Method for modifying plants, method for genome editing of plants, and method for producing plants

Abstract

A plant modification method comprising a step for coating microparticles with at least one kind of nucleic acid and / or at least one kind of protein, a step for shooting the coated microparticles into a shoot apex of a plant, a step for growing the shoot apex, into which the coated microparticles have been shot, to give plant bodies, and a step for selecting a modified plant body from among the plant bodies, said method being characterized in that the shoot apex is (1) the shoot apex of the embryo of a mature seed, (2) the shoot apex of a plumule, (3) the shoot apex of an apical bud or a lateral bud, or (4) the shoot apex of an immature embryo.

Description

[Technical field]

[0001] The present invention relates to a method for modifying a plant. [Background technology]

[0002] The currently popular methods for transforming plants involve the introduction of foreign genes into in vitro cultured protoplasts, calli, or tissue fragments by electroporation, Agrobacterium tumefaciens, or particle gun technology. However, these methods have the problem that even if genes are introduced into cells or tissues, it is difficult to culture the tissues of some plant varieties, making it difficult to regenerate the plants and produce transformants. In addition, the transformation efficiency is not high enough, so selection marker genes must be introduced and marker selection must be performed. Another problem is that somatic mutations (somaclonal mutations) frequently occur due to the need for long-term tissue culture. Therefore, there has been a demand for the development of a method for modifying plants that does not involve tissue culture, from the viewpoints of reducing the labor required for producing transformed plants and the safety of transformed plants.

[0003] Meanwhile, a transformation method (in planta transformation method) that does not use callus or tissue pieces of an in vitro culture system is also known for wheat, rice, etc. A known in planta transformation method is a method in which a gene is directly introduced into the exposed shoot apex of an immature embryo or a mature embryo using a particle gun method (Non-Patent Document 1). Patent Document 1 and Non-Patent Document 2 also describe a method in which a gene is introduced by infecting a mature embryo immediately after germination with Agrobacterium.

[0004] However, the methods described in these documents have in common that the efficiency of gene transfer is low because they are highly dependent on the technique of the experimenter, and there is room for improvement in terms of reproducibility. Furthermore, Non-Patent Document 1 has not yet demonstrated that the introduced gene is transmitted to the next generation. For these reasons, the above-mentioned methods have not been widely used to date. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] International Publication No. WO2005 / 024034 [Non-patent literature]

[0006] [Non-Patent Document 1] Bilang et al. (1993) Transient gene expression in vegetative shot apical meristems of wheat after ballistic microtargeting. Plant Journal (1993) 4, 735-744 [Non-Patent Document 2] Supartana et al. (2005) Development of simple and efficient in planta transformation for rice (Oryza sativa L.) using Agrobacterium tumefaciencs. Journal of Bioscience AND Bioengineering (2005) 4, 391-397 Summary of the Invention [Problem to be solved by the invention]

[0007] The present invention provides a method for modifying a plant without using callus or tissue explants in an in vitro culture system. The present invention also provides a method for modifying a plant without introducing a selection marker gene. The present invention further provides a method for genome editing of a plant and a method for producing a plant with excellent reproducibility. [Means for solving the problem]

[0008] The present inventors have conducted extensive research to solve the above problems and have completed the present invention.

[0009] That is, the present invention includes the following. <1> A method for modifying a plant, comprising the steps of: coating microparticles with at least one type of nucleic acid and / or at least one type of protein; bombarding the shoot apex of a plant with the coated microparticles; growing the shoot apex bombarded with the coated microparticles to obtain a plant body; and selecting a modified plant body from the plant body, wherein the shoot apex is (1) the shoot apex of the embryo of a ripe seed, (2) the shoot apex of a young bud, (3) the shoot apex of an apical bud or lateral bud, or (4) the shoot apex of an immature embryo. <2> The growth of the shoot tips bombarded with the coated microparticles is carried out in an antibiotic-free medium. <1> The method described above. <3> The growth of the shoot tips bombarded with the coated microparticles is carried out in a medium that does not contain plant hormones. <1> The method described above. <4> The shoot tips bombarded with the coated microparticles are grown in a medium free of antibiotics and plant hormones. <1> The method described above. <5> The plant's shoot apex is bombarded by bombarding L2 layer cells of the shoot apex with coated microparticles. <1> The method described above. <6> The plant's shoot apex is bombarded by bombarding shoot apex stem cells that transition to the germ lineage of the shoot apex with microparticles coated thereon. <1> The method described above. <7> The fine particles have a diameter of 0.3 μm or more and 1.5 μm or less. <1> The method described above. <8> The shoot apex of the plant is the shoot apex of the embryo of the fully ripe seed (1), and the shoot apex of the embryo of the fully ripe seed (1) is the shoot apex exposed by removing the endosperm, coleoptile, leaf primordia, and excess scutellum from the fully ripe seed. <1> The method described above. <9> The shoot apex of the plant is the shoot apex of the (2) shoot seedling, and the shoot apex of the (2) shoot seedling is an exposed shoot apex obtained by removing tubers and leaf primordia from the shoot seedling. <1> The method described above. <10> The shoot apex of the plant is the shoot apex of the terminal bud or lateral bud (3), and the shoot apex of the terminal bud or lateral bud (3) is an exposed shoot apex obtained by removing leaf primordia from the terminal bud or lateral bud. <1> The method described above. <11> The shoot apex of the plant is the shoot apex of an immature embryo (4), and the shoot apex of an immature embryo (4) is an exposed shoot apex obtained by removing the endosperm, coleoptile, leaf primordia, and excess scutellum from an immature seed 8 to 35 days after pollination. <1> The method described above. <12> The coating of the microparticles is carried out by coating the microparticles with a linear DNA containing a nucleic acid cassette to be introduced. <1> The method described above. <13> The linear DNA is a linear plasmid, and further comprises nucleic acids of 0.8 kb to 1.2 kb each located at each end of a nucleic acid cassette. <12> The method described above. <14> The coating of the microparticles is carried out by coating the microparticles with a nucleic acid that encodes a modifying enzyme. <1> The method described above. <15> The modifying enzyme is a nuclease or a deaminase. <1> The method described above. <16> The microparticle coating is carried out by coating the microparticle with nucleic acids linked to a promoter and a terminator, respectively, the nucleic acids including a nucleic acid capable of expressing at least one guide RNA and a nucleic acid encoding a Cas nuclease protein. <1> The method described above. <17> The coating of the microparticles is carried out by coating the microparticles with a nuclease. <1> The method described above. <18> The nuclease is a Cas nuclease. <17> The method described above. <19> The coating of the microparticles is performed by coating the microparticles with a protein, and the shooting of the plant into the shoot tip is performed using a hydrophilic macrocarrier film having the protein-coated microparticles. <1> The method described above. <20> The fully ripe seeds are fully ripe seeds including a root having a length of 1 mm or less. <1> The method described above. <21> The plant is selected from the group consisting of wheat, barley, rice, corn, soybean, potato and apple. <1> The method described above. <22> The method further comprises contacting the shoot tip of the embryo of the mature seed, the shoot tip of the shoot of the young shoot, the shoot tip of the terminal bud or the shoot tip of the lateral bud, or the shoot tip of the immature embryo with a hypertonic solution. <1> The method described above. <23> The step of contacting with a hypertonic solution is performed before or after the step of bombarding the coated microparticles. <22> The method described above. <24> the step of contacting with a hypertonic solution occurs before and after the step of bombarding the coated microparticles; <22> The method described above. <25> The method further comprises the step of growing the modified plant. <1> The method described above. <26> A method for genome editing of plants, comprising the steps of: coating microparticles with at least one type of nucleic acid and / or at least one type of protein; bombarding the shoot apex of a plant with the coated microparticles; growing the shoot apex bombarded with the coated microparticles to obtain a plant body; and selecting a modified plant body from the plant body, wherein the shoot apex is (1) the shoot apex of an embryo of a ripe seed, (2) the shoot apex of a young shoot, (3) the shoot apex of an apical bud or lateral bud, or (4) the shoot apex of an immature embryo, and the genome is present in a germ cell lineage in the shoot apical meristem or in a stem cell capable of transferring thereto; and the method is an implant in planta method. <27> The method further comprises the step of growing the modified plant. <26> The method described above. <28> A method for producing a plant, comprising the steps of: coating microparticles with at least one type of nucleic acid and / or at least one type of protein; bombarding the shoot apex of a plant with the coated microparticles; growing the shoot apex bombarded with the coated microparticles to obtain a plant body; and selecting a modified plant body from the plant body, wherein the shoot apex is (1) the shoot apex of an embryo of a ripe seed, (2) the shoot apex of a young bud, (3) the shoot apex of an apical bud or lateral bud, or (4) the shoot apex of an immature embryo. Effect of the Invention

[0010] According to the method of the present invention, by using a mature seed embryo, a young shoot, an apical bud, a lateral bud, or the shoot apex of an immature embryo as a target for bombarding with microparticles, it is possible to obtain a modified plant with good reproducibility without the need for callus formation or a selection marker gene. According to the present invention, it is possible to efficiently introduce a target gene into the shoot apical stem cell that transitions to the germ cell lineage in the shoot apex. [Brief description of the drawings]

[0011] [Figure 1] FIG. 1 is a diagram showing the expression of GFP protein in the shoot apex according to Example 1 of the present invention. [Diagram 2] FIG. 2 shows the results of confirming the introduced gene by genomic PCR in the T1 generation transformants according to Example 2 of the present invention. [Diagram 3] FIG. 3 is a photograph showing the results of Southern analysis of transgenic individuals (Example 3). [Figure 4A] FIG. 4A is a photograph of the entire T1 generation seed observed by GFP fluorescence according to Example 4 of the present invention. [Figure 4B] FIG. 4B is a GFP fluorescence observation photograph of half-cut seeds of the T1 generation according to Example 4 of the present invention. [Figure 4C] FIG. 4C is a GFP fluorescent photograph of young leaves of the T1 generation according to Example 4 of the present invention. [Figure 4D] FIG. 4D is a Western blot photograph showing detection of GFP protein in mature leaves of the T1 generation according to Example 4 of the present invention. [Figure 5A] FIG. 5A is a photograph showing the results of Southern analysis of genomic DNA obtained from young leaves of T1 seeds obtained from the main stem (Example 5). [Figure 5B] FIG. 5B is a photograph showing the results of Southern analysis of genomic DNA obtained from young leaves of T1 seeds obtained from the main stem and tillers (Example 5). [Figure 6] FIG. 6 is a photograph showing transient expression of GFP in maize (Example 6). [Figure 7] FIG. 7 is a photograph showing transient expression of GFP in soybean (Example 7). [Figure 8] FIG. 8 is a photograph showing transient expression of GFP in barley (Example 8). [Figure 9] FIG. 9 is a photograph showing transient expression of GFP in potato (Example 9). [Figure 10] FIG. 10 shows a diagram of an individual into which a target gene has been introduced (Example 13). [Figure 11] FIG. 11 shows the introduction of mutations into the target gene in the shoot apex one week after gene introduction (Example 14). [Figure 12] FIG. 12 shows a diagram of an individual into which a target gene has been introduced in adult leaves of the T0 generation (Example 14). [Figure 13] FIG. 13 shows targeted gene mutation introduction in T1 generation leaves (Example 14). [Figure 14] FIG. 14 shows individuals into which a target gene has been introduced by direct introduction of Cas9 protein (Example 15). [Figure 15] Fig. 15A is a photograph showing an isolated maize immature embryo (17 days after pollination), Fig. 15B is a photograph showing an immature embryo after culture, and Fig. 15C is a photograph showing an immature embryo with a length of about 7 to 15 mm (Example 23). [Figure 16] Figure 16A is a photograph showing a maize immature embryo before gene introduction, Figure 16B is a photograph showing a maize immature embryo during gene introduction, and Figure 16C is a fluorescent observation photograph showing transient expression of tdTomato in maize 20 hours after gene introduction (Example 23). [Figure 17] Figure 17A is a photograph showing an osmotically treated maize immature embryo before gene introduction, Figure 17B is a photograph showing a maize immature embryo during gene introduction, and Figure 17C is a fluorescent observation photograph showing the transient expression of tdTomato in maize 20 hours after gene introduction (Example 24). [Figure 18]Figure 18A is a photograph showing a maize immature embryo that was subjected to osmotic pressure treatment before gene introduction. Figure 18B is a photograph showing a maize immature embryo during gene introduction. Figure 18C is a photograph showing a maize immature embryo that was subjected to osmotic pressure treatment after gene introduction. Figure 18D is a fluorescence observation photograph showing transient expression of tdTomato in maize 20 hours after gene introduction (Example 25). [Figure 19] Figure 19A is a fluorescence observation photograph showing transient expression of tdTomato in maize 20 hours after gene transfer. The arrow indicates the shoot apical meristem. Figure 19B is a fluorescence observation photograph showing an immature embryo with a strong fluorescent signal. The arrow indicates the shoot apical meristem. Figure 19C is a photograph showing selected embryos 10 days after gene transfer. Figure 19D is a photograph showing selected embryos 40 days after gene transfer (Example 26). [Figure 20] Figure 20A is a photograph showing the shoot apex of an embryo 7 days after gene transfer. The area of ​​the shoot apex that was sampled is indicated by a black line. [Figure 21A] FIG. 21A is a graph showing the percentage of site-specific insertions and deletions (InDel%) in the shoot apical meristem of maize immature embryos (Example 26). [Figure 21B] 21B is a diagram showing site-specific deletion in the shoot apical meristem of maize immature embryos. The PAM site (TTTA) and predicted LbCpf1 cleavage site are indicated (Example 26). [Figure 22A] FIG. 22A is a fluorescence observation photograph showing transient expression of mNeongreen in maize 20 hours after gene introduction (Example 27). [Figure 22B] Figure 22B shows a close-up view of a selected embryo. The arrow indicates the shoot apical meristem (Example 27). [Diagram 23] FIG. 23 is a fluorescence observation photograph showing transient expression of GFP in wheat 20 hours after gene introduction (Example 29). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] The present invention will be described in detail below. The method for modifying a plant according to the present invention includes the steps of coating microparticles with at least one type of nucleic acid and / or at least one type of protein, bombarding the coated microparticles into the shoot apex of a plant, growing the shoot apex bombarded with the coated microparticles to obtain a plant body, and selecting a modified plant body from the plant body, wherein the shoot apex is (1) the shoot apex of the embryo of a ripe seed, (2) the shoot apex of a young bud, (3) the shoot apex of an apical bud or lateral bud, or (4) the shoot apex of an immature embryo.

[0013] In this specification, the term "seed" includes not only natural seeds obtained by cultivating (or culturing) a plant under natural or similar conditions, but also artificial seeds, and is preferably natural seeds. However, if artificial seeds from which a transformable shoot tip can be obtained are developed, they can also be used. Natural seeds include not only seeds obtained from outdoor fields, but also seeds obtained by greenhouse cultivation and seeds obtained from tissue cultures such as in vitro seedlings. Seeds obtained by tissue culture (direct reprogramming) can also be used as seeds of the present invention as long as a shoot tip can be obtained.

[0014] In the present invention, it is preferable to use fully ripe seeds, rhizomes, or immature seeds as materials for obtaining the shoot apex. Fully ripe seeds are seeds that have completed the ripening process after pollination and are fully ripe as seeds. Whether the ripening process is completed or not can be determined by whether the moisture content of the seeds is 35% or less. Rhizomes are a general term for underground stems, and include tubers that are lumpy and have many buds, corms that are spherical and have large terminal buds, and bulbs that have become spherical with enlarged scale leaves attached to shortened stems. Immature seeds are seeds that are not fully ripe as seeds.

[0015] In this specification, the shoot apex includes the growing point at the tip of the stem (shoot apical meristem) and tissue consisting of the growing point and several leaf primordia generated from the growing point. In the present invention, only the hemispherical (dome-shaped) growing point from which the leaf primordia have been removed may be used as the shoot apex, or the shoot apex including the growing point and the leaf primordia or plant tissue including the shoot apex may be used. By using only the growing point from which the leaf primordia have been removed, virus-free tissue can be obtained. In addition, in this specification, the term "germ cell lineage" refers to a general term for germ cells from primordial germ cells, which are the source of germ cells, to the final products, egg cells and sperm cells, and the "L2 layer" refers to the second cell layer from the outside of the shoot apical meristem. The term "juvenile bud" refers to a bud at the apex of the embryo of a higher plant, which can be identified by growing after germination to become an aboveground stem, and the term "immature embryo" refers to the embryo of an immature seed, which can be identified by the degree of maturation of the seed.

