Solanaceae plant, solanaceae plant cell, and method for producing solanaceae plant resistant to tomato spotted wilt virus

Abstract

The present invention addresses the problem of providing: a solanaceous plant and a solanaceous plant cell that have resistance to tomato spotted wilt virus (TSWV) and that have the property of inhibiting TSWV infection, the property of suppressing the proliferation of TSWV after infection, and / or the property of suppressing the onset of the symptoms of TSWV infection; and a method for producing the solanaceous plant. The present invention provides a solanaceous plant that has resistance to TSWV, in which at least one gene selected from the group consisting of receptor-like kinase RLK genes and homologous genes thereof has a mutation, and in which as a result of the mutation, either the expression of the gene having the mutation is suppressed or a protein encoded by the gene having the mutation is non-functional with respect to TSWV.

Description

Technical Field

[0001] The present invention relates to a solanaceous plant resistant to tomato spotted wilt virus, a solanaceous plant cell, and a method for producing a solanaceous plant.

Background Art

[0002] As the distribution of agricultural products has become active, viral diseases that previously occurred locally have spread throughout the world. Representative examples are viruses belonging to the genus Tospovirus of the Bunyaviridae family and the genus Begomovirus of the Geminiviridae family.

[0003] Tomato spotted wilt virus (hereinafter often abbreviated as "TSWV") is one of the very important plant viruses that have scientific and economic impacts and is ranked within the top five among many plant viruses (see, for example, Non-Patent Document 1).

[0004] Tomato spotted wilt virus is a relatively old plant virus discovered in 1915, but its research has lagged behind that of other viruses because it was difficult to purify complete virus particles. In the 1990s, research finally increased, and it is now classified as the type virus of the genus Tospovirus of the Bunyaviridae family. There are four genera other than the genus Tospovirus in the Bunyaviridae family, and all of these are viruses that infect animals, making it a taxonomically extremely special virus group in which animal viruses and plant viruses belong to the same family (see, for example, Non-Patent Documents 2 and 3).

[0005] TSWV is a spherical virus with an envelope approximately 100 nm in diameter, and inside it contains a three-segmented closed-loop strand-like nucleocapsid. The viral genome also consists of three-segmented single-stranded RNA and basically passes through the gene translation system as a minus strand.

[0006] A major factor contributing to the worldwide prevalence of tospoviruses including TSWV and begomoviruses including Tomato yellow leaf curl virus (TYLCV) is that with the globalization of distribution, important vectors of both viruses have attached to agricultural products including flowers and expanded their distribution.

[0007] TSWV is mainly transmitted by minute insects about 1 mm in body length, thrips. Known thrips species capable of transmission include the soybean thrips, the onion thrips, the citrus thrips, and the western flower thrips. Thrips can acquire TSWV only by sucking sap during the larval stage. Larvae have the ability to transmit even before hatching, but generally, they transmit TSWV during sap sucking after becoming adults. Initially, in Japan, the thrips that transmitted TSWV were native species such as the western flower thrips and the soybean thrips. However, the citrus thrips, known as an important vector of TSWV, invaded Japan from overseas in 1990. As its long-distance movement ability expanded its occurrence and distribution, the occurrence pattern of TSWV changed drastically.

[0008] Since thrips prefer pollen, tospoviruses including TSWV cause great damage to various flower plants and also expand the damage to vegetables cultivated around them. The host range of TSWV is very wide, exceeding 900 plant species. Currently, it occurs worldwide mainly in vegetable and flower plants such as tomatoes, peppers, tobacco, melons, chrysanthemums, dahlias, gerberas, and campanulas (see, for example, Non-Patent Document 4). In addition, TSWV can infect weeds such as Compositae and Polygonaceae, and some of them overwinter and become the infection source for the following year. Tospoviruses tend to become established in plants once infected, and it is difficult to eradicate them.

[0009] Previously, the methods for controlling viruses of the genus Tospovirus, including TSWV, were limited to cultivar countermeasures through resistant breeding, or thorough control to prevent the entry of the vector, the thrips, and the early removal and disposal of TSWV-infected strains. However, thrips are very small insects less than 1 mm in size, and in order to prevent their entry, the field must be isolated with a fine-mesh net, which raises concerns about the increase in temperature within the field, and thus it is not easily implemented at present. Furthermore, thrips prefer pollen and enter the perianth to avoid pesticides, so chemical control has not been an effective means either.

[0010] In addition, as a breeding technique for conferring resistance to TSWV in plants, for example, in 1998, the resistance gene Sw-5 was identified from wild tomato Solanum peruvianum L. and introduced into cultivated varieties (see, for example, Non-Patent Document 5). Sw-5 was a promising resistance gene in tomatoes, but before it could be widely commercialized, TSWV isolates that could overcome the resistance of this gene appeared all over the world (see, for example, Non-Patent Document 6). The same phenomenon has also occurred with the TSWV resistance gene Tsw in Capsicum. Such a phenomenon is often seen in these dominant resistance genes, and there is currently a shortage of useful resistance genes.

[0011] In addition to this, as a genetic engineering technique, a method of conferring virus resistance to plants by so-called genetic recombination, in which a gene encoding the viral coat protein of TSWV or a sequence gene complementary to at least a part of the viral RNA replication intermediate is introduced into the plant genome by genetic manipulation and plant transformation methods, has been developed in tobacco, tomatoes, potatoes, papayas, etc. (see, for example, Non-Patent Documents 7, 8, Patent Documents 1, 2).

[0012] However, the above-mentioned genetically modified plants are still difficult to commercially cultivate in many countries around the world. Also, even in countries where cultivation is possible, a very large number of experimental trials are currently required.

Prior Art Documents

Patent Documents

[0013]

Patent Document 1

Patent Document 2

Non-Patent Documents

[0014]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Non-Patent Document 6

Non-Patent Document 7

Non-Patent Document 8

Summary of the Invention

Problems to be Solved by the Invention

[0015] As described above, the following methods can be mentioned as methods for controlling plant diseases caused by TSWV. (1) Control the thrips that transmit TSWV. (2) Develop TSWV-resistant varieties. (3) Develop TSWV-resistant transgenic plants by genetic recombination. (4) Develop a mild virus that controls TSWV.

[0016] However, the methods (1) and (3) are difficult as described above. Also, regarding the method (4), unless the side effects of the mild virus on plant growth are extremely small or non-existent, it is difficult to put into practical use. So far, no mild virus using TSWV useful for solanaceous vegetables has been developed.

[0017] Under the above background, the present inventors have intensively studied a method for controlling plant diseases caused by TSWV by the method (2) above. As a result, a new resistance gene was discovered, and by developing a plant having this gene as a variety, it is an object to provide a method for controlling TSWV and a TSWV-resistant plant.

