporation of an N-methyl amino acid into a polypeptide during translation. For example, by performing translation in the presence of a modified ARS and an N-methyl amino acid, and detecting the incorporation of the N-methyl amino acid into the polypeptide produced by translation, it is possible to detect whether the ARS has produced an N-methyl amino acid-tRNA. The higher the incorporation of the N-methyl amino acid into the polypeptide, the higher the reactivity with the N-methyl amino acid is judged to be.

[0030] Moreover, being able to react more efficiently than the original natural ARS may mean reacting more efficiently than the original natural ARS under at least certain conditions, or may mean being able to confirm a reaction or reaction product that cannot be confirmed with the original ARS. For example, if a polypeptide incorporating an N-methyl amino acid is produced in greater amounts when the modified ARS is used than when the original natural ARS is used, the modified ARS is judged to react with the N-methyl amino acid more efficiently than the original natural ARS. Also, for example, if the production of a polypeptide containing an N-methyl amino acid cannot be confirmed when the original natural ARS is used, but can be confirmed when the modified ARS is used, the modified ARS is judged to react with the N-methyl amino acid more efficiently than the original natural ARS. For example, if the production of a polypeptide containing two, three or more consecutive N-methyl amino acids cannot be confirmed when the original natural ARS is used, but can be confirmed when the modified ARS is used, the modified ARS is judged to react with the N-methyl amino acid more efficiently than the original natural ARS.

[0031] In addition, being able to react more efficiently than the original natural ARS may mean that the target reactant is purified to a higher purity than the original natural ARS at least under certain conditions. For example, when a modified ARS is used rather than the original natural ARS, if a greater amount of polypeptide incorporating an N-methyl amino acid is produced compared to the natural amino acid derived from contamination, the modified ARS is judged to react with an N-methyl amino acid more efficiently than the original natural ARS. Alternatively, if it is confirmed that the reaction efficiency with an N-methyl amino acid remains unchanged while the reaction efficiency with a natural amino acid is decreased, the modified ARS is judged to react with an N-methyl amino acid more efficiently than the original ARS. For example, if the reactivity with an N-methyl amino acid is relatively increased compared to the reactivity with a natural amino acid, the modified ARS is judged to react with an N-methyl amino acid more efficiently than the original natural ARS.

[0032] There is no particular limitation on the N-methyl amino acid, but one that corresponds to the ARS is appropriately selected. For example, if the modified ARS is the ARS of valine (ValRS), the N-methyl amino acid is N-methylvaline; if the modified ARS is the ARS of threonine (Thr), the N-methyl amino acid is N-methylthreonine; if the modified ARS is the ARS of serine (SerRS), the N-methyl amino acid is N-methylserine; if the modified ARS is the ARS alpha subunit of phenylalanine (PheRS), the N-methyl amino acid is N-methylphenylalanine; if the modified ARS is the ARS of tryptophan (TrpRS), the N-methyl amino acid is N-methyltryptophan; if the modified ARS is the ARS of leucine (LeuRS), the N-methyl amino acid is N-methylleucine.

[0033] For example, in the case of ValRS, the modification site of ARS is preferably the position corresponding to asparagine at position 43 and / or threonine at position 45 and / or threonine at position 279 of ValRS derived from Escherichia coli. It is preferably a combination of any two positions selected from the positions corresponding to asparagine at position 43, threonine at position 45 and threonine at position 279 (for example, a combination of positions 43 and 45, 43 and 279, or 45 and 279), more preferably a combination of positions corresponding to asparagine at position 43, threonine at position 45 and threonine at position 279. In the case of SerRS, it can be modified at the position corresponding to glutamic acid at position 239 and / or threonine at position 237 of SerRS derived from Escherichia coli, more preferably a combination of positions corresponding to glutamic acid at position 239 and threonine at position 237. In the case of PheRSα subunit, it is preferable to modify at the position corresponding to glutamine at position 169 of PheRS derived from Escherichia coli. In the case of ThrRS, the modification can be performed at the position corresponding to methionine at position 332 and / or histidine at position 511 of ThrRS derived from E. coli. In the case of TrpRS, the modification can be performed at the position corresponding to methionine at position 132 and / or glutamine at position 150 and / or histidine at position 153 of TrpRS derived from E. coli, preferably a combination of any two positions selected from the positions corresponding to methionine at position 132, glutamine at position 150 and histidine at position 153 (for example, a combination of positions 132 and 150, 132 and 153, or 150 and 153), more preferably a combination of positions corresponding to methionine at position 132, glutamine at position 150 and histidine at position 153. In the case of LeuRS, the modification can be performed at the position corresponding to tyrosine at position 43 of LeuRS derived from E. coli. These modified ARSs also include those further modified at other positions. Here, the position number of each ARS is represented with the initiation methionine of each ARS derived from E. coli being number 1.Specifically, the position numbers of each ARS are expressed with the first methionine in the sequence (UniProt (http: / / www.uniprot.org / )) of ValRS: P07118 (SEQ ID NO: 24), PheRS α subunit: P08312 (SEQ ID NO: 28), ThrRS: P0A8M3 (SEQ ID NO: 29), SerRS: P0A8L1 (SEQ ID NO: 26), TrpRS: P00954 (SEQ ID NO: 188), and LeuRS: P07813 (SEQ ID NO: 189), set as 1. In addition, the position of an ARS that corresponds to an amino acid in the E. coli-derived ARS refers to the position of an ARS that corresponds to that amino acid in the E. coli-derived ARS. The term "position" refers to an amino acid located at a position corresponding to an amino acid in the ARS derived from E. coli, and can be identified based on the structural similarity between the two. For example, by aligning the amino acid sequences of the target ARS and the ARS derived from E. coli, the corresponding amino acid can be identified as an amino acid aligned at the position of the amino acid in the ARS derived from E. coli. In the present invention, the position corresponding to an amino acid in the ARS derived from E. coli is preferably a position three-dimensionally corresponding to an amino acid in the ARS derived from E. coli. The three-dimensionally corresponding position refers to the position of an amino acid that corresponds to the position of the amino acid in the ARS derived from E. coli in the three-dimensional structure of the ARS.

[0034] A person skilled in the art can easily identify the sterically equivalent position by, for example, using Multiple Sequence Alignment in ClustalW ver2.1 (http: / / clustalw.ddbj.nig.ac.jp) with default parameters to align the E. coli ARS with all known ARSs of other organisms. In particular, the ARSs of interest are not limited to prokaryotes. In general, ARS sequences in eukaryotes have various functional domains in addition to the catalytic domain, and the sequence identity with ARSs derived from prokaryotes is not necessarily high. On the other hand, the sequences of catalytic sites such as amino acid recognition sites and editing sites (editing domains) are highly conserved, and it is possible to easily identify the sterically equivalent positions of ARSs derived from eukaryotes using public alignment methods. For example, the sites corresponding to positions 43 and 45 of E. coli ValRS may be the amino acid sites "N / Y / T" and "T / S", respectively, of the PPP(N / Y / T)X(T / S)G motif (SEQ ID NO: 180; "N / Y / T" is preferably N; X is any amino acid, preferably V, I or P, more preferably V; "T / S" is preferably T) present in ValRS of another organism. More preferably, the sites corresponding to positions 43 and 45 of E. coli ValRS may be the amino acid sites N and T, respectively, of the PPPNXTG motif (SEQ ID NO: 181; X is any amino acid, preferably V, I or P, more preferably V) present in ValRS of another organism. For example, the position corresponding to asparagine 43 of E. coli ValRS is asparagine 345 in Human (Uniprot P26640) and asparagine 191 in Saccharomyces cervisiae (Uniprot P07806).

[0035] The modification of ARS preferably includes substitution of at least one amino acid with an amino acid that reduces the molecular weight by at least 10. Such modifications include, for example, modifying an amino acid other than Thr (T), such as an amino acid selected from the group consisting of Gln (Q), Asn (N), Glu (E), Met (M), Tyr (Y) and His (H), to Ala (A) or Gly (G) (preferably to Gly), and also, for example, modifying Thr (T) to Ser (S), and also, for example, modifying Met (M) to Val (V).

[0036] The amino acid to be modified may be appropriately selected. For example, in the case of ValRS, the position corresponding to asparagine at position 43 of ValRS derived from E. coli is preferably modified to glycine or alanine, the position corresponding to threonine at position 45 of ValRS derived from E. coli is preferably modified to serine, and the position corresponding to threonine at position 279 of ValRS derived from E. coli is preferably modified to glycine or alanine. In the case of SerRS, the position corresponding to glutamic acid at position 239 of SerRS derived from E. coli is preferably modified to glycine or alanine, and the position corresponding to threonine at position 237 of SerRS derived from E. coli is preferably modified to serine. In the case of PheRS, the position corresponding to glutamine at position 169 of the PheRSα subunit derived from E. coli is preferably modified to glycine or alanine. In the case of ThrRS, the position corresponding to methionine at position 332 of ThrRS derived from E. coli is preferably modified to glycine, and the position corresponding to histidine at position 511 of ThrRS derived from E. coli is preferably modified to glycine. In the case of TrpRS, the position corresponding to methionine 132 of E. coli-derived TrpRS is preferably modified to valine or alanine, the position corresponding to glutamine 150 of E. coli-derived TrpRS is preferably modified to alanine, and the position corresponding to histidine 153 of E. coli-derived TrpRS is preferably modified to alanine. In the case of LeuRS, the position corresponding to tyrosine 43 of E. coli-derived LeuRS is preferably modified to glycine.

[0037] Specifically, the present invention includes the following polypeptides: (a) A polypeptide comprising any one of the amino acid sequences of SEQ ID NOs: 3 to 5, 182 and 183 (ValRS04, ValRS13, ValRS13-11, ValRS66 and ValRS67). (b) a polypeptide having at least 90% identity to any one of the amino acid sequences of SEQ ID NOs: 3 to 5, 182, and 183, and having reactivity with N-methyl Val, the polypeptide containing at least one amino acid listed in the following (i) to (iii): (i) the amino acid at the position corresponding to position 43 of SEQ ID NOs: 3 to 5, 182, and 183 is Gly or Ala; (ii) the amino acid at the position corresponding to position 45 of SEQ ID NOs: 3 to 5, 182, and 183 is Ser; and (iii) The amino acid at the position corresponding to position 279 in SEQ ID NOs: 3 to 5, 182, and 183 is Gly or Ala. The reactivity is preferably higher than that of (i) the amino acid at position 43 is Asn, and / or (ii) the amino acid at position 45 is Thr, and / or (iii) the amino acid at position 279 is Thr. For example, the ValRS of the present invention preferably has a higher reactivity with N-methyl Val than that of a ValRS in which the amino acid at position 43 is Asn, the amino acid at position 45 is Thr, and the amino acid at position 279 is Thr.

[0038] The present invention also includes the following polypeptides: (a) A polypeptide comprising any one of the amino acid sequences of SEQ ID NOs: 6 to 9 (SerRS03, SerRS05, SerRS35, and SerRS37). (b) a polypeptide having at least 90% identity to any one of the amino acid sequences of SEQ ID NOs: 6 to 9, and having reactivity to N-methyl Ser, the polypeptide containing at least one amino acid described in the following (i) and (ii): (i) the amino acid at the position corresponding to position 237 of SEQ ID NOs: 6 to 9 is Ser; and (ii) The amino acid at the position corresponding to position 239 in SEQ ID NOs: 6 to 9 is Gly or Ala. The reactivity is preferably higher than that of (i) the amino acid at the position corresponding to position 237 is Thr and / or (ii) the amino acid at the position corresponding to position 239 is Glu. For example, the SerRS of the present invention is preferably higher in reactivity with N-methylSer than a SerRS in which the amino acid at the position corresponding to position 237 is Thr and the amino acid at the position corresponding to position 239 is Glu.

[0039] The present invention also includes the following polypeptides: (a) A polypeptide comprising any one of the amino acid sequences of SEQ ID NOs: 1 to 2 (PheRS05 and PheRS04). (b) A polypeptide having at least 90% identity with any of the amino acid sequences of SEQ ID NOs: 1 to 2, and having reactivity with N-methyl Phe, comprising an amino acid sequence in which the amino acid at position 169 of any of SEQ ID NOs: 1 to 2 is Gly or Ala. The reactivity is preferably higher than when the amino acid at that position is Gln. Since the above polypeptide is an α subunit of ARS, a functional ARS can be obtained by forming a complex with a β subunit. There is no particular limitation on the β subunit, and for example, a desired wild-type subunit can be used, but as an example, a subunit containing the amino acid sequence of NCBI Reference Sequence WP_000672380 (for example, WP_000672380.1) (the base sequence is 1897337-1899721 of GenBank CP009685 (for example, CP009685.1)) can be used.

[0040] The present invention also includes the following polypeptides: (a) A polypeptide comprising any one of the amino acid sequences of SEQ ID NOs: 10 to 11 (ThrRS03 and ThrRS14). (b) a polypeptide having at least 90% identity to any one of the amino acid sequences of SEQ ID NOs: 10 to 11 and having reactivity to N-methyl Thr, the polypeptide containing at least one amino acid described in the following (i) and (ii): (i) the amino acid at the position corresponding to position 332 of SEQ ID NOs: 10 to 11 is Gly; and (ii) The amino acid at the position corresponding to position 511 in SEQ ID NOs: 10 to 11 is Gly. The reactivity is preferably higher than that of (i) a ThrRS having Met at the amino acid position corresponding to position 332 and / or (ii) His at the amino acid position corresponding to position 511. For example, the ThrRS of the present invention is preferably higher in reactivity to N-methyl Thr than a ThrRS having Met at the amino acid position corresponding to position 332 and His at the amino acid position corresponding to position 511 of the ThrRS.

[0041] The present invention also includes the following polypeptides: (a) A polypeptide comprising any one of the amino acid sequences of SEQ ID NOs: 184-186 (TrpRS04, TrpRS05 and TrpRS18). (b) a polypeptide having at least 90% identity to any one of the amino acid sequences of SEQ ID NOs: 184-186 and having reactivity with N-methyl Trp, the polypeptide containing at least one amino acid listed in any one of (i) to (iii) below: (i) the amino acid at the position corresponding to position 132 of SEQ ID NO: 184-186 is Val or Ala; (ii) the amino acid at the position corresponding to position 150 of SEQ ID NO: 184-186 is Ala; (iii) the amino acid at the position corresponding to position 153 of SEQ ID NO: 184-186 is Ala. The reactivity is preferably higher than that of (i) the amino acid at position 132 is Met, and / or (ii) the amino acid at position 150 is Gln, and / or (iii) the amino acid at position 153 is His. For example, the TrpRS of the present invention is preferably more reactive to N-methylTrp than a TrpRS having an amino acid Met at position 132, an amino acid Gln at position 150, and an amino acid His at position 153 of the TrpRS.

[0042] The present invention also includes the following polypeptides: (a) A polypeptide comprising the amino acid sequence of SEQ ID NO: 187 (LeuRS02). (b) A polypeptide having at least 90% identity to the amino acid sequence of SEQ ID NO: 187, and comprising an amino acid sequence in which the amino acid at position 43 of SEQ ID NO: 187 is Gly, and having reactivity to N-methyl-Leu. The reactivity is preferably higher than that when (i) the amino acid at the position corresponding to 43 is Tyr.

[0043] Here, the identity of the amino acid sequences is preferably 93% or more, more preferably 95% or more, more preferably 97% or more, 98% or more, or 99% or more.

[0044] The N-methylaminoacyl-tRNA synthetase of the present invention is characterized in that it can efficiently acylate tRNA with N-methylamino acids, which are known to improve the drug-likeness of peptides as non-natural amino acids. The N-methylaminoacyl-tRNA synthetase of the present invention may be derived from any organism, such as bacteria such as Escherichia coli, yeast, animals, or plants. However, those that are highly conserved in sequence with the aminoacyl-tRNA synthetases exemplified in the Examples of the present specification (SEQ ID NOs: 1 to 11, 182 to 187) and therefore have corresponding mutation sites that are easy to identify in other organisms are preferred for their versatility. For example, the polypeptide containing the modified ARS of the present invention may be derived from the ARS of a eukaryote or a prokaryote. Eukaryotes include protists (including protozoans and unicellular green algae), fungi (including ascomycetes and basidiomycetes), plants (including bryophytes, ferns, and seed plants (gymnosperms and angiosperms)), and animals (including invertebrates and vertebrates), and prokaryotes include archaea (including thermophiles and methanogens) and eubacteria (including cyanobacteria and Escherichia coli). The polypeptide containing the modified ARS of the present invention may be derived from a mammal (human, mouse, rat, guinea pig, rabbit, sheep, monkey, goat, donkey, cow, horse, pig, etc.). The polypeptide containing the modified ARS of the present invention may be derived from, for example, Escherichia coli or yeast, and is preferably derived from a prokaryote, for example, a bacterium. The polypeptides of the present invention are derived from bacteria of the Family Enterobacteriaceae, for example, from Escherichia coli, and examples thereof include, but are not limited to, the genus Escherichia (including E. coli, E. albertii, E. fergusonii), the genus Shigella (including S. dysenteriae, S. flexneri, S. boydii, S. sonnei, S. enterica, S. bongori), the genus Citrobacter (including C. rodentium, C. koseri, C. farmeri, C. youngae), the genus Kluyvera (including K. ascorbata), the genus Trabulsiella (including T. guamensis), and the genus Klebsiella.

[0045] In addition, in the examples of the present specification, since the N-methylaminoacyl tRNA synthetase derived from Escherichia coli has been used as an example, the modification position is for Escherichia coli. When the N-methylaminoacyl tRNA synthetase derived from another organism is used, the amino acid at the position corresponding to the amino acid sequence position of the N-methylaminoacyl tRNA synthetase derived from Escherichia coli in terms of sequence homology should be modified. Since ARS is an enzyme involved in the core of the translation mechanism that all organisms possess, it is generally highly conserved. Therefore, a desired ARS can be modified based on the method of the present invention to obtain a modified ARS with increased ability to incorporate N-methyl amino acids.

[0046] When introducing an amino acid into N-methylaminoacyl-tRNA synthetase, the distance from the N-methyl group and the interaction with the amino acid and hydrophilicity, hydrogen bonds, and size of the side chain are taken into consideration, and for example, when preventing steric repulsion between the amino acid at that position and the N-methyl group, the distance from the N-methylamino group can be adjusted by, for example, modifying an amino acid with a large molecular weight to an amino acid with a small molecular weight. Specifically, for example, the molecular weight can be reduced by changing threonine (Thr) to serine (Ser), and the distance can be adjusted.

[0047] For example, when the amino acid to be modified by N-methylaminoacyl-tRNA synthetase is asparagine, examples of the amino acid with a small molecular weight include, but are not limited to, serine, valine, glycine, aspartic acid, or alanine. When the amino acid to be modified is glutamic acid, examples of the amino acid with a small molecular weight include, but are not limited to, alanine, valine, serine, alanine, and aspartic acid. When the amino acid to be modified is Thr, examples of the amino acid with a small molecular weight include, but are not limited to, alanine, valine, serine, alanine, and aspartic acid. When the amino acid to be modified is other than Thr, examples of the amino acid with a small molecular weight include, but are not limited to, glycine (Gly) or alanine (Ala), and among these, glycine (Gly) is preferred. As a specific example, Thr can be replaced with Ser, Gln, Glu, and Asn can be replaced with Gly or Ala, and Met, His, Gln, etc. can be replaced with Gly, but are not limited thereto.