[0016] 1. Pretreatment steps for transformation The plant modification method according to the present invention can be applied to a wide range of plants, including seed-bearing plants, plants that bear rhizomes, and plants that can be cultured by shoot apex. Thus, the target plants of the plant modification method according to the present invention are seed plants, including angiosperms and gymnosperms. Angiosperms include monocotyledonous plants and dicotyledonous plants. The in planta transformation method is generally a transformation method that does not involve tissue culture manipulation, and is a method in which cells at the meristem site of a plant are transformed while the plant is still growing. However, in this specification, the in planta transformation method is used to mean that it includes only tissue culture methods that use shoot apex culture, and does not include methods that include other tissue culture manipulations. The in planta method has the same meaning.

[0017] The monocotyledonous plant may be of any type, but examples thereof include plants of the Gramineae family, Liliaceae family, Musaceae family, Bromeliaceae family, and Orchidaceae family.

[0018] Examples of plants in the Gramineae family include rice, wheat, barley, corn, oats, turfgrass, sorghum, rye, foxtail millet, and sugarcane. Examples of plants in the Liliaceae family include leeks and asparagus. Examples of plants in the Musaceae family include bananas. Examples of plants in the Bromeliaceae family include pineapples. Examples of plants in the Orchidaceae family include orchids.

[0019] Examples of dicotyledonous plants include Brassicaceae, legumes, Solanaceae, Cucurbitaceae, Convolvulaceae, Rosaceae, Mulberry, Malvaceae, Asteraceae, Amaranthaceae, and Polygonaceae.

[0020] Examples of Brassicaceae include Arabidopsis thaliana, Chinese cabbage, rapeseed, cabbage, cauliflower, and radish. Examples of Leguminaceae include soybean, adzuki bean, kidney bean, pea, cowpea, and alfalfa. Examples of Solanaceae include tomato, eggplant, potato, tobacco, and chili pepper. Examples of Cucurbitaceae include orangutan, cucumber, melon, and watermelon. Examples of Convolvulaceae include morning glory, sweet potato, and bindweed. Examples of Rosaceae include rose, strawberry, and apple. Examples of Mulberry family include mulberry, fig, and rubber tree. Examples of Malvaceae include cotton and kenaf. Examples of Asteraceae include lettuce. Examples of Amaranthaceae include sugar beet. Examples of Polygonaceae include buckwheat.

[0021] On the other hand, gymnosperms include pines, cedars, ginkgo trees, and cycads.

[0022] In one embodiment of the method for modifying a plant according to the present invention, first, mature or immature seeds of a plant are imbibed with water. If necessary, vernalization may be performed before imbibition. Imbibition is performed by soaking the seeds in water and incubating them. Alternatively, embryos from which endosperm and the like have been removed may be incubated on an agar medium. The temperature for imbibition is preferably 15 to 25°C in the case of wheat, barley, or rice, and 25 to 35°C in the case of corn or soybean. At this time, the water may be exchanged once or more. In the case of wheat, the period for imbibition is preferably before the root starts to elongate (roots of 1 mm or less) or before new leaf primordia are formed. In terms of the time for imbibition, it is less than 16 hours after imbibition, and preferably 12 hours, depending on the dormancy state of the seeds. This imbibition process can soften the seeds to make it easier to expose the shoot apex.

[0023] 2. Exposing the shoot tip of the seed embryo Next, the shoot apex of the embryo in the seeds absorbed as described above is exposed. In the case of wheat, barley, rice, or corn, the sheath leaves and leaf primordia are removed to expose the shoot apex. In the case of soybean, the seed coat and cotyledons are removed to expose the shoot apex. In the case of potato, the seed potatoes are sprouted, and the tubers and leaf primordia are removed from the excised young shoots to expose the shoot apex. In the case of apple, the leaf primordia are removed from the seed embryo or the excised apical or lateral buds to expose the shoot apex. The exposing means may be any means capable of removing the sheath leaves and leaf primordia or the seed coat and cotyledons under a stereomicroscope, and examples of such means include a drilling tool such as a needle with a diameter of about 0.2 mm, tweezers, a pipette, a syringe, and a cutting tool such as a scalpel and a cutter. Next, the endosperm and excess scutellum are removed using a cutting tool such as a scalpel, and the embryo and scutellum including the exposed shoot apex are placed on an agar medium with the shoot apex facing upward. To obtain virus-free shoot tips, the scalpel may be replaced with a new sterile scalpel at the final stage of cutting out the shoot tips, and virus-free transformants can be obtained. When using immature seeds, it is preferable to use embryos 8 to 35 days after pollination, more preferably 10 to 20 days after pollination, and even more preferably 15 to 20 days after pollination. Alternatively, when using immature seeds, one can use the immature embryo by removing 1 / 4 of the kernel from the top of the immature ear containing the embryo from which the husk and silk have been removed, and then pulling the immature embryo from the kernel.

[0024] 3. Introducing nucleic acids and / or proteins into shoot apex cells The introduction of nucleic acid and / or protein can be performed by known genetic engineering techniques, and is not particularly limited. In general, a recombinant vector containing a target gene is prepared, and nucleic acid (recombinant vector, etc.) or protein can be introduced into the shoot apex of a mature or immature embryo by Agrobacterium method, electroporation method, particle gun method, PEG-calcium phosphate method, liposome method, microinjection method, whisker method, plasma method, laser injection method, etc., but a method of shooting fine particles coated with nucleic acid and / or protein into a mature or immature seed embryo is preferred. There is no particular limit to the means for shooting fine particles as long as it can shoot fine particles into plant cells, and examples of the means include a particle gun (gene gun) in the particle gun method. In wheat, rice, corn, or soybean, a method of introducing into a mature or immature seed embryo using the particle gun method is preferred in terms of the efficiency of introduction into the plant body. The particle gun method is also effective for introducing genes into the shoot apex of potatoes. The particle gun method involves coating metal particles with nucleic acids and / or proteins and injecting them into cell tissues, and is effective when the infection efficiency of Agrobacterium is low, such as in monocotyledonous plants.

[0025] The vector used in the present invention is not particularly limited, and examples of vectors that can be used include the pAL series (pAL51, pAL156, etc.), pUC series (pUC18, pUC19, pUC9, etc.), pBI series (pBI121, pBI101, pBI221, pBI2113, pBI101.2, etc.), pPZP series, pSMA series, intermediate vector series (pLGV23Neo, pNCAT, etc.), cauliflower mosaic virus (CaMV), bean mosaic virus (BGMV), tobacco mosaic virus (TMV), etc.

[0026] A vector containing a gene of interest can be prepared, for example, as follows. To insert a gene of interest into a vector, for example, a method can be used in which purified DNA is cleaved with an appropriate restriction enzyme, and inserted into an appropriate restriction enzyme site or multicloning site of vector DNA, and then ligated to the vector. Alternatively, the gene of interest may be inserted into an intermediate vector by double cross-over, or TA cloning, In-Fusion cloning, etc. may be used.

[0027] The gene of interest or the gene targeted by genome editing is not particularly limited, and may be an endogenous gene of the target plant or a foreign gene, as long as the expression or inhibition of the expression of the gene is desired. The foreign gene may be from a different species of organism, and may be, for example, an animal, a plant, a microorganism, or a virus. Examples of such genes include sugar metabolism-related genes, lipid metabolism-related genes, useful substance (medicine, enzyme, pigment, aroma component, etc.) production-related genes, plant growth control (promotion / inhibition)-related genes, flowering regulation-related genes, disease and pest resistance (insect feeding resistance, nematode, mold (fungi) and bacterial disease resistance, virus (disease) resistance, etc.)-related genes, environmental stress (low temperature, high temperature, dryness, salt, light damage, ultraviolet light)-related resistance genes, transporter-related genes, flour milling characteristics, bread making characteristics, noodle making characteristics-related genes, site-specific nuclease genes, etc. In addition, the gene of interest may be introduced so as to express antisense, ribozyme, RNAi, etc., depending on the purpose of gene introduction, in addition to the sense strand. In addition, the nuclease gene to be introduced may be derived from a different biological species, for example, an animal, plant, microorganism, virus, or artificially synthesized gene. Examples of such genes include meganuclease genes, TALEN, CRISPR-CAS system, TARGET AID, etc.

[0028] For genes targeted by genome editing, the desired mutation may be introduced by inserting or substituting foreign DNA between the cut sites through recombination.

[0029] In this specification, "genome editing" refers to a part of a technology called New Breeding Technique (NBT), which includes, but is not limited to, the use of meganuclease, CRISPR-CAS, etc. to cleave a specific gene on the genome and introduce a mutation to destroy the gene, the insertion or replacement of a DNA fragment in a site-specific manner, or the construction of an artificial enzyme complex in which a deaminase, a deaminating enzyme, is added to a CRISPR system from which the nuclease activity has been removed, and the expression of the complex in a cell to introduce a targeted point mutation with high efficiency to modify the gene function. Any technology capable of editing the genome may be used. By using genome editing technology, the targeted gene can be destroyed with high efficiency. In the case of gene destruction, since only the targeted gene can be destroyed without leaving any trace of genetic recombination, some countries do not treat the plant as a recombinant plant. In addition, genome editing allows efficient site-specific insertion or replacement of a DNA fragment by linking fragments homologous to the sequences on both sides of the cleavage sequence to both sides of the DNA fragment to be introduced at that site.

[0030] In the above sense, genome editing can be said to be a different technology from conventional plant transformation methods in which foreign genes are incorporated almost randomly, such as direct introduction methods and Agrobacterium methods, and it is possible to consider excluding genome editing technology from the definition of transformation methods. Genome editing technology is characterized by including a step of cleaving genomic DNA using a nuclease or guide RNA and nuclease that can target the cleavage site, and can be distinguished from conventional transformation methods that do not use such targetable nuclease or guide RNA and nuclease. Here, the meaning of "using nuclease or guide RNA and nuclease" means that a nuclease protein may be introduced into a cell, or DNA and / or RNA encoding a nuclease gene may be introduced into a cell to express the nuclease protein. In addition, with regard to guide RNA, RNA may be introduced into a cell, or DNA capable of expressing guide RNA may be introduced to express guide RNA.

[0031] Examples of proteins encoded by site-specific nuclease genes include zinc finger nucleases, proteins expressing zinc finger nuclease activity, or TAL effector nucleases (TALENs). Zinc finger nucleases are fusion proteins of several zinc finger motifs that recognize specific bases and FokI nuclease. TALLENs are fusion proteins of Transcription Activator Like (TAL) effector and FokI nuclease. Site-specific nucleases are composed of other additional targeting technologies, such as meganucleases, RNA-induced CRISPR-Cas9, or leucine zippers.

[0032] The site-specific nuclease can be introduced into the shoot apex, integrated into the genome, expressed, and genome editing can be performed to change or modify the expression of one or more gene products. That is, a CRISPR-Cas system can be introduced into a cell that contains and can express a DNA molecule encoding one or more gene products, which can include a Cas protein and one or more guide RNAs that target the DNA molecule, so that the one or more guide RNAs target the genomic locus of the DNA molecule encoding one or more gene products, and the Cas protein cleaves the genomic locus of the DNA molecule encoding one or more gene products, thereby changing or modifying the expression of one or more gene products.

[0033] When genome editing is performed by introducing a nuclease gene or protein into a cell, it is not necessary to integrate the gene into the genome to obtain a stable transformant. Genome editing can be performed by transiently expressing the nuclease gene. Genome editing can also be performed by introducing a protein such as a Cas protein (and a guide RNA) into a cell. According to these methods, the genome-edited individual obtained may not be a genetically modified organism.

[0034] The Cas protein and the guide RNA may be naturally occurring (combined) or may be a combination that does not occur in nature. In the present invention, the expression of two or more gene products may be altered or modified. The guide RNA may comprise a guide sequence fused to a tracr sequence.

[0035] The length of the guide RNA is at least 15, 16, 17, 18, 19, or 20 nucleotides, and the preferred upper limit of the number of nucleotides is 30 or less, more preferably 25 or less, even more preferably 22 or less, and most preferably 20 or less.

[0036] In a preferred embodiment, the cell to be transformed or the cell to be subject to genome editing is a plant cell, more preferably a cell in the shoot apical meristem, even more preferably an L2 cell in the shoot apical meristem, and most preferably a cell transitioning to the germ lineage in the shoot apical meristem.

[0037] In the present invention, a protein such as a Cas protein may contain one or more nuclear localization signals (NLS). In some embodiments, the Cas protein is a type II CRISPR enzyme. In some embodiments, the Cas protein is a Cas9 protein. In some embodiments, the Cas9 protein is a S. pneumoniae, S. pyogenes, or S. thermophilus Cas9, including mutant Cas9s derived from these organisms. The protein may be a Cas9 homolog or ortholog.

[0038] Proteins such as Cas proteins may be codon-optimized for expression in eukaryotic cells. Cas proteins may direct one or two strand cleavage at the location of a target sequence. In another aspect of the invention, the expression of a gene product is reduced, and the gene product is a protein.

[0039] In addition to the gene of interest, for example, a promoter, an enhancer, an insulator, an intron, a terminator, a polyA addition signal, a selection marker gene, etc. can be ligated to the vector.

[0040] The target gene to be inserted into the vector may be of multiple types per vector, and the recombinant vector to be coated onto the microparticle may also be of multiple types per microparticle. For example, a recombinant vector containing a target gene or a nuclease gene and a recombinant vector containing a drug resistance gene may be prepared separately, mixed, coated onto microparticles, and then injected into plant tissue.

[0041] The number of target genes for genome editing may be two or more, and a vector may be constructed so that two or more target genes can be cleaved. In that case, two or more types of vectors may be prepared, and multiple guide RNAs may be inserted on one plasmid so as to be expressed. In addition, the guide RNA may contain a guide sequence fused to the tracr sequence.

[0042] Genome editing can be used to perform site-specific double-stranded cuts and promote homologous recombination. In this case, DNA with homologous sequences on both sides of the cut region can be introduced to cause double crossover recombination. Homologous recombination can also be performed using the D10A mutant of Cas9, which is known to function as a nickase (a DNA cutting enzyme that nicks only one DNA strand).

[0043] The promoter may not be derived from a plant, as long as it functions in a plant body or plant cells and is constitutively expressed or can induce expression in a specific tissue or at a specific developmental stage of a plant. Specific examples include the cauliflower mosaic virus (CaMV) 35S promoter, the El2-35S omega promoter, the nopaline synthase gene promoter (Pnos), the ubiquitin promoter derived from maize, the actin promoter derived from rice, the PR protein promoter derived from tobacco, the ADH promoter, and the RuBisco promoter. Translation efficiency can be increased by using a sequence that enhances translation activity, for example, the omega sequence of the tobacco mosaic virus. In addition, proteins can be translated from multiple coding regions by inserting an IRES (internal ribosomal entry site) as a translation initiation region at the 3'-downstream side of the promoter and at the 5'-upstream side of the translation initiation codon.

[0044] The terminator may be any sequence that can terminate the transcription of the gene transcribed by the promoter and has a polyA addition signal, and examples of such a sequence include the nopaline synthase (NOS) gene terminator, the octopine synthase (OCS) gene terminator, and the CaMV 35S terminator.

[0045] Examples of the selection marker gene include herbicide resistance genes (bialaphos resistance gene, glyphosate resistance gene (EPSPS), sulfonylurea resistance gene (ALS)), drug resistance genes (tetracycline resistance gene, ampicillin resistance gene, kanamycin resistance gene, hygromycin resistance gene, spectinomycin resistance gene, chloramphenicol resistance gene, neomycin resistance gene, etc.), fluorescent or luminescent reporter genes (luciferase, β-galactosidase, β-glucuronidase (GUS), green fluorescent protein (GFP), etc.), neomycin phosphotransferase II (NPT II), dihydrofolate reductase, and other enzyme genes. However, according to the present invention, it is possible to produce a transformant or a genome-edited plant without introducing a selection marker gene.