Means for Solving the Problems

[0018] The present invention provides the following solanaceous plants, parts thereof, and processed products thereof. [1] A solanaceous plant having at least one gene selected from the group consisting of a receptor-like kinase RLK gene and its homologous genes having a mutation, wherein the expression of the gene having the mutation is suppressed by the mutation, or the protein encoded by the gene having the mutation is non-functional against tomato yellow leaf curl virus and has tomato yellow leaf curl virus resistance. [2] The solanaceous plant according to [1], wherein the mutation is introduced into a gene in the genome by a genome editing technique. [3] The solanaceous plant according to [1] or [2], wherein the mutation is at least one of the following (a) to (d). (a) Frame-shift mutation, (b) Nonsense mutation, (c) Deletion of continuous or non-continuous 3n bases (n = 1-7), and (d) Substitution, deletion, addition, and / or insertion of one or more bases. [4] The solanaceous plant according to any one of [1] to [3], which has a mutation in the receptor-like kinase RLK gene or its homologous gene. [5] The receptor-like kinase RLK gene has a cDNA sequence containing the nucleotide sequence shown in SEQ ID NO: 1, and the homologous gene of the translated receptor-like kinase RLK gene has a nucleotide sequence having a sequence homology of 85% or more with respect to the nucleotide sequence shown in SEQ ID NO: 1. The solanaceous plant according to [4]. [6] The solanaceous plant according to [5], which has a mutation in the region corresponding to the nucleotide sequence shown in SEQ ID NO: 3 within the receptor-like kinase RLK gene or its homologous gene. [7] The solanaceous plant according to [6], wherein the region corresponding to the nucleotide sequence shown in SEQ ID NO: 3 has mutated to the nucleotide sequence shown in SEQ ID NO: 8 or SEQ ID NO: 9. [8] The solanaceous plant according to any one of [1] to [7], which is tomato. [9] A part of the solanaceous plant according to any one of [1] to [8].

[10] A part of the solanaceous plant according to [9], which is a fruit.

[11] A part of the solanaceous plant according to [9], which is a seed.

[12] A processed product of the solanaceous plant according to any one of [1] to

[11] or a part thereof.

[13] The processed product according to

[12] , which is edible.

[0019] Furthermore, the present invention provides the following solanaceous plant cells, as well as solanaceous plants having the same and parts thereof.

[14] At least one gene selected from the group consisting of receptor-like kinase RLK genes and their homologous genes has a mutation, and due to the mutation, the expression of the gene having the mutation is suppressed, or the protein encoded by the gene having the mutation is non-functional against tomato yellow leaf curl virus, and a solanaceous plant cell having resistance to tomato yellow leaf curl virus.

[15] The solanaceous plant cell according to

[14] , wherein the mutation is introduced into a gene in the genome by a genome editing technique.

[16] The solanaceous plant according to

[14] or

[15] , wherein the mutation is at least one of the following (a) to (d). (a) Frame shift mutation, (b) Nonsense mutation, (c) Deletion of 3n consecutive or non-consecutive bases (n = 1 to 7), and (d) Substitution, deletion, addition, and / or insertion of one or more bases.

[17] The solanaceous plant cell according to any one of

[14] to

[16] , which has a mutation in the receptor-like kinase RLK gene or its homologous gene.

[18] The cDNA sequence of the receptor-like kinase RLK gene includes the nucleotide sequence shown in SEQ ID NO: 1, and the cDNA sequence of the homologous gene of the receptor-like kinase RLK gene includes a nucleotide sequence having a sequence homology of 85% or more with respect to the nucleotide sequence shown in SEQ ID NO: 1. The solanaceous plant cell according to

[17] .

[19] The solanaceous plant cell according to

[18] , which has a mutation in a region corresponding to the nucleotide sequence shown in SEQ ID NO: 3 within the receptor-like kinase RLK gene or its homologous gene.

[20] The solanaceous plant cell according to

[19] , wherein the region corresponding to the nucleotide sequence shown in SEQ ID NO: 3 is mutated to the nucleotide sequence shown in SEQ ID NO: 8 or SEQ ID NO: 9.

[21] The solanaceous plant cell according to any one of

[14] to

[20] , wherein the solanaceous plant is tomato.

[22] A solanaceous plant and a part thereof, which have the solanaceous plant cell according to any one of

[14] to

[21] and have resistance to tomato yellow leaf curl virus.

[23] The part of the Solanaceae plant according to

[22] , which is a fruit.

[24] The part of the Solanaceae plant according to

[22] , which is a seed.

[25] A processed product of the Solanaceae plant or a part thereof according to any one of

[22] to

[24] .

[26] The processed product according to

[25] , which is edible.

[0020] Furthermore, the present invention provides a method for producing the following Solanaceae plants and the Solanaceae plants obtained by the production method.

[27] A method for producing a Solanaceae plant resistant to tomato yellow leaf curl virus, comprising a step of selecting at least one gene selected from the group consisting of a receptor-like kinase RLK gene and its homologous genes, a step of introducing, into the selected gene in the genome of the Solanaceae plant, a mutation in which the expression of the selected gene is suppressed, or a mutation in which the protein encoded by the selected gene becomes non-functional against tomato yellow leaf curl virus, and a step of screening a Solanaceae plant resistant to tomato yellow leaf curl virus.

[28] The method for producing a Solanaceae plant resistant to tomato yellow leaf curl virus according to

[27] , wherein the mutation is introduced into the gene in the genome by a genome editing technique.

[29] The method for producing a Solanaceae plant resistant to tomato yellow leaf curl virus according to claim 27 or 28, wherein the mutation is at least one of the following (a) to (d). (a) A frameshift mutation, (b) A nonsense mutation, (c) A deletion of 3n consecutive or non-consecutive bases (n = 1 to 7), and (d) Substitution, deletion, addition, and / or insertion of one or more bases.

[30] The method for producing a Solanaceae plant resistant to tomato yellow leaf curl virus according to any one of

[27] to

[29] , wherein a mutation is introduced into the receptor-like kinase RLK gene or its homologous gene.

[31] The receptor-like kinase RLK gene has a cDNA sequence containing the nucleotide sequence shown in SEQ ID NO: 1, and the homologous gene of the receptor-like kinase RLK gene has a nucleotide sequence having a sequence homology of 85% or more with respect to the nucleotide sequence shown in SEQ ID NO: 1. The method for producing a tomato yellow leaf curl virus-resistant Solanaceous plant according to

[30] .

[32] The method for producing a tomato yellow leaf curl virus-resistant Solanaceous plant according to

[31] , wherein a mutation is introduced into a region corresponding to the nucleotide sequence shown in SEQ ID NO: 3 within the receptor-like kinase RLK gene or its homologous gene.

[33] The method for producing a tomato yellow leaf curl virus-resistant Solanaceous plant according to

[32] , wherein a mutation is introduced so that the region corresponding to the nucleotide sequence shown in SEQ ID NO: 3 becomes the nucleotide sequence shown in SEQ ID NO: 8 or SEQ ID NO: 9.

[34] The method for producing a tomato yellow leaf curl virus-resistant Solanaceous plant according to any one of

[27] to

[33] , wherein the Solanaceous plant is a tomato.

[35] A tomato yellow leaf curl virus-resistant Solanaceous plant obtained by the production method according to any one of

[27] to

[34] .

[0021] Furthermore, the present invention provides a method for producing progeny of Solanaceous plant breeding and a Solanaceous plant obtained by the production method.