[0048] More specifically, examples of modifications of valine aminoacyl-tRNA synthetase (ValRS) include modifications of the amino acids at positions 43 and / or 45 and / or 279 of SEQ ID NO: 24 (natural ValRS) or amino acids at positions corresponding thereto. There is no limitation on which amino acids are substituted, but as described above, for example, Thr can be substituted with Ser, Ala or Gly, and other amino acids (e.g., Asn) can be substituted with Gly or Ala. For example, it is preferable to substitute the amino acid at position 43 of SEQ ID NO: 24 or an amino acid at a position corresponding thereto with Gly or Ala, and / or to substitute the amino acid at position 45 of SEQ ID NO: 24 or an amino acid at a position corresponding thereto with Ser, and to substitute the amino acid at position 279 or an amino acid at a position corresponding thereto with Gly or Ala. These substitutions may be any one of them, or any combination of these substitutions may be used (e.g., substitutions at positions 43 and 45, substitutions at positions 43 and 279, or substitutions at positions 45 and 279), or all of them may be substituted. In addition, other substitutions may be further combined. More specifically, it is preferable to substitute amino acids at positions N43 and / or T45 and / or T279 of SEQ ID NO: 24 or corresponding positions, and it is preferable to substitute with N43G and / or T45S and / or T279A.

[0049] In addition, the modification of serine aminoacyl-tRNA synthetase (SerRS) may be, for example, modification of the amino acids at positions 237 and / or 239 of SEQ ID NO: 26 (natural SerRS) or the amino acids at positions corresponding thereto. There is no limitation on which amino acids are substituted, but as described above, for example, Thr can be substituted with Ser, and other amino acids (for example, Glu) can be substituted with Gly or Ala. For example, it is preferable to substitute the amino acid at position 237 of SEQ ID NO: 26 or the amino acid at a position corresponding thereto with Ser, and / or to substitute the amino acid at position 239 of SEQ ID NO: 26 or the amino acid at a position corresponding thereto with Gly or Ala. These substitutions may be either one or both. In addition, other substitutions may be further combined. More specifically, it is preferable to substitute the amino acids at positions T237 and / or E239 of SEQ ID NO: 26 or the amino acids at positions corresponding thereto, and it is preferable to substitute T237S and / or E239G (or E239A).

[0050] In addition, in the modification of phenylalanine aminoacyl-tRNA synthetase α subunit (PheRS α), for example, the amino acid at position 169 of SEQ ID NO: 28 (natural PheRS α subunit) or an amino acid at a position equivalent thereto can be exemplified. There is no limitation on which amino acid is substituted, but for example, as described above, if it is Thr, it can be substituted with Ser, and if not, it can be substituted with glycine (Gly) or alanine (Ala) (more preferably Gly). For example, it is preferable to substitute the amino acid at position 169 of SEQ ID NO: 28 or an amino acid at a position equivalent thereto with Gly. In addition, other substitutions may be further combined. More specifically, it is preferable to substitute the amino acid at position Q169 of SEQ ID NO: 28 or an amino acid at a position equivalent thereto, and it is preferable to substitute with Q169G (or Q169A).

[0051] In addition, the modification of threonine aminoacyl-tRNA synthetase (ThrRS) may be, for example, modification of the amino acids at positions 332 and / or 511 of SEQ ID NO: 29 (natural ThrRS) or the amino acids at positions corresponding thereto. There is no limitation on which amino acids are substituted, but as described above, for example, Thr can be substituted with Ser, and other amino acids (for example, Met and His) can be substituted with Gly. For example, it is preferable to substitute the amino acid at position 332 of SEQ ID NO: 29 or the amino acid at a position corresponding thereto with Gly, and / or to substitute the amino acid at position 511 of SEQ ID NO: 29 or the amino acid at a position corresponding thereto with Gly. These substitutions may be either one or both. In addition, other substitutions may be further combined. More specifically, it is preferable to substitute the amino acids at positions M332 and / or H511 of SEQ ID NO: 29 or the amino acids at positions corresponding thereto, and it is preferable to substitute M332G and / or H511G.

[0052] In addition, examples of modification of tryptophan aminoacyl-tRNA synthetase (TrpRS) include modification of the amino acids at positions 132 and / or 150 and / or 153 of SEQ ID NO: 188 (natural TrpRS), or amino acids at positions corresponding thereto. There is no limitation on which amino acid is substituted, but, for example, as described above, Met can be substituted with Val or Ala, and other amino acids (e.g., Gln) can be substituted with Ala. In addition, for example, it is preferable to substitute the amino acid at position 132 of SEQ ID NO: 188, or an amino acid at a position corresponding thereto, with Val or Ala, and / or to substitute the amino acid at position 150 of SEQ ID NO: 188, or an amino acid at a position corresponding thereto, with Ala, and / or to substitute the amino acid at position 153 of SEQ ID NO: 188, or an amino acid at a position corresponding thereto, with Ala. These substitutions may be any one of them, any combination of these substitutions (e.g., substitutions at positions 132 and 150, substitutions at positions 132 and 153, or substitutions at positions 150 and 153), or all of them may be substituted. Other substitutions may also be combined. More specifically, it is preferable to substitute amino acids at M132 and / or Q150 and / or H153 or positions corresponding thereto in SEQ ID NO: 188, and it is preferable to substitute M132V and / or Q150A and / or H153A.

[0053] In addition, modification of leucine aminoacyl-tRNA synthetase (LeuRS) can be, for example, modification of the amino acid at position 43 of SEQ ID NO: 189 (natural LeuRS) or an amino acid at a position corresponding thereto. There is no limitation on which amino acid is substituted, but as described above, for example, Thr can be substituted with Gly. For example, it is preferable to substitute the amino acid at position 43 of SEQ ID NO: 189 or an amino acid at a position corresponding thereto with Gly. Other substitutions may also be combined. More specifically, it is preferable to substitute Y43 of SEQ ID NO: 189 or an amino acid at a position corresponding thereto, and it is preferable to substitute with Y43G.

[0054] The method for producing the mutant N-methylaminoacyl-tRNA synthetase of the present invention in which an amino acid at a specific position is modified with another amino acid can be performed by known genetic engineering techniques. For example, a primer in which a base sequence encoding the position of the target amino acid is replaced with a base sequence encoding the amino acid to be modified is used to amplify DNA in which the base sequence encoding the amino acid to be modified is replaced, and the amplified DNA fragments are ligated to obtain DNA encoding a full-length mutant aminoacyl-tRNA synthetase, which is then expressed using a host cell such as Escherichia coli, thereby easily producing the mutant. The primer used in this method is 20 to 70 bases, preferably about 20 to 50 bases. Since this primer has 1 to 3 bases mismatched with the original base sequence before modification, it is preferable to use a relatively long one, for example, one having 20 bases or more. Furthermore, the method for producing a mutant N-methylaminoacyl-tRNA synthetase of the present invention in which an amino acid at a specific position has been modified with another amino acid is not limited to the method described above, and various genetic engineering techniques can be used, such as known point mutation techniques, gene synthesis techniques, and methods for introducing modified fragments using restriction enzymes, and expression is not limited to E. coli, but animal cells and cell-free translation systems can also be used.

[0055] The modified ARS of the present invention includes a polypeptide comprising an amino acid sequence set forth in any one of SEQ ID NOs: 1 to 11, 182-187 (PheRS05, PheRS04, ValRS04, ValRS13, ValRS13-11, SerRS03, SerRS05, SerRS35, SerRS37, ThrRS03, ThrRS14, ValRS66, ValRS67, TrpRS04, TrpRS05, TrpRS18, LeuRS02) and a polypeptide functionally equivalent to the polypeptide. Here, the functionally equivalent polypeptide is an ARS having a high structural identity to a polypeptide comprising an amino acid sequence set forth in any one of SEQ ID NOs: 1 to 11, 182-187 and having reactivity to N-methyl amino acids. More specifically, the ARS has a high structural identity with a polypeptide comprising any one of the amino acid sequences set forth in SEQ ID NOs: 1 to 11, 182-187, and the amino acids have been modified as described above, thereby increasing the reactivity to N-methyl amino acids compared to the ARS before modification. The increase in reactivity to N-methyl amino acids may be, for example, an increase in substrate specificity for N-methyl amino acids (for example, the value of reactivity with N-methyl amino acids / reactivity with unmodified amino acids).

[0056] Such polypeptides include, for example, polypeptides in which one or more amino acids (preferably 1 to 20 amino acids, for example 1 to 10 amino acids, 1 to 7 amino acids, 1 to 5 amino acids, 1 to 3 amino acids, 1 to 2 amino acids, or 1 amino acid) have been substituted, deleted, inserted, and / or added in the amino acid sequence set forth in any of SEQ ID NOs: 1 to 11, 182-187. Furthermore, such polypeptides may be, for example, polypeptides in which one to several amino acids have been substituted, deleted, inserted, and / or added in the amino acid sequence set forth in any of SEQ ID NOs: 1 to 11, 182-187.

[0057] Furthermore, a polypeptide functionally equivalent to the modified ARS consisting of an amino acid sequence set forth in any one of SEQ ID NOs: 1 to 11, 182-187 usually has a high identity to the amino acid sequence set forth in any one of SEQ ID NOs: 1 to 11, 182-187. Furthermore, a polynucleotide encoding the functionally equivalent polypeptide usually has a high identity to a base sequence encoding an amino acid sequence set forth in any one of SEQ ID NOs: 1 to 11, 182-187 (e.g., SEQ ID NOs: 12 to 22, 190-195). A high identity is specifically 70% or more, preferably 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, or 99% or more.

[0058] The identity of amino acid sequences or nucleotide sequences can be determined by the algorithm BLAST by Karlin and Altschul (Proc. Natl. Acad. Sci. USA (1993) 90:5873-7). Based on this algorithm, programs called BLASTN and BLASTX have been developed (Altschul et al., J. Mol. Biol. (1990) 215:403-10). When analyzing a nucleotide sequence using BLASTN based on BLAST, the parameters are, for example, score=100 and wordlength=12. When analyzing an amino acid sequence using BLASTX based on BLAST, the parameters are, for example, score=50 and wordlength=3. When using BLAST and Gapped BLAST programs, the default parameters of each program are used. Specific methods for these analysis methods are known (information on the BLAST (Basic Local Alignment Search Tool) website of NCBI (National Center for Biotechnology Information) can be referred to).

[0059] Further, examples of the polypeptide of the present invention include a polypeptide described in any of (a) to (d) below, which is a polypeptide in which the amino acids corresponding to positions 43, 45 and 279 of SEQ ID NO: 24 (ValRS) are not Asn, Thr and Thr, respectively (i.e., a polypeptide in which at least one of the three positions is different), and which has increased reactivity to N-methyl Val compared to a polypeptide in which the amino acids corresponding to positions 43, 45 and 279 are Asn, Thr and Thr, respectively. (a) a polypeptide comprising an amino acid sequence having a high identity to any one of the amino acid sequences set forth in SEQ ID NOs: 3 to 5, 182 and 183 (ValRS04, ValRS13, ValRS13-11, ValRS66 and ValRS67); (b) a polypeptide comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in any one of the amino acid sequences set forth in SEQ ID NOs: 3 to 5, 182 and 183; (c) a polypeptide encoded by a nucleotide sequence having a high identity to any one of the nucleotide sequences set forth in SEQ ID NOs: 14 to 16, 190, and 191 (DNA of ValRS04, ValRS13, ValRS13-11, ValRS66, and ValRS67); or (d) A polypeptide encoded by a DNA that hybridizes under stringent conditions with a complementary strand of the base sequence set forth in any one of SEQ ID NOs: 14 to 16, 190 and 191. The polypeptide is preferably a polypeptide in which (i) the amino acid corresponding to position 43 is Gly or Ala, and / or (ii) the amino acid corresponding to position 45 is Ser, and / or (iii) the amino acid corresponding to position 279 is Gly or Ala. Such polypeptides include natural polypeptides and artificially modified polypeptides, and are preferably polypeptides in which (i) the amino acid corresponding to position 43 is Gly or Ala, and / or (ii) the amino acid corresponding to position 45 is Ser, and / or (iii) the amino acid corresponding to position 279 has been modified to Gly or Ala.

[0060] Further, examples of the polypeptide of the present invention include a polypeptide described in any of (a) to (d) below, which is a polypeptide in which the amino acids corresponding to positions 237 and 239 of SEQ ID NO:26 (SerRS) are not Thr and Glu, respectively (i.e., a polypeptide in which at least one of the two positions is different), and which has increased reactivity to N-methyl Ser compared to a polypeptide in which the amino acids corresponding to positions 237 and 239 are Thr and Glu, respectively. (a) a polypeptide comprising an amino acid sequence having a high identity to any one of the amino acid sequences set forth in SEQ ID NOs: 6 to 9 (SerRS03, SerRS05, SerRS35, and SerRS37); (b) a polypeptide comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence set forth in any one of SEQ ID NOs: 6 to 9; (c) a polypeptide encoded by a nucleotide sequence having a high identity to any one of the nucleotide sequences set forth in SEQ ID NOs: 17 to 20 (DNA of SerRS03, SerRS05, SerRS35, and SerRS37); or (d) A polypeptide encoded by a DNA that hybridizes under stringent conditions with a complementary strand of the nucleotide sequence set forth in any one of SEQ ID NOs: 17 to 20. The polypeptide is preferably a polypeptide in which (i) the amino acid corresponding to position 237 is Ser, and / or (ii) the amino acid corresponding to position 239 is Gly or Ala. Such polypeptides include natural polypeptides and artificially modified polypeptides, and are preferably polypeptides in which (i) the amino acid corresponding to position 237 has been modified to Ser, and / or (ii) the amino acid corresponding to position 239 has been modified to Gly or Ala.

[0061] Such polypeptides of the present invention include any of the following polypeptides (a) to (d), in which the amino acid corresponding to position 169 of SEQ ID NO:28 (PheRS) is not Gln and which have increased reactivity to N-methylPhe compared to polypeptides in which that position is Gln. (a) a polypeptide comprising an amino acid sequence having a high identity to the amino acid sequence set forth in any one of SEQ ID NOs: 1 to 2 (PheRS05 and PheRS04); (b) a polypeptide comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence set forth in any one of SEQ ID NOs: 1 to 2; (c) a polypeptide encoded by a nucleotide sequence having a high identity to any one of the nucleotide sequences set forth in SEQ ID NOs: 12 to 13 (DNA of PheRS05 and PheRS04); or (d) A polypeptide encoded by a DNA that hybridizes under stringent conditions with a complementary strand of the nucleotide sequence set forth in any one of SEQ ID NOs: 12 to 13. The polypeptide is preferably a polypeptide in which the amino acid corresponding to position 169 is Gly or Ala. Such polypeptides include natural polypeptides and artificially modified polypeptides, and are preferably polypeptides in which the amino acid corresponding to position 169 has been modified to Gly or Ala.

[0062] Further, examples of the polypeptide of the present invention include a polypeptide described in any of (a) to (d) below, in which the amino acids corresponding to positions 332 and 511 of SEQ ID NO:29 (ThrRS) are not Met and His, respectively (i.e., a polypeptide in which at least one of the two positions is different), and which has increased reactivity to N-methyl Thr compared to a polypeptide in which the amino acids corresponding to positions 332 and 511 are Met and His, respectively. (a) a polypeptide comprising an amino acid sequence having a high identity to any one of the amino acid sequences set forth in SEQ ID NOs: 10 to 11 (ThrRS03 and ThrRS14); (b) a polypeptide comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence set forth in any one of SEQ ID NOs: 10 to 11; (c) a polypeptide encoded by a nucleotide sequence having a high identity to any one of the nucleotide sequences set forth in SEQ ID NOs: 21 to 22 (DNA of ThrRS03 and ThrRS14); or (d) A polypeptide encoded by a DNA that hybridizes under stringent conditions with a complementary strand of the base sequence set forth in any one of SEQ ID NOs: 21 to 22. The polypeptide is preferably a polypeptide in which (i) the amino acid corresponding to position 332 is Gly, and / or (ii) the amino acid corresponding to position 511 is Gly. Such polypeptides include natural polypeptides and artificially modified polypeptides, and are preferably polypeptides in which the amino acid corresponding to position 332 has been modified to Gly, and / or the amino acid corresponding to position 511 has been modified to Gly.

[0063] Further, examples of the polypeptide of the present invention include a polypeptide set forth in any of the following (a) to (d), in which the amino acids corresponding to positions 132, 150, and 153 of SEQ ID NO: 188 (TrpRS) are not Met, Gln, and His, respectively (i.e., a polypeptide in which at least one of the three positions is different), and which has increased reactivity to N-methyl Trp compared to a polypeptide in which the amino acids corresponding to positions 132, 150, and 153 are Met, Gln, and His, respectively. (a) a polypeptide comprising an amino acid sequence having a high identity to any one of the amino acid sequences set forth in SEQ ID NOs: 184-186 (TrpRS04, TrpRS05, and TrpRS18); (b) a polypeptide comprising an amino acid sequence having one or more amino acid substitutions, deletions, insertions and / or additions in any of the amino acid sequences set forth in SEQ ID NOs: 184-186; (c) a polypeptide encoded by a nucleotide sequence having a high identity to any of the nucleotide sequences set forth in SEQ ID NOs: 192-194 (DNA of TrpRS04, TrpRS05, and TrpRS18); or (d) A polypeptide encoded by DNA that hybridizes under stringent conditions with the complementary strand of the nucleotide sequence set forth in any one of SEQ ID NOs: 192-194. The polypeptide is preferably a polypeptide in which (i) the amino acid corresponding to position 132 is Val or Ala, and / or (ii) the amino acid corresponding to position 150 is Ala, and / or (iii) the amino acid corresponding to position 153 is Ala. Such polypeptides include natural polypeptides and artificially modified polypeptides, and are preferably polypeptides in which (i) the amino acid corresponding to position 132 has been modified to Val or Ala, and / or (ii) the amino acid corresponding to position 150 has been modified to Ala, and / or (iii) the amino acid corresponding to position 153 has been modified to Ala.

[0064] Further, examples of the polypeptide of the present invention include a polypeptide described in any of (a) to (d) below, which is a polypeptide in which the amino acid corresponding to position 43 of SEQ ID NO: 189 (LeuRS) is not Tyr and which has increased reactivity to N-methyl-Leu compared to a polypeptide in which the amino acid corresponding to position 43 is Tyr. (a) a polypeptide comprising an amino acid sequence having a high identity to the amino acid sequence set forth in SEQ ID NO: 187 (LeuRS02); (b) a polypeptide comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in any one of the amino acid sequences set forth in SEQ ID NO: 187; (c) a polypeptide encoded by a nucleotide sequence having a high identity to the nucleotide sequence set forth in SEQ ID NO: 195 (DNA of LeuRS02); or (d) A polypeptide encoded by DNA that hybridizes under stringent conditions with the complementary strand of the base sequence set forth in SEQ ID NO: 195. The polypeptide is preferably a polypeptide in which the amino acid corresponding to position 43 is Gly. Such polypeptides include natural polypeptides and artificially modified polypeptides, and are preferably polypeptides in which the amino acid corresponding to position 43 is modified to Gly.