[0046] The vector containing the target gene to be injected into the plant may be a circular plasmid, a linear DNA obtained by cutting a plasmid with a restriction enzyme or the like, a linear plasmid, a nucleic acid cassette fragment obtained by cutting out only the DNA fragment to be introduced, or a DNA fragment to which 0.8 kb or more and 1.2 kb or less of nucleic acid has been added to one or both ends of the cassette fragment. These DNA fragments may be DNA fragments amplified by PCR. In this case, the nucleic acid to be added is not particularly limited and may be a sequence derived from the vector, but the sequence of the target site for introduction is more preferably used. The lower limit of the length of the nucleic acid to be added to the end of the cassette fragment is 0.5 kb or more, more preferably 0.8 kb or more, and even more preferably 1.0 kb or more, and the upper limit is 3.0 kb or less, more preferably 2.0 kb or less, and even more preferably 1.5 kb or less.

[0047] A vector containing the above-mentioned target gene or a nuclease targeting the above-mentioned target gene is shot into a mature embryo, a young shoot, an apical bud, a lateral bud, or an immature embryo of a plant. A nucleic acid and / or a protein (such as a nuclease) encoding the target gene or a nuclease gene targeting the target gene can be shot into a plant cell by coating the surface of a fine particle (microcarrier). The fine particle is not particularly limited as long as it has a high specific gravity to increase the penetration into the cell, is chemically inactive, and is unlikely to cause harm to the living body, and examples of the fine particle include metal fine particles and ceramic fine particles. The metal fine particle may be a metal simple substance fine particle or an alloy fine particle, and among the above-mentioned metal simple substance fine particles, gold particles, tungsten particles, etc. are particularly preferably used.

[0048] A gene of interest can be introduced into plant cells as follows: First, fine particles such as gold particles or tungsten particles are washed and sterilized, and the fine particles, nucleic acid (recombinant vector, linear DNA, RNA, etc.) and / or protein, CaCl 2 Then, spermidine is added while stirring with a vortex mixer or the like to coat the gold particles or tungsten particles with DNA, RNA, and / or protein, and the particles are washed with ethanol or phosphate buffered saline (PBS, etc.). The coating may be on the entire surface of the metal particles, or on only a portion of it.

[0049] The particle size (diameter) of the fine particles is preferably 0.3 μm or more and 1.5 μm or less, more preferably 0.4 μm or more, even more preferably 0.5 μm or more, and particularly preferably 0.6 μm. The upper limit of the particle size is preferably 1.4 μm or less, 1.3 μm or less, 1.2 μm or less, 1.1 μm or less, 1.0 μm or less, 0.9 μm or less, 0.8 μm or less, 0.7 μm or less, and 0.6 μm or less, in that order.

[0050] The gold or tungsten particles are applied as uniformly as possible to the macrocarrier film using a pipette or the like, and then dried in a sterile environment such as a clean bench. In the case of protein-coated microparticles, it is preferable to use a hydrophilic macrocarrier film.

[0051] The hydrophilic macrocarrier film may be made by attaching a hydrophilic film to the macrocarrier film or by applying a hydrophilic coating to the macrocarrier film. Methods for making the film hydrophilic include methods using surfactants, photocatalysts, and hydrophilic polymers.

[0052] Examples of hydrophilic polymers used in the above-mentioned methods include polymers of hydrophilic monomers such as polyethylene glycol, hydroxyethyl methacrylate, hydroxypropyl methacrylate, dihydroxyethyl methacrylate, diethylene glycol methacrylate, triethylene glycol methacrylate, polyethylene glycol methacrylate, vinylpyrrolidone, acrylic acid, acrylamide, dimethylacrylamide, glucoxyoxyethyl methacrylate, 3-sulfopropylmethacryloxyethyldimethylammonium betaine, 2-methacryloyloxyethyl phosphorylcholine, and 1-carboxydimethylmethacryloyloxyethylmethane ammonium.

[0053] Then, the macrocarrier film and the plate on which the target mature embryo, young shoot, apical bud, lateral bud, or shoot tip of immature embryo is placed are placed in a particle gun device, and high-pressure helium gas is fired from the gas acceleration tube toward the macrocarrier film. The macrocarrier film is stopped by the stopping plate, but the gold particles pass through the stopping plate and penetrate into the target placed below the stopping plate, and the target gene is introduced.

[0054] The distance between the stopping plate and the target shoot apex depends on the particle size of the microparticles, but is preferably 9 cm or less, more preferably 8 cm or less, even more preferably 7 cm or less, and particularly preferably 6 cm or less, and the lower limit of the distance is preferably 2 cm or more, more preferably 3 cm or more, and even more preferably 4 cm or more. The optimal value of the distance between the stopping plate and the target can be appropriately determined by transient expression experiments or the like depending on the type, particle size, gas pressure, etc. of the microparticles.

[0055] The gas pressure depends on the type of fine particles and the distance from the target, but is preferably, for example, 1,100 to 1,600 psi, and more preferably 1,200 to 1,500 psi. The optimal gas pressure can be determined appropriately by a transient expression experiment or the like depending on the type of fine particles, the type of target, the distance between the target and the stopping plate, and the like.

[0056] In the method for modifying a plant of the present invention, the number of times that the microparticles are bombarded into the shoot apex is preferably 2 or more, more preferably 3 or more, and even more preferably 4 or more. The upper limit of the number of times that the microparticles are bombarded into the shoot apex is preferably 20 or less, more preferably 15 or less, and even more preferably 10 or less. The optimal number of times that the microparticles are bombarded can be appropriately determined by a transient expression experiment or the like.

[0057] In cells bombarded with microparticles, nucleic acids and / or proteins are released from the microparticles, and the nucleic acids are integrated into genomic DNA to obtain transformed cells. However, when nucleic acids that grow in the form of plasmids, such as geminiviruses, or artificial chromosomes are introduced, transformation may occur without integration. In addition, according to the transformation method of the present invention, it is also possible to introduce foreign genes into organelles. In such cases, it is preferable to use genes functionally linked to a promoter that is specifically expressed in organelles. In the plant genome editing method of the present invention, in a cell bombarded with microparticles, nucleic acids and / or proteins are released from the microparticles, and the nucleic acids migrate to the nucleus and express nucleases to cleave genomic DNA, and mutations occur during the repair process to obtain a genome-edited cell. In the case of proteins, genome editing occurs by migrating to the nucleus (organelle) by a nuclear migration signal (which may be an organelle migration signal) and cleaving DNA. Genome editing can be applied not only to genome genes in the nucleus, but also to genes in organelles (intracellular organelles such as chloroplasts and mitochondria). In this case, the migration signal to each organelle may be linked to a nuclease and introduced, and a promoter that is expressed only in each organelle may be used as a promoter linked to a nuclease or the like.

[0058] The modified mature embryo, young shoot, terminal bud, lateral bud, or shoot tip of immature embryo is grown on an agar medium for about one month and then transplanted into soil. In the case of bombardment of the shoot tip, transformants can be obtained by growing in a normal medium without applying selective pressure using drugs (not including antibiotics, plant hormones, etc.), but a drug resistance gene may also be introduced. In the plant genome editing method of the present invention, genome-edited individuals can also be selected by simultaneously introducing a nuclease and a drug resistance gene. When a drug resistance gene is introduced, transformed cells can be selectively cultured using a drug. As a selective drug suitable for shoot tip culture, for example, the sulfonylurea herbicide chlorosulfuron (resistance can be acquired by introducing a mutant ALS gene (acetobutyric acid synthase gene)) is known.

[0059] When a drug resistance gene is introduced, the drug resistance gene may be on the same vector as the target gene or the nuclease gene, or on a different vector. When the drug resistance gene is inserted on a different vector, if they are integrated into different chromosomes, there is an advantage that the plant individual into which the target gene has been introduced or the genome-edited plant individual and the plant individual having the drug resistance gene can be separated by self-pollination or backcrossing to obtain progeny.

[0060] In the plant modification method of the present invention, in order to increase the efficiency of modification, the method may further include a step of contacting the shoot apex of the embryo of a ripe seed, the shoot apex of a young shoot, the shoot apex of an apical bud or lateral bud, or the shoot apex of an immature embryo with a hypertonic solution.

[0061] As the hypertonic solution, a solution having a higher osmotic pressure than the plant cytoplasm can be used, and examples of the hypertonic solution include solutions containing sugar or sugar alcohol. Examples of the sugar or sugar alcohol include sorbitol, mannitol, sucrose, etc., and from the viewpoint of efficient high osmotic pressure treatment, it is preferable to include sorbitol, mannitol, and sucrose. The osmotic potential of the hyperosmotic solution may be at least equal to the osmotic potential of an 11% aqueous sucrose solution.

[0062] Examples of the contacting method include a method of immersing the shoot apex of the embryo of a ripe seed, the shoot apex of a young shoot, the shoot apex of an apical bud or lateral bud, or the shoot apex of an immature embryo in the high osmotic pressure solution, a method of placing the shoot apex of the embryo of a ripe seed, the shoot apex of a young shoot, the shoot apex of an apical bud or lateral bud, or the shoot apex of an immature embryo in a medium of the high osmotic pressure solution, and a method of spraying the shoot apex of the embryo of a ripe seed, the shoot apex of a young shoot, the shoot apex of an apical bud or lateral bud, or the shoot apex of an immature embryo with the high osmotic pressure solution.

[0063] The environment for the contact may be a lighted or dark place, but from the viewpoint of germination efficiency, a dark place is preferable for dark-germinated seeds, and a lighted place is preferable for light-germinated seeds.

[0064] The timing of the contact may be before or after the step of bombarding the coated fine particles. From the viewpoint of increasing the modification efficiency, it is preferable to include a contact step before and after the step of bombarding the coated fine particles.

[0065] The contact time before the step of bombarding the coated microparticles is preferably from 1 hour to 20 hours, more preferably from 2 hours to 10 hours, and even more preferably from 3 hours to 5 hours. The contact time after the step of bombarding the coated microparticles is preferably from 1 hour to 60 hours, more preferably from 10 hours to 30 hours, and even more preferably from 15 hours to 25 hours.

[0066] By the above-mentioned method, it is possible to produce a plant body into which a target gene has been introduced or a plant body modified by genome editing, and further to grow the plant body. Furthermore, in the plant produced in this way, the trait of the target gene or the genome-edited gene is stably expressed, or the expression of the target gene is suppressed, and the trait is normally inherited (transmitted) to the progeny.

[0067] The efficiency of gene introduction into a plant, or the efficiency of genome editing and the efficiency of expression of a gene of interest (transformation efficiency) can be examined as follows.

[0068] The efficiency of gene introduction can be determined by extracting DNA from grown individuals after modification or gene introduction treatment, and detecting the target gene or whether the target gene has been genome-edited by PCR and / or electrophoresis or Southern blotting. The efficiency of gene introduction can be calculated from the number of explants used for introduction and the number of grown individuals that contained the foreign gene.

[0069] The expression efficiency of the target gene or the genome editing efficiency of the target gene is examined for the presence or absence of RNA expressed from the target gene in the grown individual in which the introduction of the gene has been confirmed. The presence or absence of RNA can be confirmed, for example, by RT-PCR. It may also be detected by Northern blotting.

[0070] It is also possible to examine the presence or absence of a protein expressed from the target gene or the genome-edited target gene. The presence or absence of a protein can be confirmed, for example, by staining a plant piece, electrophoresis, ELISA, RIA, dot immunobinding assay, and / or Western blotting. The expression efficiency of the target gene (transformation efficiency) or the genome editing efficiency of the target gene is calculated from the number of explants used for the introduction and the number of grown individuals in which the presence of the protein expressed from the target gene is confirmed, or the number of explants used for the introduction and the number of grown individuals in which the presence (or absence) of the protein obtained by genome editing of the target gene is confirmed. EXAMPLES

[0071] The present invention will be specifically described below with reference to examples, but the present invention is not limited to these examples in any way.

[0072] [Example 1] Examination of optimal gold particle size for gene transfer To find the appropriate gold particle size, we examined the presence or absence of GFP fluorescence in the shoot apex after gene transfer treatment or its contemporaneous (T 0 The presence or absence of the introduced gene was examined in each generation.

[0073] 1. Investigation using the transient expression system of GFP fluorescent protein as an indicator (1) Preparation of ripe wheat seeds Mature seeds of wheat (Triticum aestivum cv. Fielder) were immersed in bleach (6% hypochlorite concentration, Kao Corporation), shaken at room temperature for 20 minutes, and then washed with sterile water in a clean bench. After washing, the seeds were placed on a Kimtowel or filter paper moistened with sterile water and incubated at 4°C for 2 days to break dormancy. They were then incubated at 22°C for approximately 12 hours and used in the following experiments.

[0074] (2) Exposure of the shoot apex in the mature seed embryo Under a stereomicroscope, the coleoptile and the first to third leaf primordia of the embryo part of the germinated seeds were removed using the tip of a needle (0.20 mm in diameter). Then, the endosperm and excess scutellum were removed using a sterilized knife (or a sterilized scalpel) to completely expose the shoot apex. These were placed on MS-maltose medium (4.3 g / L MS salt, MS vitamin, 30 g / L maltose, 0.98 g / L MES, 3% PPM (plant preservative mixture, Nacalai Tesque), 7.0 g / L phytagel (registered trademark, Sigma-Aldrich), pH 5.8) at 30 pieces / plate.

[0075] (3) Gene transfer Gene transfer into the shoot apex of ripe wheat embryos was carried out using a particle gun method as follows. In the examples, a plasmid DNA (pUC-based plasmid) containing the fluorescent reporter gene GFP (S65T) was used as the introduced gene. The gene was designed to be expressed under the control of the maize ubiquitin promoter and the first intron. The terminator added was the nopaline synthase (NOS) gene terminator. 30 mg of gold particles ranging from 0.3 μm to 1.6 μm were weighed out, 500 μL of 70% ethanol was added, and the particles were thoroughly suspended using a vortex mixer. The gold particles were then precipitated by centrifugation, and the ethanol was removed. Then, 500 μL of 50% glycerol was added to obtain a sterilized gold particle solution.

[0076] Plasmid DNA solution (1 μg / μL) purified using Qiagen Plasmid Midi Kit (Qiagen) was added to a 1.5 mL tube so that the amount was 5 μg per 750 μg of gold particles. Before use, the sterilized gold particle-containing solution was thoroughly suspended using an ultrasonic generator (UW-25 ultrasonic cleaner manufactured by Taga Electric Co., Ltd.), and an appropriate amount was added to the above tube and stirred by pipetting. Next, 2.5 M CaCl per 750 μg of gold particles was added to the above tube. 225μL of 0.1M Spermidine (Nacalai Tesque) and 10μL of 0.1M Spermidine (Nacalai Tesque) were added. Immediately after mixing, the mixture was vigorously suspended by vortexing for 5 minutes. After leaving the mixture at room temperature for 10 minutes, it was centrifuged at 9,100×g for 2 seconds. The supernatant was removed and the mixture was washed with 70% ethanol and 99.5% ethanol. Finally, the supernatant was removed and 24μL of 99.5% ethanol was added and the mixture was thoroughly suspended. 6μL was poured into the center of the macrocarrier in a clean bench and air-dried.

[0077] The particle gun (gene gun) used was the Biolistic (registered trademark) PDS-1000 / He Particle Delivery System (BIO-RAD), and the pressure at the time of shooting was about 94.9 kgf / cm 2 (1,350 psi), and the distance to the target tissue was 5 cm (particle diameter 0.6 μm or more) or 3.5 cm (particle diameter less than 0.6 μm). Each dish was bombarded four times. After bombardment, the dish was left to stand overnight at 22°C in the dark.

[0078] (4) Investigation of the efficiency of transient expression of GFP protein The efficiency of GFP gene transfer in the shoot apex was calculated by observing GFP fluorescence (excitation: 470 / 40, absorption: 525 / 50) in the shoot apex under a stereoscopic fluorescence microscope (Leica MZFLIII) (Figure 1). Among the mature embryos treated with transformation, those in which 5 or more spots of GFP fluorescence were observed in the shoot apex tissue were considered to be transgenic individuals, and the efficiency of gene transfer (transgenic individuals / number of treated mature embryos x 100) was calculated. As a result, the efficiency of gene transfer in the shoot apex was higher in the cases of gold particles with diameters of 0.8 μm, 0.6 μm, and 0.3 μm than in the cases of gold particles with diameters of 1.6 μm and 1.0 μm (Table 1). In particular, when 0.6 μm was used, the efficiency of gene transfer in the shoot apex was the highest at 73.3%, compared to the other gold particle diameters (Table 1). As will be described later, the efficiency of gene transfer was also higher in the case of 0.6 μm gold particles than in the case of 1.0 μm gold particles.