[36] A method for producing progeny of a tomato yellow leaf curl virus-resistant Solanaceous plant, comprising the step of self-pollinating or cross-pollinating a tomato yellow leaf curl virus-resistant Solanaceous plant obtained by the production method according to any one of

[27] to

[34] or its progeny.

[37] A tomato yellow leaf curl virus-resistant Solanaceous plant obtained by the production method according to

[36] . [Effect of the Invention]

[0022] According to the present invention, there are provided a TSWV-resistant Solanaceous plant, a Solanaceous plant cell, and a method for producing a Solanaceous plant, which have properties of inhibiting TSWV infection, suppressing the growth of TSWV after infection, and / or suppressing the expression of TSWV infection symptoms.

Brief Description of the Drawings

[0023]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Modes for Carrying Out the Invention

[0024] As a result of intensive studies to solve the above problems, the present inventors have found that solanaceous plants have mutations in the receptor-like kinase RLK gene or its homologous genes, and due to these mutations, the expression of the RLK gene having the mutation or their homologous genes is suppressed, or the protein encoded by the gene having the mutation is non-functional against TSWV, and solanaceous plants have TSWV resistance. Such TSWV-resistant plants are reported for the first time in solanaceous plants.

[0025] Hereinafter, embodiments for carrying out the present invention (hereinafter also referred to as "the present embodiments") will be described in detail. It should be noted that the present invention is not limited to the following present embodiments and drawings, and can be implemented with various modifications within the scope of the gist thereof.

[0026] [I] Solanaceous plants resistant to TSWV In one aspect, the present embodiments relate to Solanaceous plants resistant to TSWV. In the present embodiments, a Solanaceous plant resistant to TSWV is a plant having a property of inhibiting TSWV infection, a property of suppressing TSWV growth even when infected, and / or a property of suppressing the manifestation of TSWV infection symptoms. The Solanaceous plant resistant to TSWV preferably has a property of inhibiting TSWV infection or suppressing TSWV growth even when infected.

[0027] In the present embodiments, the Solanaceous plant is not particularly limited as long as it belongs to the Solanaceae family, and examples include plants belonging to the genus Solanum, Nicotiana, Capsicum, etc. Specifically, tomato ( Solanum lycopersicum ), eggplant ( Solanum melongena ), tobacco ( Nicotiana tabacum ), pepper ( Capsicum annuum ), potato ( Solanum tuberosum ), etc. are mentioned, preferably tomato, eggplant, and potato, and particularly preferably tomato.

[0028] (RLK gene) The Solanaceous plant resistant to TSWV of the present embodiments has a mutation in the receptor-like kinase RLK gene and its homologous genes. The RLK gene is a tomato gene that encodes "Receptor-Like Kinase", that is, receptor-like kinase. RLK is called BAM1 (Barely Any Meristem 1) in Arabidopsis thaliana and encodes a CLAVATA1-related receptor-like kinase protein necessary for shoot and flower meristem functions involved in leaf and gamete formation. In addition, the existence of BAM2, which has a high degree of homology with BAM1 of Arabidopsis thaliana, has been recognized, and in tomatoes as well, the existence of highly homologous homologs has been found from recent research. Such a homolog, when the RLK according to this embodiment is designated as "RLK1" (Solyc02g091840, on chromosome 2), is known as "RLK2". Regarding BAM1 of Arabidopsis thaliana, although it has been suggested to be involved in the relationship with the C4 protein of viruses in the genus Begomovirus of the family Geminiviridae and also in the replication of related viruses, there has been no report so far on the relationship between the RLK of tomatoes and the genus Tospovirus including TSWV.

[0029] In this embodiment, it is preferable that the "RLK gene" has a cDNA sequence containing the nucleotide sequence shown in SEQ ID NO: 1 or consists of the nucleotide sequence shown in SEQ ID NO: 1.

[0030] In this embodiment, the "homologous gene of the RLK gene" preferably has a cDNA sequence containing a nucleotide sequence having sequence homology to the nucleotide sequence shown in SEQ ID NO: 1, or consists of a nucleotide sequence having sequence homology to the nucleotide sequence shown in SEQ ID NO: 1. There is no particular limitation on the homology with the nucleotide sequence of SEQ ID NO: 1, but it is preferably 85% or more and less than 100%. Also, the lower limit value of homology can be any value such as 87% or more, 90% or more, 93% or more, 95% or more, 97% or more, 99% or more, 99.5% or more. The homology between the nucleotide sequence shown in SEQ ID NO: 1 and the cDNA sequence of the homologous gene can be determined by known methods. For example, the homology of nucleotide sequences can be determined using a known homology search program such as BLAST.

[0031] (TSWV resistance gene) In this embodiment, the solanaceous plant has a mutation in at least one gene selected from the group consisting of receptor-like kinase RLK genes and their homologous genes (hereinafter, the gene having the mutation is also referred to as the "TSWV resistance gene"). The mutation suppresses the expression of the gene having the mutation or renders the protein encoded by the gene non-functional against TSWV. A protein that is non-functional against TSWV refers to a protein that cannot be used when TSWV infects and propagates in a plant or a protein that reduces the infection and propagation of TSWV. In one aspect, the TSWV resistance gene may be mutated so as not to encode a protein.

[0032] Without being bound by theory, when TSWV infects a plant, it is considered that a specific RLK among a plurality of RLK isoforms present in the solanaceous plant is used. At this time, if the gene encoding the specific isoform used by TSWV (i.e., the RLK that is functional against TSWV) is mutated so that the specific RLK protein used by TSWV is not produced or the produced RLK protein is non-functional against TSWV, it is considered that the translation of the protein necessary for infection and propagation encoded on the viral genome does not proceed. Alternatively, a TSWV protein that requires interaction with RLK cannot perform its function, and it is considered that the solanaceous plant acquires TSWV resistance by inhibiting the infection and propagation of TSWV.

[0033] On the other hand, even if one of the multiple RLK homologs present in the solanaceous plant is mutated, the plant itself can utilize other homologs or the plant itself can utilize an RLK protein that is non-functional against TSWV. Therefore, it is considered possible to confer TSWV resistance without affecting the growth of the host solanaceous plant. Specifically, the existence of RLK2, which has high homology with RLK1 (Solyc02g091840, on chromosome 2), is known, and it is considered that they exist while complementing each other in the plant.

[0034] As described above, the solanaceous plant having the TSWV resistance gene acquires TSWV resistance. For example, even when 20 days or more have passed since TSWV inoculation, if the accumulation amount of TSWV in the plant body is equal to or less than that of the non-TSWV-inoculated strain, and / or if TSWV infection symptoms cannot be visually confirmed, it can be determined that the plant has "TSWV resistance". Specifically, as shown in the examples described later, TSWV is infected into the plant by a conventional method, and the accumulation of TSWV in the plant body is confirmed by known methods such as ELISA method and reverse transcription PCR method, whereby the TSWV resistance of the plant can be judged. Also, the TSWV resistance of the plant can be judged by confirming the presence or absence of TSWV infection symptoms (such as leaf mosaic, yellowing, thread leaf, dwarfing, and necrosis) of the plant infected with TSWV.