[0065] When the polypeptide of the present invention is a polypeptide obtained by modifying a natural ARS, it is a polypeptide having a higher reactivity to N-methyl amino acids than the ARS before modification, and when the polypeptide of the present invention is a natural ARS or an artificially produced polypeptide, it is a polypeptide having reactivity to N-methyl amino acids, i.e., a polypeptide having activity of acylating tRNA with N-methyl amino acids. When comparing the reactivity of a modified ARS with that of a natural ARS, if the ARS is composed of multiple subunits, the subunits other than the subunits to be compared are the same for comparison. These may be natural (or wild-type) subunits or modified subunits as long as they are the same in both ARSs.

[0066] As described above, a high identity refers to, for example, 70% or more, preferably 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, or 99% or more identity. The number of amino acid sequences to be substituted, deleted, inserted and / or added may be one or several, for example, 1 to 20, preferably 1 to 15, more preferably 1 to 10, more preferably 1 to 8, more preferably 1 to 7, more preferably 1 to 6, more preferably 1 to 5, more preferably 1 to 4, more preferably 1 to 3, more preferably 1 to 2, and more preferably 1. Stringent conditions for hybridization are, for example, conditions of about "1X SSC, 0.1% SDS, 37°C", more stringent conditions are conditions of about "0.5X SSC, 0.1% SDS, 42°C", even more stringent conditions are conditions of about "0.2X SSC, 0.1% SDS, 65°C", and even more stringent conditions are conditions of about "0.1X SSC, 0.1% SDS, 65°C". However, the above combinations of SSC, SDS and temperature conditions are examples, and a person skilled in the art can achieve the same stringency as above by appropriately combining the above or other factors that determine the stringency of hybridization (e.g., probe concentration, probe length, hybridization reaction time, etc.).

[0067] The present invention also relates to a polynucleotide encoding the polypeptide of the present invention. The polynucleotide of the present invention includes any polynucleotide containing the coding sequence of the above-mentioned polypeptide of the present invention, and includes genomic DNA, cDNA, and DNA artificially produced based on them. Genomic DNA includes exons and introns. That is, genomic DNA may or may not contain introns, and may or may not contain untranslated regions (5'UTR and / or 3'UTR), transcriptional regulatory regions, etc. Furthermore, cDNA may include a nucleic acid sequence derived from a part of an intron sequence and encoding an amino acid sequence. The polynucleotide also includes a degenerate polynucleotide composed of any codons that code for the same amino acid. The polynucleotide of the present invention may be a polynucleotide derived from a desired organism.

[0068] The polynucleotide of the present invention may be obtained by any method. For example, it includes complementary DNA (cDNA) prepared from mRNA, DNA prepared from genomic DNA, DNA obtained by chemical synthesis, DNA obtained by amplifying RNA or DNA as a template by PCR, and DNA constructed by an appropriate combination of these methods. The polynucleotide of the present invention can be prepared by cloning from genomic DNA or RNA encoding the polypeptide of the present invention according to a conventional method, introducing a mutation, or the like.

[0069] For example, a method for cloning a cDNA from an mRNA encoding the polypeptide of the present invention is to first prepare an mRNA encoding the polypeptide of the present invention from any tissue or cell that expresses and produces the polypeptide of the present invention in a conventional manner, for example, by subjecting total RNA prepared by the guanidine thiocyanate method, hot phenol method, AGPC method, or other method to affinity chromatography using oligo(dT)cellulose, polyU-Sepharose, or the like.

[0070] Next, using the obtained mRNA as a template, a cDNA strand is synthesized by known methods, such as using reverse transcriptase (Mol. Cell. Biol., Vol. 2, p. 161, 1982; Mol. Cell. Biol., Vol. 3, p. 280, 1983; Gene, Vol. 25, p. 263, 1983), and the cDNA is converted into double-stranded cDNA. This cDNA is then incorporated into a plasmid vector, phage vector, cosmid vector, etc., and transformed into E. coli, or after in vitro packaging, is transfected into E. coli to prepare a cDNA library.

[0071] The target gene can be obtained by screening using the polynucleotide of the present invention (e.g., SEQ ID NOs: 12-22, 190-195) or a part thereof as a probe. Alternatively, the gene can be directly amplified by PCR using the polynucleotide of the present invention (e.g., SEQ ID NOs: 12-22, 190-195) or a part thereof as a primer. The site and length of the probe or primer may be appropriately determined.

[0072] The present invention also relates to a vector (recombinant vector) containing a polynucleotide encoding the above-mentioned polypeptide of the present invention. The vector of the present invention is not particularly limited as long as it can maintain replication or self-replicate in any of prokaryotic and / or eukaryotic hosts, and includes plasmid vectors, phage vectors, and virus vectors.

[0073] Examples of cloning vectors include pUC19, λgt10, λgt11, etc. When isolating cells capable of expressing the polypeptide of the present invention in a host cell, the vector is preferably one having a promoter capable of expressing the polynucleotide.

[0074] The recombinant vector of the present invention can be prepared simply by ligating a polynucleotide encoding the polypeptide of the present invention to a recombinant vector (plasmid DNA or bacteriophage DNA) available in the art using a conventional method.

[0075] Examples of the recombinant vector to be used include plasmids derived from Escherichia coli (pBR322, pBR325, pUC12, pUC13, pUC19, etc.), yeast-derived plasmids (pSH19, pSH15, etc.), and Bacillus subtilis-derived plasmids (pUB110, pTP5, pC194, etc.).

[0076] Examples of phages include bacteriophages such as λ phage, and further include animal and insect viruses such as retroviruses, vaccinia viruses, nuclear polyhedrosis viruses, and lentiviruses (pVL1393, Invitrogen).

[0077] For the purpose of expressing a polynucleotide encoding the polypeptide of the present invention to produce the polypeptide of the present invention, an expression vector is useful. There is no particular limitation on the expression vector, so long as it has the function of expressing a polynucleotide encoding the polypeptide of the present invention in a host cell of either a prokaryotic cell and / or a eukaryotic cell and producing the polypeptide.

[0078] For example, pMAL C2, pEF-BOS (Nucleic Acid Research, Vol. 18, 1990, p. 5322, etc.) or pME18S (Experimental Medicine Special Issue "Genetic Engineering Handbook", 1992, etc.) can be mentioned.

[0079] The present invention also relates to a fusion of the polypeptide of the present invention with another protein. The fusion polypeptide of the present invention is a fusion polypeptide between the polypeptide of the present invention reactive to N-methyl amino acids and another polypeptide, and the fusion polypeptide itself does not need to be reactive to N-methyl amino acids, so long as it contains a polypeptide chain of the present invention reactive to N-methyl amino acids. For example, when the fusion polypeptide of the present invention is prepared as a fusion protein with GST (Glutathione S-transferase), it can be prepared by subcloning a cDNA encoding the polypeptide of the present invention into, for example, a plasmid pGEX4T1 (Pharmacia), transforming Escherichia coli DH5α or the like, and culturing the transformant.

[0080] Alternatively, it can be prepared as a fusion with HA (influenza agglutinin), immunoglobulin constant region, β-galactosidase, MBP (maltose binding protein), etc. Furthermore, it can be prepared as a fusion with known peptides such as, for example, FLAG (Hopp, TP et al., BioTechnology (1988) 6, 1204-1210), tags consisting of several (e.g., 6) His (histidine) residues (6×His, 10×His, etc.), influenza agglutinin (HA), human c-myc fragments, VSV-GP fragments, p18HIV fragments, T7-tag, HSV-tag, E-tag, SV40T antigen fragments, lck tag, α-tubulin fragments, B-tag, Protein C fragments, Stag, StrepTag, HaloTag, etc.

[0081] When the vector of the present invention is used in a bacterium, particularly Escherichia coli, as a host cell, it is preferable that the vector contains at least a promoter-operator region, an initiation codon, a polynucleotide encoding a polypeptide of the present invention, a stop codon, a terminator region and a replicable unit.

[0082] When yeast, animal cells, or insect cells are used as the host, the expression vector preferably contains at least a promoter, an initiation codon, a polynucleotide encoding the polypeptide of the present invention, and a termination codon.

[0083] The vector may also contain DNA encoding a signal peptide, an enhancer sequence, untranslated regions on the 5' and 3' sides of the gene encoding the polypeptide of the present invention, a splicing junction, a polyadenylation site, a selection marker region, or a replicable unit.

[0084] If desired, the vector may also contain a marker gene (gene amplification gene, drug resistance gene, etc.) that enables gene amplification and selection of a transformed host.

[0085] For example, the dihydrofolate reductase (DHFR) gene, the thymidine kinase gene, the neomycin resistance gene, the glutamate synthetase gene, the adenosine deaminase gene, the ornithine decarboxylase gene, the hygromycin-B-phosphotransferase gene, the aspartate transcarbamylase gene, and the like can be mentioned.

[0086] A promoter-operator region for expressing a polypeptide of the present invention in bacteria can comprise a promoter, an operator, and a Shine-Dalgarno (SD) sequence (eg, AAGG, etc.).

[0087] For example, when the host is a bacterium of the genus Escherichia, examples include those including the Trp promoter, lac promoter, recA promoter, λPL promoter, lpp promoter, and tac promoter.

[0088] Examples of promoters for expressing the polypeptide of the present invention in yeast include the PH05 promoter, the PGK promoter, the GAP promoter, and the ADH promoter. When the host is a bacterium of the genus Bacillus, examples of the promoter include the SL01 promoter, the SP02 promoter, and the penP promoter.

[0089] When the host is a eukaryotic cell such as a mammalian cell, examples of the promoter include a promoter derived from SV40, a retrovirus promoter, and a heat shock promoter. SV40 and retrovirus are preferred. However, the promoter is not particularly limited to these. In addition, the use of an enhancer is also an effective method for expression.

[0090] A suitable initiation codon is, for example, a methionine codon (ATG). A suitable termination codon is, for example, a commonly used termination codon (e.g., TAG, TGA, TAA). A commonly used natural or synthetic terminator can be used as the terminator region.

[0091] A replicable unit refers to a DNA having the ability to replicate its entire DNA sequence in a host cell, and includes natural plasmids, artificially modified plasmids (DNA fragments prepared from natural plasmids), and synthetic plasmids. Suitable plasmids include plasmid pBR322 or its artificial modifications (DNA fragments obtained by treating pBR322 with an appropriate restriction enzyme) in E. coli, yeast 2μ plasmid or yeast chromosomal DNA in yeast, and plasmid pRSVneo (ATCC 37198), plasmid pSV2dhfr (ATCC 37145), plasmid pdBPV-MMTneo (ATCC 37224), and plasmid pSV2neo (ATCC 37149) in mammalian cells.

[0092] The enhancer sequence, polyadenylation site and splicing junction site may be any sequence commonly used by those skilled in the art, such as those derived from SV40.

[0093] The expression vector of the present invention can be prepared by linking at least the above-mentioned promoter, initiation codon, polynucleotide encoding the polypeptide of the present invention, termination codon and terminator region continuously and circularly to an appropriate replicable unit. In this case, if desired, an appropriate DNA fragment (e.g., a linker, other restriction enzyme cleavage site, etc.) can be used by a conventional method such as digestion with a restriction enzyme or ligation using T4 DNA ligase.

[0094] The present invention also relates to a recombinant cell transformed with the above-mentioned vector of the present invention, which can be prepared by introducing the above-mentioned expression vector into a host cell.

[0095] The host cells used in the present invention are not particularly limited as long as they are compatible with the above-mentioned expression vector and can be transformed, and examples thereof include various cells such as natural cells or artificially established recombinant cells commonly used in the technical field of the present invention, for example, bacteria (such as Escherichia and Bacillus), yeasts (such as Saccharomyces and Pichia), animal cells, and insect cells.

[0096] Preferred are Escherichia coli or animal cells, and examples thereof include Escherichia coli (DH5α, TB1, HB101, etc.), mouse-derived cells (COP, L, C127, Sp2 / 0, NS-1, NIH3T3, etc.), rat-derived cells (PC12, PC12h), hamster-derived cells (BHK, CHO, etc.), monkey-derived cells (COS1, COS3, COS7, CV1, Velo, etc.), and human-derived cells (Hela, cells derived from diploid fibroblasts, myeloma cells, HepG2, etc.).

[0097] Introduction of an expression vector into a host cell (transformation (transfection)) can be carried out according to a conventional method ([in the case of E. coli, Bacillus subtilis, etc.]: Proc. Natl. Acad. Sci. USA, Vol. 69, p. 2110, 1972; Mol. Gen. Genet., Vol. 168, p. 111, 1979; J. Mol. Biol., Vol. 56, p. 209, 1971; [in the case of Saccharomyces cerevisiae]:Proc.Natl.Acad.Sci.USA.,Vol.75,p.1927,1978;J.Bacteriol.,Vol.153,p.163,198 3); [In the case of animal cells]: Virology, Vol. 52, p. 456, 1973; [In the case of insect cells]: Mol. Cell. Biol., Vol. 3, p. 2156-2165, 1983).

[0098] The polypeptide of the present invention can be produced by culturing transformed recombinant cells (hereinafter, this term is used to include inclusion bodies) containing the expression vector prepared as described above in a nutrient medium according to a conventional method. The polypeptide of the present invention can be produced by culturing the above-mentioned recombinant cells, particularly animal cells, and allowing them to be secreted into the culture supernatant.

[0099] The resulting culture is filtered or centrifuged to obtain a culture filtrate (supernatant), and the polypeptide of the present invention is purified and isolated from the culture filtrate according to a conventional method generally used for purifying and isolating natural or synthetic proteins. Examples of isolation and purification methods include methods that utilize solubility, such as salting out and solvent precipitation; methods that utilize differences in molecular weight, such as dialysis, ultrafiltration, gel filtration, and sodium dodecyl sulfate-polyacrylamide gel electrophoresis; methods that utilize charge, such as ion exchange chromatography and hydroxylapatite chromatography; methods that utilize specific affinity, such as affinity chromatography; methods that utilize differences in hydrophobicity, such as reversed-phase high-performance liquid chromatography; and methods that utilize differences in isoelectric point, such as isoelectric focusing.

[0100] On the other hand, when the polypeptide of the present invention is present in the periplasm or cytoplasm of cultured recombinant cells (such as E. coli), the culture is subjected to a conventional method such as filtration or centrifugation to collect the bacterial bodies or cells, which are then suspended in an appropriate buffer solution, and the cell walls and / or cell membranes of the cells are disrupted by, for example, ultrasonic waves, lysozyme, or freezing and thawing, followed by centrifugation, filtration, or other methods to obtain a membrane fraction containing the protein of the present invention. TM The crude solution is solubilized using a surfactant such as -X100 to obtain a crude solution, which can then be isolated and purified using standard methods such as those described above.

[0101] The present invention also relates to an oligonucleotide that hybridizes to a polynucleotide (cDNA or genomic DNA) encoding the above-mentioned polypeptide of the present invention or its complementary strand. For example, the oligonucleotide is an oligonucleotide that hybridizes to a base sequence containing at least the modified site of the ARS of the present invention or its complementary strand. Furthermore, the oligonucleotide of the present invention is preferably a partial fragment of a polynucleotide encoding the modified ARS of the present invention, and is preferably a fragment containing the base of the modified site of the modified ARS or its complementary strand.

[0102] For example, the oligonucleotide of the present invention may be an oligonucleotide containing bases encoding codons corresponding to the amino acid corresponding to position 43 and / or the amino acid corresponding to position 45 and / or the amino acid corresponding to position 279 of the amino acid sequences set forth in SEQ ID NOs: 3 to 5, 182 and 183 (ValRS04, ValRS13, ValRS13-11, ValRS66 and ValRS67) in a polynucleotide encoding a polypeptide of the present invention having reactivity with N-methyl Val, or an oligonucleotide consisting of a complementary sequence thereof. Here, the amino acid corresponding to position 43 is preferably Gly or Ala (more preferably Gly), the amino acid corresponding to position 45 is preferably Ser, and the amino acid corresponding to position 279 is preferably Gly or Ala (more preferably Ala).

[0103] For example, the oligonucleotide of the present invention may be an oligonucleotide containing bases encoding codons corresponding to the amino acid corresponding to position 237 and / or the amino acid corresponding to position 239 of the amino acid sequences set forth in SEQ ID NOs: 6 to 9 (SerRS03, SerRS05, SerRS35, and SerRS37) in a polynucleotide encoding a polypeptide of the present invention having reactivity with N-methyl Ser, or an oligonucleotide consisting of a complementary sequence thereof. Here, the amino acid corresponding to position 237 is preferably Ser, and the amino acid corresponding to position 239 is preferably Gly or Ala (more preferably Gly).

[0104] For example, the oligonucleotide of the present invention may be an oligonucleotide containing bases encoding a codon corresponding to the amino acid at position 169 of the amino acid sequences set forth in SEQ ID NOs: 1 to 2 (PheRS04 and PheRS05) in a polynucleotide encoding a polypeptide of the present invention having reactivity with N-methylPhe, or an oligonucleotide consisting of a complementary sequence thereof. Here, the amino acid at position 169 is preferably Gly or Ala.

[0105] For example, the oligonucleotide of the present invention may be an oligonucleotide containing bases encoding codons corresponding to the amino acid at position 332 and / or the amino acid at position 511 of the amino acid sequences set forth in SEQ ID NOs: 10 to 11 (ThrRS03 and ThrRS14) in a polynucleotide encoding a polypeptide of the present invention having reactivity with N-methyl Thr, or an oligonucleotide consisting of a complementary sequence thereof. Here, the amino acid at position 332 is preferably Gly, and the amino acid at position 511 is preferably Gly.

[0106] For example, the oligonucleotide of the present invention may be an oligonucleotide containing bases encoding codons corresponding to the amino acid corresponding to position 132 and / or the amino acid corresponding to position 150 and / or the amino acid corresponding to position 153 of the amino acid sequence set forth in SEQ ID NOs: 184-186 (TrpRS04, TrpRS05 and TrpRS18) in a polynucleotide encoding a polypeptide of the present invention reactive with N-methylTrp, or an oligonucleotide consisting of a complementary sequence thereof. Here, the amino acid corresponding to position 132 is preferably Val or Ala (more preferably Val), the amino acid corresponding to position 150 is preferably Ala, and the amino acid corresponding to position 279 is preferably Ala.

[0107] For example, the oligonucleotide of the present invention may be an oligonucleotide containing bases encoding a codon corresponding to the amino acid at position 43 of the amino acid sequence set forth in SEQ ID NO: 187 (LeuRS02) in a polynucleotide encoding a polypeptide of the present invention having reactivity with N-methyl-Leu, or an oligonucleotide consisting of a complementary sequence thereof, in which the amino acid at position 43 is preferably Gly.

[0108] The length of the partial fragment of the polynucleotide encoding the polypeptide of the present invention reactive with N-methylamino acids is not particularly limited, but is, for example, at least 15 consecutive bases, preferably 16 or more bases, more preferably 17 or more bases, more preferably 18 or more bases, more preferably 20 or more bases, more preferably 25 or more bases, more preferably 28 or more bases, more preferably 30 or more bases, more preferably 32 or more bases, more preferably 35 or more bases, more preferably 40 or more bases, and more preferably 50 or more bases.

