Compositions and methods for extending the shelf life of bananas

Abstract

Compositions and methods for extending the shelf life of bananas are provided. A banana plant is provided, the genome of which includes a loss-of-function mutation in a nucleic acid sequence encoding a component in the ethylene biosynthetic pathway of the banana. Also provided is a method for extending the shelf life of bananas, comprising the steps of: (a) subjecting banana plant cells to a DNA editing agent directed to a nucleic acid sequence encoding a component in the ethylene biosynthetic pathway of the banana to create a loss-of-function mutation in the nucleic acid sequence encoding the ethylene biosynthetic pathway; and (b) regenerating a plant from the plant cells.

Description

Technical Field

[0001] In some of its embodiments, the present invention relates to compositions and methods for extending the shelf life of bananas.

Background Art

[0002] Cultivated bananas and plantains are giant herbs belonging to the genus Musa. They are sterile and parthenocarpic, so the fruits develop without seeds. The cultivated hybrids and species are mostly triploid (2n = 3x = 33; some are diploid or tetraploid), and most have been propagated from mutants found in the wild.

[0003] Bananas are one of the top 10 food crops in the world. Bananas can be eaten raw or cooked depending on the cultivar. Approximately 60% of bananas are eaten raw as dessert fruits, and the other 40% are cooked by processes such as steaming, boiling, roasting, and frying. More than 120 million tons of banana fruits are produced annually, and the three major producing countries, India, Uganda, and China, consume almost all of what they produce domestically.

[0004] Bananas belong to the climacteric type of fruits. After harvest, green bananas need to undergo climacteric changes through their ripening process, including the production of endogenous ethylene, hydrolysis of starch and protopectin, etc., until the pulp becomes soft, the sweetness increases, and aroma substances are produced, and then the dietary value can be enhanced.

[0005] Conventionally, bananas were harvested in advance, and the period of their transportation and storage was extended by the progress of ripening. However, banana fruits are likely to undergo ripening due to the production of ethylene during the transportation process. Furthermore, the fruits may overripen and rot, significantly reducing the value of this marker. Therefore, the control of ethylene biosynthesis can be used to provide a method for controlling the ripening of bananas.

[0006] Ethylene is a plant hormone that exists as a gas and can affect several physiological and biochemical reactions in plants. Ethylene plays an important role in plant growth, development, and stress responses. For example, when plants are exposed to flooding, mechanical damage, bacterial infection, leaf and flower senescence, fruit ripening, etc., plants produce ethylene. The biosynthetic pathway of ethylene involves the conversion of methionine to S-adenosyl-methionine (AdoMet) by AdoMet synthase, the synthesis of 1-aminocyclopropane-1-carboxylic acid (ACC) from AdoMet by ACC synthase (ACS), and then the oxidation of ACC to ethylene by ACC oxidase (ACO) (see Figure 1; modified from Rudus et al., 2013, Volume 35, Number 2, pages 295 - 307). ACO is known to be the last enzyme used in the ethylene biosynthetic pathway. As a result, inhibition of ACO gene or its protein expression can inhibit / knock down ethylene biosynthesis and further achieve the goal of delaying fruit ripening.

[0007] Unlike most other major food crops, bananas are difficult to genetically improve. The problem is that almost all banana cultivars and landraces are triploid and are associated with high levels of male sterility and female sterility. There are breeding programs under several international agreements, and many of these are developing new cultivars. However, it is virtually impossible to backcross bananas, and thus the possibility of introducing new traits into current cultivars through genetic transformation is excluded.

[0008] Thus, to meet the challenge of increasing global demand for food production, typical approaches towards improving agricultural productivity (such as increasing yields or pest resistance through genetic manipulation) have relied on mutagenesis breeding, or the introduction of novel genes into the genomes of crop species by transformation. These processes are inherently non-specific and relatively inefficient. For example, plant transformation methods deliver foreign DNA, which integrates into the genome at random positions. Thus, to identify and isolate transgenic plant lines with desirable traits, it is necessary to generate hundreds of unique random integration events per construct and then screen for the desired individuals. As a result, conventional plant genetic engineering is laborious, time-consuming, and unpredictable. Furthermore, due to the randomness of these integrations, it becomes difficult to predict whether pleiotropic effects have occurred due to unintended disruption of the genome.