[0035] As long as the solanaceous plant has the above-described TSWV resistance, the gene mutation may be present in at least one gene selected from the group consisting of the receptor-like kinase RLK gene and its homologous genes. Therefore, a solanaceous plant having a mutation in the receptor-like kinase RLK gene and / or its homologous gene may be included in this embodiment.

[0036] Furthermore, in the TSWV-resistant solanaceous plant in this embodiment, when having a mutation in the RLK gene, all the genes encoding the RLK gene protein functional against TSWV may have a mutation. For example, in the case of a polyploid plant such as an allotetraploid, it is preferable that all of the multiple genes encoding the RLK gene protein functional against TSWV have mutated into the TSWV resistance gene. Such a TSWV-resistant solanaceous plant may have other normal RLK gene as long as the gene encoding the RLK gene protein functional against TSWV has mutated. Also, it may be one in which all of the endogenous genes encoding the RLK gene protein functional against TSWV have been deleted, disrupted, etc. and lost their function, and instead an exogenous RLK gene has been introduced.

[0037] That is, all genes encoding any protein functional against TSWV according to the present invention may have mutations, and it is preferable that all genes encoding proteins functional against TSWV have mutated into TSWV resistance genes. Such a TSWV-resistant solanaceous plant may have other normal genes as long as the gene encoding any protein functional against TSWV has mutated. Alternatively, all endogenous genes encoding any protein functional against TSWV may be deleted, disrupted, etc. to lose their function, and foreign homologous genes may be introduced instead.

[0038] In one aspect, the TSWV-resistant solanaceous plant in the present embodiment has mutations in the genes within its genome. Specific examples of gene mutations include the following (a) to (d). (a) Frame shift mutation, (b) Nonsense mutation, (c) Deletion of consecutive or non-consecutive 3n bases (n = 1 to 7), and (d) Substitution, deletion, addition, and / or insertion of one or more bases.

[0039] (a) A frame shift mutation is a mutation in which the reading frame of a codon is shifted due to deletion or insertion of a base, resulting in encoding a different amino acid sequence. Since the encoded amino acid sequence changes, the mutant gene becomes a TSWV resistance gene.

[0040] (b) A nonsense mutation is a mutation in which a codon that originally encoded an amino acid changes to a stop codon, thereby becoming a TSWV resistance gene.

[0041] (c) Due to deletion of consecutive or non-consecutive 3n bases (n = 1 to 7, preferably n = 1 to 3, for example, 3n bases are 3, 6, or 9 bases), the amino acid sequence encoded by the base sequence downstream from the deletion region changes. Because such a change occurs, it becomes a TSWV resistance gene.

[0042] (d) Due to substitution, deletion, addition, and / or insertion of one or more bases, the reading frame of the amino acid sequence encoded by the base sequence downstream of the mutation region changes. Due to the change in the reading frame, the originally encoded amino acid sequence changes, resulting in structural changes in the protein, etc., thus becoming a TSWV resistance gene. In one embodiment, this mutation is preferably a mutation of a base other than the third base of the codon. The number of bases to be substituted, deleted, added, and / or inserted is not particularly limited as long as the TSWV resistance gene can be obtained. For example, it can be 1 to 5, 1 to 3, or 1 to 2.

[0043] The mutation possessed by the TSWV resistance gene is preferably at least one selected from the group consisting of the above (a) to (d). Note that the mutations in (a) to (d) above are not alternative. For example, as a result of the mutations in (c) or (d), the mutations in (a) or (b) may occur.

[0044] The mutation in the genome of the solanaceous plant suppresses the expression of the gene having the mutation or renders the protein encoded by the gene non-functional against TSWV, confers TSWV resistance to the plant having the mutant gene, and is not particularly limited as long as it does not cause a significant impairment to the life and growth of the plant.

[0045] Next, such mutations will be specifically described.

[0046] In one embodiment, when the solanaceous plant has a mutation in the RLK gene, the mutation preferably exists within exon 1 (SEQ ID NO: 2) of the RLK gene, and more preferably exists within the region containing bases 790 to 809 in exon 1, that is, within the region containing TCTCTAGAGTACCTTGCAGT shown in SEQ ID NO: 3. When the solanaceous plant has a mutation in a homologous gene of the RLK gene, the mutation preferably exists within the region corresponding to the base sequence shown in SEQ ID NO: 2 within the homologous gene, and more preferably exists within the region corresponding to the base sequence shown in SEQ ID NO: 3 within the region.

[0047] When a solanaceous plant has a mutation in the region of TCTCTAGAGTACCTTGCAGT shown in SEQ ID NO: 3 or a corresponding region thereto, the mutation is preferably a 5-base deletion or a 1-base insertion. The nucleotide sequences of the regions having such mutations are shown in SEQ ID NOs: 8 and 9, as well as FIGS. 5 and 6. Further, the nucleotide sequence of the RLK gene having the 5-base deletion is shown in SEQ ID NO: 10, and the nucleotide sequence of the RLK gene having the 1-base insertion is shown in SEQ ID NO: 11.

[0048] Note that the mutation possessed by the solanaceous plant is not limited to the above-described region, and mutations may exist in other regions within the RLK gene or in other genes as long as the TSWV resistance is not impaired.

[0049] In one aspect, the mutation of the gene of the solanaceous plant is preferably introduced into the gene in the genome by a genome editing technique such as the CRISPR system described later.

[0050] The mutated gene in the genome may be in a homozygous form present in both of the two alleles or in a heterozygous form present only in one of the alleles, but is preferably in a homozygous form. This is because it is considered that the properties brought about by the mutated gene are more strongly expressed in the homozygous form in which the two alleles are characterized by the same mutated sequence.

[0051] (TSWV-resistant solanaceous plants and parts thereof) The TSWV-resistant solanaceous plant in the present embodiment may be a complex-resistant solanaceous plant that exhibits resistance to other viruses and bacteria as long as it exhibits resistance to TSWV. Specific examples of other viruses include all potyviruses (such as PVY) that infect solanaceous plants, viruses belonging to the genera Bymovirus and Sobemovirus that have VPg similar to PVY at the 5'-end of the viral genome and for which resistance due to mutations in the translation initiation factor has been reported, viruses belonging to the genus Carmovirus for which resistance due to mutations in the translation initiation factor has been reported, and the like.

[0052] In one aspect, the present embodiment relates to a part of a solanaceous plant having resistance to TSWV. The part includes a solanaceous plant having the above characteristics, a part collected from the plant body of its progeny plants or clones, or a derivative obtained from the plant body or part. Specific examples of the part include organs such as fruits, shoots, stems, roots, young branches, and anthers, as well as plant tissues and cells. Such a part may be in any form, and may also be a suspension culture, protoplast, embryo, callus tissue, leaf piece, gametophyte, sporophyte, pollen, and microspore. Examples of derivatives of solanaceous plants include seeds.

[0053] In addition, the part of the solanaceous plant having TSWV resistance in the present embodiment may be a scion, rootstock, etc. used for grafting. In one aspect, the present embodiment also relates to plant cells (including callus) that can regenerate the above-described solanaceous plant having TSWV resistance. The solanaceous plant having TSWV resistance in the present embodiment includes plants obtained from such plant cells.