[0079] [Table 1]

[0080] 2.T 0 Genomic PCR-based survey of plants (1) Preparation of ripe wheat seeds The method was as described in Example 1-1-(1). (2) Exposure of the shoot apex in the mature seed embryo The method was carried out in accordance with Example 1-1-(2). (3) Gene transfer Two types of gold particle diameters, 0.6 μm and 1.0 μm, were used in accordance with the method described in Example 1-1-(3).

[0081] (4) Growth of transformed plants The transformed plants were left to stand overnight and then transplanted into disposable plant cell culture vessels (Sigma) containing MS-maltose medium and grown under long days (22°C, 16-hour day length). After 3-4 weeks of growth, when the second and third leaves were observed, the plants were transplanted into pots containing horticultural seedling soil. They were then grown in a long-day artificial climate chamber (24°C, 16-hour day length, 50-70% humidity) until the fourth to sixth leaves appeared.

[0082] (5) T 0 Presence or absence of the transgene in plant leaves The presence or absence of the fluorescent reporter gene GFP was examined by PCR in the obtained plants. Genomic DNA was extracted from the 4th to 6th leaves (50 mg) using the benzyl chloride method, and PCR was performed using this as a template and primers created from the sequence specific to the GFP gene. Primer sequence: ACGGCACAAGTTCAGCGT (SEQ ID NO: 1) Primer sequence: ACCATGTGATCGCGCTTCT (SEQ ID NO:2)

[0083] The PCR reaction solution contained 20 ng of genomic DNA, 0.25 U of ExTaqHS (registered trademark, TaKaRa), 1.5 μL of 10× attached buffer, 2 mM dNTPs, and 2.5 pmol of each primer pair, and was filled up to a total of 15 μL with sterile distilled water.

[0084] PCR was performed using a TaKaRa PCR Thermal Cycler Dice (registered trademark), with treatment at 95° C. for 3 minutes, followed by 33 cycles of reaction at 95° C. for 30 seconds, 60° C. for 30 seconds, and 72° C. for 1 minute. After the PCR reaction, 1.0% agarose gel electrophoresis was performed and the PCR product was detected by staining with ethidium bromide. Individuals in which the expected 601 bp GFP gene fragment was detected were determined to be transgenic.

[0085] The gene transfer efficiency per number of fully ripe embryos treated with gene transfer (number of individuals transferred with gene / number of fully ripe embryos treated with gene transfer) was calculated from the number of individuals transferred with gene transfer using two gold particle diameters, 1.0 μm and 0.6 μm.

[0086] As a result, when gold particles with a diameter of 1.0 μm were used, the introduced gene was not detected (Table 2). On the other hand, when gold particles with a diameter of 0.6 μm were used, the introduced gene was confirmed in only a few individuals (T 0 Generation) were detected in three individuals (gene transfer efficiency 1.4%) (Table 2). From this, it was found that the gene transfer efficiency was improved by using gold particles with a diameter of 0.6 μm, which showed a high transient expression efficiency in Example 1-1-(4), compared with the gold particles with a diameter of 1.0 μm.

[0087] [Table 2]

[0088] [Example 2] Examination of optimal gas pressure for gene transfer To find the appropriate gas pressure, we examined the presence or absence of GFP fluorescence in the shoot apex after gene transfer and the corresponding phenotype (T 0 The presence or absence of the introduced gene was examined in each generation. 1. Investigation using the transient expression system of GFP fluorescent protein as an indicator (1) Preparation of ripe wheat seeds The method was as described in Example 1-1-(1). (2) Exposure of the shoot apex in the mature seed embryo The method was carried out in accordance with Example 1-1-(2). (3) Gene transfer The gold particle diameter was 0.6 μm, the gas pressure was 1,100 psi or 1,350 psi, and the method described in Example 1-1-(3) was followed.

[0089] (4) Investigation of the efficiency of transient expression of GFP protein The method described in Example 1-1-(4) was followed. As a result, the gene transfer efficiency described in Example 1-1-(4) was 74.2% when the gas pressure was 1,350 psi, which was higher than the 13.3% when the gas pressure was 1,100 psi (Table 3). 0 The gene transfer efficiency for the next generation was also higher at a gas pressure of 1,350 psi than at a gas pressure of 1,100 psi.

[0090] [Table 3]

[0091] 2.T 0 Genomic PCR-based survey of plants (1) Growth of transformed plants The method was carried out in accordance with that described in Example 1-2-(4). (2)T 0 Presence or absence of the transgene in plant leaves The method described in Example 1-2-(5) was followed. As a result, the gene transfer efficiency described in Example 1-2-(5) was 4.2% when the gas pressure was 1,350 psi, which was higher than 0.8% when the gas pressure was 1,100 psi (Table 3). From this, it was found that the gene transfer efficiency was improved by using a gas pressure of 1,350 psi, which had a high transient expression efficiency of GFP protein in Example 2-1-(4), compared to a gas pressure of 1,100 psi.

[0092] [Example 3] Examination of optimal water absorption time for gene transfer To find the appropriate water absorption time, we examined the presence or absence of GFP fluorescence in the shoot apex after gene introduction and its relation to the current generation (T 0 Generation) and Next Generation (T 1 The presence or absence of the introduced gene was examined in each generation.

[0093] 1. Preparation of mature embryos and gene transfer (1) Preparation of ripe wheat seeds Fully ripe seeds of wheat (Triticum aestivum cv. Fielder) were immersed in bleach (hypochlorite concentration 6%), shaken at room temperature for 20 minutes, and then washed with sterile water in a clean bench. After washing, they were placed on a Kimtowel or filter paper moistened with sterile water and incubated at 4°C for 2 days. They were then incubated at 22°C for 6 to 12 hours and 12 to 18 hours, and used in the following experiments. Seminal root length was investigated by measuring the length of the radicle after cutting open the root sheath. (2) Exposure of the shoot apex in the mature seed embryo The method was carried out in accordance with Example 1-1-(2). (3) Gene transfer The gold particles had a diameter of 0.6 μm, and the method described in Example 1-1-(3) was followed.

[0094] 2.T 0 Generation and T 1 Genomic PCR-based survey of plants (1) Growth of transformed plants The individuals in which transient GFP fluorescence was observed in the shoot apex in Example 3-1-(3) were grown by the method described in Example 1-2-(4).

[0095] (2)T 0 Presence or absence of the transgene in plant leaves The method described in Example 1-2-(5) was followed. When the fully matured embryos after each imbibition time were transformed, the transgene-confirmed individuals obtained (T 0The gene transfer efficiency (number of gene-introduced individuals / number of treated mature embryos x 100) per number of mature embryos that underwent gene transfer treatment was calculated from the number of mature embryos that underwent gene transfer treatment (generations). As a result, when mature seeds that had been imbibed for 6 to 12 hours and 12 to 18 hours were used in the experiment, the gene transfer efficiency was 3.1% and 1.3%, respectively (Table 4), and was particularly high in mature embryos 6 to 12 hours after imbibition (Table 4).

[0096] [Table 4]

[0097] (3) T 1 Presence or absence of the transgene in plant leaves The individuals in which the introduced gene was confirmed in (2) above were cultivated and 1 Seeds were obtained. 1 About 10 to 20 seeds were sown and grown, and the first leaves (50 mg) were sampled. Genomic PCR and electrophoresis were performed in accordance with Example 1-2-(5). When fully matured embryos were transformed after each imbibition time, the resulting individuals with confirmed introduced genes (T 1 From the total number of mature embryos imbibed with water (generations), the gene transfer efficiency (number of individuals imbibed with gene / number of mature embryos treated x 100) per number of mature embryos treated with gene transfer was calculated. As a result, when mature seeds imbibed with water for 6 to 12 hours and 12 to 18 hours were used in the experiment, the gene transfer efficiency was 3.1% (Figure 2, lines 1 and 2, Table 4) and 0.7% (Figure 2, lines 3 to 5, Table 4), respectively, and was particularly high in mature embryos imbibed with water for 6 to 12 hours. From these results, it was determined that the early stage of imbibition of mature seeds (approximately 6 to 18 hours, with a seminal root length of 1.0 mm or less) is appropriate for gene transfer, and that 6 to 12 hours after imbibition is particularly preferable.

[0098] The transgene-confirmed individuals shown in Table 4 (T 1 For the (1st generation) 5 line, Southern blot analysis using the GFP gene region as a probe also confirmed that the GFP gene had been integrated into the genomic DNA (Figure 3).

[0099] [Example 4] T 1 Confirmation of gene expression in the next generation The presence or absence of expression of the introduced gene (GFP gene) in the transformed wheat produced by this gene transfer method was examined.

[0100] 1.T 1 Observation of GFP fluorescence in seeds T obtained in Example 3-2-(3) 1 The seeds were placed in a sterile petri dish and incubated under LAS3000 (FujiFilm). 1 GFP fluorescence was observed in the seeds (filter 510DF10) (Figure 4A). Next, the seeds in which GFP fluorescence was observed were cut in half and the GFP fluorescence of the endosperm was observed (excitation: 470 / 40, absorption: 525 / 50) under a stereoscopic fluorescence microscope (Leica MZFLIII). As a result, GFP fluorescence was observed in the endosperm (E), and strong GFP fluorescence was also observed in the aleurone layer (Al) (Figure 4B).

[0101] 2.T 1 Expression analysis of GFP fluorescent protein in young leaves of the first generation T grown in Example 3-2-(3) 1 Young leaves of the 10th generation plants were sampled, and GFP fluorescence (excitation: 470 / 40, absorption: 525 / 50) in the leaves was observed under a stereoscopic fluorescence microscope (Leica MZFLIII). As a result, as shown in Figure 4C, GFP fluorescence was observed in the stomatal cells of the leaves in genomic PCR-positive individuals (transformants).

[0102] Next, total protein was extracted from mature leaves of the wild type and transformants (transgenic individuals) and GFP fluorescent protein was detected by Western blotting. One gram of mature leaves was frozen and crushed in liquid nitrogen, then suspended in protein extraction buffer (0.25 M sorbitol, 50 mM Tris / acetate, pH 7.5, 1 mM EDTA, 2 mM DTT, 1% PVP, 10 μM PMSF). The extract was centrifuged (1,100 × g, 15 min, 4 ° C), and the supernatant was further centrifuged (12,800 × g, 15 min, 4 ° C). The supernatant obtained after this centrifugation was used as the total protein fraction. 20 μg of the total protein fraction was electrophoresed using a 12.5% ​​SDS polyacrylamide gel and transferred to a nitrocellulose membrane by the semi-dry method. The membrane was shaken for 1 hour in blocking buffer (5% [w / v] Skim Milk Powder in TTBS (10 mM Tris-HCl, 150 mM NaCl, 0.05% Tween-20, pH 7.5)). The membrane was washed 3 times with TTBS for 5 minutes, and then reacted with the primary antibody for 1 hour. The membrane was washed 3 times with TTBS for 5 minutes, and then reacted with the secondary antibody for 1 hour. The membrane was washed 3 times with TTBS for 5 minutes, and then detection was performed according to the method described in the instruction manual for the Amersham ECL Western blotting analysis system (GE Healthcare). Mouse IgG was used as the primary antibody. 1 A κ-derived GFP antibody (ROCHE) (2000-fold dilution) was used, and as the secondary antibody, a peroxidase-labeled anti-mouse IgG antibody (5000-fold dilution) provided with the above kit was used.

[0103] Western blot analysis showed that the transformants showed a signal at approximately 27 kDa, the estimated molecular weight of the GFP protein, but no signal was detected in the wild-type strain (Figure 4D). These results confirmed that the transgene was normally expressed in the transformed plants produced by this gene transfer method.

[0104] Transformants can also be obtained for barley, corn, rice, soybean, potato and apple using techniques essentially similar to those for wheat.

[0105] [Example 5] T 0 T obtained from generation 1 lineage 1 Confirmation of genotypes in each generation The transgenic individuals (T 0 The second generation) will be a chimera in which cells with different genetic information are mixed within the same individual. 0 Multiple T 1 To investigate whether the seeds carry different genetic information, Southern blot analysis was performed.

[0106] T obtained in Example 3-2-(3) 0 From the FG1 lineage individuals of the first generation, the T 1 Seeds were harvested and multiple plants were sown from them. 1 The generation individuals were grown and each T 1 The presence or absence of the introduced gene in the 1st generation individuals was examined. As a result, T harvested from the main stem and the panicles derived from the tillers other than tiller 2 were 1 The transgene was confirmed in the next generation (Table 5).

[0107] [Table 5]

[0108] Next, the T obtained from the main stem 1 Genomic DNA obtained from the young leaves of 14 seed individuals (FG1-main stem-1 to 14) was treated with HindIII and subjected to Southern blot analysis using the GFP gene region as a probe. As a result, the same signal pattern was obtained for all individuals (Figure 5A). Furthermore, T 1Genomic DNA obtained from the young leaves of the seeds (FG1-main stem-1, FG1-tiller 1-1, FG1-tiller 3-1, FG1-tiller 4-1, FG1-tiller 5-1) was treated with HindIII and subjected to Southern blot analysis in the same manner as above. As a result, the same signal pattern was obtained for all the individuals (Figure 5B). From these results, it was confirmed that one line of transgenic individuals (T 0 Multiple T 1 It was found that the seeds have the same genetic information, suggesting that only a very small number of shoot apical stem cells transition into the germ lineage, and that the method in question makes it possible to introduce genes into these very small number of shoot apical stem cells.

[0109] [Example 6] Obtaining transformants in maize To confirm whether maize transformants could be obtained using a similar technique to that used for wheat, the presence or absence of GFP fluorescence in the shoot apex after gene introduction was examined.

[0110] 1. Investigation using the transient expression system of GFP fluorescent protein as an indicator (1) Preparation of ripe corn seeds Mature seeds of corn (Snowdent Wangxia) were immersed in bleach (6% hypochlorite concentration), shaken at room temperature for 20 minutes, and then washed with sterile water in a clean bench. After washing, the seeds were placed on a Kimtowel or filter paper moistened with sterile water, incubated at 30°C for about 36 hours, and used in the following experiments.

[0111] (2) Exposure of the shoot apex in the mature seed embryo Under a stereomicroscope, the endosperm and excess scutellum were removed using a sterilized knife (or a sterilized scalpel). After that, the coleoptile and leaf primordia of the embryo part of the germinated seeds were removed using the tip of a needle (diameter 0.20 mm) to completely expose the shoot apex part. These were placed on MS-maltose medium (4.3 g / L MS salt, MS vitamin, 30 g / L maltose, 0.98 g / L MES, 3% PPM (plant preservative mixture, registered trademark, Nacalai Tesque), 7.0 g / L phytagel, pH 5.8) at 10 pieces per plate. Two of the above plates were prepared for each treatment.

[0112] (3) Gene transfer The method described in Example 1-1-(3) was followed.

[0113] (4) Investigation of the efficiency of transient expression of GFP protein The efficiency of GFP gene transfer in the shoot apex was calculated by observing GFP fluorescence (excitation: 470 / 40, absorption: 525 / 50) in the shoot apex under a stereoscopic fluorescence microscope (Leica MZFLIII) (Figure 6). Among the mature embryos treated with transformation, those in which 5 or more spots of GFP fluorescence were observed in the shoot apex tissue were considered to be transgenic individuals, and the efficiency of gene transfer (transgenic individuals / number of treated mature embryos x 100) was calculated. As a result, the efficiency of gene transfer in the shoot apex was higher in the cases of gold particles with diameters of 0.8 μm, 0.6 μm, and 0.3 μm than in the cases of gold particles with diameters of 1.6 μm and 1.0 μm (Table 6). In particular, when 0.6 μm was used, the efficiency of gene transfer in the shoot apex was 85%, the highest, compared to the other gold particle diameters (Table 6).

[0114] [Table 6]

[0115] [Example 7] Obtaining transformants in soybean To confirm whether soybean transformants could be obtained using a similar technique to that used for wheat, we investigated the presence or absence of GFP fluorescence in the shoot apex after gene introduction and the subsequent efficiency of transformant acquisition.