[0009] The randomness of current transformation processes requires hundreds of events for the identification and selection of transgene event candidates (transformation and event screening are rate-limiting compared to gene candidates identified from functional genomics studies). In addition, depending on the location of integration within the genome, gene expression cassettes may be expressed at different levels as a result of the effects of the genomic position. As a result, the generation, isolation, and characterization of plant lines with engineered genes or traits is a process that is extremely laborious, costly, and has a low probability of success. In addition to the obstacles associated with the selection of transgene events, several major concerns have arisen regarding the level of strictness required for the release of transgenic plants into the environment for gene isolation and commercial applications.

[0010] Recent advances in genome editing techniques have made it possible to alter DNA sequences in living cells. Genome editing is more precise than conventional crop breeding methods or standard genetic engineering (transgenic or GM) methods. By editing only a few out of the billions of nucleotides (the basic units of genes) in a plant cell, these new techniques may be the most effective way to obtain crops that grow better in harsh climates, are resistant to pests, or have improved nutrient uptake. The more precise the technique, the less genetic material is altered, reducing uncertainty about other effects on plant behavior.

[0011] The most established method of plant genetic engineering using CRISPR Cas9 genome editing technology requires the insertion of new DNA into the host genome. This insert, the transfer DNA (T-DNA), carries several transcriptional units. Collectively, these consist of an antibiotic resistance gene for selection of transgenic plants, the Cas9 machinery, and several sgRNA units. Due to the integration of foreign DNA into the genome, plants thus produced are classified as transgenic or genetically modified (GM). Once the genome editing is established in the host, this T-DNA backbone can be removed by sexual reproduction (seed propagation) and breeding, since the CRISPR Cas9 machinery is no longer required to maintain the phenotype. However, as mentioned above, banana varieties are parthenocarpic (do not produce viable seeds), and thus, removal of the T-DNA backbone by sexual reproduction is not possible.

[0012] Further background art includes the following. U.S. Patent Application Publication No. 20130097732, U.S. Patent Application Publication No. 20140075593, Zhang, Y. et al., Efficient and transgene-free genome editing in wheat through transient expression of CRISPR / Cas9 DNA or RNA. Nat Commun, 2016. 7: 12617, Woo, J. W. et al., DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nat Biotechnol, 2015. 33(11): 1162-4, Svitashev, S. et al., Genome editing in maize directed by CRISPR-Cas9 ribonucleoprotein complexes. Nat Commun, 2016. 7: 13274, Luo, S. et al., Non-transgenic Plant Genome Editing Using Purified Sequence-Specific Nucleases. Mol Plant, 2015. 8(9): 1425-7, Hoffmann 2017 PlosOne 12(2): e0172630, Chiang et al., 2016. SP1,2,3. Sci Rep. 2016 Apr 15; 6: 24356.

Prior Art Documents

Patent Documents

[0013]

Patent Document 1

Patent Document 2

Non-Patent Documents

[0014]

Non-Patent Document 1

[0015] According to one aspect of some embodiments of the present invention, in the ethylene biosynthesis pathway of banana There is provided a banana plant (Musa) comprising a genome containing a loss-of-function mutation in a nucleic acid sequence encoding a component.

[0016] According to one aspect of some embodiments of the present invention, there is provided a method for extending the storage life of bananas, comprising: (a) subjecting banana plant cells to a DNA editing agent directed to a nucleic acid sequence encoding a component in the ethylene biosynthesis pathway of bananas, to generate a loss-of-function mutation in the nucleic acid sequence encoding the ethylene biosynthesis pathway; (b) regenerating a plant from the plant cells. A method comprising the above steps is provided.

[0017] According to some embodiments of the present invention, the method further comprises harvesting fruits from the plant.

[0018] According to some embodiments of the present invention, the plant lacks a transgene encoding the DNA editing agent.

[0019] According to some embodiments of the present invention, the mutation is homozygous.