[0054] The part of the solanaceous plant having TSWV resistance is preferably a fruit that is useful for raw consumption or processing. Also, since it is useful for the production of progeny, etc., the part is preferably a seed.

[0055] (Processed product of solanaceous plant or its part) In one aspect, the present embodiment relates to a processed product of a solanaceous plant or its part. The processed product is not particularly limited, and examples include processed products for food, industrial use, medical use, etc., and particularly preferably a processed product for food.

[0056] For example, when the solanaceous plant having TSWV resistance is a tomato, examples of edible processed products of tomatoes include canned tomatoes, tomato paste, ketchup, tomato sauce, tomato soup, dried tomatoes, tomato juice, tomato powder, tomato concentrate, etc. Also, nutritional supplements (supplements) using tomatoes as raw materials are also an example of processed products.

[0057] [II] Solanaceous plant cells having TSWV resistance In one aspect, the present embodiment relates to a solanaceous plant cell having resistance to TSWV.

[0058] The solanaceous plant cell of the present embodiment has a mutation in at least one gene selected from the group consisting of a receptor-like kinase RLK gene and its homologous genes. These genes and their mutations are as described above in relation to solanaceous plants resistant to TSWV.

[0059] The TSWV resistance of the solanaceous plant cell can be confirmed by the method described above. For example, by infecting the plant cell with TSWV by a conventional method and detecting the accumulation of TSWV in the cell by a known method such as ELISA or reverse transcription PCR, the presence or absence of TSWV resistance can be confirmed.

[0060] The TSWV-resistant solanaceous plant cell of the present embodiment may be isolated from the above-described solanaceous plant resistant to TSWV and its progeny plants or cloned plant bodies or parts, or may be a plant cell into which a gene mutation has been introduced obtained by the method for producing a solanaceous plant resistant to TSWV described later. Furthermore, the form of the TSWV-resistant solanaceous plant cell is not particularly limited, and includes suspension cultures and protoplasts.

[0061] The type of the plant cell is not particularly limited as long as it is a cell of a solanaceous plant, but it is preferably a cell of tomato, eggplant, tobacco, pepper, or potato, more preferably a cell of tomato, eggplant, or potato, and even more preferably a cell of tomato.

[0062] In one aspect, the present embodiment relates to a solanaceous plant body and a part thereof having the above-described solanaceous plant cell and having resistance to TSWV. The solanaceous plant body and its part include parts such as a plant body or tissue or organ regenerated from a plant cell into which a gene mutation has been introduced. The part of the plant body regenerated from the plant cell is also a part having the above-described solanaceous plant cell. Note that the details of the part are as described above in relation to the solanaceous plant resistant to TSWV.

[0063] In addition, the part of the Solanaceae plant is preferably a fruit that is useful for raw consumption or processing. Also, since it is useful for the production of progeny and the like, the part is preferably a seed.

[0064] In one aspect, the present embodiment relates to a processed product of a Solanaceae plant or a part thereof. The processed product is not particularly limited, and examples include processed products for food, industrial use, medical use, etc., and particularly preferably a processed product for food.

[0065] [III] Method for producing a Solanaceae plant resistant to TSWV In one aspect, the present embodiment relates to a method for producing a TSWV-resistant Solanaceae plant of the present invention. Specifically, it relates to a production method including the following steps. A step of selecting at least one gene selected from the group consisting of a receptor-like kinase RLK gene and its homologous genes; A step of introducing a mutation in which the expression of the selected gene is suppressed, or a mutation in which the protein encoded by the selected gene becomes non-functional against TSWV, into the selected gene in the genome of the Solanaceae plant; A step of screening for a Solanaceae plant having resistance to TSWV.

[0066] First, a target gene into which a mutation is to be introduced is selected. At least one gene selected from the group consisting of a receptor-like kinase RLK gene and its homologous genes is selected as the target gene. The gene to be selected may be one kind, or a combination of two or more genes. These genes are as described above in relation to TSWV-resistant Solanaceae plants.

[0067] Next, a mutation is introduced into the selected gene. As methods for introducing a mutation into a gene in the genome, roughly speaking, the following two methods can be exemplified. (1) Direct genome editing: A method of directly editing the genome of a plant having an RLK functional against TSWV to introduce a mutation pinpointedly at a target site and produce a plant having a TSWV resistance gene. (2) Introduction of mutant gene: This is a method that combines the following procedures (A) and (B). (A): Prepare a TSWV resistance gene and introduce it into a plant using an appropriate promoter. (B): Among the endogenous genes in the plant that correspond to the TSWV resistance gene prepared in (A) above, make the gene that is functional against TSWV non-functional against TSWV. The following will explain each method.

[0068] (1) Direct genome editing Direct genome editing can be carried out using known genome editing techniques that use site-specific nucleases such as CRISPR and TALEN. When a double-strand break is introduced using a restriction enzyme that can cleave a specific site in the genome, various mutations are introduced due to repair errors when this is repaired. As a result, mutations are introduced into the target gene (in this embodiment, the gene encoding RLK that is functional against TSWV).

[0069] Since mutations can be introduced with particularly high specificity and high efficiency, it is preferable to use the CRISPR system, and it is particularly preferable to use the CRISPR / Cas9 system. In the CRISPR / Cas9 system, a guide RNA (sgRNA) containing a sequence of about 20 bases complementary to the target gene recognizes the target, the Cas9 protein cleaves the double strand, and when this is repaired by the non-homologous end joining (NHEJ) repair pathway, mutations are introduced into the target site due to repair errors.

[0070] Delivery of the Cas9 protein and sgRNA to the plant can be carried out using methods known to those skilled in the art, such as the Agrobacterium method, standard transfection methods, electroporation methods, particle bombardment methods, etc., via vectors encoding them.

[0071] For simplicity, as shown in the examples described below, a binary vector incorporating the Cas9 gene and sgRNA is constructed, and after transforming Agrobacterium using this vector, the plant can be transformed using this Agrobacterium to deliver Cas9 protein and sgRNA to the plant (see Friedrich Fauser et al., "The Plant Journal," 2014, 79: 348-359, and Ryo Oze and Hiroshi Emine, "Let's Understand New Plant Breeding Techniques - NBT (New plant breeding techniques)", Kokusai Bunken Sha, 2013, etc.).

[0072] The form of the plant to be transformed by Agrobacterium is not particularly limited as long as the plant body can be regenerated. Examples include suspension-cultured cells, protoplasts, leaf sections, callus, etc. After removing Agrobacterium, it can be cultured in a medium containing a drug corresponding to the vector used, and selection culture of the section into which the target gene has been incorporated can be performed using drug resistance as an index.

[0073] The guide RNA can be designed so that mutations can be introduced into the target site with high efficiency. In the CRISPR system, the three bases immediately before a three-base sequence called the PAM sequence (NGG in the case of using Cas9 derived from S . pyogenes is basically cleaved. Since the PAM sequence needs to be present immediately after the target sequence, the guide RNA can be designed with the upstream of the PAM sequence as the target sequence.