[0109] Furthermore, the oligonucleotide of the present invention may further comprise an oligonucleotide consisting of another sequence at both ends or one end (5' end and / or 3' end) in addition to the partial fragment of the polynucleotide encoding the ARS of the present invention. The oligonucleotide of the present invention is, for example, 500 bases or less, more preferably 300 bases or less, more preferably 200 bases or less, more preferably 100 bases or less, more preferably 70 bases or less, more preferably 60 bases or less, more preferably 50 bases or less.

[0110] The oligonucleotide of the present invention is useful for preparing a nucleic acid encoding a polypeptide of the present invention (e.g., introducing a mutation), and is also useful for detecting a nucleic acid encoding a polypeptide of the present invention. For example, the oligonucleotide of the present invention can also be used as a probe in the operation of DNA hybridization or RNA hybridization. In order to use the DNA as a probe, a partial base sequence of 20 or more consecutive bases that hybridizes to the polynucleotide of the present invention can be mentioned, preferably a partial base sequence of 30 or more consecutive bases, more preferably a partial base sequence of 40 or more consecutive bases or 50 or more consecutive bases, even more preferably a partial base sequence of 100 or more consecutive bases, more preferably a partial base sequence of 200 or more consecutive bases, and particularly preferably a partial base sequence of 300 or more consecutive bases.

[0111] The polypeptide, polynucleotide, and oligonucleotide of the present invention can be combined with a suitable carrier or vehicle to form a composition. The composition can be produced using a method known to those skilled in the art. For example, it can be combined with a pharmacologically acceptable carrier or vehicle, specifically, sterilized water, physiological saline, vegetable oil, emulsifier, suspending agent, surfactant, stabilizer, flavoring agent, excipient, vehicle, preservative, binder, etc. In addition, these can be formulated by mixing them in a unit dose form required for generally accepted pharmaceutical practice.

[0112] The present invention also provides a cell transformed with a polynucleotide (including DNA and RNA) encoding the above-mentioned mutant N-methylaminoacyl-tRNA synthetase. Such a cell may be a prokaryotic cell or a eukaryotic cell.

[0113] Furthermore, when the mutant N-methylaminoacyl-tRNA synthetase of the present invention expressed in a cell is used for protein synthesis in the cell as it is, a cell according to the purpose can be used. As a method for transformation, a known method can be adopted.

[0114] The present invention also provides a method for producing a polypeptide containing an N-methyl amino acid, using the above-mentioned ARS of the present invention having a modified amino acid sequence. Furthermore, the ARS of the present invention having a modified amino acid sequence can be used not only within cells but also in vitro (cell-free system). In either case, unlike prior art techniques that use chemical synthesis methods such as the pdCpA method, it is possible to repeatedly acylate tRNA during the translation reaction, which allows for a continuous supply of N-methylaminoacyl-tRNA and makes it possible to avoid the addition of large amounts of tRNA, which inhibits translation. Thus, the present invention provides a method for producing unnatural amino acids efficiently, selectively, particularly regioselectively, and in large quantities.

[0115] <General method for preparing the modified ARS of the present invention> The modified ARS of the present invention can be produced using known recombinant gene techniques as described above, but can generally be prepared as follows: First, a plasmid containing a wild-type ARS gene is used as a template, and site-specific mutations are introduced at specific positions and specific amino acids by PCR using primers, and the template plasmid is digested with a restriction enzyme and then transformed into E. coli or the like, and the plasmid with the desired mutation introduced is cloned.

[0116] When introducing an amino acid mutation at the second amino acid position, the plasmid in which a mutation has been introduced at a specific position is used as a template, and site-specific mutagenesis using a primer is repeated in the same manner as above to construct a plasmid DNA encoding a double amino acid substitution. Further amino acid mutations can be introduced in the same manner.

[0117] The DNA thus prepared is transformed into E. coli BL21 or other strains together with a plasmid such as pREP4 that encodes the lac repressor (LacI), and the resulting transformed strain is isolated and cultured, after which expression is induced with IPTG. The resulting strain is then disrupted, and the mutant ARS is purified by passing the supernatant through an affinity column using a His tag, or the like.

[0118] Alternatively, it can be prepared by the following method: a specific mutant ARS sequence is gene-synthesized and then inserted into an expression vector, followed by protein expression and purification of the target protein using an affinity column that utilizes various purification tags.

[0119] In addition, the method for producing a mutant of the N-methylaminoacyl-tRNA synthetase of the present invention in which an amino acid at a specific position is modified with another amino acid is not limited to the above-mentioned method, and various gene manipulation techniques such as known point mutation techniques, gene synthesis techniques, and methods for introducing modified fragments using restriction enzymes can be used, and the expression is not limited to E. coli, and animal cells and cell-free translation systems can also be used. Furthermore, the purification method is not limited to affinity columns using polyhistidine, and various peptide tags and purification columns can be used.

[0120] <Method for confirming substrate specificity of the obtained modified ARS of the present invention> Furthermore, the substrate specificity of the obtained variant can be confirmed, for example, by using any one of the following three assay methods.

[0121] In the first method, a translation reaction is carried out in a cell-free translation system reconstituted with a modified ARS instead of the wild-type ARS and an N-methylated amino acid instead of the natural amino acid, and the N-methyl amino acid is aminoacylated in the translation system. Mass spectrometry is used to confirm that the N-methyl amino acid has been introduced into the peptide in accordance with the codon on the mRNA.

[0122] The second method is to estimate the yield of peptides by labeling the peptides produced in translation experiments using amino acids labeled with radioisotopes or fluorescent molecules, and then separating and visualizing them by electrophoresis or analytical columns. In this case, when a modified ARS is used, the translation incorporation efficiency of the corresponding N-methyl amino acid is higher than when a wild-type ARS is used, so the radioactivity or fluorescence of the peptide observed in the electrophoresis or chromatogram is stronger.

[0123] The third method involves reacting a modified ARS with the corresponding tRNA and an N-methylamino acid in a test tube, and then isolating the resulting N-methylaminoacyl-tRNA from unreacted tRNA by electrophoresis to quantify the efficiency of the acylation reaction. When a modified ARS is used, more acylated tRNA is detected than when a wild-type ARS is used.

[0124] As described above, the modified ARS of the present invention has an increased reactivity to N-methyl amino acids compared to the ARS before modification. The increased reactivity to N-methyl amino acids may be an increased reaction rate, an increased amount of reaction products acylated with N-methyl amino acids, or an increased substrate specificity for N-methyl amino acids. The increased reactivity to N-methyl amino acids may be qualitative or quantitative. For example, a reaction is carried out under the same conditions except for using the ARS before modification or the ARS after modification, and if the reactivity (such as the reaction rate or the amount of the reaction product) with N-methyl amino acids as substrates is significantly increased in the ARS after modification compared to the ARS before modification, the reactivity to N-methyl amino acids is judged to have increased. Even if the reaction rate or the amount of the reaction product with N-methyl amino acids as substrates is not significantly increased, if the reaction rate or the amount of the reaction product with unmodified amino acids or the substrate specificity for N-methyl amino acids compared to the reaction products is increased in the ARS after modification compared to the ARS before modification, such a modified ARS is judged to have increased reactivity to N-methyl amino acids. Preferably, the modified ARS of the present invention has an increased reaction rate or increased amount of reaction product using an N-methylamino acid as a substrate, compared to the ARS before modification.

[0125] For example, when the modified ARS of the present invention is used to measure under the same conditions using the ARS before and after modification, the amount of tRNA aminoacylated with an N-methyl amino acid, or the amount of a peptide into which an N-methyl amino acid has been incorporated, is significantly increased, preferably by at least 10%, preferably by 20%, preferably by 1.3-fold or more, preferably by 1.5-fold or more, preferably by 2-fold or more, preferably by 3-fold or more, more preferably by 5-fold or more, more preferably by 10-fold or more, more preferably by 20-fold or more, more preferably by 30-fold or more, more preferably by 50-fold or more, and more preferably by 100-fold or more. Alternatively, when the modified ARS of the present invention is measured under the same conditions using the ARS before and after modification, the ratio of the amount of "N-methyl amino acid reaction product / unmodified amino acid reaction product" is significantly increased in the modified ARS compared to the ARS before modification, preferably at least 10%, preferably 20%, preferably 1.3 times or more, preferably 1.5 times or more, preferably 2 times or more, preferably 3 times or more, more preferably 5 times or more, more preferably 10 times or more, more preferably 20 times or more, more preferably 30 times or more, more preferably 50 times or more, and more preferably 100 times or more. Alternatively, when the modified ARS of the present invention is measured under the same conditions using the ARS before and after modification, when a nucleic acid encoding a polypeptide containing consecutive N-methyl amino acids is translated, the amount of a polypeptide containing consecutive N-methyl amino acids produced is significantly increased in the modified ARS compared to the ARS before modification, preferably at least 10%, preferably 20%, preferably 1.3 times or more, preferably 1.5 times or more, preferably 2 times or more, and preferably 3 times or more. The consecutive N-methyl amino acids may be, for example, two and / or three consecutive.

[0126] The reactivity to N-methyl amino acids can be measured according to the above-mentioned confirmation method, specifically, for example, the peptides produced by translation are electrophoresed, and the band intensities of peptides incorporating N-methyl amino acids and peptides not incorporating N-methyl amino acids are measured qualitatively or quantitatively to be regarded as reactivity. Alternatively, the peak values ​​in mass spectrometry are measured, and the peak values ​​of peptides incorporating N-methyl amino acids and peptides not incorporating N-methyl amino acids are measured to be regarded as reactivity.

[0127] For example, when peptide synthesis is performed in the presence of unmodified amino acids and N-methyl amino acids and the quantitative ratio of "N-methyl amino acid reaction product / unmodified amino acid reaction product" is measured, the substrate specificity of the modified ARS of the present invention is significantly increased, preferably by at least 10%, preferably by 20%, preferably by 1.3-fold or more, preferably by 1.5-fold or more, preferably by 2-fold or more, preferably by 3-fold or more, more preferably by 5-fold or more, more preferably by 10-fold or more, and more preferably by 20-fold or more, compared to that of the unmodified ARS.

[0128] The reaction conditions may be appropriately determined as long as the same conditions are used for the ARS before and after modification. The substrate concentrations of unmodified amino acids and N-methyl amino acids during the reaction may be appropriately adjusted, as long as the reactivity to N-methyl amino acids increases under any concentration condition. Preferably, unmodified amino acids may be added without any addition (only endogenous amino acids originally contained in the cell-free translation system), or may be reacted with an appropriate adjustment between 0.1 μM to 1 mM, for example, 0.1 to 500 μM, 0.1 to 250 μM, 0.1 to 100 μM, or 0.1 to 50 μM. N-methyl amino acids may be reacted with an appropriate adjustment between, for example, 50 μM to 10 mM, for example, 100 μM to 5 mM, 200 μM to 2 mM, or 500 μM to 1 mM.

[0129] The modified ARS obtained by the above-mentioned preparation method can be used to produce peptides and peptide-mRNA fusions into which N-methyl amino acids have been site-specifically incorporated.

[0130] Furthermore, since the ARS used here is highly conserved among organisms, it is clear that the method of the present invention can be widely applied to the modification of N-methylamino acid tRNA synthetases of other organisms.

[0131] In addition, by using the modified ARS of the present invention, it is possible to create peptides in which a specific amino acid is replaced with its N-methylated unnatural amino acid in the translation system of a prokaryote. Such peptides can also be created by modifying ARSs derived from other organisms in the same manner as in the present invention.

[0132] <Acylation reaction of tRNA using the modified ARS of the present invention> The modified ARS of the present invention enables the use of an N-methyl amino acid as a substrate in the acylation of tRNA. The modified ARS of the present invention enables the acylation of tRNA with an N-methyl amino acid, thereby enabling the translation of a peptide containing an N-methyl amino acid.

[0133] To generate N-methylaminoacyl-tRNA using the modified ARS of the present invention, the modified ARS may be reacted with the corresponding N-methylamino acid and tRNA in a test tube, as in the case of a chemical synthesis method such as the pdCpA method, and the resulting N-methylaminoacyl-tRNA may be isolated by a known nucleic acid purification method such as ethanol precipitation and added to a translation system, thereby producing a polypeptide in which an N-methylamino acid has been introduced at the desired position, or a polypeptide-mRNA fusion product.

[0134] In addition, unlike chemical synthesis methods that require a reaction to be carried out in a reaction solution containing only a specific tRNA and the corresponding N-methyl amino acid as a substrate, the modified ARS of the present invention has high substrate specificity for tRNA and amino acids, so that even in a mixture of translation reaction solutions containing other tRNAs and amino acids, the modified ARS, N-methyl amino acid, and tRNA accurately and efficiently produce the desired N-methylaminoacyl tRNA. Therefore, the above-mentioned isolation and purification procedures are not essential, and the reaction solution in which tRNA is acylated with N-methyl amino acid can be used for the translation reaction as is, or the translation reaction can be carried out simultaneously with the reaction of acylation of tRNA with N-methyl amino acid. In addition, since there is no need for chemical synthesis of substrates such as pdCpA amino acid and activated amino acid, and the method can be carried out using commercially available reagents, it is highly convenient.

[0135] The most important feature is that when peptide translation is performed using the modified ARS of the present invention, the corresponding tRNA does not need to be stoichiometrically considered. When aminoacyl tRNA is supplied by chemical synthesis, the reaction reduces N-methyl aminoacyl tRNA, lowering the reaction efficiency, but when ARS is used, translation efficiency is good even in peptide synthesis in which multiple N-methyl amino acids are introduced. In the translation system, aminoacyl tRNA is constantly deacylated by hydrolysis and transpeptidation, but the modified ARS of the present invention can recognize the released tRNA and acylate a new N-α amino acid, thereby constantly supplying N-α aminoacyl tRNA in the translation system. Therefore, the amount of tRNA required is smaller than that of the polypeptide to be produced. Since the addition of a large amount of tRNA itself is a factor in reducing the peptide yield, the modified ARS of the present invention is useful for producing N-α amino acid-containing peptides with high translation efficiency and for creating a highly diverse peptide library.

[0136] Furthermore, since the modified ARS of the present invention has improved reactivity with N-methyl amino acids compared to natural ARS, it can acylate tRNA in the presence of N-methyl amino acids at lower concentrations than when natural ARS is used, i.e., the absolute amount of N-methyl amino acids required for peptide translation is not as large as when natural ARS is used.

[0137] Furthermore, by using the modified ARS of the present invention, it is possible to translate an N-methyl amino acid-containing peptide at a lower concentration of ARS than when a natural ARS is used to translate the N-methyl amino acid-containing peptide, i.e., the absolute amount of the modified ARS of the present invention required for peptide translation is significantly less than when a natural ARS is used to translate the N-methyl amino acid-containing peptide.

[0138] These features are important for improving the orthogonality of aminoacylation reactions. That is, the more the substrate N-methyl amino acid or the ARS corresponding to that amino acid is required in a higher concentration than other natural amino acids or the ARS corresponding to other natural amino acids to translate an N-methyl amino acid-containing peptide, the more likely it is that a non-specific reaction will occur, such as an ARS that should originally use an N-methyl amino acid as a substrate will use other natural amino acids in the acylation reaction, or an excessive N-methyl amino acid will be used in the acylation reaction by an ARS corresponding to other natural amino acids, resulting in a problem with peptide libraries in that the resulting translated peptide will be a mixture of N-methyl amino acid-containing peptides and the corresponding natural amino acid peptides. However, the use of the modified ARS of the present invention is expected to reduce this problem.

[0139] Therefore, the characteristics of the modified ARS of the present invention can be expressed as follows. A modified ARS that catalyzes the acylation of tRNA, (a) tRNA binding site (b) an N-methyl amino acid substrate binding site, and (c) a catalytically active site having activity for catalyzing an acyl group transfer reaction from an N-methyl amino acid substrate to the 3' end of tRNA; Including, The modified ARS is characterized in that it can accurately recognize and acylate tRNA and N-methylamino acids even in a translation reaction mixture, and further reuse the released tRNA after the acylation reaction to repeat the acylation reaction.

[0140] Furthermore, in addition to the above (a), (b), and (c), the modified ARS of the present invention may also contain (d) a proofreading site that hydrolyzes tRNA acylated with an undesired amino acid.

[0141] <Synthesis of acylated tRNA using the modified ARS of the present invention> The modified ARS of the present invention can be used to synthesize a tRNA acylated with a desired N-methyl amino acid substrate.

[0142] The method for producing an acylated tRNA using the modified ARS of the present invention comprises the following steps: (a) providing one or more modified ARSs of the invention; (b) providing a tRNA; (c) providing an N-methyl amino acid; and (d) contacting the modified ARS with the tRNA and the N-methyl amino acid to acylate the tRNA.

[0143] In addition to the above steps, the method may further include (e) a step of recovering the reaction product containing the acylated tRNA. However, in the recovery step, it is not necessary to purify the acylated tRNA, and the reaction mixture can be recovered and used as is. By not separating and purifying the generated aminoacyl-tRNA from ARS, deacylation can be prevented.

[0144] In this method, N-methylamino acids are used as substrates. Particularly preferred are N-methylphenylalanine, N-methylvaline, N-methylthreonine, N-methyltryptophan, N-methylleucine and / or N-methylserine. The N-methylamino acids used as substrates are appropriately selected from those that are used as substrates by ARS (amino acids corresponding to the ARS).

[0145] In the method for producing acylated tRNA by the modified ARS of the present invention, a tRNA corresponding to the ARS of the corresponding natural amino acid can be used as the tRNA. The "corresponding natural amino acid" refers to an amino acid that is not N-methylated with respect to an N-methyl amino acid. For example, in the case of N-methylphenylalanine, the corresponding amino acid is phenylalanine, and the tRNA is a tRNA that recognizes UUU or UUC as a codon (has a corresponding anticodon). In the case of N-methylvaline, the corresponding amino acid is valine, and the tRNA is a tRNA that recognizes GUU, GUC, GUA, or GUG as a codon (has a corresponding anticodon). In the case of N-methylserine, the corresponding amino acid is serine, and the tRNA is a tRNA that recognizes UCU, UCC, UCA, UCG, AGU, or AGC as a codon (has a corresponding anticodon). In the case of N-methylthreonine, the corresponding amino acid is threonine, and the tRNA is a tRNA that recognizes ACU, ACC, ACA, or ACG as a codon (has a corresponding anticodon). For N-methyltryptophan, the corresponding amino acid is tryptophan, and the tRNA that recognizes UGG as the codon (has a corresponding anticodon) is used. For N-methylleucine, the corresponding amino acid is leucine, and the tRNA that recognizes UUA, UUG, CUU, CUC, CUA, or CUG as the codon (has a corresponding anticodon) is used. For other N-methylamino acids, tRNAs that recognize the codons corresponding to the corresponding amino acids (has a corresponding anticodon) can also be used.