[0020] According to some embodiments of the present invention, the plant or its ancestor has been treated with a DNA editing agent directed to a genomic sequence encoding the component in the ethylene biosynthesis pathway.

[0021] According to some embodiments of the present invention, the mutation is selected from the group consisting of deletions, insertions, insertion / deletions (indels), and substitutions.

[0022] According to some embodiments of the present invention, the component in the ethylene biosynthesis pathway is selected from the group consisting of 1-aminocyclopropane-1-carboxylic acid synthase (ACS) and ACC oxidase (ACO).

[0023] According to one aspect of some embodiments of the present invention, there is provided a nucleic acid construct comprising a nucleic acid sequence encoding a DNA editing agent directed to a nucleic acid sequence encoding a component in the ethylene biosynthesis pathway of banana, which is operably linked to a plant promoter.

[0024] According to some embodiments of the present invention, the DNA editing agent is of a DNA editing system selected from the group consisting of meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR-Cas.

[0025] According to some embodiments of the present invention, the DNA editing agent is of a DNA editing system comprising CRISPR-Cas.

[0026] According to some embodiments of the present invention, the component in the ethylene biosynthesis pathway is selected from the group consisting of Ma04_g35640 (SEQ ID NO: 9) and Ma07_g19730 (SEQ ID NO: 27).

[0027] According to some embodiments of the present invention, the component in the ethylene biosynthesis pathway is selected from the group consisting of Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9), Ma04_g31490 (SEQ ID NO: 8), Ma01_g11540 (SEQ ID NO: 20), and Ma07_g19730 (SEQ ID NO: 27).

[0028] According to some embodiments of the present invention, the component in the ethylene biosynthesis pathway is selected from the group consisting of Ma04_g35640 (SEQ ID NO: 9) and Ma07_g19730 (SEQ ID NO: 27).

[0029] According to some embodiments of the present invention, the component in the ethylene biosynthesis pathway is selected from the group consisting of Ma09_g19150 (SEQ ID NO: 13), Ma04_g31490 (SEQ ID NO: 8), and Ma01_g11540 (SEQ ID NO: 20).

[0030] According to some embodiments of the present invention, the DNA editing agent is targeted to nucleic acid coordinates that specifically target a plurality of nucleic acid sequences encoding the components in the ethylene biosynthesis pathway.

[0031] According to some embodiments of the present invention, the DNA editing agent comprises a nucleic acid sequence that is at least 99% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 47 to SEQ ID NO: 54.

[0032] According to some embodiments of the present invention, the DNA editing agent comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 47.

[0033] According to some embodiments of the present invention, the DNA editing agent comprises the nucleic acid shown in SEQ ID NO: 47.

[0034] According to some embodiments of the present invention, the DNA editing agent comprises a plurality of nucleic acid sequences shown in SEQ ID NO: 47 to SEQ ID NO: 54.

[0035] According to some embodiments of the present invention, the DNA editing agent comprises a plurality of nucleic acid sequences shown in SEQ ID NO: 47, SEQ ID NO: 49 or SEQ ID NO: 50.

[0036] According to some embodiments of the present invention, the DNA editing agent comprises a plurality of nucleic acid sequences shown in SEQ ID NO: 51 and SEQ ID NO: 53.

[0037] According to some embodiments of the present invention, the banana plant is non-genetically modified.

[0038] According to one aspect of some embodiments of the present invention, a plant part of the plant described herein is provided.

[0039] According to some embodiments of the present invention, the plant part is a fruit.

[0040] According to some embodiments of the present invention, the fruit is dried.

[0041] According to one aspect of some embodiments of the present invention, a method for producing bananas, comprising: (a) growing a plant as described herein; and (b) harvesting fruits from the plant. A method comprising these steps is provided.

[0042] According to one aspect of some embodiments of the present invention, a processed banana product is provided, which contains genomic banana DNA containing a loss-of-function mutation in a nucleic acid sequence encoding a component in the ethylene biosynthesis pathway of bananas.

[0043] According to one aspect of some embodiments of the present invention, a banana plant, or a part thereof, containing a loss-of-function mutation introduced into a genomic nucleic acid sequence encoding a protein that is a component in the ethylene biosynthesis pathway of bananas, wherein the mutation causes a decrease in the level or activity of the protein compared to a banana plant lacking the loss-of-function mutation, is provided.