[0074] In the design of the guide RNA, it is preferable to consider the GC content because the higher the GC content of the base sequence, the higher the cleavage efficiency. Also, it can be designed to minimize non-specific cleavage due to off-target effects.

[0075] In FIG. 1 showing the cDNA sequence (SEQ ID NO: 1) of the RLK gene present on chromosome 2 of tomato, the portion indicated by the square present in exon 1 (the underlined portion in FIG. 1, SEQ ID NO: 2) is used as the PAM sequence, and a guide RNA can be designed targeting the normal 20 bases (SEQ ID NO: 3) upstream from these 3 bases. When directly performing genome editing on other plants of the Solanaceae family, as in the case of tomato, a region corresponding to the nucleotide sequence shown in SEQ ID NO: 3 within the homologous gene of the RLK gene is selected as the target, and the PAM sequence can be selected and the guide RNA can be designed. By introducing mutations into the target site in this way, plants having the RLK gene with TSWV resistance can be produced.

[0076] When a double-strand break is introduced at one location within a gene by the CRISPR system, it is considered that about 20 bases are repaired and mutations are introduced due to repair errors. Therefore, in one aspect, the mutations possessed by the TSWV resistance gene of the present embodiment are mutations of 3n bases (n = 1 to 7, preferably 1 to 3) that are continuous or non-continuous.

[0077] Furthermore, the present embodiment also relates to the guide RNA used for producing the above-described TSWV-resistant Solanaceae plant and a vector containing the guide RNA. The sequence possessed by the guide RNA is as described above. The present embodiment further relates to a kit containing the above-described guide RNA. The kit may contain a site-specific nuclease or the like necessary for performing genome editing by the CRISPR system and can be used for producing a TSWV-resistant Solanaceae plant.

[0078] (2) Mutant gene introduction Mutant gene introduction is a method that combines the following procedures (A) and (B). (A): Prepare a TSWV resistance gene and introduce it into a plant using an appropriate promoter. (B): Among the endogenous genes of the plant corresponding to the TSWV resistance gene prepared in (A) above, make the gene that is functional against TSWV non-functional against TSWV. The order of carrying out the above (A) and (B) is not particularly limited as long as the plant does not die, and (B) may be carried out first. Note that the method of carrying out only (B) at a specific site is the above (1) direct genome editing.

[0079] In step (A), a mutant gene encoding an RLK protein non-functional against TSWV is prepared and introduced into a plant using an appropriate promoter. The preparation of the mutant gene can be carried out using methods known to those skilled in the art. For example, a nucleotide sequence having a desired mutation can be synthesized and obtained by amplifying it by PCR or the like. The mutation introduced here is as described above in relation to TSWV-resistant solanaceous plants.

[0080] The introduction of the prepared mutant gene into a plant can also be carried out using methods known to those skilled in the art. For simplicity, using a vector carrying the mutant gene, for example, it can be carried out using the polyethylene glycol method, the electroporation method, the Agrobacterium method, the particle gun method, etc. The mutant gene introduced here is a TSWV-resistant gene obtained by mutating an RLK gene (or its homologous gene) derived from a solanaceous plant, and it may also be a TSWV-resistant gene of another plant species.

[0081] The form of the plant into which the above vector is introduced is not particularly limited as long as it can regenerate a plant body, and examples include suspension culture cells, protoplasts, leaf sections, callus, etc.

[0082] Next, in step (B), among the endogenous RLK genes (or their homologous genes) possessed by the plant, those functional against TSWV are changed to those non-functional against TSWV. For the implementation of step (B), methods known as methods for introducing mutations into plants can be used. For example, mutagenesis treatments such as ion beams and EMS can be used. It can also be carried out by genome editing techniques such as the above-mentioned CRISPR and TALEN. It is desirable to make all of those functional against TSWV among the endogenous RLKs non-functional against TSWV.

[0083] Next, a plant is regenerated from a part of a plant (such as a leaf blade or a plant cell) having a TSWV resistance gene. The regeneration of the plant can be carried out by a method known to those skilled in the art according to the type of the plant. For example, for tomatoes, reference can be made to Sun H.J. et al., "Plant Cell Physiol.", 2006, 47: 426, etc., and for tobacco, reference can be made to Jefferson R.A. et al., "EMBO J.", 1987, 6: 3901, etc.

[0084] Furthermore, from the regenerated plants, a Solanaceae plant having resistance to TSWV is selected. The selection can be carried out by the method for confirming the TSWV resistance described above. For example, a plant is infected with TSWV by a conventional method, and the accumulation of TSWV in the plant body is confirmed by a known method such as the ELISA method or reverse transcription PCR method, whereby a plant having TSWV resistance can be selected. Also, by confirming the presence or absence of TSWV infection symptoms (such as leaf mosaic, yellowing, thread leaves, dwarfing, and necrosis) in the plant infected with TSWV, a Solanaceae plant having resistance to TSWV can also be selected.

[0085] Examples of the Solanaceae plant produced by the above method include tomato, eggplant, tobacco, pepper, and potato, preferably tomato, eggplant, and potato, and particularly preferably tomato.

[0086] In one aspect, the present embodiment relates to a Solanaceae plant produced by the method described above. The Solanaceae plant is the same as the TSWV-resistant Solanaceae plant described above.

[0087] Once a TSWV-resistant Solanaceae plant having a TSWV resistance gene is obtained, progeny and clones of the plant can be obtained by known techniques. Therefore, the TSWV-resistant Solanaceae plants of the present embodiment also include these progeny and clones.

[0088] In one aspect, the present embodiment relates to a method for producing breeding progeny of a TSWV-resistant solanaceous plant, including the step of self-pollinating or cross-pollinating a TSWV-resistant solanaceous plant (primary generation) obtained by the above-described production method or its progeny. Self-pollination or cross-pollination of a plant can be carried out by methods known in the art and may be carried out naturally or artificially. The progeny thus obtained can be further self-pollinated or cross-pollinated to produce further progeny.

[0089] Recessive resistance does not exhibit immune resistance like dominant resistance and may sometimes allow virus infection, movement, or proliferation. However, unlike dominant resistance in which resistance is established by the ligand-receptor reaction between a virus-specific gene and a plant-specific gene, the infection rate is significantly suppressed because host factors essential for virus infection and proliferation become unavailable due to mutation. Recessive resistance is considered suitable for sustainable breeding as an effect different from dominant resistance, in which resistance is broken by a slight mutation of the virus.

Examples

[0090] <Mutant production> [Example 1] · Preparation of recombinant Agrobacterium for introducing a mutation into the RLK gene A site recognized by the guide RNA was arbitrarily set within exon 1 (SEQ ID NO: 2) of the RLK gene (Solyc02g091840) supposed to be present on chromosome 2 of tomato. A double-stranded DNA corresponding to the set 20-base-long site (SEQ ID NO: 3: TCTCTAGAGTACCTTGCAGT) was synthesized and inserted into the restriction enzyme BbsI site in the vector pUC19_AtU6oligo (obtained from the National Institute of Agrobiological Sciences, Japan), and a recombinant vector was constructed. The cDNA sequence of the RLK gene present on chromosome 2 of the wild-type tomato is shown in FIG. 1 and SEQ ID NO: 1.