[0116] 1. Investigation using the transient expression system of GFP fluorescent protein as an indicator (1) Preparation of mature soybean seeds Mature soybean (Yukihomare) seeds were immersed in bleach (6% hypochlorite concentration), shaken at room temperature for 3 minutes, and then washed with sterile water in a clean bench. After washing, they were placed on a Kimtowel or filter paper moistened with sterile water, incubated at 23°C for about 40 hours, and used in the following experiments.

[0117] (2) Exposure of the shoot apex in the mature seed embryo Under a stereomicroscope, all the cotyledons were cut off using a sterilized knife (or a sterilized scalpel) to leave only the hypocotyl. The primary leaves and base of the hypocotyl were then removed using the tip of a needle (0.20 mm in diameter) to completely expose the shoot apex. These were then placed on BM medium (4.3 g / L MS salt, MS vitamin, 3% sucrose, 0.50 g / L MES, 3% PPM (plant preservative mixture, Nacalai Tesque), 6.0 g / L phytagel, pH 5.7) at approximately 15 pieces per plate.

[0118] (3) Gene transfer The 35S promoter of cauliflower mosaic virus (CaMV) was used as the promoter, and the method described in Example 1-1-(3) was followed.

[0119] (4) Investigation of the efficiency of transient expression of GFP protein The efficiency of GFP gene transfer in the shoot apex was calculated by observing GFP fluorescence (excitation: 470 / 40, absorption: 525 / 50) in the shoot apex under a stereoscopic fluorescence microscope (Leica MZFLIII) (Figure 7). Among the mature embryos treated with transformation, those in which 5 or more spots of GFP fluorescence were observed in the shoot apex tissue were defined as transgenic individuals, and the efficiency of gene transfer (transgenic individuals / number of treated mature embryos x 100) was calculated. As a result, the efficiency of gene transfer in the shoot apex was 85.0%, which was higher when gold particles with a diameter of 0.6 μm were used than when gold particles with a diameter of 1.6 μm and 1.0 μm were used (Table 7).

[0120] [Table 7]

[0121] 2.T 0 Genomic PCR-based survey of plants (1) Growth of transformed plants The transformed plants were left to stand overnight and then transplanted into disposable plant cell culture vessels (Sigma) containing RM medium (4.3 g / L MS salt, MS vitamin, 3% sucrose, 0.50 g / L MES, 3% PPM (plant preservative mixture, Nacalai Tesque), 0.3% Gelrite, pH 5.7) and grown in an incubator (23°C, 16-hour day length). When root growth and leaf differentiation from the shoot apex were observed, the plants were transplanted into cell trays containing horticultural seedling soil. They were then grown in the same incubator until the second leaf appeared.

[0122] (2)T 0 Presence or absence of the transgene in plant leaves The presence or absence of the fluorescent reporter gene GFP was examined by PCR in the obtained plants. Genomic DNA was extracted from the second leaf (50 mg) using the benzyl chloride method, and PCR was performed using this as a template and primers created from a sequence specific to the GFP gene. Primer sequence: ACGGCACAAGTTCAGCGT (SEQ ID NO: 1) Primer sequence: ACCATGTGATCGCGCTTCT (SEQ ID NO:2)

[0123] The PCR reaction solution contained 20 ng of genomic DNA, 0.25 U of ExTaqHS (TaKaRa), 1.5 μL of 10× attached buffer, 2 mM dNTPs, and 2.5 pmol of each primer pair, and was filled up to a total of 15 μL with sterile distilled water.

[0124] PCR was performed using a TaKaRa PCR Thermal Cycler Dice, with treatment at 95°C for 3 minutes, followed by 32 cycles of 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 1 minute. After the PCR reaction, 1.0% agarose gel electrophoresis was performed, and the PCR product was detected by staining with ethidium bromide and irradiating with ultraviolet light. Individuals in which the expected 601 bp GFP gene fragment was detected were determined to be transgenic.

[0125] The gene transfer efficiency per number of fully ripe embryos treated with gene transfer (number of individuals transferred with gene / number of fully ripe embryos treated with gene transfer) was calculated from the number of individuals transferred with gene transfer using two gold particle diameters, 1.0 μm and 0.6 μm.

[0126] As a result, when 0.6 μm diameter gold particles were used, 470 mature embryos were treated and the introduced gene was confirmed (T 0 Generation) was 63 individuals (gene introduction efficiency 13.4%). From this, it was found that by using gold particles with a diameter of 0.6 μm, which showed high transient expression efficiency in Example 7-1-(4), it is possible to obtain soybean individuals into which genes were introduced with high efficiency.

[0127] [Example 8] Obtaining transformants in barley To confirm whether a barley transformant could be obtained using a technique similar to that used for wheat, the presence or absence of GFP fluorescence in the shoot apex after gene introduction was examined.

[0128] 1. Investigation using the transient expression system of GFP fluorescent protein as an indicator (1) Preparation of mature barley seeds Mature seeds of barley (Wasedori Nijo) were immersed in bleach (6% hypochlorite concentration), shaken at room temperature for 20 minutes, and then washed with sterile water in a clean bench. After washing, they were placed on a Kimtowel or filter paper moistened with sterile water, incubated at 4°C for 2 days, and then incubated at 22°C for 6 to 12 hours, and used in the following experiments.

[0129] (2) Exposure of the shoot apex in the mature seed embryo Under a stereomicroscope, the endosperm and excess scutellum were removed using a sterilized scalpel. Then, the coleoptile and leaf primordia of the embryo part of the germinated seed were removed using the tip of a needle (diameter 0.20 mm) to completely expose the shoot apex. These were placed on MS-maltose medium (4.3 g / L MS salt, MS vitamin, 30 g / L maltose, 0.98 g / L MES, 3% PPM (plant preservative mixture, registered trademark, Nacalai Tesque), 7.0 g / L phytagel, pH 5.8) at 30 pieces / plate.

[0130] (3) Gene transfer The method described in Example 1-1-(3) was followed.

[0131] (4) Investigation of the efficiency of transient expression of GFP protein The method described in Example 1-1-(4) was followed. As a result, the efficiency of gene transfer in the shoot apex was higher when gold particles had diameters of 0.8 μm, 0.6 μm, and 0.3 μm than when gold particles had diameters of 1.6 μm and 1.0 μm (Table 8). In particular, when 0.3 μm was used, the efficiency of gene transfer in the shoot apex was 80.0%, the highest, compared with the other gold particle diameters (Figure 8, Table 8).

[0132] [Table 8]

[0133] [Example 9] Obtaining transformants in potato To confirm whether potato transformants could be obtained using a technique similar to that used for wheat, the presence or absence of GFP fluorescence in the shoot apex after gene introduction was examined.

[0134] 1. Investigation using the transient expression system of GFP fluorescent protein as an indicator (1) Preparation of potatoes Seed potatoes (Danshaku) were disinfected with bleach (1% hypochlorite concentration), washed with water, dried, and then incubated under fluorescent lights at 22°C for 1-2 weeks to allow germination.

[0135] (2) Exposure of the shoot apex Under a stereomicroscope, the leaf primordia were removed from the shoots using the tip of a needle (0.20 mm in diameter) to completely expose the shoot apex. These were then placed on MS medium (4.3 g / L MS salt, MS vitamin, 30 g / L sucrose, 0.98 g / L MES, 3% PPM (plant preservative mixture, registered trademark, Nacalai Tesque), 7.0 g / L phytagel, pH 5.8) at 40 pieces per plate.

[0136] (3) Gene transfer The vector used for introduction was pUC18-35S-GFP, and the method described in Example 1-1-(3) was followed.

[0137] (4) Investigation of the efficiency of transient expression of GFP protein The method described in Example 1-1-(4) was followed. As a result, GFP fluorescence in the shoot apex could be observed by using gold particles with a diameter of 0.6 μm (FIG. 9).

[0138] [Example 10] Transformation using linear plasmid To improve transformation efficiency, we investigated the presence or absence of GFP fluorescence in the shoot apex after gene transfer using a linear plasmid and the subsequent efficiency of transformant acquisition.

[0139] 1.T 0 Genomic PCR-based survey of plants (1) Preparation of ripe wheat seeds The method described in Example 1-1-(1) was followed.

[0140] (2) Exposure of the shoot apex in the mature seed embryo The method described in Example 1-1-(2) was followed.

[0141] (3) Adjustment of linear vectors Using the GFP vector (SEQ ID NO: 3) used in Example 1-1-(3) as a template, a PCR reaction was carried out using primers prepared from sequences specific to the ubiquitin promoter and Nos terminator (SEQ ID NO: 4 and 5) or sequences specific to the vector (SEQ ID NO: 6 and 7). The PCR product was then purified by ethanol precipitation to prepare linear vector 1 (Pubi-GFP-Tnos fragment) and linear vector 2 (Pubi-GFP-Tnos fragment-1 kb added). In linear vector 2, a GFP vector-derived sequence of about 1.2 kbp was added to the 5' end of linear vector 1, and a 0.8 kbp sequence was added to the 3' end. Primer sequence: CGACGGCCAGTGCCAAGCTT (SEQ ID NO: 4) Primer sequence: ATGACCATGATTACGAATTC (SEQ ID NO:5) Primer sequence: AAGCTAGAGTAAGTAGTTCGCCA (SEQ ID NO: 6) Primer sequence: ATACTGTCCTTCTAGTGTAGCCG (SEQ ID NO: 7)

[0142] The PCR reaction solution contained 10 ng of vector DNA, 1.0 U of PrimeSTAR (registered trademark) GXL DNA Polymerase (TaKaRa), 4.0 μL of 5× attached buffer, 0.2 mM dNTPs, and 2.5 pmol of each primer pair, and was filled up to a total of 20 μL with sterile distilled water.

[0143] PCR was performed using a TaKaRa PCR Thermal Cycler Dice, with 40 cycles consisting of 10 seconds at 98°C, 15 seconds at 60°C, and 2 minutes and 30 seconds at 68°C. The PCR product was purified by ethanol precipitation and dissolved in sterile water to a concentration of 1 μg / μL, and used in the following experiments.

[0144] (4) Gene transfer Gold particles with a diameter of 0.6 μm were used, and a GFP vector or linear vector solution (1 μg / μL) was added at 10 μg per 750 μg of gold particles, following the method described in Example 1-1-(3).

[0145] (5) Growth of transformed plants The transformed plants were left to stand overnight and then transplanted into disposable plant cell culture vessels (Sigma) containing MS-maltose medium and grown under long days (22°C, 16-hour day length). After 3-4 weeks of growth, when the second and third leaves were observed, the plants were transplanted into pots containing horticultural seedling soil. They were then grown in a long-day artificial climate chamber (24°C, 16-hour day length, 50-70% humidity) until the fourth to sixth leaves appeared.

[0146] (6) T 0 Presence or absence of the transgene in plant leaves The method described in Example 1-2-(5) was followed. When various vectors were used for transformation, the resulting transgene-confirmed individuals (T 0 The gene transfer efficiency (number of gene-introduced individuals / number of treated ripe embryos × 100) per number of ripe embryos subjected to gene transfer treatment was calculated from the total number of ripe embryos (generations) that had been transferred. As a result, the gene transfer efficiency was 7.1% and 14.2% when linear vector 1 and linear vector 2 were used in the experiment, respectively, compared to 4.2% when a conventional GFP vector was transferred (Table 9), and linear vector 2 was particularly high. From these results, it was found that a linear vector (nucleic acid cassette to be transferred) is preferable for gene transfer, and more preferably, a linear vector having 0.8 kb or more of nucleic acid added to both ends of the nucleic acid cassette to be transferred is used.

[0147] [Table 9]

[0148] [Example 11] Obtaining transformants in rice Regarding rice, transformants can be obtained essentially in the same manner as for wheat. 1. Preparation of Rice Mature Seeds Threshed, fully ripe rice seeds (variety: Nipponbare) were sterilized and washed using the method described in Example 1-1-(1), then placed on a Kimtowel or filter paper moistened with sterilized water and incubated at 25°C for 24 to 48 hours for use in the following experiments.

[0149] 2. Exposure of the shoot apex in mature seed embryos According to the method described in Example 1-1-(2), the shoot apex of the mature seed embryo is completely exposed. The mature embryo with the shoot apex exposed is placed on MS-maltose medium at about 30 pieces per plate.

[0150] 3. Gene Transfer Gene transfer into the shoot apex of a mature rice embryo is carried out according to the method described in Example 1-1-(3). 4. Selection based on transient expression of GFP protein According to the method described in Example 1-1-(4), among the individuals transformed with gold particles having a diameter of 0.6 μm, those in which 5 or more spots of GFP fluorescence are observed in the shoot apical tissue are selected. 5. Growth of transformed plants The transformed plants are grown according to the method described in Example 1-2-(4). 6.T 0 Confirmation of the transgene in plant leaves According to the method described in Example 1-2-(5), an individual confirmed to have introduced the gene is obtained. The obtained individual is cultivated, and the next generation seeds are obtained, whereby a stable transformant can be obtained.

[0151] [Example 12] Obtaining transformants in apple For apple, transformants can be obtained essentially in the same manner as for wheat. 1. Preparation of Apple Shoot Apices Preparation of shoot tips from apple (variety: Jonagold) is carried out according to the conditions for inducing shoot tip culture described in Plant Tissue Culture, 9(2), 69-73 (1992).

[0152] 2. Exposure of the shoot apex The shoot tips prepared by method 1 are placed on MS-maltose medium (4.3 g / L MS salt, MS vitamin, 30 g / L maltose, 0.98 g / L MES, 3% PPM (plant preservative mixture, registered trademark, Nacalai Tesque), 7.0 g / L phytagel, pH 5.8) at approximately 30 tips per plate.

[0153] 3. Gene Transfer The 35S promoter of cauliflower mosaic virus (CaMV) was used as the promoter, and the method described in Example 1-1-(3) was followed. 4. Selection based on transient expression of GFP protein According to the method described in Example 1-1-(4), among the individuals transformed with gold particles having a diameter of 0.6 μm, those in which 5 or more spots of GFP fluorescence are observed in the shoot apical tissue are selected. 5. Growth of transformed plants The transformed plants are grown according to the method described in Example 1-2-(4). 6.T 0 Confirmation of the transgene in plant leaves According to the method described in Example 1-2-(5), an individual confirmed to have introduced the gene is obtained. The obtained individual is cultivated, and the next generation seeds are obtained, whereby a stable transformant can be obtained.

[0154] [Example 13] Targeted mutagenesis using the gene transfer method In order to verify whether genome editing of wheat is possible using this gene transfer method, mutation introduction of the target sequence by RNA-induced CRISPR / Cas9 was attempted. Note that, in order to create a stable transformant using this gene transfer method, a gold particle diameter of 0.3 μm to 0.9 μm is preferable from Example 1-1-(4), but in order to create a genome-edited individual, it is sufficient to express nucleases or the like transiently in the plant cell nucleus or organelle, so the above particle diameter is not limited. Therefore, the range of gold particle diameters that allows genome editing of wheat using this gene transfer method was examined.

[0155] 1. Confirmation of targeted mutation introduction using GFP fluorescence as an indicator (1) Preparation of ripe wheat seeds Mature seeds of wheat (Triticum aestivum cv. Fielder) were immersed in bleach (6% hypochlorite concentration), shaken at room temperature for 20 minutes, and then washed with sterile water in a clean bench. After washing, the seeds were placed on a Kimtowel or filter paper moistened with sterile water and incubated at 4°C for 2 days to break dormancy. They were then incubated at 22°C for approximately 12 hours and used in the following experiments.

[0156] (2) Exposure of the shoot apex in the mature seed embryo The procedure was carried out in accordance with the method described in Example 1-1-(2). (3) Gene transfer Gene transfer into the shoot apex of ripe wheat embryos was carried out using a particle gun method as follows.

[0157] In the examples, a target plasmid DNA (pUC-based plasmid) was used in which a 20 bp partial sequence (CCGTCACGCAGGACCCAATCTCC: SEQ ID NO: 8) inside the TaMLO gene was inserted as a target sequence immediately after the start codon of the fluorescent reporter gene (GFP). The gene was designed to be expressed under the control of the ubiquitin promoter and first intron of maize. As a terminator, the terminator of the nopaline synthase (NOS) gene was added. By co-introducing the vector and the gRNA / Cas9 integrated plasmid, the TaMLO gene target sequence is cleaved by Cas9, and two bases are deleted or one base is inserted during the repair process. As a result, a translation frameshift occurs, the reading frame of the GFP gene codon is restored, and active GFP protein is expressed.