[0146] When acylation of tRNA with the modified ARS is carried out in a solution, the reaction solution is precipitated with ethanol, the pellet is dissolved in an appropriate buffer (e.g., 1 mM potassium acetate, pH 5, etc.), and added to the translation system. Typical reaction conditions include, for example, reacting a 0.1 M reaction buffer containing 0.5 to 40 μM tRNA, 0.1 to 10 μM modified ARS of the present invention, 0.1 to 10 mM N-methylamino acid, 0.1 to 10 mM ATP, and 0.1 to 10 mM MgCl2 at a final concentration of pH 7.5 at 37° C. for 5 minutes to 1 hour.

[0147] Furthermore, to carry out an aminoacylation reaction, for example, a solution of 1 to 50 μM tRNA, 10 to 200 (e.g., 50 to 200) mM HEPES-K (pH 7.0 to 8.0 (e.g., 7.6)), and 1 to 100 (e.g., 10) mM KCl can be heated at 95° C. for 2 minutes and then allowed to stand at room temperature for 5 minutes or more to refold the tRNA. This tRNA solution can be prepared by adding an acylation buffer (final concentration: 25 to 100 (e.g., 50) mM HEPES-K [pH 7.0 to 8.0 (e.g., 7.6)], 1 to 10 (e.g., 2) mM ATP, 10 to 100 (e.g., 100) mM potassium acetate, 1 to 20 (e.g., 10) mM magnesium acetate, 0.1 to 10 (e.g., 1) mM DTT, and 0.1 mg / mL bovine serum albumin) to a final concentration of 1 to 40 (e.g., 10) μM, mixing with modified ARS (final concentration: 0.1 to 10 (e.g., 0.5) μM) and N-methylamino acid (final concentration: 0.1 to 10 (e.g., 1) mM), and incubating at 37° C. for 5 to 60 (e.g., 10) minutes.

[0148] In this way, the acylation reaction using the modified ARS of the present invention is simple because it can be carried out using commercially available N-methyl amino acids without requiring substrates or activated amino acids that require synthesis, and can also be made into a kit product for obtaining acylated tRNA in combination with a substrate. The minimum contents of the kit are sufficient to include (a) one or more modified ARSs of the present invention, (b) N-methyl amino acids, and (c) tRNA, but it may also include a reaction buffer, a reaction vessel, instructions for use, etc. Here, the N-methyl amino acid in (b) and the tRNA in (c) are the N-methyl amino acid and tRNA that are substrates for the modified ARS in (a), respectively. In other words, the tRNA is a tRNA that recognizes a codon corresponding to the natural amino acid corresponding to the N-methyl amino acid (has a corresponding anticodon).

[0149] <Synthesis of N-methyl amino acid-containing polypeptide using the modified ARS of the present invention> A polypeptide having an N-methyl amino acid introduced into a desired site can be produced using an N-methyl amino acid-binding tRNA, which comprises translating a nucleic acid encoding a polypeptide of interest in the presence of a modified ARS of the present invention.

[0150] More specifically, for example, a method for producing an N-methyl amino acid-containing polypeptide using the modified ARS of the present invention includes the steps of (a) providing the modified ARS of the present invention, (b) constructing a cell-free translation system reconstituted with the modified ARS of the present invention instead of the wild-type ARS, (c) providing an mRNA having a codon at a desired site corresponding to the anticodon of a tRNA that serves as a substrate for the modified ARS, and (d) adding the mRNA to the cell-free translation system to produce a polypeptide in which an N-methyl amino acid has been introduced at a desired site. The following describes matters particularly related to the production of the polypeptide in (d).

[0151] When acylating tRNA with N-methylamino acids using the modified ARS of the present invention, it is preferable to use N-methylalanine, N-methylleucine, N-methyltryptophan, N-methylphenylalanine, N-methylvaline, N-methylthreonine, and / or N-methylserine as the N-methylamino acid, and particularly preferable are N-methylphenylalanine, N-methylvaline, N-methylthreonine, N-methyltryptophan, N-methylleucine, and / or N-methylserine.

[0152] The specific method for synthesizing the polypeptide may basically be performed according to known methods, for example, as described in WO2013100132, but various modifications are possible. In general, the synthesis can be performed according to the following description.

[0153] The translation system is preferably a cell-free translation system in which translation factors are reconstituted, such as PURESYSTEM (registered trademark) (BioComber, Japan). This allows the factors constituting the translation system to be freely manipulated, and for example, by removing phenylalanine and its ARS from the translation system and adding N-methylphenylalanine and the modified phenylalanine ARS of the present invention instead, N-methylphenylalanine can be site-specifically introduced into codons such as UUU or UUC that code for phenylalanine.

[0154] In the cell-free translation system, ATP and GTP are preferably used as ribonucleosides at 0.1-10 mM. As a buffer, HEPES-KOH is preferably used at 5-500 mM and pH 6.5-8.5, and other examples include, but are not limited to, Tris-HCl and phosphoric acid. As salts, acetates such as potassium acetate and ammonium acetate, and glutamates such as potassium glutamate can be used, and are preferably used at 10-1000 mM. As a magnesium component, magnesium acetate is preferably used at 2-200 mM, and other examples include, but are not limited to, magnesium chloride. As a component of the energy regeneration system, creatine kinase is preferably used at 0.4-40 μg / mL, and creatine phosphate is preferably used at 2-200 mM. Furthermore, other energy regeneration systems represented by pyruvate kinase and phosphoenolpyruvate can also be used. As the nucleoside conversion enzyme, myokinase and nucleoside diphosphate kinase are preferably used at 0.1-10 units / mL and 0.2-20 μg / mL, respectively. As the diphosphate decomposition enzyme, inorganic pyrophosphatase is preferably used at 0.2-20 units / mL. As the polyamine, spermidine is preferably used at 0.2-20 mM, and other examples include, but are not limited to, spermine. As the reducing agent, dithiothreitol is preferably used at 0.1-10 mM, and other examples include, but are not limited to, β-mercaptoethanol. As the tRNA, for example, E. coli MRE600 (RNase negative)-derived tRNA (Roche) is preferably used at 0.5-50 mg / mL, and other E. coli-derived tRNAs can also be used. As a formyl donor and an enzyme for synthesizing formylmethionine used in the translation initiation reaction, 10-HCO-H4folate is preferably used at 0.1-10 mM and methionyl-tRNA transformylase is preferably used at 0.05-5 μM. As translation initiation factors, IF1 is preferably used at 0.5-50 μM, IF2 is preferably used at 0.1-50 μM, and IF3 is preferably used at 0.1-50 μM.As the translation elongation factor, EF-G is preferably used at 0.1-50 μM, EF-Tu at 1-200 μM, and EF-Ts at 1-200 μM. As the translation termination factor, RF-2, RF3, and RRF are preferably used at 0.1-10 μM, respectively. Ribosomes are preferably used at 1-100 μM. There are 20 types of aminoacyl-tRNA synthetases, but only the enzymes corresponding to the amino acids contained in the peptide to be synthesized need to be added. For example, ArgRS, AspRS, LysRS, MetRS, and TyrRS are preferably used at 0.01-1 μM, respectively. The amino acids that serve as substrates for peptide synthesis are the 20 natural amino acids that constitute proteins and their derivatives, and it is preferable to use only the amino acids contained in the peptide to be synthesized at 0.25-10 mM. As the template for peptide synthesis, mRNA is preferably used at 0.1-10 μM. On the other hand, when transcribing mRNA from template DNA in a cell-free translation system, commercially available enzymes such as T7 RNA polymerase, T3 RNA polymerase, and SP6 RNA polymerase can be used, and may be selected appropriately to suit the promoter sequence of the template DNA, and are preferably used at 1-100 μg / mL. In this case, the substrate nucleosides CTP and UTP are preferably used at 0.1-10 mM. Translational synthesis of peptides is achieved by leaving a solution containing these factors at rest for 1 hour at 37° C., for example, and the temperature and reaction time are not limited to these.

[0155] The modified ARS of the present invention can also be combined with other techniques for introducing unnatural amino acids, such as the pdCpA method or the flexizyme method. For example, a polypeptide containing both can be synthesized by adding N-methylphenylalanine and modified phenylalanine ARS to a translation system while simultaneously adding aminoacyl-tRNA to which N-methylglycine has been bound by the pdCpA method to the translation system.

[0156] Alternatively, by inserting the modified ARS of the present invention into an expression vector or genome, the modified ARS can be expressed intracellularly, and a polypeptide containing N-methyl amino acid can be expressed intracellularly by using the N-methyl amino acid added to the medium as a substrate.

[0157] As the tRNA, tRNA of the natural amino acid corresponding to the N-methyl amino acid can be used. These may be purified products from living bodies containing modified bases, or tRNAs without modified bases generated by utilizing in vitro transcription reactions. Also, mutant tRNAs with mutations added to parts other than the part recognized by ARS in tRNA can also be used as substrates.

Example

[0158] The content of the above-described invention will be further described in detail by the following examples, which are illustrative and the scope of the present invention is not limited thereto. Various changes and modifications are possible for those skilled in the art based on the descriptions in the specification and the claims, and these changes and modifications are also included in the present invention.

[0159] All prior art documents cited in this specification are incorporated herein by reference.

[0160] Example 1: ARS that tolerates N-methylphenylalanine

[0161] <Preparation of plasmids of wild-type and mutant PheRS> Starting from a plasmid (pQE-32(2)2_wtPheRS) containing the ORF sequence (SEQ ID NO: 27, 28) of the E. coli wild-type PheRS α subunit gene, the mutant PheRS plasmid (having a His-tag (6xHis) at the N-terminus) shown in Table 1 was constructed by introducing site-specific mutations using PCR. Specifically, 2 μL of 10 ng / μL template, 10 μL of 2xKOD Fx buffer (TOYOBO KFX-101), 0.6 μL of 10 μM forward primer, 0.6 μL of 10 μM reverse primer, 4 μL of 2 mM dNTP, 0.4 μL of KOD FX (TOYOBO KFX-101), and 2.4 μL of H2O were mixed, and the reaction solution was heated to 94°C for 2 minutes, and then exposed to 10 cycles of heating at 98°C for 10 seconds and 68°C for 7 minutes to amplify the mutant gene. The combination of the template plasmid, forward primer, and reverse primer used is shown in Table 2. The sequences of the primers are SEQ ID NO: 30 to 33 for "F.F02" to "F.F05" and SEQ ID NO: 34 to 37 for "R.F02" to "R.F05". Then, 0.5 μL of 10 U / μL DpnI was added to the PCR reaction solution, and the template DNA was digested by incubating at 37°C for 1.5 hours, and the resulting mutated DNA was purified. Next, the resulting mutated DNA and pREP4 (Invitrogen, V004-50) encoding the lacI gene were simultaneously transformed into Escherichia coli strain XL-1 Blue (STRATAGENE, 200236), and the transformed strain was spread on an agar medium containing ampicillin and kanamycin to obtain a clone, from which the target plasmid was purified, and it was confirmed that the mutation had been introduced.

[0162] [Table 1]

[0163] [Table 2]

[0164] <Small-scale expression of wild-type and mutant PheRS> Subsequently, a plasmid containing the obtained mutant gene and the gene encoding the PheRSβ subunit was introduced into Escherichia coli to express the mutant protein heterodimer. First, Escherichia coli BL21 strain transformed with the mutant plasmid and pREP4 (Invitrogen, V004-50) was cultured at 37 °C in 4 mL of LB medium containing kanamycin, ampicillin, and 0.5% glucose. Then, after the OD value at 600 nm reached 0.4 - 0.8, IPTG with a final concentration of 0.5 mM was added, and the culture was continued at 37 °C for another 4 hours. Subsequently, the cells were collected by centrifugation.

[0165] <Small-scale purification of wild-type and mutant PheRS> Next, the obtained cells were disrupted, and the target mutant protein was purified from the supernatant. Specifically, the above cells were suspended in 600 μL of CHAPS solution (0.5% CHAPS (DOJINDO: 349-04722), 50% TBS (TaKaRa, T903)), mixed with 6 μL of 30 U / μl rLysozyme (Novagen, 71110-3) and 2 μL of 2.5 U / μL of benzonase nuclease (Novagen, 70746-3), incubated at room temperature for 30 minutes, and then imidazole with a final concentration of 15 mM was added. Subsequently, the insoluble fraction was separated by centrifugation. Subsequently, the obtained supernatant was used to purify the mutant protein according to the product manual using the Ni-NTA spin column kit from Qiagen (Qiagen, 31314). Finally, an excessive amount of imidazole was removed using a desalting column PD miniTrap G-25 (GE Healthcare 28-9180-07) according to the product manual.

[0166] <Large-scale purification of wild-type and mutant PheRS> For the mutant proteins whose activities were confirmed, large-scale preparation was carried out. Specifically, Escherichia coli BL21 strain transformed with a plasmid containing the mutant gene of the α subunit and the wild-type gene of the β subunit, and pREP4 (Invitrogen, V004-50) was cultured at 37 °C in 3 L of LB medium containing kanamycin, ampicillin and 0.5% glucose. Then, after the OD value at 600 nm reached 0.4, IPTG with a final concentration of 0.5 mM was added, and after further culturing at 37 °C for 4 hours, the cells were collected by a centrifuge. The above cells were suspended in 1 L of CHAPS solution (0.5% CHAPS (DOJINDO: 349-04722), 50% TBS (TaKaRa, T903)), mixed with 10 μL of 30 KU / μl rLysozyme (Novagen, 71110-3), and stirred at room temperature for 10 minutes. Subsequently, 2 mL of 1 M MgCl2 and 320 μL of Benzonase Nuclease (Novagen, 70746-3) were added, and the mixture was stirred at room temperature for 20 minutes. Then, after adding imidazole with a final concentration of 20 mM, the insoluble fraction was separated by centrifugation. Subsequently, using a column filled with 15 mL of Ni Sepharose High Performance (GE Healthcare) and AKTA10S (GE Healthcare), the mutant protein was purified by a gradient of imidazole concentration (initial concentration 20 mM, final concentration 500 mM). Finally, using a dialysis cassette (MWCO10,000, Slide-A-Lyzer G2 Dialysis Cassettes 70 mL, Thermo Scientific Pierce), dialysis was carried out 3 times (twice for 2 hours and once overnight) using 3 L of Stock solution (50 mM Hepes-KOH, 100 mM KCl, 10 mM MgCl2, 1 mM DTT, pH 7.6) to obtain the mutant protein.

[0167] <Aminoacylation reaction of N-methylphenylalanine by wild-type and mutant PheRS> [Synthesis of Escherichia coli tRNAPhe by in vitro transcription reaction] Escherichia coli tRNA (R-tRNAPhe (sequence number 39)) was synthesized from template DNA (D-tRNAPhe (sequence number 38)) by in vitro transcription reaction using RiboMAX Large Scale RNA production System T7 (Promega, P1300) in the presence of 7.5 mM GMP, and purified using an RNeasy Mini kit (Qiagen).

[0168] D-tRNAPhe (SEQ ID NO: 38) tRNAPhe DNA sequence: GGCGTAATACGACTCACTATAGCCCGGATAGCTCAGTCGGTAGAGCAGGGGATTGAAAATCCCCGTGTCCTTGGTTCGATTCCGAGTCCGGGCACCA

[0169] R-tRNAPhe (SEQ ID NO: 39) tRNAPhe RNA sequence: GCCCGGAUAGCUCAGUCGGUAGAGCAGGGGAUUGAAAAUCCCCUGUCCUUGGUUCGAUUCCGAGUCCGGGCACCA

[0170] <Aminoacylation reaction> To perform the aminoacylation reaction, a solution of 40 μM transcribed tRNAPhe, 10 mM HEPES-K (pH 7.6), and 10 mM KCl was heated at 95 °C for 2 minutes and then allowed to stand at room temperature for at least 5 minutes to refold the tRNA. This tRNA solution was adjusted to a final concentration of 10 μM, and after adding acylation buffer (final concentration 50 mM HEPES-K [pH 7.6], 2 mM ATP, 100 mM potassium acetate, 10 mM magnesium acetate, 1 mM DTT, 2 mM spermidine, 0.1 mg / mL Bovine Serum Albumin), it was mixed with wild-type or mutant PheRS (final concentration 0.5 μM) and phenylalanine (final concentration 0.25 mM, Watanabe Chemical Industries, G00029) or N-methylphenylalanine (final concentration 1 mM, Watanabe Chemical Industries, J00040) and incubated at 37 °C for 10 minutes. Four volumes of loading buffer (90 mM sodium acetate [pH 5.2], 10 mM EDTA, 95% (w / w) formamide, 0.001% (w / v) xylene cyanol) were added to the reaction solution, and it was analyzed by acidic PAGE (12% (w / v) polyacrylamide gel, pH 5.2) containing 6 M urea to separate unreacted tRNA and aminoacylated tRNA, thereby confirming the aminoacylation activity. RNA staining was performed using SYBR Gold (Life Technologies), and detection was performed using LAS4000 (GE Healthcare).

[0171] When evaluating the activity of the aminoacylation reaction, an improvement in the aminoacylation activity of N-methyl-phenylalanine was observed in mutants 04 and 05 compared to the wild type (Figure 1). The nucleotide sequence of mutant 04 is shown in SEQ ID NO: 12, and the amino acid sequence is shown in SEQ ID NO: 1. Also, the nucleotide sequence of mutant 05 is shown in SEQ ID NO: 13, and the amino acid sequence is shown in SEQ ID NO: 2.

[0172] <Introduction of N-methylphenylalanine translation by wild-type and mutant PheRS> [Synthesis of template DNA-F by in vitro transcription reaction]

[0173] A translation template mRNA (RF (sequence number 41)) was synthesized from the template DNA (DF (sequence number 40)) by in vitro transcription reaction using the RiboMAX Large Scale RNA production System T7 (Promega, P1300) and purified using an RNeasy Mini kit (Qiagen).

[0174] DF (SEQ ID NO: 40) DNA sequence: GGCGTAATACGACTCACTATAGGGTTAACTTTAACAAGGAGAAAAACATGCGTTTCCGTGACTACAAGGACGACGACGACAAGTAAGCTTCG

[0175] RF (SEQ ID NO: 41) RNA sequence: GGGUUAACUUUAACAAGGAGAAAAACAUGCGUUUCCGUGACUACAAGGACGACGACGACAAGUAAGCUUCG

[0176] <Cell-free translation system> To confirm the translational incorporation of N-methylphenylalanine, we synthesized the desired polypeptide containing N-methylphenylalanine by adding N-methylamino acids and PheRS to a cell-free translation system using the PURE system, a reconstituted cell-free protein synthesis system derived from Escherichia coli. Specifically, the basic cell-free translation solution (1 mM GTP, 1 mM ATP, 20 mM creatine phosphate, 50 mM HEPES-KOH pH 7.6, 100 mM potassium acetate, 9 mM magnesium acetate, 2 mM spermidine, 1 mM dithiothreitol, 0.5 mg / ml E. coli MRE600 (RNase negative) derived tRNA (Roche), 4 μg / ml creatine kinase, 3 μg / ml myokinase, 2 units / ml inorganic pyrophosphatase, 1.1 μg / ml nucleoside diphosphate kinase, 0.6 μM methionyl-tRNA transformylase, 0.26 μM EF-G, 0.24 μM RF2, 0.17 μM RF3, 0.5 μM RRF, 2.7 μM IF1, 0.4 μM IF2, 1.5 μM IF3, 40 μM A solution of EF-Tu, 44 μM EF-Ts, 1.2 μM ribosome, 0.03 μM ArgRS, 0.13 μM AspRS, 0.11 μM LysRS, 0.03 μM MetRS, and 0.02 μM TyrRS (the in-house prepared protein was basically prepared as a His-tagged protein) was supplemented with 1 μM template mRNA, arginine, aspartic acid, lysine, methionine, and tyrosine at 250 μM each. PheRS wild-type or mutant, phenylalanine, or N-methylphenylalanine was then added and the solution was left to stand at 37°C for 1 hour to perform translation synthesis of peptides.