[0091] A cassette portion containing the guide RNA sequence region was excised from the constructed recombinant vector and inserted into the restriction enzyme I-SceI site in the binary vector pZD_OsU3gYSA_HolgerCas9_NPTII to obtain a recombinant binary vector. This binary vector was used to transform Agrobacterium LBA4404 (manufactured by Takara Bio Inc.) in a conventional manner to obtain a recombinant Agrobacterium.

[0092] [Example 2] ·Transformation of tomato The tomato to be transformed was the well-known variety Manny Maker or our own variety S. Tomato transformation using Agrobacterium was carried out according to the method described in a general textbook (for example, "Protocols for plant transformation" edited by Yutaka Tabei, Kagaku Dojinsha, 2012). Specifically, cotyledon pieces obtained by germinating tomato seeds in a sterile medium, or cotyledon pieces or primary leaves sown in a normal manner were sterilized and prepared. Next, a culture solution was prepared in which the recombinant Agrobacterium obtained in Example 1 was cultured until the turbidity reached 0.1 to 1.0, and the leaf pieces were immersed in the culture solution for about 10 minutes to be infected with Agrobacterium.

[0093] Three days after infection, the Agrobacterium was removed. Tomato leaf pieces were transferred onto Murashige and Skoog medium (hereinafter sometimes abbreviated as "MS basal medium"; MS basal medium supplemented with 3% sucrose, 1.5 mg / L zeatin, and 1% agar) supplemented with carbenicillin (100-500 mg / ml) and kanamycin (20-100 mg / ml) and subjected to selective culture under illumination at 25°C (16 hours of light / 8 hours of darkness). Callus formation from the leaf pieces was promoted by replacing the medium every 10 days to 2 weeks from the start of culture and subculturing the transplants. Adventitious buds were induced by subsequent repeated subculturing.

[0094] When the adventitious buds grew to about several centimeters in size, they were transplanted onto a rooting medium (MS basal medium supplemented with 1.5% sucrose, 1% agar, 50 - 250 mg / ml carbenicillin, 20 - 100 mg / ml kanamycin, and in some cases, naphthaleneacetic acid (NAA)), and cultured for 1 - 3 months with subculture every month.

[0095] All cultures were carried out under aseptic conditions until culturing on the rooting medium. The rooted individuals were taken out from the aseptic medium and transplanted into potting soil mixed with commercially available black soil, red lava soil, etc., and grown. The regenerated individuals obtained in this way were designated as transgenic T0 generation (hereinafter sometimes abbreviated as "T0").

[0096] [Example 3] ·Selection of gene - edited lines To confirm whether there were gene recombination and editing (base deletion, insertion or substitution) sites in the target gene of the transgenic T0 generation, the target site was amplified by PCR using the following primers. For the region within RLK (Solyc02g091840), primer 1 (TTAACACGTCTGCGTAACCTC (SEQ ID NO: 4)) and primer 2 (CCGGTGAAGGTATTGTAGTATCC (SEQ ID NO: 5)). For PCR, "KOD Plus Neo" manufactured by Toyobo Co., Ltd. was used, and DNA amplification was carried out according to the attached manual.

[0097] Next, the amplified fragment was treated with a restriction enzyme having a restriction enzyme cleavage site within the target site, specifically, XbaI, to confirm whether the amplified fragment was cleaved. In the gene where gene recombination and editing occurred, the restriction enzyme site had changed, so the amplified fragment was not cleaved by the restriction enzyme. Based on this, it was determined that gene recombination and editing had occurred within the target gene (data not shown).

[0098] As a result, in several regenerated individuals, it was confirmed that the sequence of the RLK gene was edited, and edited lines were selected. The selected RLK - edited line was named the C74 line.

[0099] The selected individuals of the edited line (T0) were grown in an isolated greenhouse, self-pollinated, and seeds were collected. Transgenic progeny (T1) were collected. The seeds of T1 were further self-pollinated, and the collected progeny seeds were designated as the T2 generation.

[0100] [Example 4] [TSWV Inoculation Test] ·Method The T2 generation of the C74 line, which is an RLK-edited line obtained in Example 3 above, was sown to obtain tomato seedlings about 10 cm tall. The obtained tomato seedlings were mechanically inoculated with a ground crude sap of TSWV-infected leaves. As the ground crude sap of TSWV-infected leaves (also referred to as the crude virus sap), Nicotiana rustica (tobacco) inoculated with TSWV and grown, 0.5 g of the infected leaves at the onset of necrotic spots were collected and frozen at -80°C, ground in 0.05 M phosphate buffer (pH 7.0, containing 10 mM sodium sulfite), and diluted 10 - 20 times was used. Also, mechanical inoculation was performed by soaking a cotton swab with the crude virus sap and rubbing it on the first or second true leaf of the tomato together with celite (No. 454). As a control plant, variety S8, which is the wild type (WT) before mutation, was used.

[0101] Fifteen to thirty days after inoculation with the crude virus sap, visual observation of disease symptoms was carried out to determine positive mosaic, yellowing, and esca symptoms on the inoculated leaves and upper leaves.

[0102] Furthermore, leaves near the growing point (about 0.1 g each) were sampled, and total RNA was extracted from them using the PLANT TOTAL RNA mini kit (manufactured by VIOGENE). Using the total RNA as a template, cDNA was synthesized by reverse transcription with the Primescript II 1ST Strand cDNA synthesis kit (manufactured by Takara Bio Inc.). Furthermore, using primer 3 for detecting Tospovirus (5'-CTGTARTGKTCCATWGCARCA (SEQ ID NO: 6)) and primer 4 (5'-GAYATGACYTTCMGAAGRCTTGAT (SEQ ID NO: 7)), which are based on sequences common to Tospovirus, and GO Taq Green master polymerase (manufactured by Promega), PCR was performed (conditions: 95°C for 2 minutes: 94°C for 30 seconds - 56°C for 40 seconds - 72°C for 45 seconds, 31 cycles: 72°C for 3 minutes) to obtain an amplification product. The obtained amplification product was subjected to 1% agarose gel electrophoresis to confirm the infection with TSWV.

[0103] The above inoculation test was repeated three times. In the first test, symptom observation and RT-PCR were performed 25 days after inoculation. In the second test, symptom observation and RT-PCR were performed 27 days after inoculation. In the third test, only symptom observation was performed 25 days after inoculation.

[0104] · Results Figure 2 shows the results of RT-PCR of the first test of the C74 line and the wild-type tomato without introduced mutations as a control. M in the figure is a molecular weight marker, P is a positive control, N is a negative control. The lane on the left side of M is the C74 line, and the right side is the control. As the control, those without symptoms and those with observed symptoms were arbitrarily analyzed. In Figure 2, the upper band indicates the presence of the virus. Figure 3 shows the results of RT-PCR of the second test of the C74 line and the wild-type tomato without introduced mutations as a control. M in the figure is a molecular weight marker, P is a positive control, N is a negative control, and Mo is Mock (inoculated with buffer only). The lane marked "C74" below is the C74 line, and the lane marked "Cont" is the control. The upper band indicates the presence of the virus.