[0158] The gRNA in the integrated plasmid (pUC-based plasmid) was designed to be expressed under the control of the wheat-derived U6 promoter. The Cas9 gene was designed to be expressed under the control of the maize ubiquitin promoter and first intron. The terminator was the nopaline synthase (NOS) gene terminator.

[0159] The preparation and introduction of gold particles were performed according to the method of Example 2-1-(3). However, the target plasmid DNA solution and gRNA / Cas9 integrated plasmid were added so that they were 2.5 μg and 7.5 μg per 750 μg of gold particles, respectively. The amount of gold particles was 375 μg for gold particle diameter 0.3 μm and 187.5 μg for other gold particle diameters per shot.

[0160] (4) Confirmation of GFP fluorescence by cleavage of the TaMLO gene sequence The presence or absence of cleavage of the TaMLO gene target sequence was investigated by observing GFP fluorescence (excitation: 470 / 40, absorption: 525 / 50) in the shoot apex under a stereofluorescence microscope (Leica, MZFLIII). Among the mature embryos treated with gene introduction, those in which one or more spots of GFP fluorescence were observed in the shoot apex tissue were considered as individuals with cleavage of the target sequence, and the target sequence cleavage introduction efficiency (target sequence cleavage individuals / number of treated mature embryos x 100) was calculated. The experiment was performed twice, and the average value of the target sequence cleavage introduction efficiency is shown in Table 10. As a result, when the target plasmid DNA and the gRNA / Cas9 integrated plasmid were co-introduced, GFP fluorescence indicating target sequence cleavage was observed with gold particles with diameters of 0.3 μm to 1.0 μm, but not with gold particles with a diameter of 1.6 μm (Table 10). In addition, the efficiency was the highest at 23.5% when gold particles with a diameter of 0.6 μm were used (Table 10, Figure 10). These results indicate that in order to produce genome-edited individuals using this gene transfer method, gold particle diameters of less than 1.6 μm are preferable, with gold particle diameters of 0.6 μm being preferred.

[0161] [Table 10]

[0162] [Example 14] Targeted mutagenesis using the gene transfer method (T 0 generation, T 1 generation) To verify whether genome editing of target genes in wheat is possible using this gene transfer method, we attempted to introduce mutations into the TaQsd1 gene (alanine aminotransferase gene), the TaLOX2 gene (lipoxygenase gene), and the TaGASR7 gene (Snakin / GASA gene) using RNA-induced CRISPR / Cas9. The practical cultivar "Haruyokoi" was used for the introduction of mutations into the TaQsd1 gene, and "Bobwhite" was used for the others.

[0163] 1. Confirmation of target gene mutation one week after gene transfer (1) Preparation of ripe wheat seeds The method of Example 1-1-(1) was followed using fully ripe seeds of wheat (Triticum aestivum cv. Bobwhite, Triticum aestivum cv. Haruyokoi).

[0164] (2) Exposure of the shoot apex in the mature seed embryo The procedure was carried out in accordance with the method described in Example 1-1-(2).

[0165] (3) Gene transfer Gene transfer into the shoot apex of ripe wheat embryos was carried out using a particle gun method as follows. In the examples, a wheat U6 promoter and a gRNA scaffold were cloned into the multicloning site of the pTAKN-2 vector to prepare a gRNA expression plasmid. Then, the target sequence of each target gene was introduced into the internal BbsI site to prepare each gRNA expression plasmid. TaQsd1 target sequence: ACGGATCCACCTCCCTGCAGCGG (SEQ ID NO: 9) TaLOX2 target sequence: GTGCCGCGCGACGAGCTCTTCGG (SEQ ID NO: 10) TaGASR7 target sequence: CCGCCGGGCACCTACGGCAAC (SEQ ID NO: 11)

[0166] The gRNA expression plasmid, Cas9 gene expression plasmid, and GFP expression plasmid (see Example 1-1-(3)) were added at 5 μg, 2.5 μg, and 2.5 μg, respectively, per 750 μg of gold particles. The gold particle diameter was 0.6 μm, and the amount of gold particles was 187.5 μg per shot.

[0167] (4) Confirmation of mutations introduced by cleavage of each target gene sequence Individuals that showed GFP fluorescence (excitation: 470 / 40, absorption: 525 / 50) in the shoot apex under a stereofluorescence microscope (Leica, MZFLIII) were transplanted into disposable plant cell culture vessels (Sigma) containing MS-maltose medium and grown under long days (22°C, 16-hour day length). After about one week, the shoot apex of each individual was excised and placed in an 8-tube PCR tube containing 2 μL of DNAzol Direct (registered trademark, Cosmo Bio) to extract genomic DNA.

[0168] Using this as a template, PCR was carried out using primers constructed from sequences specific to each gene. TaQsd1-F: CAGCCTGGAGGGAATGACC (SEQ ID NO: 12) TaQsd1-R:ACCTGGTGGAATCCAGAGC (SEQ ID NO: 13) TaLOX2-F: CGTCTACCGCTACGACGTCTACAACG (SEQ ID NO: 14) TaLOX2-R: GGTCGCCGTACTTGCTCGGATCAAGT (SEQ ID NO: 15) TaGASR7-F: CCTTCATCCTTCAGCCATGCAT (SEQ ID NO: 16) TaGASR7-R: CCACTAAATGCCTATCACATACG (SEQ ID NO: 17)

[0169] The PCR reaction solution was added with 0.5 μL of genomic DNA, 0.4 U of KODFXNeo (TOYOBO), 10 μL of 2× attached buffer, 0.4 mM dNTPs, and 0.2 μM of each primer pair, and was filled up to a total of 20 μL with sterile distilled water.

[0170] PCR was performed using a TaKaRa PCR Thermal Cycler Dice, with 35 cycles of 98°C for 10 seconds and 68°C for 1 minute. After the PCR reaction, 1 μL of each PCR product, 1 μL of 10x attached buffer, and 5 U of an appropriate restriction enzyme were added, and the mixture was filled up to a total of 10 μL with sterile distilled water. After reacting overnight at 37°C, 2.0% agarose gel electrophoresis was performed and stained with ethidium bromide.

[0171] In wild-type plants, the PCR product was completely cleaved by the restriction enzyme, whereas in individuals with mutations, some PCR product was left uncleaved. DNA was extracted and purified from the remaining band and subjected to sequence analysis. Those with mutations in the target gene sequence were determined to be individuals with target gene mutations (Figure 11). As a result, mutations were confirmed in the cells in the shoot apex one week after introduction of the genome editing vector for all target genes.

[0172] 2.T 0 Generation adult leaves and T 1 Confirmation of target gene mutation in young leaves of next generation (1) Preparation of ripe wheat seeds The method described in Example 13-1-(1) was followed. (2) Exposure of the shoot apex in the mature seed embryo The procedure was carried out in accordance with the method described in Example 13-1-(2). (3) Gene transfer The method described in Example 13-1-(3) was followed.

[0173] (4) Growth of transgenic individuals The transgenic plants were left overnight and transplanted into disposable plant cell culture vessels (Sigma) containing MS-maltose medium and grown under long days (22°C, 16-hour day length). After 2 weeks of growth, when the second and third leaves were observed, the plants were transplanted into pots containing horticultural seedling soil. They were then grown in a long-day artificial climate chamber (24°C, 16-hour day length, humidity 50-70%).

[0174] (5) T 0Confirmation of targeted gene mutation in plant leaves We investigated whether mutations had been introduced into the target genes in the plants obtained. Genomic DNA was extracted from the fifth leaf or flag leaf (50 mg) using the benzyl chloride method, and PCR was performed using this as a template and primers prepared from sequences specific to each gene.

[0175] The PCR reaction solution was added with 0.7 μL of genomic DNA, 0.4 U of KODFXNeo (TOYOBO), 5 μL of 2× attached buffer, 0.4 mM dNTPs, and 0.2 μM of each primer pair, and was filled up to a total of 10 μL with sterile distilled water.

[0176] PCR was carried out using a TaKaRa PCR Thermal Cycler Dice, with 32 cycles consisting of 10 seconds at 98° C. and 1 minute at 68° C. PCR / restriction enzyme analysis was carried out according to the method described in Example 13-1-(4).

[0177] In the wild type strain, the PCR product was completely cleaved by the restriction enzyme, whereas in the individuals with the mutation, some PCR product was left uncleaved. DNA was extracted and purified from the remaining band and subjected to sequence analysis. Those with mutations in the target gene sequence were determined to be individuals with target gene mutations. As a result, for all the target genes, 0 The introduction of the targeted gene mutation in mature leaves was confirmed (Figure 12, Table 11).

[0178] [Table 11]

[0179] (6) T 1 Confirmation of targeted gene mutation in plant leaves The TaQsd1 mutant individuals were identified as having the mutations in (5) above. 1 Seeds were collected and 1Genomic DNA was extracted from young leaves (50 mg) of the 10th generation plant using the benzyl chloride method. The introduction of the target gene mutation was then confirmed by the method described in (5) above. 1 Regarding the second generation, 1 The introduction of the target gene mutation in the young leaves of the T 1 The results of the analysis of one generation line were presented. It was confirmed that mutations were introduced into the target gene in 9 out of 16 individuals. It was found that by using this gene introduction method, it is possible to edit the genome of shoot apical stem cells that transition to the germ cell lineage in the shoot apex.

[0180] [Example 15] Targeted mutagenesis by introduction of Cas9 protein using the gene introduction method We investigated whether genome editing of target genes in wheat was possible by introducing gRNA / Cas9 protein using this gene transfer method. To verify this, we introduced a complex of gRNA and Cas9 protein targeting the TaLOX2 gene into the wheat shoot apex.

[0181] 1. Confirmation of target gene mutation one week after gene transfer (1) Preparation of ripe wheat seeds The method of Example 1-1-(1) was followed using ripe seeds of wheat (Triticum aestivum cv. Bobwhite).

[0182] (2) Exposure of the shoot apex in the mature seed embryo The procedure was carried out in accordance with the method described in Example 1-1-(2).

[0183] (3) gRNA / Cas9 protein introduction Gene transfer into the shoot apex of ripe wheat embryos was carried out using a particle gun method as follows. In the examples, a mixture of crRNA and tracrRNA (Fasmac) (0.5 μg / μL) was used as gRNA. EnGen Cas9 NLS (NEB) derived from Streptococcus pyogenes was used as Cas9 protein.

[0184] crRNA: GUGCCGCGCGACGAGCUCUUguuuuagagcuaugcuguuuug (SEQ ID NO: 18) tracrRNA: AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (SEQ ID NO: 19)

[0185] Add 4 μg of each gRNA, 7 μg of Cas9 protein, 2 μL of 10×Cas9 buffer, and 0.5 μL of Ribolock RNase Inhibitor, and fill up with sterile distilled water to a total of 20 μL. After leaving it at room temperature for 15 minutes, add 750 μg or 1500 μg of gold particles and leave it on ice for 10 minutes. After discarding the supernatant, add 2.5 μg of GFP expression plasmid (see Example 1-1-(3)) and 32 μL of sterile distilled water, and use this as the gold particle / Cas9 complex. Note that the gold particle diameter was 0.6 μm, and the amount of gold particles was 187.5 or 375 μg per shot, and shot four times per plate. A hydrophilic film (3M, SH2CLHF) cut into 1.0 to 1.5 cm squares was attached to the center of the macrocarrier in a clean bench. The gold particle / Cas9 complex was poured into each well at 8 μL and air-dried. The bombardment conditions were the same as in Example 1-1-(3).

[0186] (4) Confirmation of mutation introduction by cleavage of the TaLOX2 target gene sequence The analysis was performed according to the method described in Example 13-1-(4). When the hydrophilic film was not used, GFP fluorescence was not observed in the shoot apex, whereas GFP fluorescence was observed when the hydrophilic film was used (Table 12). Furthermore, by increasing the amount of gold particles per shot from 187.5 μg to 375 μg, the expression efficiency of GFP fluorescence improved from 23.3% to 66.7% (Table 12). It was found that gold particles dispersed in an aqueous solvent were efficiently introduced into the shoot apex by using the hydrophilic film. As a result of carrying out PCR / restriction enzyme analysis according to Example 13-1-(4) for the individuals in which GFP fluorescence was observed, the PCR product was completely cleaved by the restriction enzyme in the wild-type strain, whereas the PCR product was left uncut in the individuals in which the mutation was introduced. DNA was extracted and purified from the remaining band and subjected to sequence analysis, confirming that a mutation had been introduced into the target gene sequence (Figure 14). As a result, it was confirmed that mutations had been introduced into the TaLOX2 target gene in the cell group in the shoot apex one week after the introduction of gRNA / Cas9 protein.

[0187] [Table 12]

[0188] [Example 16] Targeted mutagenesis in soybean using the gene transfer method For soybean, plants into which target gene mutations have been introduced can be obtained essentially by the same techniques as for wheat.

[0189] 1. Preparation of Mature Soybean Seeds The fully ripe seeds of soybeans (Fukuyutaka, Enrei) are used and prepared according to the method described in Example 7-1-(1).

[0190] 2. Exposure of the shoot apex in mature seed embryos The method described in Example 7-1-(2) is followed.

[0191] 3. Gene Transfer Gene transfer into the shoot apex of a mature embryo is carried out using a particle gun method as follows. In the examples, a soybean U6 promoter and a gRNA scaffold are cloned into the multicloning site of the pTAKN-2 vector to prepare a gRNA expression plasmid. Then, a target sequence of a target gene is introduced into the internal BbsI site to prepare each gRNA expression plasmid. Glyma.10G244400.1 target sequence: CCTCCGCCCAAGGCTCCGCCACC (SEQ ID NO: 20) Glyma.20G150000.1 target sequence: CCTCCGCCCAAGGCTCCGCCACC (SEQ ID NO: 20)

[0192] The gRNA expression plasmid, Cas9 gene expression plasmid, and GFP expression plasmid (see Example 7-1-(3)) are added at 5 μg, 2.5 μg, and 2.5 μg, respectively, per 750 μg of gold particles. The gold particle diameter is 0.6 μm, and the amount of gold particles is 187.5 μg per shot.

[0193] 4. Selection based on transient expression of GFP protein Individuals in which GFP fluorescence (excitation: 470 / 40, absorption: 525 / 50) was observed in the shoot apex under a stereofluorescence microscope (Leica, MZFLIII) were transplanted into disposable plant cell culture vessels (Sigma) containing RM medium (4.3 g / L MS salt, MS vitamin, 3% sucrose, 0.50 g / L MES, 3% PPM (plant preservative mixture, Nacalai Tesque), 0.3% Gelrite, pH 5.7) and grown in an incubator (23°C, 16-hour day length).

[0194] 5. Growth of transgenic plants The method described in Example 7-2-(1) is followed. 6.T 0 Confirmation of targeted gene mutation in plant leaves The obtained plant body is examined for the introduction of a mutation in the target gene. Genomic DNA is extracted from a newly grown leaf (50 mg) using the benzyl chloride method, and PCR is performed using this as a template and primers prepared from sequences specific to each gene. PCR / restriction enzyme analysis is performed according to the method described in Example 13-1-(4). The individual with the mutation introduced is cultivated as is, and the next generation seeds are obtained, thereby making it possible to obtain an individual with a stable introduction of a mutation in the target gene.

[0195] [Example 17] Targeted mutation introduction into soybean by introducing Cas9 protein using the gene introduction method For soybean, it is possible to obtain plants with targeted gene mutations by essentially the same method as for wheat, for example, by introducing a complex of gRNA and Cas9 protein targeting the Glyma.10G244400.1 gene into the shoot apex. 1. Preparation of Mature Soybean Seeds This is carried out according to the method described in Example 15-1. 2. Exposure of the shoot apex in mature seed embryos This is carried out according to the method described in Example 15-2.