[0177] <Detection by electrophoresis> In order to detect peptides into which N-methylphenylalanine was translated, a peptide translation experiment was carried out using radioisotope-labeled aspartic acid. Specifically, 1 μM template mRNA (RF (SEQ ID NO: 41)) and arginine, lysine, methionine, tyrosine (final concentration 250 μM each), 14A solution was prepared by adding C-aspartic acid (final concentration 37 μM, Moravek Biochemicals, MC139), and PheRS wild type or mutant 05 (final concentration 0.1 μM) and phenylalanine (final concentration 250 μM) or N-methylphenylalanine (final concentration 1 mM or 250 μM) were added and incubated at 37°C for 60 minutes. An equal amount of 2X sample buffer (TEFCO, cat No. 06-323) was added to the resulting translation reaction solution, which was then heated at 95°C for 3 minutes and subjected to electrophoresis (16% Peptide-PAGE mini, TEFCO, TB-162). After electrophoresis, the gel was dried using Clear Dry Quick Dry Starter KIT (TEFCO, 03-278), exposed to an imaging plate (GE Healthcare, 28-9564-75) for approximately 16 hours, detected using a bioanalyzer system (Typhoon FLA 7000, GE Healthcare), and analyzed using ImageQuantTL (GE Healthcare). In the presence of 0.1 μM wild-type PheRS, almost no bands of the translated peptide were observed when 0.25 mM and 1 mM N-methylphenylalanine were added (Figure 2). On the other hand, in the presence of 0.1 μM PheRS mutant 05, a peptide band was observed even when 0.25 mM N-methylphenylalanine was added. This confirmed that the aminoacylation activity of PheRS mutant 05 for N-methylphenylalanine was improved and that the translation synthesis of peptides containing N-methylphenylalanine proceeded in high yields.

[0178] <Detection by mass spectrometry> To detect peptides into which N-methylphenylalanine was translated, mass spectrometry was performed using MALDI-TOF MS. Specifically, a solution was prepared by adding 1 μM template mRNA (RF (SEQ ID NO: 41)) and each amino acid, arginine, lysine, methionine, tyrosine, and aspartic acid (final concentration 250 μM each), to the above-mentioned cell-free translation system, and PheRS (final concentration 0.1 μM) and phenylalanine (final concentration 250 μM) or N-methylphenylalanine (final concentration 1 mM or 250 μM) were added and incubated at 37 ° C for 60 minutes. The obtained translation reaction product was purified with SPE C-TIP (Nikkyo Technos Co., Ltd.) and analyzed by MALDI-TOF MS. α-cyano-4-hydroxycinnamic acid was used as a matrix for the translation product.

[0179] As a control experiment, when a translation experiment was performed in the presence of 0.1 μM PheRS wild-type (sequence number 28) or PheRS mutant 05 (sequence number 2) and 250 μM phenylalanine was added, a peak indicating the introduction of phenylalanine (Calculated [M+H]+ = 1631.7) was detected in both cases (Figures 3(a) and (d)).

[0180] Next, when 0.25 mM N-methylphenylalanine was added to the wild-type PheRS and translation synthesis was performed, an N-methylphenylalanine peak (Calculated [M+H]+=1645.7) and a phenylalanine peak were observed (Figure 3(b)). This phenomenon is thought to be due to the phenylalanine contaminated in N-methylphenylalanine being recognized by the wild-type PheRS, causing an aminoacylation reaction, and translation synthesis proceeding. Furthermore, under the condition of 1 mM N-methylphenylalanine, the peak intensity derived from N-methylphenylalanine increased (Figure 3(c)). When the peak intensity ratio at each amino acid concentration was calculated (calculation formula: peak intensity ratio = N-methylphenylalanine peak intensity / phenylalanine peak intensity), it was 0.8 at 0.25 mM and 2.6 at 1 mM. Next, when translation synthesis was carried out by adding 0.25 mM or 1 mM of N-methylphenylalanine to PheRS variant 05, a peak of N-methylphenylalanine was significantly detected, and the peak intensity ratio to phenylalanine was 12.4 at 0.25 mM and 16.0 at 1 mM (Figs. 3(e) and (f)). From these results, it was confirmed that, compared with the PheRS wild type, PheRS variant 05 has high aminoacylation activity for N-methylphenylalanine, and as a result, promotes the translation synthesis of peptides containing N-methylphenylalanine.

[0181] Peptide sequence P-F1 (SEQ ID NO: 42) formylMetArgPheArgAspTyrLysAspAspAspAspLys

[0182] Peptide sequence P-MeF1 (SEQ ID NO: 42) formylMetArg[MePhe]ArgAspTyrLysAspAspAspAspLys

[0183] MALDI-TOF MS: Calc. m / z: [H+M]+ = 1631.7 (peptide corresponding to sequence P-F1.) Calc. m / z: [H+M]+ = 1645.7 (peptide corresponding to sequence P-MeF1.)

[0184] <Comparison with the pdCpA method> The incorporation efficiency of N-methylphenylalanine was compared with the pdCpA method. Translation was performed using a cell-free translation system with sequences containing one, two consecutive, or three consecutive phenylalanines, and the bands of the synthesized peptides were detected by electrophoresis. When compared between the case of using the PheRS mutant (PhrRS05 (SEQ ID NO: 2)) of the present invention and the case of using the pdCpA method, in both cases, a higher amount of synthesized peptide was detected when using the PheRS mutant of the present invention compared to the pdCpA method, confirming that the translation efficiency was high. In particular, it was found that the amount of peptide produced when translating sequences containing two consecutive and three consecutive N-methylphenylalanines was 4 to 8 times higher when using the PheRS mutant (PhrRS05) of the present invention than when using the pdCpA method.

[0185] Example 2: ARS that tolerates N-methylvaline

[0186] <Preparation of plasmids for ValRS wild type and mutants> Starting from a plasmid (PQE-32(2)2_wtVALRS) encoding the ORF sequence (SEQ ID NO: 23, 24) containing the wild-type ValRS gene of E. coli, a ValRS plasmid (having a His-tag (6xHis) at the N-terminus) with the mutations listed in Table 3 was constructed by introducing site-specific mutations using PCR. Specifically, 2 μL of 10 ng / μL template, 10 μL of 2xKOD Fx buffer (TOYOBO KFX-101), 0.6 μL of 10 μM forward primer, 0.6 μL of 10 μM reverse primer, 4 μL of 2 mM dNTP, 0.4 μL of KOD FX (TOYOBO KFX-101), and 2.4 μL of H2O were mixed, and the reaction solution was then heated to 94°C for 2 minutes, and then subjected to 10 cycles of heating at 98°C for 10 seconds and 68°C for 7 minutes to amplify the mutant gene. The combinations of the template plasmids, forward primers, and reverse primers used are shown in Table 4. The sequences of the primers are SEQ ID NOs: 43 to 79 for "F.V2" to "F.V19", "F.V46" to "F.V48", and "F.V13-01" to "F.V13-16", and SEQ ID NOs: 80 to 116 for "R.V2" to "R.V19", "R.V46" to "R.V48", and "R.V13-01" to "R.V13-16". Then, 0.5 μL of 10 U / μL DpnI was added to the PCR reaction solution, and the template DNA was digested by incubation at 37° C. for 1.5 hours, and the resulting mutant DNA was purified. Next, the resulting mutated DNA and pREP4 (Invitrogen, V004-50) encoding the lacI gene were simultaneously transformed into Escherichia coli strain XL-1 Blue (STRATAGENE, 200236), and the transformed strain was plated on agar medium containing ampicillin and kanamycin to obtain clones from which the target plasmid was purified and it was confirmed that the mutation had been introduced. In addition, for constructing a plasmid requiring multiple steps of mutagenesis, the above procedure was repeated to obtain the desired plasmid with the mutation introduced. The combination of primers and templates used in this case is shown in Table 4.

[0187] [Table 3]

[0188]

Table 4

[0189] <Small-scale expression of wild-type and mutant ValRS> Subsequently, the obtained mutant plasmid was introduced into E. coli to express the mutant protein. First, the transformed E. coli BL21 strain with the mutant plasmid and pREP4 (Invitrogen, V004-50) was cultured at 37 °C in 4 mL of LB medium containing kanamycin and ampicillin. After that, IPTG with a final concentration of 0.5 mM was added after the OD value at 600 nm reached 0.4 - 0.8, and the cells were further cultured at 37 °C for 4 hours, and then the cells were collected by a centrifuge.

[0190] <Small-scale purification of wild-type and mutant ValRS> Next, the obtained cells were disrupted, and the target mutant protein was purified from the supernatant. Specifically, the above cells were suspended in 600 μL of CHAPS solution (0.5% CHAPS (DOJINDO: 349-04722), 50% TBS (TaKaRa, T903)), mixed with 6 μL of 30 U / μl rLysozyme (Novagen, 71110-3), incubated at room temperature for 10 minutes, further mixed with 2 μL of 2.5 U / μL of benzonase nuclease (Novagen, 70746-3), incubated at room temperature for 20 minutes, and the insoluble fraction was separated by centrifugation. Subsequently, the obtained supernatant was used to purify the mutant protein according to the product manual using the Ni-NTA spin column kit from Qiagen (Qiagen, 31314). Finally, the desalting column PD miniTrap G-25 (GE Healthcare 28-9180-07) was used to remove excess imidazole according to the product manual.

[0191] <Aminoacylation reaction of N-methylvaline by wild-type and mutant ValRS> [Synthesis of E. coli tRNAVal by in vitro transcription reaction] Escherichia coli tRNA (R-tRNAVal2A (sequence number 118)) was synthesized from template DNA (D-tRNAVal2A (sequence number 117)) by in vitro transcription reaction using RiboMAX Large Scale RNA production System T7 (Promega, P1300) in the presence of 7.5 mM GMP, and purified using an RNeasy Mini kit (Qiagen).

[0192] D-tRNAVal2A (SEQ ID NO: 117) tRNAVal2A DNA sequence: GGCGTAATACGACTCACTATAGCGTCCGTAGCTCAGTTGGTTAGAGCACCACCTTGACATGGTGGGGGTCGGTGGTTCGAGTCCACTCGGACGCACCA

[0193] R-tRNAVal2A (SEQ ID NO: 118) tRNAVal2A RNA sequence: GCGUCCGUAGCUCAGUUGGUUAGAGCACCACCUUGACAUGGUGGGGUCGGUGGUUCGAGUCCACUCGGACGCACCA

[0194] <Aminoacylation reaction> To perform the aminoacylation reaction, a solution of 40 μM transcribed tRNA, 10 mM HEPES-K (pH 7.6), and 10 mM KCl was heated at 95 °C for 2 minutes and then allowed to stand at room temperature for at least 5 minutes to refold the tRNA. The tRNA solution was adjusted to a final concentration of 10 μM, and then acylation buffer (final concentration 50 mM HEPES-K [pH 7.6], 2 mM ATP, 100 mM potassium acetate, 10 mM magnesium acetate, 1 mM DTT, 2 mM spermidine, 0.1 mg / mL Bovine Serum Albumin) was added. After that, wild-type or mutant ValRS (final concentration 0.2 - 1 μM) and N-methylvaline (final concentration 5 mM) were added and mixed, and the mixture was incubated at 37 °C for 10 minutes. Four volumes of loading buffer (90 mM sodium acetate [pH 5.2], 10 mM EDTA, 95% (w / w) formamide, 0.001% (w / v) xylene cyanol) was added to the reaction solution, and the solution was analyzed by acidic PAGE containing 6 M urea to separate unreacted tRNA and aminoacyl-tRNA, thereby confirming the aminoacylation activity. RNA staining was performed using SYBR Gold (Life Technologies), and detection was performed using LAS4000 (GE Healthcare) (Figure 4). As a result, tRNA acylated with N-methylvaline was observed in Variant 13, indicating that its aminoacylation activity against N-methylvaline was higher than that of wild-type ValRS (Figure 4, lane 2 vs 10).

[0195] <Introduction of N-methylvaline by wild-type and mutant ValRS> Translation template mRNAs (R-V, R-V2, R-V3 (SEQ ID NOs: 120, 122, 124 respectively)) were synthesized from template DNAs (D-V, D-V2, D-V3 (SEQ ID NOs: 119, 121, 123 respectively)) by in vitro transcription reaction using RiboMAX Large Scale RNA Production System T7 (Promega, P1300) and purified using the RNeasy Mini kit (Qiagen).

[0196] D-V (SEQ ID NO: 119) DNA sequence: GGCGTAATACGACTCACTATAGGGTTAACTTTAACAAGGAGAAAAACATGCGTGTCCGTGACTACAAGGACGACGACGACAAGTAAGCTTCG

[0197] RV (SEQ ID NO: 120) RNA sequence: GGGUUAACUUUAACAAGGAGAAAAACAUGCGUGUCGGUGACUACAAGGACGACGACGACAAGUAAGCUUCG

[0198] D-V2 (SEQ ID NO: 121) DNA sequence: GGCGTAATACGACTCACTATAGGGTTAACTTTAACAAGGAGAAAAAACATGCGTGTCGTCCGTGACTACAAGGACGACGACGACAAGTAAGCTTCG

[0199] R-V2 (SEQ ID NO: 122) RNA sequence: GGGUUAACUUUAACAAGGAGAAAAACAUGCGUGUCGUCCGUGACUACAAGGACGACGACGACAAGUAAGCUUCG

[0200] D-V3 (SEQ ID NO: 123) DNA sequence: GGCGTAATACGACTCACTATAGGGTTAACTTTAACAAGGAGAAAAACATGCGTGTCGTCGTCCGTGACTACAAGGACGACGACGACAAGTAAGCTTCG

[0201] R-V3 (SEQ ID NO: 124) RNA sequence: GGGUUAACUUUAACAAGGAGAAAAACAUGCGCGUGUCGUCGUCUGACUACAAGGACGACGACGACAAGUAAGCUUCG

[0202] <Cell-free translation system> To confirm the translational incorporation of N-methylvaline, we synthesized the desired polypeptide containing N-methylvaline by adding N-methylvaline and the ValRS mutant to a cell-free translation system, the PURE system, a reconstituted cell-free protein synthesis system derived from Escherichia coli. Specifically, the basic cell-free translation solution (1 mM GTP, 1 mM ATP, 20 mM creatine phosphate, 50 mM HEPES-KOH pH 7.6, 100 mM potassium acetate, 9 mM magnesium acetate, 2 mM spermidine, 1 mM dithiothreitol, 1.5 mg / ml E. coli MRE600 (RNase negative) derived tRNA (Roche), 0.1 mM 10-HCO-H4folate, 4 μg / ml creatine kinase, 3 μg / ml myokinase, 2 units / ml inorganic pyrophosphatase, 1.1 μg / ml nucleoside diphosphate kinase, 0.6 μM methionyl-tRNA transformylase, 0.26 μM EF-G, 0.24 μM RF2, 0.17 μM RF3, 0.5 μM RRF, 2.7 μM IF1, 0.4 μM A solution of 1 μM IF2, 1.5 μM IF3, 40 μM EF-Tu, 84 μM EF-Ts, 1.2 μM ribosome, 0.03 μM ArgRS, 0.13 μM AspRS, 0.11 μM LysRS, 0.03 μM MetRS, and 0.02 μM TyrRS (the in-house prepared proteins were basically prepared as His-tagged proteins) was added with 1 μM template mRNA, arginine, aspartic acid, lysine, methionine, and tyrosine at 250 μM each, and ValRS wild-type or mutant and N-methylvaline were added. The solution was then left to stand at 37°C for 1 hour to achieve translational synthesis of peptides.

[0203] <Detection by mass spectrometry> To detect peptides into which N-methylvaline was translated, mass spectrometry was performed using MALDI-TOF MS. Specifically, a solution was prepared by adding 1 μM template mRNA (RV (SEQ ID NO: 120)) and arginine, lysine, methionine, tyrosine, and aspartic acid (final concentration 250 μM each) to the above-mentioned cell-free translation system, and ValRS (final concentration 0.1-1 μM) and N-methylvaline (final concentration 5 mM) were added and incubated at 37 ° C for 60 minutes. The obtained translation reaction product was purified with SPE C-TIP (Nikkyo Technos Co., Ltd.) and analyzed by MALDI-TOF MS. The translation product was identified by measuring the MALDI-TOF MS spectrum using α-cyano-4-hydroxycinnamic acid as a matrix. As a result of translation using wild-type ValRS (SEQ ID NO: 24), a peak corresponding to the peptide sequence P-V1 into which valine contaminating in the cell-free translation system had been introduced (Figure 5(a), Peak V1, m / z: [H+M]+=1583.6) was observed as the main product. When similar experiments were performed using various mutant ValRSs, when ValRS04 (SEQ ID NO: 3) and ValRS13 (SEQ ID NO: 4) were used, a peak corresponding to the peptide sequence P-MeV1 into which N-methylvaline had been introduced (Figure 5(b), Peak MeV1, m / z: [H+M]+=1597.5; Figure 5(c), Peak MeV2, m / z: [H+M]+=1597.5) was observed as the main product. This indicates that ValRS04 and ValRS13 have improved activity against N-methylvaline compared to wild-type ValRS from the viewpoint of translation. In addition, peaks corresponding to peptide P-V1, into which valine contaminating the translation system was introduced (Fig. 5(b) Peak V2, (c) Peak V3) were also observed at the same time, but the peak intensity was smaller in ValRS13, suggesting that ValRS13 has higher activity against N-methylvaline (Fig. 5(b) and (c)).

[0204] Peptide sequence P-V1 (SEQ ID NO: 125) formylMetArgValArgAspTyrLysAspAspAspAspLys

[0205] Peptide sequence P-MeV1 (SEQ ID NO: 125) formylMetArg[MeVal]ArgAspTyrLysAspAspAspAspLys

[0206] MALDI-TOF MS: Calc. m / z: [H+M]+ = 1583.7 (peptide corresponding to P-V1). Calc. m / z: [H+M]+ = 1597.7 (peptide corresponding to P-MeV1).

[0207] <Preparation of ValRS13-11 Mutant with Further Improved Aminoacylation Activity against N-Methylvaline> By introducing further mutations into the above-mentioned ValRS13, the aim was to improve the activity against N-methylvaline. The plasmid into which the target mutation was introduced was prepared as described above, and the ValRS mutant was prepared by expression and purification in E. coli (Table 3). As a result of screening by aminoacylation reaction and in vitro translation, ValRS13-11 (SEQ ID NO: 5) showed higher activity against N-methylvaline compared with ValRS13.

[0208] When the aminoacylation reactions of N-methylvaline by ValRS wild type, ValRS13 and ValRS13-11 were confirmed, it was observed that the amount of aminoacyl-tRNA synthesized by ValRS13-11 was larger than that by ValRS13 (Figure 6, lanes 8 vs 9 and lanes 12 vs 13). Especially at a low concentration of 1.25 mM of N-methylvaline, a large difference occurred in the synthesis amounts between ValRS13 and ValRS13-11, indicating that ValRS13-11 has high activity.