[0044] According to some embodiments of the present invention, the plant contains one or more non-natural loss-of-function mutations introduced into one or more genomic nucleic acid sequences encoding one or more proteins that are components in the ethylene biosynthesis pathway of bananas, and each of the one or more mutations causes a decrease in the level or activity of the protein compared to a banana plant lacking the loss-of-function mutation.

[0045] According to some embodiments of the present invention, the one or more proteins are selected from the group consisting of 1-aminocyclopropane-1-carboxylic acid synthase (ACS) and ACC oxidase (ACO).

[0046] According to some embodiments of the present invention, the above ACS protein genomic nucleic acid sequence is at least 85% identical, at least 90% identical, at least 95% identical to a nucleic acid sequence selected from the group consisting of Ma01_g07800.1 (SEQ ID NO: 1), Ma01_g12130.1 (SEQ ID NO: 2), Ma02_g10500.1 (SEQ ID NO: 3), Ma03_g12030.1 (SEQ ID NO: 4), Ma03_g27050.1 (SEQ ID NO: 5), Ma04_g01260.1 (SEQ ID NO: 6), Ma04_g24230.1 (SEQ ID NO: 7), Ma04_g31490.1 (SEQ ID NO: 8), Ma04_g35640.1 (SEQ ID NO: 9), Ma04_g37400.1 (SEQ ID NO: 10), Ma05_g08580.1 (SEQ ID NO: 11), Ma05_g13700.1 (SEQ ID NO: 12), Ma09_g19150.1 (SEQ ID NO: 13), and Ma10_g27510.1 (SEQ ID NO: 14), or is a nucleic acid sequence selected from the group consisting of Ma01_g07800.1 (SEQ ID NO: 1), Ma01_g12130.1 (SEQ ID NO: 2), Ma02_g10500.1 (SEQ ID NO: 3), Ma03_g12030.1 (SEQ ID NO: 4), Ma03_g27050.1 (SEQ ID NO: 5), Ma04_g01260.1 (SEQ ID NO: 6), Ma04_g24230.1 (SEQ ID NO: 7), Ma04_g31490.1 (SEQ ID NO: 8), Ma04_g35640.1 (SEQ ID NO: 9), Ma04_g37400.1 (SEQ ID NO: 10), Ma05_g08580.1 (SEQ ID NO: 11), Ma05_g13700.1 (SEQ ID NO: 12), Ma09_g19150.1 (SEQ ID NO: 13), and Ma10_g27510.1 (SEQ ID NO: 14), and the above ACO protein genomic nucleic acid sequence is Ma09_g04370.1 (SEQ ID NO: 15), Ma06_g17160.1 (SEQ ID NO: 16), Ma11_g05490.1 (SEQ ID NO: 17), Ma00_g04490.1 (SEQ ID NO: 18), Ma07_g15430.1 (SEQ ID NO: 19), Ma01_g11540.1 (SEQ ID NO: 20), Ma10_g16100.1 (SEQ ID NO: 21), Ma05_g08170.1 (SEQ ID NO: 22), Ma06_g14430.1 (SEQ ID NO: 23), Ma05_g09360.1 (SEQ ID NO: 24), Ma11_g22170.1 (SEQ ID NO: 25), Ma05_g31690.1 (Accession No. 26), Ma07_g19730.1 (Accession No. 27), Ma06_g02600.1 (Accession No. 28), Ma10_g05270.1 (Accession No. 29), Ma06_g14370.1 (Accession No. 30), Ma11_g05480.1 (Accession No. 31), Ma06_g14410.1 (Accession No. 32), Ma06_g14420.1 (Accession No. 33), Ma06_g34590.1 (Accession No. 34), Ma02_g21040.1 (Accession No. 35), Ma11_g04210.1 (Accession No. 36), Ma05_g12600.1 (Accession No. 37), Ma04_g23390.2 (Accession No. 38), Ma03_g06970.1 (Accession No. 39), Ma05_g09980.1 (Accession No. 40), Ma04_g36640.1 (Accession No. 41), Ma11_g04180.1 (Accession No. 42), Ma11_g02650.1 (Accession No. 43), and Ma00_g04770.1 (Accession No. 44)? comprises a nucleic acid sequence that is at least 85% identical, at least 90% identical, or at least 95% identical to a nucleic acid sequence selected from the following group, or is a nucleic acid sequence selected from the group consisting of Ma09_g04370.1 (SEQ ID NO: 15), Ma06_g17160.1 (SEQ ID NO: 16), Ma11_g05490.1 (SEQ ID NO: 17), Ma00_g04490.1 (SEQ ID NO: 18), Ma07_g15430.1 (SEQ ID NO: 19), Ma01_g11540.1 (SEQ ID NO: 20), Ma10_g16100.1 (SEQ ID NO: 21), Ma05_g08170.1 (SEQ ID NO: 22), Ma06_g14430.1 (SEQ ID NO: 23), Ma05_g09360.1 (SEQ ID NO: 24), Ma11_g22170.1 (SEQ ID NO: 25), Ma05_g31690.1 (SEQ ID NO: 26), Ma07_g19730.1 (SEQ ID NO: 27), Ma06_g02600.1 (SEQ ID NO: 28), Ma10_g05270.1 (SEQ ID NO: 29), Ma06_g14370.1 (SEQ ID NO: 30), Ma11_g05480.1 (SEQ ID NO: 31), Ma06_g14410.1 (SEQ ID NO: 32), Ma06_g14420.1 (SEQ ID NO: 33), Ma06_g34590.1 (SEQ ID NO: 34), Ma02_g21040.1 (SEQ ID NO: 35), Ma11_g04210.1 (SEQ ID NO: 36), Ma05_g12600.1 (SEQ ID NO: 37), Ma04_g23390.2 (SEQ ID NO: 38), Ma03_g06970.1 (SEQ ID NO: 39), Ma05_g09980.1 (SEQ ID NO: 40), Ma04_g36640.1 (SEQ ID NO: 41), Ma11_g04180.1 (SEQ ID NO: 42), Ma11_g02650.1 (SEQ ID NO: 43), and Ma00_g04770.1 (SEQ ID NO: 44).