[0196] 3. gRNA / Cas9 protein delivery Gene transfer into the shoot apex of a mature soybean embryo is carried out using a particle gun method as follows. In the examples, a mixture of crRNA and tracrRNA (Fasmac) (0.5 μg / μL) is used as gRNA. EnGen Cas9 NLS (NEB) derived from Streptococcus pyogenes is used as Cas9 protein. crRNA: GGUGGCGGAGCCUUGGGCGGguuuuagagcuaugcuguuuug (SEQ ID NO: 21) tracrRNA: AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (SEQ ID NO: 19) The shooting conditions are as described in Example 14-1-(3).

[0197] 4. Selection based on transient expression of GFP protein Follow the procedure described in Example 15-4. 5. Growth of transgenic plants Follow the procedure described in Example 15-5. 6.T 0 Confirmation of targeted gene mutation in plant leaves According to the method described in Example 15-6, an individual in which a mutation has been stably introduced into the target gene can be obtained.

[0198] [Example 18] Targeted mutation introduction into rice by introducing Cas9 protein using the gene introduction method For rice, it is possible to obtain mutant plants with target genes by using techniques similar to those used for wheat, such as introducing a complex of gRNA and Cas9 protein targeting the rice phytoene desaturase (OsPDS) gene into the shoot apex of rice plants.

[0199] 1. Preparation of Rice Mature Seeds This is carried out according to the method described in Example 10-1. 2. Exposure of the shoot apex in mature seed embryos This is carried out according to the method described in Example 10-2.

[0200] 3. gRNA / Cas9 protein delivery Gene transfer into the shoot apex of a mature rice embryo is carried out using a particle gun method as follows. In the examples, a mixture of crRNA and tracrRNA (Fasmac) (0.5 μg / μL) is used as gRNA. EnGen Cas9 NLS (NEB) derived from Streptococcus pyogenes is used as Cas9 protein. crRNA: GUUGGUCUUUGCUCCUGCAGguuuuagagcuaugcuguuuug (SEQ ID NO: 22) tracrRNA: AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (SEQ ID NO: 19) The shooting conditions are as described in Example 14-1-(3).

[0201] 4. Selection based on transient expression of GFP protein Follow the procedure described in Example 10-4. 5. Growth of transgenic plants Follow the method described in Example 10-5. 6.T 0 Confirmation of targeted gene mutation in plant leaves According to the method described in Example 15-6, an individual in which a mutation has been stably introduced into the target gene can be obtained.

[0202] [Example 19] Targeted mutation introduction into apple by introducing Cas9 protein using the gene introduction method For apples, it is possible to obtain mutants with targeted genes by essentially the same method as for wheat. For example, a complex of gRNA and Cas9 protein targeting the apple phytoene desaturase (PDS) gene is introduced into the shoot apex of apple.

[0203] 1. Preparation of Apple Shoot Apices Follow the procedure described in Example 11-1. 2. Exposure of the shoot apex Follow the procedure described in Example 11-2. 3. gRNA / Cas9 protein delivery Gene transfer into the shoot apex of apple is carried out using a particle gun method as follows. In the examples, a mixture of crRNA and tracrRNA (Fasmac) (0.5 μg / μL) is used as gRNA. EnGen Cas9 NLS (NEB) derived from Streptococcus pyogenes is used as Cas9 protein. crRNA: ACCUGAUCGAGUAACUACAGguuuuagagcuaugcuguuuug (SEQ ID NO: 23) tracrRNA: AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (SEQ ID NO: 19) The bombardment conditions were the same as those described in Example 14-1-(3), except that the GFP vector described in Example 7-1-(3) was used.

[0204] 4. Selection based on transient expression of GFP protein Follow the procedure described in Example 11-4. 5. Growth of transgenic plants Follow the procedure described in Example 11-5. 6.T 0 Confirmation of targeted gene mutation in plant leaves According to the method described in Example 15-6, an individual in which a mutation has been stably introduced into the target gene can be obtained.

[0205] [Example 20] Targeted mutation introduction into potato by introducing Cas9 protein using the gene introduction method For potato, it is possible to obtain mutant plants with targeted genes by essentially the same method as for wheat. For example, a complex of gRNA and Cas9 protein targeting the StIAA2 (an Auxin / Indole-3-Acetic Acid family member) gene is introduced into the potato shoot apex.

[0206] 1. Preparation of Potato Shoot Apices Follow the method described in Example 9-1. 2. Exposure of the shoot apex Follow the method described in Example 9-2.

[0207] 3. gRNA / Cas9 protein delivery Gene transfer into the potato shoot apex is carried out using a particle gun method as follows. In the examples, a mixture of crRNA and tracrRNA (Fasmac) (0.5 μg / μL) is used as gRNA. EnGen Cas9 NLS (NEB) derived from Streptococcus pyogenes is used as Cas9 protein. crRNA: GAUGUUUAGCUCCUUUACUAguuuuagagcuaugcuguuuug (SEQ ID NO: 24) tracrRNA: AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (SEQ ID NO: 19) The bombardment conditions were the same as those described in Example 14-1-(3), except that the GFP vector described in Example 7-1-(3) was used.

[0208] 4. Selection based on transient expression of GFP protein Follow the procedure described in Example 9-(4). 5. Growth of transgenic plants The method described in Example 1-2-(4) is followed. 6.T 0 Confirmation of targeted gene mutation in plant leaves According to the method described in Example 15-6, an individual in which a mutation has been stably introduced into the target gene can be obtained.

[0209] [Example 21] Targeted mutation introduction into maize by introducing Cas9 protein using the gene introduction method For maize, it is possible to obtain mutant plants with targeted genes by essentially the same method as for wheat, for example, by introducing a complex of gRNA and Cas9 protein targeting the ZmALS2 (maize acetolactate synthase) gene into the maize shoot apex.

[0210] 1. Corn Shoot Apex Preparation The method described in Example 6-1-(1) is followed. 2. Exposure of the shoot apex The method described in Example 6-1-(2) is followed.

[0211] 3. gRNA / Cas9 protein delivery Gene transfer into the corn shoot apex is carried out using a particle gun method as follows. In the examples, a mixture of crRNA and tracrRNA (Fasmac) (0.5 μg / μL) is used as gRNA. EnGen Cas9 NLS (NEB) derived from Streptococcus pyogenes is used as Cas9 protein. crRNA: GCUGCUCGAUUCCGUCCCCAguuuuagagcuaugcuguuuug (SEQ ID NO: 25) tracrRNA: AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (SEQ ID NO: 19) The shooting conditions are as described in Example 14-1-(3).

[0212] 4. Selection based on transient expression of GFP protein According to the method described in Example 1-1-(4), among the individuals transformed with gold particles having a diameter of 0.6 μm, those in which GFP fluorescence is observed in the shoot apical tissue are selected. 5. Growth of transgenic plants The method described in Example 1-2-(4) is followed. 6.T 0 Confirmation of targeted gene mutation in plant leaves According to the method described in Example 15-6, an individual in which a mutation has been stably introduced into the target gene can be obtained.

[0213] [Example 22] Targeted mutation introduction into barley by introducing Cas9 protein using the gene introduction method For barley, it is possible to obtain mutants with targeted genes by using techniques similar to those used for wheat. For example, a complex of gRNA and Cas9 protein targeting the HvPM19 (barley ABA-inducible plasma membrane protein) gene is introduced into the barley shoot apex.

[0214] 1. Preparation of Barley Shoot Apices The method described in Example 8-1-(1) is followed. 2. Exposure of the shoot apex The method described in Example 8-1-(2) is followed.

[0215] 3. gRNA / Cas9 protein delivery Gene transfer into the shoot apex of barley is carried out using a particle gun method as follows. In the examples, a mixture of crRNA and tracrRNA (Fasmac) (0.5 μg / μL) is used as gRNA. EnGen Cas9 NLS (NEB) derived from Streptococcus pyogenes is used as Cas9 protein. crRNA: GCUCUCCACUCUGGGCUCUUguuuuagagcuaugcuguuuug (SEQ ID NO: 26) tracrRNA: AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (SEQ ID NO: 19) The shooting conditions are as described in Example 14-1-(3).

[0216] 4. Selection based on transient expression of GFP protein According to the method described in Example 1-1-(4), among the individuals transformed using gold particles having a diameter of 0.6 μm, those in which GFP fluorescence is observed in the shoot apical tissue are selected. 5. Growth of transgenic plants The method described in Example 1-2-(4) is followed. 6.T 0Confirmation of targeted gene mutation in plant leaves According to the method described in Example 15-6, an individual in which a mutation has been stably introduced into the target gene can be obtained.

[0217] [Example 23] Obtaining transformants in maize using immature maize embryos

[0218] 1. Investigation using a transient expression system of fluorescent proteins as an indicator (1) Preparation of maize immature embryos Immature ears of corn A188 10–20 days after pollination, with 2–5 mm embryos, from which all husks and silks had been removed, were immersed in 70% ethanol for 5 min, then immersed in a solution containing 10% bleach (8.25% sodium hypochlorite) and 0.1% Tween 20 for 20 min, and washed with sterile water. After washing, they were dried in a sterile hood for 5–10 min. Then, a sterilized scalpel was used to remove ¼ kernels from the top of the ear, and a spatula was used to carefully pull out the immature embryos from the kernels. Freshly isolated immature embryos were placed scutellum side down on MSO plates (MSO medium: MS salts, MS vitamins, 2 g / L myo-inositol, 20 g / L sucrose, 8 g / L Bacto-agar, pH 5.8) (Figure 15A). They were incubated at 25 °C for 2 days in light (approximately 50 μmol m -2 s -1 ) and the ones when coleoptiles began to appear were used in the following experiments (Fig. 15B and C).

[0219] (2) Exposure of the shoot apex in immature embryos Under a stereomicroscope, the coleoptile, the first leaf primordium, and the second leaf primordium were removed using microtweezers and a microneedle (33 G NanoPass needle) to completely expose the shoot apex. The left and right scutellum were trimmed so that they could be easily placed on the MSO bombardment plate.

[0220] (3) Gene transfer Gene transfer into the shoot apex of maize immature embryos was carried out using a particle gun method as follows. The transgenes used were plasmid DNA (pGEP359) containing LpCpf1 nuclease expressed using a promoter (ZmUbi1) derived from the maize ubiquitin 1 gene and the fluorescent reporter gene tdTomato expressed using the d35S promoter, and plasmid DNA (pGEP324) containing a guide RNA targeting maize HMG13 and expressed using ZmUbi1. HMG13 target sequence: CTCGTCACGATTCCCCTCTCC (SEQ ID NO:27) 10 mg of 0.4 μm or 0.6 μm gold particles were weighed out, 1 mL of 70% ethanol was added, and the mixture was thoroughly suspended by vortexing. The gold particles were then precipitated by centrifugation, and the ethanol was removed. Then, 1 mL of 50% glycerol was added to obtain a sterilized gold particle solution.

[0221] To each 100 μL of gold particles in 50% glycerol, 10 μL of plasmid DNA solution (1.0 μg of pGEP359 and 1.5 μg of pGEP324) was added. The sterile gold particle-containing solution was thoroughly suspended using an ultrasonic generator before use, and an appropriate amount was added to the above tube and stirred by pipetting. Next, 100 μL of 2.5 M CaCl 2 , and 40 μL of 0.1 M spermidine were added. After mixing, vortexing was continued for 5 to 10 minutes at room temperature or 30 minutes at 4°C. The DNA-coated gold particles were allowed to settle for 1 minute, spun at maximum speed for 5 seconds to remove the supernatant, and washed with 500 μL of 100% ethanol. Finally, the supernatant was removed and 120 μL of 100% ethanol was added to suspend the particles (for 10 bombardments). 10 μL of each solution was poured into the center of the macrocarrier in a clean bench and air-dried.

[0222] The particle gun (gene gun) used was Biolistic (registered trademark) PDS-1000 / He Particle Delivery System (BIO-RAD), and the pressure at the time of shooting was about 94.9 kgf / cm 2(1,350 psi) and the distance to the target tissue was 5 cm (for particles with diameters of 0.6 μm or more) or 3.5 cm (for particles with diameters of less than 0.6 μm). Four shots were fired per dish (Figures 16A and B).

[0223] (4) Investigating the efficiency of transient expression of tdTomato protein Twenty hours after bombardment, tdTomato fluorescence (maximum excitation 554 nm and maximum emission 581 nm) in the shoot apex was observed under a stereofluorescence microscope (Nikon SMZ 18 with a DS-Ri 2 camera) (Figure 16C).

[0224] [Example 24] Effect of osmotic pressure treatment before bombardment on obtaining transformants in maize using maize immature embryos 1. Investigation using a transient expression system of fluorescent proteins as an indicator (1) Preparation of maize immature embryos The method described in Example 23-1-(1) was followed.

[0225] (2) Exposure of the shoot apex in immature embryos The method described in Example 23-1-(2) was followed.

[0226] (3) Gene transfer The method described in Example 23-1-(3) was followed, except that before bombardment, immature embryos were incubated in the dark at 25° C. for 4 hours on osmotic bombardment plates (MSOSM medium: MS salts, MS vitamins, 2 g / L myo-inositol, 20 g / L sucrose, 0.2 M mannitol (36.4 g / L) + 0.2 M sorbitol (36.4 g / L), 15 g / L Bacto-agar, pH 5.8) (FIG. 17A).

[0227] (4) Investigating the efficiency of transient expression of tdTomato protein The method described in Example 23-1-(4) was followed. Compared to the absence of osmotic pressure treatment (Figure 16C), the fluorescence intensity from the tdTomato protein was increased when osmotic pressure treatment was performed for 4 hours before bombardment (Figure 17C). This indicates that osmotic pressure treatment improves the efficiency of transient expression of the fluorescent reporter gene.

[0228] [Example 25] Effects of osmotic treatment before and after bombardment on the production of transformants in maize using immature embryos 1. Investigation using a transient expression system of fluorescent proteins as an indicator (1) Preparation of maize immature embryos The method described in Example 23-1-(1) was followed.

[0229] (2) Exposure of the shoot apex in immature embryos The method described in Example 23-1-(2) was followed.

[0230] (3) Gene transfer The method described in Example 23-1-(3) was followed, except that before bombardment, immature embryos were incubated in the dark on osmotic bombardment plates (MSOSM medium: MS salts, MS vitamins, 2 g / L myo-inositol, 20 g / L sucrose, 0.2 M mannitol (36.4 g / L) + 0.2 M sorbitol (36.4 g / L), 15 g / L Bacto-agar, pH 5.8) at 25°C for 4 hours, and after bombardment, immature embryos were incubated in the dark on osmotic bombardment plates for 20 hours (Figure 18C).

[0231] (4) Investigating the efficiency of transient expression of tdTomato protein The method described in Example 23-1-(4) was followed. Compared to the case where only osmotic pressure treatment was performed for 4 hours before bombardment (Figure 17C), the fluorescence intensity derived from the tdTomato protein was improved when osmotic pressure treatment was performed for 4 hours before bombardment and for 20 hours after bombardment (Figure 18D). This shows that the transient expression efficiency of the fluorescent reporter gene is dramatically improved by osmotic pressure treatment before and after bombardment.

[0232] [Example 26] In planta genome editing in immature maize shoot apical meristems (1) Preparation of maize immature embryos The method described in Example 23-1-(1) was followed.

[0233] (2) Exposure of the shoot apex in immature embryos The method described in Example 23-1-(2) was followed.

[0234] (3) Gene transfer The method described in Example 25-1-(3) was followed. (4) Selection and cultivation based on transient expression of tdTomato protein Twenty hours after bombardment, tdTomato fluorescence (maximum excitation 554 nm and maximum emission 581 nm) in the shoot apex was observed under a stereofluorescence microscope (Nikon SMZ 18 with a DS-Ri 2 camera) (Figure 19A), and embryos with strong fluorescent signals in the shoot apical meristem were selected (Figure 19B). The selected embryos were transferred onto MSO medium in disposable plant cell culture vessels (Sigma) and incubated at 25°C in the light (50-100 μmol m ) for embryo germination and growth. -2 s -1 ) (Figure 19C). Viable seeds with 2-4 leaves were transferred to soil and grown at 25°C in the light (200 μmol m -2 s -1 ) in a growth chamber. A photograph taken 40 days after bombardment is shown in FIG. 19D.