[0209] Next, to confirm the translation synthesis of peptides containing N-methylvaline using ValRS13 and ValRS13-11, mass spectrometry was performed using MALDI-TOF MS. Specifically, a solution was prepared by adding 1 μM template mRNA (RV (SEQ ID NO: 120)) and arginine, lysine, methionine, tyrosine, and aspartic acid (final concentration 250 μM each) to the above-mentioned cell-free translation system, and ValRS (final concentration 4 μM) and N-methylvaline (final concentration 5 mM) were added and incubated at 37 ° C for 60 minutes. In addition, a similar experiment was performed using template mRNAs (R-V2 (SEQ ID NO: 122), R-V3 (SEQ ID NO: 124)) encoding peptide sequences with two or three consecutive N-methylvalines. The obtained translation reaction product was purified with SPE C-TIP (Nikkyo Technos Co., Ltd.) and analyzed by MALDI-TOF MS.

[0210] When template mRNA (RV (SEQ ID NO: 120)) containing one N-methylvaline was used, the synthesis of the peptide sequence P-MeV1 containing the target N-methylvaline was confirmed by ValRS13 and ValRS13-11 (Figure 7(a) Peak MeV1, (b) Peak MeV2). In addition, a slight peak corresponding to the peptide sequence P-V1 containing valine contaminating the cell-free translation system was observed (Figure 7(a) Peak V1, (b) Peak V2).

[0211] Next, when template mRNA (R-V2 (SEQ ID NO: 122)) containing two consecutive N-methylvalines was used, the synthesis of the peptide sequence P-MeV2 containing two N-methylvaline residues as the main product was confirmed for both ValRS mutants (Fig. 7(c) Peak MeV3, (d) Peak MeV5). On the other hand, the peptide sequence P-MeV4 containing one N-methylvaline residue and one valine residue was observed (Fig. 7(c) Peak MeV4, (d) Peak MeV6), but the peak intensity was somewhat suppressed in ValRS13-11 compared to ValRS13.

[0212] Finally, a translation experiment was performed using template mRNA (R-V3 (SEQ ID NO: 124)) containing three consecutive N-methylvalines. When ValRS13 was added, the synthesis of the target peptide sequence P-MeV3 containing three N-methylvaline residues was observed (Figure 7(e), Peak MeV7), but the main product was the peptide sequence P-MeV5 consisting of two N-methylvaline residues and one valine residue (Figure 7(e), Peak MeV8). The peptide sequence P-MeV6 consisting of one N-methylvaline residue and two valine residues was also observed (Figure 7(e), Peak MeV9). On the other hand, when ValRS13-11 was added, the translation synthesis of the target peptide sequence P-MeV3 containing three N-methylvaline residues was observed as the main product (Figure 7(f), Peak MeV10). The peptide sequences P-MeV5 and P-MeV6 containing valine were also observed, but their peak intensities were suppressed compared to ValRS13 (Figure 7(f), Peak MeV11 and MeV12). These results indicate that ValRS13-11 has improved aminoacylation activity for N-methylvaline compared to ValRS13, leading to an increase in the translation synthesis yield of the desired peptide containing N-methylvaline.

[0213] Peptide sequence P-MeV2 (SEQ ID NO: 126) formylMetArg[MeVal][MeVal]ArgAspTyrLysAspAspAspAspLys

[0214] Peptide sequence P-MeV4 (SEQ ID NO: 126) formylMetArg[MeVal]ValArgAspTyrLysAspAspAspAspLys or formylMetArgVal[MeVal]ArgAspTyrLysAspAspAspAspLys

[0215] Peptide sequence P-MeV3 (SEQ ID NO: 127) formylMetArg[MeVal][MeVal][MeVal]ArgAspTyrLysAspAspAspAspLys

[0216] Peptide sequence P-MeV5 (SEQ ID NO: 127) formylMetArg[MeVal][MeVal]ValArgAspTyrLysAspAspAspAspLys or formylMetArg[MeVal]Val[MeVal]ArgAspTyrLysAspAspAspAspLys or formylMetArgVal[MeVal][MeVal]ArgAspTyrLysAspAspAspAspLys

[0217] Peptide sequence P-MeV6 (SEQ ID NO: 127) formylMetArg[MeVal]ValValArgAspTyrLysAspAspAspAspLys or formylMetArgVal[MeVal]ValArgAspTyrLysAspAspAspAspLys or formylMetArgValVal[MeVal]ArgAspTyrLysAspAspAspAspLys

[0218] MALDI-TOF MS: Calc. m / z: [H+M]+=1710.8 (Peptide corresponding to sequence P-MeV2.) Calc. m / z: [H+M]+=1696.8 (Peptide corresponding to sequence P-MeV4.) Calc. m / z: [H+M]+=1823.9 (Peptide corresponding to sequence P-MeV3.) Calc. m / z: [H+M]+=1809.9 (Peptide corresponding to sequence P-MeV5.) Calc. m / z: [H+M]+=1795.9 (Peptide corresponding to sequence P-MeV6.)

[0219] Example 3: Development of an ARS that tolerates N-methylserine

[0220] <Preparation of Plasmids of SerRS Wild-Type and Mutants> Using the plasmid encoding the ORF sequence (SEQ ID NOs: 25, 26) containing the wild-type E. coli SerRS gene (PQE-32(2)2_wtSERRS) as the starting material, mutant SerRS plasmids (having a His-tag (6xHis) at the N-terminus) described in Table 5 were constructed by introducing site-specific mutations using the PCR method. Specifically, 2.5 μL of 10 ng / μL template, 12.5 μL of 2xKOD Fx buffer (TOYOBO, KFX-101), 0.75 μL of 10 μM Forward primer, 0.75 μL of 10 μM Reverse primer, 5 μL of 2 mM dNTP, 0.5 μL of KOD FX (TOYOBO, KFX-101), and 3 μL of H2O were mixed. Subsequently, the reaction solution was heated at 94°C for 2 minutes, and then subjected to 10 cycles of heating consisting of 98°C for 10 seconds and 68°C for 7 minutes to amplify the mutant gene. The combinations of the template plasmid, Forward primer, and Reverse primer used are shown in Table 6. The sequences of each primer are SEQ ID NOs: 128 to 149 in order from "F.S2" to "F.S8", "F.S15" to "F.S23", and "F.S33" to "F.S38", and SEQ ID NOs: 150 to 171 in order from "R.S2" to "R.S8", "R.S15" to "R.S23", and "R.S33" to "R.S38". Thereafter, 0.5 μL of 10 U / μL DpnI was added to the PCR reaction solution, and the template DNA was digested by further incubating at 37°C for 1.5 hours, and the obtained mutant DNA was purified. Subsequently, the obtained gene mutant DNA and pREP4 (Invitrogen, V004-50) encoding the lacI gene were simultaneously transformed into the E. coli strain XL-1 Blue (STRATAGENE, 200236), and the target plasmid was purified from the clones obtained by spreading the transformants on an agar medium containing ampicillin and kanamycin, and it was confirmed that the mutation had been introduced.

[0221] Also, for plasmid construction requiring multi-step mutation introduction, the target mutation-introduced plasmid was obtained by repeating the above operations. The combinations of primers and templates in that case are shown in Table 6.

[0222]

Table 5

[0223]

Table 6

[0224] <Small-scale expression of SerRS wild type and mutants> Subsequently, the obtained mutant plasmid was introduced into E. coli to express the mutant protein. First, the transformed E. coli BL21 strain with the mutant plasmid and pREP4 (Invitrogen, V004-50) was cultured at 37 °C in 4 mL of LB medium containing kanamycin and ampicillin. After that, when the OD value at 600 nm reached 0.4 - 0.8, IPTG with a final concentration of 0.5 mM was added, and the culture was continued at 37 °C for another 4 hours. Then, the cells were collected by a centrifuge.

[0225] <Small-scale purification of SerRS wild type and mutants> Next, the obtained cells were disrupted, and the target mutant protein was purified from the supernatant. Specifically, the above cells were suspended in 600 μL of CHAPS solution (0.5% CHAPS (DOJINDO: 349-04722), 50% TBS (TaKaRa, T903)), mixed with 6 μL of 30 U / μl rLysozyme (Novagen, 71110-3), incubated at room temperature for 10 minutes, further mixed with 2 μL of 2.5 U / μL benzonase nuclease (Novagen, 70746-3), incubated at room temperature for 20 minutes, and the insoluble fraction was separated by centrifugation. Subsequently, the obtained supernatant was used to purify the mutant protein according to the product manual using the Qiagen Ni-NTA spin column kit (Qiagen, 31314). Finally, an excess of imidazole was removed using a desalting column PD miniTrap G-25 (GE Healthcare 28-9180-07) according to the product manual.

[0226] <Aminoacylation Reactions of N-Methylserine of SerRS Wild-Type and Mutants> [Synthesis of Escherichia coli tRNASer by In Vitro Transcription Reaction] Escherichia coli tRNA (R-tRNASer3 (SEQ ID NO: 173)) was synthesized from template DNA (D-tRNASer3 (SEQ ID NO: 172)) by an in vitro transcription reaction using the RiboMAX Large Scale RNA production System T7 (Promega, P1300) in the presence of 7.5 mM GMP and purified with an RNeasy Mini kit (Qiagen).

[0227] D-tRNASer3 (SEQ ID NO: 172) tRNASer3 DNA sequence: GGCGTAATACGACTCACTATAGGTGAGGTGGCCGAGAGGCTGAAGGCGCTCCCCTGCTAAGGGAGTATGCGGTCAAAAGCTGCATCCGGGGTTCGAATCCCCGCCTCACCGCCA

[0228] R-tRNASer3 (SEQ ID NO: 173) tRNASer3 RNA sequence: GGUGAGGUGGCCGAGAGGCUGAAGGCGCUCCCCUGCUAAGGGAGUAUGCGGUCAAAAGCUGCAUCCGGGGUUCGAAUCCCCGCCUCACCGCCA

[0229] <Aminoacylation Reaction> To perform the aminoacylation reaction, a solution of 40 μM transcribed tRNA, 10 mM HEPES-K (pH 7.6), and 10 mM KCl was heated at 95 °C for 2 minutes and then allowed to stand at room temperature for at least 5 minutes to refold the tRNA. The acylating buffer (final concentration 50 mM HEPES-K [pH 7.6], 2 mM ATP, 100 mM potassium acetate, 10 mM magnesium acetate, 1 mM DTT, 2 mM spermidine, 0.1 mg / mL Bovine Serum Albumin) was added to the tRNA solution to a final concentration of 10 μM, followed by mixing with SerRS wild type or mutants (final concentration 0.1 - 2 μM) and N-methylserine (final concentration 1 mM), and incubating at 37 °C for 10 minutes. Four volumes of loading buffer (90 mM sodium acetate [pH 5.2], 10 mM EDTA, 95% (w / w) formamide, 0.001% (w / v) xylene cyanol) were added to the reaction solution, and the solution was analyzed by acidic PAGE containing 6 M urea to separate unreacted tRNA and aminoacyl-tRNA, thereby confirming the aminoacylation activity. RNA staining was performed using SYBR Gold (Life Technologies), and detection was performed using LAS4000 (GE Healthcare) (Figure 8).

[0230] As a result, tRNA acylated with N-methylserine was observed for mutants 03 (SEQ ID NO: 6), 35 (SEQ ID NO: 8), and 37 (SEQ ID NO: 9), suggesting that the aminoacylation activity of N-methylserine is higher than that of wild-type SerRS. (Figure 8, lanes 3, 5, 27).

[0231] <Introduction of N-methylserine translation by SerRS wild type and mutants> Template mRNA (R-S (SEQ ID NO: 175)) was synthesized from template DNA (D-S (SEQ ID NO: 174)) by an in vitro transcription reaction using the RiboMAX Large Scale RNA production System T7 (Promega, P1300) and purified using the RNeasy Mini kit (Qiagen).

[0232] DS(CT21) (SEQ ID NO: 174) DNA sequence: GGCGTAATACGACTCACTATAGGGTTAACTTTAACAAGGAGAAAAACATGCGTTCCCGTGACTACAAGGACGACGACGACAAGTAAGCTTCG

[0233] RS (SEQ ID NO: 175) RNA sequence: GGGUUAACUUUAACAAGGAGAAAAACAUGCGUUCCCGUGACUACAAGGACGACGACGACAAGUAAGCUUCG

[0234] <Cell-free translation system> To confirm the translational incorporation of N-methylserine, we synthesized the desired polypeptide containing N-methylserine by adding N-methylserine and SerRS to a cell-free translation system, PURE system, a reconstituted cell-free protein synthesis system derived from Escherichia coli. Specifically, the basic cell-free translation solution (1 mM GTP, 1 mM ATP, 20 mM creatine phosphate, 50 mM HEPES-KOH pH 7.6, 100 mM potassium acetate, 9 mM magnesium acetate, 2 mM spermidine, 1 mM dithiothreitol, 1.5 mg / ml E. coli MRE600 (RNase negative) derived tRNA (Roche), 0.1 mM 10-HCO-H4folate, 4 μg / ml creatine kinase, 3 μg / ml myokinase, 2 units / ml inorganic pyrophosphatase, 1.1 μg / ml nucleoside diphosphate kinase, 0.6 μM methionyl-tRNA transformylase, 0.26 μM EF-G, 0.24 μM RF2, 0.17 μM RF3, 0.5 μM RRF, 2.7 μM IF1, 0.4 μM A solution of 1 μM IF2, 1.5 μM IF3, 40 μM EF-Tu, 84 μM EF-Ts, 1.2 μM ribosome, 0.03 μM ArgRS, 0.13 μM AspRS, 0.11 μM LysRS, 0.03 μM MetRS, and 0.02 μM TyrRS (the in-house prepared proteins were basically prepared as His-tagged proteins) was added with 1 μM template mRNA, arginine, aspartic acid, lysine, methionine, and tyrosine at 250 μM each, and SerRS wild-type or mutant and N-methylserine were added. The solution was then left to stand at 37°C for 1 hour to achieve translational synthesis of peptides.

[0235] <Detection by mass spectrometry> To detect peptides into which N-methylserine was translated, mass spectrometry was performed using MALDI-TOF MS. Specifically, a solution was prepared by adding 1 μM template mRNA (RS (SEQ ID NO: 175)) and arginine, lysine, methionine, tyrosine, and aspartic acid (final concentration 250 μM each) to the above-mentioned cell-free translation system, and SerRS (final concentration 0.1-2 μM) and N-methylserine (final concentration 5 mM) were added and incubated at 37 ° C. for 60 minutes. The obtained translation reaction product was purified with SPE C-TIP (Nikkyo Technos Co., Ltd.) and analyzed by MALDI-TOF MS. The translation product was identified by measuring the MALDI-TOF MS spectrum using α-cyano-4-hydroxycinnamic acid as a matrix.

[0236] As a result of translation using wild-type SerRS (sequence number 25), a peak corresponding to the target peptide peak P-CT21MeSer containing N-methylserine was observed (Figure 9(a), Peak MeS1 m / z: [H+M]+ = 1585.6), but the main product was a peak corresponding to the Ser-containing peptide P-CT21Ser (Figure 9(a), Peak S1 m / z: [H+M]+ = 1571.6), which is thought to be derived from a trace amount of Ser contaminating the translation system (Figure 9(a)). On the other hand, when a similar experiment was performed using mutant SerRSs (Ser03 (sequence number 6), 05 (sequence number 7)) with mutations introduced, peaks corresponding to P-CT21Ser were also observed (Fig. 9(b) Peak S2, (c) Peak S3), but this was found to be a by-product, and the main product was P-CT21MeSer (Fig. 9(b) Peak MeS2, (c) Peak MeS3). In particular, when SerRS35 and 37 were used, no peaks corresponding to P-CT21Ser were observed, indicating that CT21MeSer was synthesized with high purity (Fig. 9(d) Peak MeS4, (e) Peak MeS5). These results indicate that these modified SerRSs have improved activity against MeSer compared to wild-type SerRS.

[0237] Peptide sequence P-CT21Ser (SEQ ID NO: 176) formylMetArgSerArgAspTyrLysAspAspAspAspLys

[0238] Peptide sequence P-CT21MeSer (SEQ ID NO: 176) formylMetArg[MeSer]ArgAspTyrLysAspAspAspAspLys

[0239] MALDI-TOF MS: Calc. m / z: [H+M]+ = 1571.7 (peptide corresponding to SEQ P-CT21Ser.) Calc. m / z: [H+M]+ = 1585.7 (peptide corresponding to SEQ P-CT21MeSer.)

[0240] Example 4: Development of an N-methylthreonine-tolerant ARS

[0241] <Protein Preparation of ThrRS Wild-Type and Mutants> An expression vector having a polyhistidine sequence at the N-terminus and containing the mutations described in Table 7 was constructed. Subsequently, this vector was transformed into an expression strain, and the target mutant protein was purified from the supernatant after cell disruption using a nickel column.

[0242]

Table 7

[0243] <Translation Introduction of N-Methylthreonine by ThrRS Wild-Type and Mutants> Template mRNA (R-T (SEQ ID NO: 178)) was synthesized from template DNA (D-T (SEQ ID NO: 177)) by an in vitro transcription reaction using RiboMAX Large Scale RNA production System T7 (Promega, P1300) and purified by RNeasy Mini kit (Qiagen).

[0244] D-T(3lib15#09) (SEQ ID NO: 177) DNA sequence: GGCGTAATACGACTCACTATAGGGTTAACTTTAAGAAGGAGATATACATATGAAGGCTGGTCCGGGTTTTATGACTAAGAGTGGTAGTGGTAGTTAAGCTTCG

[0245] R-T (SEQ ID NO: 178) RNA sequence: GGGUUAACUUUAAGAAGGAGAUAUACAUAUGAAGGCUGGUCCGGGUUUUAUGACUAAGAGUGGUAGUGGUAGUUAAGCUUCG

[0246] <Cell-free translation system> To confirm the translational incorporation of N-methylthreonine, we synthesized the desired polypeptide containing N-methylthreonine by adding N-methylthreonine and the ThrRS mutant to a cell-free translation system, the PURE system, a reconstituted cell-free protein synthesis system derived from Escherichia coli. Specifically, the basic cell-free translation solution (1 mM GTP, 1 mM ATP, 20 mM creatine phosphate, 50 mM HEPES-KOH pH 7.6, 100 mM potassium acetate, 9 mM magnesium acetate, 2 mM spermidine, 1 mM dithiothreitol, 1.5 mg / ml E. coli MRE600 (RNase negative) derived tRNA (Roche), 0.1 mM 10-HCO-H4folate, 4 μg / ml creatine kinase, 3 μg / ml myokinase, 2 units / ml inorganic pyrophosphatase, 1.1 μg / ml nucleoside diphosphate kinase, 0.6 μM methionyl-tRNA transformylase, 0.26 μM EF-G, 0.24 μM RF2, 0.17 μM RF3, 0.5 μM RRF, 2.7 μM IF1, 0.4 μM Peptide translation synthesis was achieved by adding 1 μM template mRNA, 250 μM each of glycine, proline, alanine, phenylalanine, lysine, methionine, and serine to a solution containing 1.5 μM IF2, 40 μM EF-Tu, 93 μM EF-Ts, 1.2 μM ribosome, 2.73 μM AlaRS, 0.13 μM AspRS, 0.09 μM GlyRS, 0.11 μM LysRS, 0.03 μM MetRS, 0.68 μM PheRS, 0.16 μM ProRS, and 0.25 μM SerRS (the in-house prepared proteins were basically prepared as His-tagged proteins). The solution was then added with 250 μM each of glycine, proline, alanine, phenylalanine, lysine, methionine, and serine, and the ThrRS wild-type or mutant and N-methylthreonine. The solution was then left to stand at 37°C for 1 hour.