[0047] According to some embodiments of the present invention, the genomic nucleic acid sequence encoding the protein component in the ethylene biosynthesis pathway comprises a nucleic acid sequence that is at least 85% identical, at least 90% identical, at least 95% identical to a nucleic acid sequence selected from the group consisting of Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9), Ma04_g31490 (SEQ ID NO: 8), Ma01_g11540 (SEQ ID NO: 20), and Ma07_g19730 (SEQ ID NO: 27), or is a nucleic acid sequence selected from the group consisting of Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9), Ma04_g31490 (SEQ ID NO: 8), Ma01_g11540 (SEQ ID NO: 20), and Ma07_g19730 (SEQ ID NO: 27).

[0048] According to some embodiments of the present invention, the genomic nucleic acid sequence encoding the protein component in the ethylene biosynthesis pathway comprises a nucleic acid sequence that is at least 85% identical, at least 90% identical, at least 95% identical to a nucleic acid sequence selected from the group consisting of Ma04_g35640 (SEQ ID NO: 9) and Ma07_g19730 (SEQ ID NO: 27), or is a nucleic acid sequence selected from the group consisting of Ma04_g35640 (SEQ ID NO: 9) and Ma07_g19730 (SEQ ID NO: 27).

[0049] According to some embodiments of the present invention, the genomic nucleic acid sequence encoding the protein component in the ethylene biosynthesis pathway comprises a nucleic acid sequence that is at least 85% identical, at least 90% identical, at least 95% identical to a nucleic acid sequence selected from the group consisting of Ma09_g19150 (SEQ ID NO: 13), Ma04_g31490 (SEQ ID NO: 8), and Ma01_g11540 (SEQ ID NO: 20), or is a nucleic acid sequence selected from the group consisting of Ma09_g19150 (SEQ ID NO: 13), Ma04_g31490 (SEQ ID NO: 8), and Ma01_g11540 (SEQ ID NO: 20).