[0105] The ratio of the total number of plant individuals showing disease symptoms (such as leaf mosaic, yellowing, and esophagus symptoms) and the number of plant individuals showing positive results by PCR to the number of inspected plant individuals (number of test samples) was defined as the disease incidence rate and is shown in Fig. 4. The numbers in () in the figure are the number of test samples. As is clear from Fig. 4, the disease incidence rate of the control was as high as over 0.5 to 0.8, while the disease incidence rate of the RFL editing line C74 was less than 0.4 even at its highest. Note that the test method implemented here has a higher infection pressure than virus infection by natural insect vectors in nature. Therefore, a disease incidence rate of less than 0.4 in this test is estimated to be a value at which virus infection does not occur in nature.

[0106] [Example 5] [Confirmation of Mutation Pattern] · Method 0.1 g of true leaves was collected from the T1 generation of the C74 line, and total DNA was extracted using a MonoFas Plant DNA Extraction Kit (manufactured by GL Sciences Inc.). Next, using the extracted DNA as a template, primer 1 (5’-TTAACACGTCTGCGTAACCTC (SEQ ID NO: 4)) and primer 2 (5’-CCGGTGAAGGTATTGTAGTATCC (SEQ ID NO: 5)) for RLK detection, as well as KOD FX-Neo (manufactured by Takara Bio Inc.), PCR was performed under the conditions of "95°C for 2 minutes: 98°C for 10 seconds - 60°C for 20 seconds - 68°C for 15 seconds, 31 cycles: 72°C for 3 minutes" to obtain an amplification product. Using a TA cloning kit TArgetClone (manufactured by Toyobo Co., Ltd.), the amplification product was cloned into a cloning plasmid, and the nucleotide sequence of the amplification product was determined by sequencing.

[0107] · Results Two types of mutation patterns were detected from the amplified region. One is a 5-base deletion in the C74-1 line, and the other is a 1-base insertion in the C74-7 line. The confirmed base sequences are shown in Figures 5(A) and 5(B) together with the wild-type base sequence. In Figure 5, "RLKwt" is the wild type, and below it are the sequences of each clone. The "CCG" shown in the white box is the PAM sequence, and the part shown in the gray box is the 20 bases recognized by the guide RNA (however, the actual guide RNA recognizes the complementary strand (reverse strand) of this sequence). Also, in Figure 6, the wild type, the mutant region of the C74-1 line (mutation region R-A), and the mutant region of the C74-7 line (mutation region R-B) are shown side by side. The underline in the figure represents the mutation site, and "·" represents the absence (deletion) of a base.

[0108] This application claims priority based on Japanese Patent Application No. 2019-232766 filed on December 24, 2019. All of the contents described in the application specification are incorporated herein by reference.

Industrial Applicability

[0109] The present invention provides a TSWV-resistant solanaceous plant, a solanaceous plant cell, and a method for producing a solanaceous plant, which have the property of inhibiting TSWV infection, the property of suppressing the growth of TSWV after infection, and / or the property of suppressing the expression of TSWV infection symptoms. According to the present invention, problems mainly in the agricultural field, such as a reduction in the yield of solanaceous plants due to TSWV infection, can be solved.

Sequence Listing Free-Text

[0110] SEQ ID NO: 1 is the cDNA sequence of the RLK gene (Solyc02g091840), and bases 1 to 2818 are exon 1, and bases 790 to 809 are the target sequence. SEQ ID NO: 2 is exon 1 of the RLK gene, and bases 790 to 809 are the target sequence. SEQ ID NO: 3 is the target sequence within exon 1 of the RLK gene SEQ ID NO: 4 is primer 1 for detecting the RLK gene SEQ ID NO: 5 is primer 2 for detecting the RLK gene SEQ ID NO: 6: Primer 3 for detecting Tospovirus genus SEQ ID NO: 7: Primer 4 for detecting Tospovirus genus SEQ ID NO: 8: Mutation region R-A of RLK gene SEQ ID NO: 9: Mutation region R-B of RLK gene SEQ ID NO: 10: cDNA sequence of mutant RLK gene, where bases 790 to 804 are the mutation region R-A SEQ ID NO: 11: cDNA sequence of mutant RLK gene, where bases 790 to 810 are the mutation region R-B

Claims

1. The receptor-like kinase RLK gene has a mutation, The receptor-like kinase RLK gene has a cDNA sequence comprising the base sequence shown in SEQ ID NO:1, the mutation is present in a region in the base sequence shown in SEQ ID NO:1 that corresponds to the base sequence shown in SEQ ID NO:3, and the region corresponding to the base sequence shown in SEQ ID NO:3 is mutated to the base sequence shown in SEQ ID NO:8 or SEQ ID NO:9, the expression of the gene having the mutation is suppressed by the mutation, or the protein encoded by the gene having the mutation is non-functional against Tomato spotted wilt virus; A Solanaceae plant that has resistance to Tomato spotted wilt virus.

2. The solanaceae plant according to claim 1 , wherein the mutation is introduced into a gene in the genome by genome editing technology.

3. The solanaceae plant according to claim 1 or 2, wherein the mutation is at least one of the following (a) to (d): (a) a frameshift mutation, (b) a nonsense mutation, (c) a consecutive or non-consecutive deletion of 3n bases (n = 1 to 7); and (d) Substitution, deletion, addition, and / or insertion of one or more bases.

4. The solanaceae plant according to any one of claims 1 to 3, which is a tomato.

5. A part of a Solanaceae plant described in any one of claims 1 to 4.

6. 6. The part of a Solanaceae plant according to claim 5, which is a fruit.

7. 6. The solanaceae plant part of claim 5 which is a seed.

8. A processed product made from a solanaceae plant according to any one of claims 1 to 4 or a part of a solanaceae plant according to any one of claims 5 to 7.

9. The processed product according to claim 8, which is edible.

10. The receptor-like kinase RLK gene has a mutation, The receptor-like kinase RLK gene has a cDNA sequence comprising the base sequence shown in SEQ ID NO:1, the mutation is present in a region in the base sequence shown in SEQ ID NO:1 that corresponds to the base sequence shown in SEQ ID NO:3, and the region corresponding to the base sequence shown in SEQ ID NO:3 is mutated to the base sequence shown in SEQ ID NO:8 or SEQ ID NO:9, the expression of the gene having the mutation is suppressed by the mutation, or the protein encoded by the gene having the mutation is non-functional against Tomato spotted wilt virus; A Solanaceae plant cell having resistance to Tomato spotted wilt virus.

11. The solanaceae plant cell of claim 10, wherein the solanaceae plant is tomato.

12. A solanaceae plant or part thereof, which has a solanaceae plant cell according to claim 10 or 11 and has resistance to Tomato spotted wilt virus.

13. A method for producing a breeding progeny of a Tomato spotted wilt virus-resistant Solanaceae plant, the method comprising a step of self-pollinating or cross-pollinating the Tomato spotted wilt virus-resistant Solanaceae plant or its progeny described in any one of claims 1 to 4.

14. A Solanaceae plant resistant to Tomato spotted wilt virus obtained by the production method described in claim 13.

Images