[0247] <Detection by mass spectrometry> To detect peptides into which N-methylthreonine was translated, mass spectrometry was performed using MALDI-TOF MS. Specifically, a solution was prepared by adding 1 μM template mRNA (RT (SEQ ID NO: 178)) and glycine, proline, alanine, phenylalanine, lysine, methionine, and serine (final concentration 250 μM each) to the above-mentioned cell-free translation system, and ThrRS (final concentration 2 μM) and N-methylthreonine (final concentration 5 mM) were added and incubated at 37 ° C. for 60 minutes. The obtained translation reaction product was purified with SPE C-TIP (Nikkyo Technos Co., Ltd.) and analyzed by MALDI-TOF MS. The translation product was identified by measuring the MALDI-TOF MS spectrum using α-cyano-4-hydroxycinnamic acid as a matrix.

[0248] As a result of translation using wild-type ThrRS (SEQ ID NO: 29), a peak corresponding to the target peptide peak P-3lib15MeThr containing N-methylthreonine (Figure 10(a), Peak MeT1) and a peak corresponding to its potassium salt (Figure 10(a), Peak MeT2) were observed as the main products. However, a peak corresponding to the peptide P-3lib15Thr derived from a trace amount of Thr contaminating the translation system (Figure 10(a), Peak T1) and a peak corresponding to its potassium salt (Figure 10(a), Peak T2) were also observed, indicating that there was a problem with the purity of the translation product (Figure 10(a)). On the other hand, when experiments were performed using ThrRS variants 03 (SEQ ID NO: 10) and 14 (SEQ ID NO: 11) into which mutations had been introduced, a peak (Peak T1) derived from P-CT21MeThr and a peak (Peak T2) derived from P-CT21MeThr were also observed. MeT3-6, Fig. 10) was observed in the same manner, and the peak corresponding to the peptide sequence P-3lib15Thr was hardly observed (Fig. 10(b), (c)). In other words, it was shown that the peptides with MeThr introduced therein were synthesized with higher purity than when the wild-type ThrRS was used, and it was suggested that the ThrRS variants 03 and 14 are ARSs that can introduce MeThr into peptides more efficiently than the wild-type ThrRS.

[0249] Peptide sequence P-3lib15Thr (SEQ ID NO: 179) formylMetLysAlaGlyProGlyPheMetThrLysSerGlySerGlySer

[0250] Peptide sequence P-3lib15MeThr (SEQ ID NO: 179) formylMetLysAlaGlyProGlyPheMet[MeThr]LysSerGlySerGlySer

[0251] MALDI-TOF MS: Calc. m / z: [H+M]+ = 1470.7, [K+M]+ = 1508.8 (peptide corresponding to sequence P-3lib15Thr.) Calc. m / z: [H+M]+ = 1484.7, [K+M]+ = 1522.8 (peptide corresponding to sequence P-3lib15MeThr.)

[0252] Example 5: Development of an ARS that tolerates N-methyltryptophan <Protein Preparation of TrpRS Wild-Type and Mutants> An expression vector having a polyhistidine sequence at the N-terminus and containing the mutations described in Table 8 was constructed. Subsequently, this vector was transformed into an expression strain, and the target mutant protein was purified from the supernatant after cell disruption using a nickel column.

[0253]

Table 8

[0254] <Translation Incorporation of N-Methyltryptophan by TrpRS Wild-Type and Mutants> Template mRNA (R-W (SEQ ID NO: 197)) was synthesized from template DNA (D-W (SEQ ID NO: 196)) by an in vitro transcription reaction using the RiboMAX Large Scale RNA production System T7 (Promega, P1300) and purified using the RNeasy Mini kit (Qiagen).

[0255] DW(CT29) (SEQ ID NO: 196) DNA sequence: GGCGTAATACGACTCACTATAGGGTTAACTTTAACAAGGAGAAAAACATGCGTTGGCGTGACTACAAGGACGACGACGACAAGTAAGCTTCG

[0256] RW (SEQ ID NO: 197) RNA sequence: GGGUUAACUUUAACAAGGAGAAAAACAUGCGUUGGCGUGACUACAAGGACGACGACGACAAGUAAGCUUCG

[0257] <Cell-free translation system> To confirm the translational incorporation of N-methyltryptophan, we synthesized the desired polypeptide containing N-methyltryptophan by adding N-methyltryptophan and the TrpRS mutant to a cell-free translation system, the PURE system, a reconstituted cell-free protein synthesis system derived from Escherichia coli. Specifically, the basic cell-free translation solution (1 mM GTP, 1 mM ATP, 20 mM creatine phosphate, 50 mM HEPES-KOH pH 7.6, 100 mM potassium acetate, 9 mM magnesium acetate, 2 mM spermidine, 1 mM dithiothreitol, 1.5 mg / ml E. coli MRE600 (RNase negative) derived tRNA (Roche), 0.1 mM 10-HCO-H4folate, 4 μg / ml creatine kinase, 3 μg / ml myokinase, 2 units / ml inorganic pyrophosphatase, 1.1 μg / ml nucleoside diphosphate kinase, 0.6 μM methionyl-tRNA transformylase, 0.26 μM EF-G, 0.24 μM RF2, 0.17 μM RF3, 0.5 μM RRF, 2.7 μM IF1, 0.4 μM Peptide translation synthesis was achieved by adding 1 μM template mRNA, arginine, aspartic acid, lysine, methionine, and tyrosine at 250 μM each to a solution of IF2, 1.5 μM IF3, 40 μM EF-Tu, 84 μM EF-Ts, 1.2 μM ribosome, 0.03 μM ArgRS, 0.13 μM AspRS, 0.11 μM LysRS, 0.03 μM MetRS, and 0.02 μM TyrRS (the in-house prepared proteins were basically prepared as His-tagged proteins), and adding wild-type or mutant TrpRS and N-methyltryptophan. The solution was then left to stand at 37°C for 1 hour.

[0258] <Detection by mass spectrometry> To detect peptides into which N-methyltryptophan was translated, mass spectrometry was performed using MALDI-TOF MS. Specifically, a solution was prepared by adding 1 μM template mRNA (RW (SEQ ID NO: 197)) and arginine, lysine, methionine, tyrosine, and aspartic acid (final concentration 250 μM each) to the above-mentioned cell-free translation system, and TrpRS (final concentration 5 μM) and N-methyltryptophan (final concentration 5 mM) were added and incubated at 37 ° C. for 60 minutes. The obtained translation reaction product was purified with SPE C-TIP (Nikkyo Technos Co., Ltd.) and analyzed by MALDI-TOF MS. The translation product was identified by measuring the MALDI-TOF MS spectrum using α-cyano-4-hydroxycinnamic acid as a matrix.

[0259] As a result of translation using wild-type TrpRS (SEQ ID NO: 188), a peak corresponding to the target peptide peak P-CT29MeTrp containing N-methyltryptophan (Figure 11(a), Peak MeW1) was observed, but the main product was a peak corresponding to the peptide P-CT29Trp derived from a trace amount of Trp contaminating the translation system (Figure 11(a), Peak W1). On the other hand, when experiments were performed using TrpRS variants 04 (SEQ ID NO: 184), 05 (SEQ ID NO: 185), and 18 (SEQ ID NO: 186) into which mutations had been introduced, peaks derived from P-CT29MeTrp (Peak MeW2-4, Figures 11(b)-(d)) were observed as the main product. In other words, it was shown that peptides into which MeTrp had been introduced were synthesized with higher purity than when wild-type TrpRS was used, suggesting that these TrpRS variants are ARSs that can introduce MeTrp into peptides more efficiently than wild-type TrpRS.

[0260] Peptide sequence P-CT29Trp (SEQ ID NO: 198) formylMetArgTrpArgAspTyrLysAspAspAspAspLys

[0261] Peptide sequence P-CT29MeTrp (SEQ ID NO: 199) formylMetArg[MeTrp]ArgAspTyrLysAspAspAspAspLys

[0262] MALDI-TOF MS: Calc. m / z: [H+M]+ = 1670.7 (Peptide corresponding to sequence P-CT29Trp.) Calc. m / z: [H+M]+ = 1684.7 (Peptide corresponding to sequence P-CT29MeTrp.)

[0263] Example 6: Development of an ARS that tolerates N-methyl-leucine <Protein Preparation of LeuRS Wild-Type and Mutants> An expression vector having a polyhistidine sequence at the N-terminus and containing the mutations described in Table 9 was constructed. Subsequently, this vector was transformed into an expression strain, and the target mutant protein was purified from the supernatant after cell disruption using a nickel column.

[0264]

Table 9

[0265] <Translation Introduction of N-Methylleucine by LeuRS Wild-Type and Mutants> Template DNA (D-L (SEQ ID NO: 200)) was used to synthesize template mRNA (R-L (SEQ ID NO: 201)) by an in vitro transcription reaction using the RiboMAX Large Scale RNA production System T7 (Promega, P1300), and it was purified using the RNeasy Mini kit (Qiagen).

[0266] D-L(CT23) (SEQ ID NO: 200) DNA sequence: GGCGTAATACGACTCACTATAGGGTTAACTTTAACAAGGAGAAAAACATGCGTCTCCGTGACTACAAGGACGACGACGACAAGTAAGCTTCG

[0267] R-L (SEQ ID NO: 201) RNA sequence: GGGUUAACUUUAACAAGGAGAAAAACAUGCGUCUCCGUGACUACAAGGACGACGACGACAAGUAAGCUUCG

[0268] <Cell-free translation system> To confirm the translational incorporation of N-methylleucine, we synthesized the desired polypeptide containing N-methylleucine by adding N-methylleucine and LeuRS mutants to a cell-free translation system, PURE system, a reconstituted cell-free protein synthesis system derived from Escherichia coli. Specifically, the basic cell-free translation solution (1 mM GTP, 1 mM ATP, 20 mM creatine phosphate, 50 mM HEPES-KOH pH 7.6, 100 mM potassium acetate, 9 mM magnesium acetate, 2 mM spermidine, 1 mM dithiothreitol, 1.5 mg / ml E. coli MRE600 (RNase negative) derived tRNA (Roche), 0.1 mM 10-HCO-H4folate, 4 μg / ml creatine kinase, 3 μg / ml myokinase, 2 units / ml inorganic pyrophosphatase, 1.1 μg / ml nucleoside diphosphate kinase, 0.6 μM methionyl-tRNA transformylase, 0.26 μM EF-G, 0.24 μM RF2, 0.17 μM RF3, 0.5 μM RRF, 2.7 μM IF1, 0.4 μM A solution of 1 μM IF2, 1.5 μM IF3, 40 μM EF-Tu, 84 μM EF-Ts, 1.2 μM ribosome, 0.03 μM ArgRS, 0.13 μM AspRS, 0.11 μM LysRS, 0.03 μM MetRS, and 0.02 μM TyrRS (the in-house prepared proteins were basically prepared as His-tagged proteins) was added with 1 μM template mRNA, arginine, aspartic acid, lysine, methionine, and tyrosine at 250 μM each, and LeuRS wild-type or mutant and N-methylleucine were added. The solution was then left to stand at 37°C for 1 hour to achieve translational synthesis of peptides.

[0269] <Detection by mass spectrometry> To detect peptides into which N-methylleucine was translated, mass spectrometry was performed using MALDI-TOF MS. Specifically, a solution was prepared by adding 1 μM template mRNA (RL (SEQ ID NO: 201)) and arginine, lysine, methionine, tyrosine, and aspartic acid (final concentration 250 μM each) to the above-mentioned cell-free translation system, and LeuRS (final concentration 0.4-2 μM) and N-methylleucine (final concentration 5 mM) were added and incubated at 37 ° C for 60 minutes. The obtained translation reaction product was purified with SPE C-TIP (Nikkyo Technos Co., Ltd.) and analyzed by MALDI-TOF MS. The translation product was identified by measuring the MALDI-TOF MS spectrum using α-cyano-4-hydroxycinnamic acid as a matrix.

[0270] As a result of translation using wild-type LeuRS (SEQ ID NO: 189), no peak corresponding to the target peptide peak P-CT23MeLeu containing N-methylleucine was observed, and the peptide P-CT23Leu (Figure 12(a), Peak L1) derived from a small amount of Leu contaminating the translation system was observed almost as a single product. On the other hand, when an experiment was performed using the LeuRS variant 02 (SEQ ID NO: 187) into which a mutation was introduced, a peak derived from P-CT29MeLeu (Peak MeL1, Figure 12(b)) was observed, which had an intensity ratio similar to that of the peak of the Leu-containing peptide P-CT23Leu (Peak L2, Figure 12(b)). This indicates that peptides with more MeLeu introduced were synthesized compared to when the wild-type LeuRS was used, suggesting that this LeuRS variant is an ARS that can introduce MeLeu into peptides more efficiently than the wild-type LeuRS.

[0271] Peptide sequence P-CT23Leu (SEQ ID NO: 202) formylMetArgLeuArgAspTyrLysAspAspAspAspLys

[0272] Peptide sequence P-CT23MeLeu (SEQ ID NO: 203) formylMetArg[MeLeu]ArgAspTyrLysAspAspAspAspLys

[0273] MALDI-TOF MS: Calc. m / z: [H+M]+ = 1597.7 (Peptide corresponding to sequence P-CT23Leu.) Calc. m / z: [H+M]+ = 1611.7 (Peptide corresponding to sequence P-CT23MeLeu.)

[0274] Example 7: Development of modified ValRS with improved selectivity for N-methylvaline by improving the valine hydrolysis ability in the editing domain <Protein Preparation of ValRS Wild-Type and Mutants> An expression vector of modified ValRS containing a polyhistidine sequence at the N-terminus, mutations in the catalytic domain (N44G, T45S) that improve the activity towards N-methylvaline, and a mutation in the editing domain T279A(G) was constructed (Table 10). Subsequently, this vector was transformed into an expression strain, and the target mutant protein was purified from the supernatant after cell disruption using a nickel column.

[0275]

Table 10

[0276] <Aminoacylation Reactions of Valine and N-Methylvaline with ValRS Mutants> [Synthesis of Escherichia coli tRNAVal by in vitro Transcription Reaction] Escherichia coli tRNA (R-tRNAVal1 (SEQ ID NO: 205)) was synthesized from template DNA (D-tRNAVal1 (SEQ ID NO: 204)) by an in vitro transcription reaction using RiboMAX Large Scale RNA production System T7 (Promega, P1300) in the presence of 7.5 mM GMP and purified by RNeasy Mini kit (Qiagen).

[0277] D-tRNAVal1 (SEQ ID NO: 204) tRNAVal1 DNA sequence: GGCGTAATACGACTCACTATAGGGTGATTAGCTCAGCTGGGAGAGCACCTCCCTTACAAGGAGGGGGTCGGCGGTTCGATCCCGTCATCACCCACCA

[0278] R-tRNAVal1 (SEQ ID NO: 205) tRNAVal1 RNA sequence: GGGUGAUUAGCUCAGCUGGGAGAGCACCUCCCUUACAAGGAGGGGGUCGGCGGUUCGAUCCCGUCAUCACCCACCA

[0279] <Aminoacylation reaction> To carry out the aminoacylation reaction, 50 μM transcribed tRNA, 10 mM HEPES-K (pH 7.6), and 10 mM KCl solution were heated at 95°C for 2 min, and then left at room temperature for 5 min or more to refold the tRNA. The tRNA solution was mixed with ValRS mutants (final concentration 2 μM) and N-methylvaline (final concentration 0.08-5 mM) or valine (final concentration 0.031-0.25 mM) and incubated at 37°C for 10 min. A four-fold volume of loading buffer (90 mM sodium acetate [pH 5.2], 10 mM EDTA, 95% (w / w) formamide, 0.1% (w / v) xylene cyanol) was added to the reaction solution, and the mixture was analyzed by acidic PAGE containing 6 M urea to separate unreacted tRNA and aminoacyl-tRNA to confirm the aminoacylation activity. RNA was stained with SYBR Gold (Life Technologies), and detection was performed using LAS4000 (GE Healthcare).

[0280] As a result, when N-methylvaline was used as a substrate, it was found that the acylation ability of mutant 13-11 and mutant 66 (sequence number 182), 67 (sequence number 183) was not significantly different at each N-methylvaline concentration (Figure 13, e.g., lane 17-19). On the other hand, when valine was used as a substrate, it was found that the acylation ability of mutants 66 and 67 was weakened compared to mutant 13-11 (Figure 14, e.g., lane 17-19). From this, it was found that mutants 66 and 67, which newly introduced mutations in the editing domain, can be said to be modified ValRSs with improved selectivity for N-methylvaline by reducing the aminoacylation activity for valine. [Industrial Applicability]

[0281] The present invention provides a modified aminoacyl-tRNA synthetase having higher reactivity to N-methyl amino acids than natural aminoacyl-tRNA synthetase (ARS). The modified aminoacyl-tRNA synthetase of the present invention can aminoacylate N-methyl-substituted amino acids such as N-methyl-phenylalanine, N-methyl-valine, N-methyl-serine, N-methyl-threonine, N-methyl-tryptophan, and N-methyl-leucine to the corresponding tRNA with higher efficiency than natural aminoacyl-tRNA synthetase. The present invention enables more efficient production of polypeptides containing N-methyl amino acids.

Claims

1. A polypeptide comprising the amino acid sequence of a PheRS α subunit derived from Escherichia coli, the wild-type PheRS α subunit consisting of the amino acid sequence of SEQ ID NO: 28, in which the amino acid located at the site corresponding to glutamic acid at position 169 is glycine or alanine, and having the activity of acylating tRNA with N-methylphenylalanine.

2. The polypeptide of claim 1, which is selected from the group consisting of (a) and (b) below. (a) a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 or 2 (b) a polypeptide comprising an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO: 1 or 2.

3. A polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2.

4. A polynucleotide encoding the polypeptide according to any one of claims 1 to 3.

5. A vector comprising the polynucleotide of claim 4.

6. A host cell comprising the polynucleotide of claim 4 or the vector of claim 5.

7. A method for producing the polypeptide according to any one of claims 1 to 3, comprising the step of culturing the host cell according to claim 6.

8. A method for producing a tRNA acylated with N-methylphenylalanine, comprising the step of contacting N-methylphenylalanine with a tRNA in the presence of the polypeptide according to any one of claims 1 to 3.

9. A method for producing a polypeptide containing N-methylphenylalanine, comprising a step of performing translation in the presence of the polypeptide according to any one of claims 1 to 3 and N-methylphenylalanine.

10. The method according to claim 9 , wherein the translation step is carried out in a cell-free translation system.

Images