[0050] According to some embodiments of the present invention, the non-natural loss-of-function mutation is introduced using a DNA editing agent.

[0051] According to some embodiments of the present invention, the plant does not contain a transgene encoding the DNA editing agent, a transgene encoding a selection marker or a reporter, or does not contain any transgene encoding the DNA editing agent, the selection marker or the reporter.

[0052] According to some embodiments of the present invention, the DNA editing agent included a DNA editing system selected from the group consisting of meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR-Cas.

[0053] According to some embodiments of the present invention, the DNA editing agent was CRISPR-Cas.

[0054] According to some embodiments of the present invention, the mutation is homozygous.

[0055] According to some embodiments of the present invention, the mutation is selected from the group consisting of deletions, insertions, insertion / deletions (indels), and substitutions.

[0056] According to one aspect of some embodiments of the present invention, there is provided a nucleic acid construct comprising nucleic acid sequences encoding a DNA editing agent and a DNA targeting agent, wherein the targeting agent targets an editing agent to a genomic nucleic acid sequence encoding a protein component in the ethylene biosynthesis pathway of banana to introduce a loss-of-function mutation into the genomic nucleic acid sequence, and these editing agent and targeting agent are operably linked to a plant promoter, and the mutation causes a decrease in the level or activity of the protein as compared to a banana plant lacking the loss-of-function mutation.

[0057] According to some embodiments of the present invention, the DNA editing agent and the DNA targeting agent generate one of the mutations in the genome of the plant according to any one of claims 1 to 13.

[0058] According to some embodiments of the present invention, the DNA targeting agent is designed to target a nucleic acid that is common to a plurality of genomic nucleic acid sequences encoding components in the ethylene biosynthesis pathway.

[0059] According to some embodiments of the present invention, the DNA targeting agent comprises a nucleic acid sequence that is at least 99% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 47 to SEQ ID NO: 54.

[0060] According to some embodiments of the present invention, the DNA editing agent comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 47.

[0061] According to some embodiments of the present invention, the DNA editing agent comprises the nucleic acid shown in SEQ ID NO: 47.

[0062] According to some embodiments of the present invention, the nucleic acid construct comprises two or more DNA editing agents comprising a nucleic acid sequence selected from the nucleic acid sequences shown in SEQ ID NO: 47 to SEQ ID NO: 54.

[0063] According to some embodiments of the present invention, the nucleic acid construct comprises two or more DNA editing agents comprising a nucleic acid sequence selected from the nucleic acid sequences shown in SEQ ID NO: 47, SEQ ID NO: 49 or SEQ ID NO: 50.

[0064] According to some embodiments of the present invention, the nucleic acid construct comprises at least two DNA editing agents comprising the nucleic acid sequences shown in SEQ ID NO: 51 and SEQ ID NO: 53.

[0065] According to one aspect of some embodiments of the present invention, a method for extending the storage life of bananas, comprising: (a) transforming one or more cells of a banana plant with the nucleic acid construct according to any one of claims 14 to 22; (b) A step of generating a loss-of-function mutation in the genomic nucleic acid sequence encoding the protein component of the ethylene biosynthesis pathway, wherein this mutation causes a decrease in the level or activity of the protein. (c) A step of regenerating a plant from the plant cell. A method comprising the above is provided.

[0066] According to some embodiments of the present invention, the DNA editing agent is CRISPR-Cas, and the DNA targeting agent is sgRNA.

[0067] According to some embodiments of the present invention, the genomic nucleic acid sequence encoding the protein component in the ethylene biosynthesis pathway of the banana is selected from the group consisting of Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9), Ma04_g31490 (SEQ ID NO: 8), Ma01_g11540 (SEQ ID NO: 20), and Ma07_g19730 (SEQ ID NO: 27).

[0068] According to some embodiments of the present invention, the sgRNA DNA targeting agent is selected from the group consisting of sg-183 (SEQ ID NO: 47), sg-184 (SEQ ID NO: 48), sg-188 (SEQ ID NO: 49), sg-189 (SEQ ID NO: 50), sg-190 (SEQ ID NO: 51), sg-191 (SEQ ID NO: 52), sg-194 (SEQ ID NO: 53), and sg-195 (SEQ ID NO: 54).