[0235] (5) Evaluation of targeted genome editing Shoot tips of bombarded embryos were sampled with a microNanoPass needle 7 days after bombardment (Figure 20A). Sampled shoot tips were carefully placed into clean 1.7 ml centrifuge tubes (low retention) for DNA extraction. For DNA isolation, DNAzol Direct (Molecular Research Cent, Inc., Chincinnati, OH, USA) was used according to the manufacturer's instructions. Site-specific sequence modifications were assessed using next-generation sequencing (NGS, Illumina Miseq 150 PE platform) as follows (Figures 20B and C).

[0236] (Library Preparation) Libraries were prepared by a two-step PCR that amplifies the target region and adds sequencing adapters: barcodes were designed using primers and added in the first PCR step for sample differentiation, and adapters were added in the second PCR step for sequencing.

[0237] (Next Generation Sequencing (NGS)) Amplicons were determined using an Illumina Miseq 150 PE platform. Bombarded wheat leaf samples were sequenced at 50,000× coverage.

[0238] (Data Analysis) Read QC and demultiplexing were performed using FastQC + Jemultiplexer + Trimmomatic, on-target variation identification was performed using CRISPResso, and event calling was performed using an in-house bash customer script. The entire analysis pipeline was run automatically using an in-house bash customer script.

[0239] NGS results showed that transient expression of Cpf1 (pGEP359) and guide RNA (pGEP324) delivered by biolistic bombardment could produce significant genome editing events in the shoot apical meristem of maize immature embryos (Figure 21). Compared with the non-bombarded control, the bombarded shoot apex contained 14.9% insertion deletion rate (InDel%) at the target site (Figure 21A). NGS results also revealed the chimeric nature of genome editing modifications in the shoot apical meristem, where multiple deletions of various sizes (e.g., 5bp, 6bp, and 8bp) were detected (Figure 21B).

[0240] [Example 27] Corn T 0 In planta genome editing in leaves To evaluate whether the gene transfer method can be used for genome editing of target genes in maize, we attempted to mutagenesis of the hmg13 gene with MAD7. Maize genotype A188 was used for mutagenesis of the hmg13 gene. 1. Confirmation of marker gene (mNeongreen) in the shoot apical meristem after gene introduction (1) Preparation of maize immature embryos The method described in Example 23-1-(1) was followed.

[0241] (2) Exposure of the shoot apex in immature embryos The method described in Example 23-1-(2) was followed.

[0242] (3) Gene transfer After dissection, embryos with exposed shoot apical meristems were transferred to MS-maltose bombardment plates (MS-maltose medium) or to permeabilization bombardment plates (MSOSM medium). The plates were covered with parafilm and incubated in the dark at 25°C for 4 h before bombardment. Gene transfer into the shoot apex of maize immature embryos was carried out using a particle gun method as follows. The transgenes used were plasmid DNA (pGEP837) containing MAD7 nuclease expressed using the promoter (ZmUbi1) derived from the maize ubiquitin 1 gene and the fluorescent reporter gene mNeongreen expressed using the d35S promoter, and plasmid DNA (pGEP842) containing a guide RNA targeting maize HMG13 and expressed using ZmUbi1. HMG13 target sequence: CTCGTCACGATTCCCCTCTCC (SEQ ID NO:27)

[0243] 30 mg of 0.6 μm gold particles were weighed out, 500 μL of 70% ethanol was added, and the mixture was thoroughly suspended using a vortex mixer. The gold particles were then precipitated by centrifugation, and the ethanol was removed. 500 μL of distilled water was then added to obtain a sterile gold particle-containing solution. Plasmid DNA solution (7 μg of pGEP837 and 3 μg of pGEP842) was added to a 1.5 mL test tube. An appropriate amount of sterile gold particle-containing solution, which had been thoroughly suspended using an ultrasonic generator (UW-25 ultrasonic cleaner, manufactured by Taga Electric Co., Ltd.) prior to use, was added to the tube and stirred by pipetting. Next, 25 μL of 2.5 M CaCl per 750 μg of gold particles was added. 2 and 10 μL of 0.1M Spermidine were added to the tube. Immediately after mixing, the resulting mixture was vigorously suspended for 5 minutes using a vortex mixer. The mixture was left at room temperature for 10 minutes, and then centrifuged at 9,100 × g for 2 seconds. The supernatant was removed, and the precipitate was washed with 70% ethanol and then 99.5% ethanol. Finally, the supernatant was removed, and 24 μL of 99.5% ethanol was added and thoroughly suspended. In a clean bench, 6 μL of the suspension was poured into the center of the macrocarrier, and then the macrocarrier was air-dried.

[0244] The particle gun (gene gun) used was Biolistic (registered trademark) PDS-1000 / He Particle Delivery System (BIO-RAD), and the pressure at the time of shooting was about 94.9 kgf / cm 2(1,350 psi) and the distance to the target tissue was 5 cm. Four shots were fired per dish. After bombardment, the samples were left overnight in the dark at 25°C.

[0245] (4) Investigation of the transient expression efficiency of mNeongreen protein 20 hours after bombardment, GFP fluorescence (excitation: 470 / 40, absorption: 525 / 50) in the shoot apex was observed under a stereoscopic fluorescence microscope (Nikon SMZ 18 with a DS-Ri 2 camera) (Figure 22), and the introduction efficiency of the mNeongreen gene in the shoot apex was calculated. Among the immature embryos that underwent the transformation process, those with one or more fluorescent spots observed in the shoot apical tissue were determined to be transgenic individuals. The gene transfer efficiency was then calculated (number of transgenic individuals / number of treated immature embryos x 100). As a result, it was found that the gene transfer efficiency in the shoot apical tissue in the case of MSOSM medium (with osmotic pressure treatment before and after bombardment) (OS1-8) was higher than that in the case of MS-maltose medium (without osmotic pressure treatment) (NT1-9) (Table 13).

[0246] [Table 13]

[0247] (5) Growth of shocked immature embryos All bombarded embryos left overnight were transferred to disposable containers for plant cell culture (Sigma) containing MSO medium and grown under long-day conditions (25°C, 16 h daylight) for 1-2 weeks.

[0248] (6) T 0 Confirmation of targeted gene mutation in plant leaves Genomic DNA was extracted from the third and subsequent leaves using the method described below, and the obtained plants were examined for the presence or absence of a mutation in the target gene.

[0249] - Genomic DNA extraction method - Put leaf tissue (2-5 mm) into a 2 mL tube. 2) was collected, and 300 μL of extraction buffer (20 mM Tris-HCl pH 7.5, 25 mM NaCl, 2.5 mM EDTA, 0.05% SDS) was added to the tube. The tissue was ground using a tissue homogenizer (Geno / Grinder) and centrifuged at 1,700 × g for 10 minutes. 50 μL of the supernatant was collected as the DNA template.

[0250] Using genomic DNA as a template, digital droplet PCR was performed with primers created based on sequences specific to each gene. As a result, when osmotic pressure treatment was performed using MSOSM medium, the obtained T 0 The efficiency of targeted gene mutagenesis in plants (19.6%, OS1-8) was significantly higher than that in MS-maltose medium (2.1%, NT1-9) (Table 13). Furthermore, osmotic treatment increased the proportion of gene-edited plants with high InDel% (70% or more) compared to non-osmotic treatment (Table 14).

[0251] [Table 14]

[0252] [Example 28] Corn T 1 In planta genome editing in leaves T derived from OS1 to OS8 obtained in Example 27-1-(6) 0 The plant body is grown and the next generation, T 1 We confirmed whether the hmg13 gene mutation was inherited in the plants. 8 T's 0 T harvested from the plant 1Seeds were sown and young leaves were sampled. DNA was extracted as described in Example 27-1-(6), and site-specific sequence modification was evaluated using a next-generation sequencer (NGS) (Table 15). As a result, target gene mutations were confirmed in 6 of the 8 lines, and one line was a homozygous mutant. This shows that by using immature maize embryos as a material and subjecting them to osmotic pressure treatment, it is possible to obtain next-generation genome-edited individuals with high efficiency even when using the in planta method.

[0253] [Table 15]

[0254] [Example 29] Effect of osmotic pressure treatment on wheat in planta genome editing We investigated whether the effect of osmotic treatment in in planta genome editing confirmed in Example 27 is also observed in wheat. 1. Confirmation of target gene mutation one week after gene transfer (1) Preparation of ripe wheat seeds Mature seeds of wheat (Triticum aestivum cv. Haruyokoi) were used, and the method of Example 1-1-(1) was followed.

[0255] (2) Exposure of the shoot apex in the mature seed embryo The procedure was carried out in accordance with the method described in Example 1-1-(2).

[0256] (3) Gene transfer Gene transfer into the shoot apex of wheat ripe embryos was performed according to Example 14-1-(3), except that TaGASR7 was used as the target gene and the osmotic treatment was performed according to the method of Example 27-1-(3). (4) Observation of transient expression of GFP protein 20 hours after bombardment, GFP fluorescence (excitation: 470 / 40, absorption: 525 / 50) in the shoot apex was observed under a stereoscopic fluorescence microscope (Leica, MZFLIII). As a result, the intensity of transient expression of GFP protein in mature embryos was increased in the case of MSOSM medium (with osmotic treatment before and after bombardment) compared with the case of MS-maltose medium (without osmotic treatment) (Figure 23).

[0257] (5) Growth of transgenic individuals The transgenic plants were left overnight and transplanted into disposable plant cell culture vessels (Sigma) containing MS-maltose medium and grown under long days (22°C, 16-hour day length). After 2 weeks of growth, when the second and third leaves were observed, the plants were transplanted into pots containing horticultural seedling soil. They were then grown in a long-day artificial climate chamber (24°C, 16-hour day length, humidity 50-70%). (6) T 0 Confirmation of targeted gene mutation in plant leaves The obtained plant was examined for the presence or absence of a mutation in the target gene. The fifth leaf was sampled, and DNA was extracted by the method described in Example 27-1-(6). After DNA extraction, the presence or absence of a mutation in the TaGASR7 gene was examined by the method described in Example 14-2-(5).

[0258] In wild-type strains, the PCR product is completely cleaved by the restriction enzyme, whereas in individuals with mutations, some of the PCR product remains uncleaved. DNA was extracted and purified from the remaining bands and subjected to sequence analysis. Those with mutations in the target gene sequence were determined to be individuals with target gene mutations. As a result, the percentage of T 0 It was found that the efficiency of target gene mutation introduction in leaves was improved (Table 16). Similar to the results in corn in Example 27, the improvement of genome editing efficiency by osmotic pressure treatment was confirmed in wheat as well.

[0259] [Table 16] [Industrial Applicability]

[0260] The present invention can be used in agriculture, the pharmaceutical industry, the enzyme industry, and the like. [Explanation of symbols]

[0261] Al Aleurone layer E endosperm

Claims

1. A method for modifying a plant, comprising the steps of: coating the microparticles with at least one nucleic acid and / or at least one protein; bombarding the plant shoot tip with the coated microparticles; A step of growing the shoot tip shot with the coated microparticles to obtain a plant body; and selecting a modified plant from said plant. The method is characterized in that the shoot apex is the shoot apex of an immature embryo, and the shoot apex of an immature embryo is the shoot apex exposed by removing the endosperm, coleoptile, leaf primordia, and excess scutellum from an immature seed 8 to 35 days after pollination.

2. 10. The method of claim 1, wherein the growth of the shoot tips bombarded with the coated microparticles is carried out in an antibiotic-free medium.

3. The method of claim 1, wherein the growth of the shoot tips bombarded with the coated microparticles is carried out in a medium that does not contain plant hormones.

4. The method of claim 1, wherein the growth of the shoot tips bombarded with the coated microparticles is carried out in an antibiotic- and plant hormone-free medium.

5. The method according to any one of claims 1 to 4, wherein bombarding the shoot apex of the plant is carried out by bombarding L2 layer cells of the shoot apex with the coated microparticles.

6. A method according to any one of claims 1 to 4, wherein the bombarded coated microparticles are present in shoot apical stem cells that transition into the germ cell lineage of the shoot apex.

7. The method according to claim 1 , wherein the microparticles have a diameter of 0.3 μm or more and 1.5 μm or less.

8. A method according to any one of claims 1 to 7, wherein the coating of the microparticles is carried out by coating the microparticles with linear DNA containing a nucleic acid cassette for the purpose of introduction.

9. The method described in claim 8, wherein the linear DNA is a linear plasmid and further comprises nucleic acid of 0.8 kb or more and 1.2 kb or less at both ends of the nucleic acid cassette.

10. A method according to any one of claims 1 to 9, wherein coating the microparticles is carried out by coating the microparticles with a nucleic acid encoding a modifying enzyme.

11. The method according to claim 10, wherein the modifying enzyme is a nuclease or a deaminase.

12. The coating of the microparticles is carried out by coating the microparticles with nucleic acids linked to a promoter and a terminator, 10. The method of any one of claims 1 to 9, wherein the nucleic acid comprises a nucleic acid capable of expressing at least one guide RNA and a nucleic acid encoding a Cas nuclease protein.

13. A method according to any one of claims 1 to 9, wherein coating the microparticles is carried out by coating the microparticles with a nuclease.

14. The method of claim 13, wherein the nuclease is a Cas nuclease.

15. The coating of the microparticles is carried out by coating the microparticles with a protein, 10. The method according to any one of claims 1 to 9, wherein the plant shoot tip bombardment is carried out using a hydrophilic macrocarrier film carrying the protein-coated microparticles.

16. A method according to any one of claims 1 to 15, wherein the plant is selected from the group consisting of wheat, barley, rice, corn, soybean, potato and apple.

17. A method for modifying a plant, comprising the steps of: coating the microparticles with at least one nucleic acid and / or at least one protein; bombarding the plant shoot tip with the coated microparticles; A step of growing the shoot tip shot with the coated microparticles to obtain a plant body; and selecting a modified plant from said plant. The shoot apex is an apex of an immature embryo, and the shoot apex of the immature embryo is an apex exposed by removing endosperm, coleoptile, leaf primordia, and excess scutellum from an immature seed 8 to 35 days after pollination; The method further comprises the step of contacting the shoot tip of the immature embryo with a hypertonic solution.

18. A method for modifying a plant, comprising the steps of: coating the microparticles with at least one nucleic acid and / or at least one protein; bombarding the plant shoot tip with the coated microparticles; A step of growing the shoot tip shot with the coated microparticles to obtain a plant body; and selecting a modified plant from said plant. The shoot apex is (1) the shoot apex of an embryo of a mature seed, (2) the shoot apex of a young shoot, or (3) the shoot apex of an apical or lateral bud; The method further comprises contacting the shoot tip of the embryo of the mature seed, the shoot tip of the shoot tip of the shoot tip of the apical bud or the shoot tip of the lateral bud with a hypertonic solution; The method of claim 1, wherein the step of contacting with a hypertonic solution is performed prior to the step of bombarding the plant shoot tip with the coated microparticles.

19. 20. The method of claim 18, wherein the step of contacting with a hypertonic solution occurs before and after the step of bombarding the plant shoot tip with the coated microparticles.

20. The method of claim 17, wherein the hypertonic solution contains a sugar or sugar alcohol.

21. 21. The method of any one of claims 17 to 20, further comprising growing the modified plant.

22. A genome editing method for targeting a plant genome, comprising: coating the microparticles with at least one nucleic acid and / or at least one protein; bombarding the plant shoot tip with the coated microparticles; A step of growing the shoot tip shot with the coated microparticles to obtain a plant body; and selecting a modified plant from said plant. The shoot apex is an apex of an immature embryo, and the shoot apex of the immature embryo is an apex exposed by removing endosperm, coleoptile, leaf primordia, and excess scutellum from an immature seed 8 to 35 days after pollination; The genome is present in a germline in the shoot apical meristem or in a shoot apical stem cell capable of transferring thereto; The method is characterized in that the genome editing method is an implantation method.

23. 23. The method of claim 22, further comprising growing the modified plant.

24. A method for producing a plant, comprising the steps of: coating the microparticles with at least one nucleic acid and / or at least one protein; bombarding the plant shoot tip with the coated microparticles; A step of growing the shoot tip shot with the coated microparticles to obtain a plant body; and selecting a modified plant from said plant. The method is characterized in that the shoot apex is the shoot apex of an immature embryo, and the shoot apex of an immature embryo is the shoot apex exposed by removing the endosperm, coleoptile, leaf primordia, and excess scutellum from an immature seed 8 to 35 days after pollination.

Images