[0069] According to some embodiments of the present invention, the loss-of-function mutation is as described herein.

[0070] According to one aspect of some embodiments of the present invention, there is provided a mutant banana plant comprising mutant bananas, wherein the mutant plant contains a mutation in the gene encoding 1-aminocyclopropane-1-carboxylic acid synthase (ACS) protein, and the activity of this ACS protein in the mutant banana plant is lower compared to the activity of that protein derived from a banana plant lacking the said mutation, and the fruits of the said mutant banana ripen more slowly than bananas derived from a banana plant lacking the said mutation.

[0071] According to one aspect of some embodiments of the present invention, there is provided a mutant banana plant comprising mutant bananas, wherein the mutant plant contains a mutation in gene Ma09_g19150 (SEQ ID NO: 13), gene Ma09_g19150 encodes protein 1-aminocyclopropane-1-carboxylic acid synthase (ACS), and the activity of protein ACS in the mutant banana plant is lower compared to the activity of that protein derived from a banana plant lacking the said mutation, and the fruits of the said mutant banana ripen more slowly than bananas derived from a banana plant lacking the said mutation.

[0072] According to one aspect of some embodiments of the present invention, there is provided a mutant banana plant comprising mutant bananas, wherein the mutant plant contains a mutation in gene Ma04_g35640 (SEQ ID NO: 9), gene Ma04_g35640 encodes protein 1-aminocyclopropane-1-carboxylic acid synthase (ACS), and the activity of protein ACS in the mutant banana plant is lower compared to the activity of that protein derived from a banana plant lacking the said mutation and the fruits of the said mutant banana ripen more slowly than bananas derived from a banana plant lacking the said mutation.

[0073] According to one aspect of some embodiments of the present invention, there is provided a mutant banana plant comprising mutant bananas, wherein the mutant plant contains a mutation in the gene Ma04_g31490 (SEQ ID NO: 8), the gene Ma04_g31490 encodes the protein 1-aminocyclopropane-1-carboxylic acid synthase (ACS), the activity of the protein ACS in this mutant banana plant is reduced compared to the activity of that protein derived from a banana plant lacking the above mutation, and the fruit of the above mutant banana ripens more slowly than the banana derived from a banana plant lacking the above mutation.

[0074] According to one aspect of some embodiments of the present invention, there is provided a mutant banana plant comprising mutant bananas, wherein the mutant plant contains a mutation in the gene encoding the ACC oxidase (ACO) protein, the activity of this ACO protein in the mutant banana plant is reduced compared to the activity of that protein derived from a banana plant lacking the above mutation, and the fruit of the above mutant banana ripens more slowly than the banana derived from a banana plant lacking the above mutation.

[0075] According to one aspect of some embodiments of the present invention, there is provided a mutant banana plant comprising mutant bananas, wherein the mutant plant contains a mutation in the gene Ma01_g11540 (SEQ ID NO: 20), the gene Ma01_g11540 encodes the protein ACC oxidase (ACO), the activity of the protein ACO in this mutant banana plant is reduced compared to the activity of that protein derived from a banana plant lacking the above mutation, and the fruit of the above mutant banana ripens more slowly than the banana derived from a banana plant lacking the above mutation.

[0076] According to one aspect of some embodiments of the present invention, there is provided a mutant banana plant comprising mutant bananas, wherein the mutant plant comprises a mutation in the gene Ma07_g19730 (SEQ ID NO: 27), the gene Ma07_g19730 encodes the protein ACC oxidase (ACO), and the activity of the protein ACO in this mutant banana plant is reduced as compared to the activity of that protein derived from a banana plant lacking the above mutation, and the above mutant banana is a mutant banana plant that ripens more slowly than bananas derived from banana plants lacking the above mutation.

[0077] According to one aspect of some embodiments of the present invention, there is provided a method for producing bananas, comprising: (a) growing the plants described herein; and (b) harvesting fruits from the above plants. A method comprising these steps is provided.

[0078] According to some embodiments of the present invention, the above plant, or a part thereof, is a plant part.

[0079] According to some embodiments of the present invention, the above plant part is a fruit.

[0080] According to one aspect of some embodiments of the present invention, there is provided a processed banana product comprising the above plant part.

[0081] Unless otherwise specified, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the technical field to which the present invention pertains. Methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present invention, but exemplary methods and / or materials are described hereinafter. In case of conflict, this patent specification, including definitions, will control. In addition, the materials, methods and examples are for illustrative purposes only and are not necessarily intended to be limiting.

Brief Description of the Drawings

[0082] Some embodiments of the present invention are described herein by way of example only with reference to the accompanying drawings. In referring specifically to the drawings in detail, it is emphasized that the particular ones shown are by way of example and for purposes of description of embodiments of the present invention. In this regard, the description with reference to the drawings will make it apparent to those skilled in the art how embodiments of the present invention may be practiced.

[0083]

Figure 1

Figure 2

Figure 3

Figure 4A

Figure 4B

Figure 5

Figure 6A

Figure 6B

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20A

Figure 20B

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26(1)

Figure 26(2)

Figure 26(3)

Figure 26(4)

Figure 26(5)

Figure 26(6)

Figure 26(7)

Figure 26(8)

Figure 26(9)

Figure 26(10)

Figure 26(11)

Figure 26(12)

Figure 26(13)

Figure 26(14)

Figure 26(15)

Mode for Carrying Out the Invention

[0084] In some embodiments, the present invention relates to compositions and methods for extending the shelf life of bananas.

[0085] Before detailing at least one embodiment of the present invention, it should be understood that the present invention is not necessarily limited to the details shown in the following description or exemplified by the examples in its application. The present invention is capable of other embodiments and can be practiced or carried out in various ways.

[0086] Ethylene, the simplest unsaturated hydrocarbon (two carbons with a double bond), is a gaseous plant hormone that controls substantially all physiological processes in the plant life cycle. Ethylene is involved in signal transduction changes in seed dormancy and germination, root growth and nodulation, shoot and leaf formation, flower and fruit development, senescence and organ abscission of various organs, plant defense mechanisms, and some interactions with other plant hormones. Although ethylene is undoubtedly essential for proper plant growth, development, and survival, in some cases, ethylene can also be harmful to plants. Increases in ethylene levels in plants exposed to various stresses, including chilling, heat, nutrient deficiency, anaerobic life, wounding, and pathogen infection, and the resulting increased damage to plant growth and health have been reported. Therefore, there is considerable commercial interest in genetically modifying the amount of ethylene produced during ripening, senescence, or stress conditions to produce plants with more robust and / or desirable traits.

[0087] The most established method of plant genetic engineering using CRISPR Cas genome editing technology requires the insertion of new DNA into the host genome. This insert, the transfer DNA (T-DNA), carries several transcriptional units to achieve successful CRISPR-Cas-mediated genome editing. Collectively, these consist of an antibiotic resistance gene for selection of transgenic plants, the Cas machinery, and several sgRNA units. Due to the integration of foreign DNA into the genome, the plants thus produced are classified as transgenic or genetically modified (GM). Once the genome editing is established in the host, the T-DNA can be removed by sexual reproduction and breeding, because the CRISPR Cas9 machinery is no longer required to maintain the phenotype. However, for parthenocarpic crops that do not produce viable seeds, such as bananas, removal of T-D NA by sexual reproduction is impossible.

[0088] Embodiments of the present invention relate to the identification of targets for genome editing in the ethylene biosynthesis pathway of bananas.

[0089] Thus, reducing ethylene levels in banana plants may result in an extended shelf life of banana fruits. To reduce this ethylene level, attempts have been made to knockout genes involved in ethylene biosynthesis, such as ACS and ACO (FIGS. 7A, 7B). However, the banana genome contains multiple sequences homologous to these genes.

[0090] To identify superior target genes within the banana genome that encode functional ACS and ACO, homologous sequences from characterized pathways in model or crop species were identified. This process aims to reconstruct the evolutionary history of the genes by phylogenetic analysis, screen candidates by verifying the expression of candidates in general and target tissues, and sequence (determine the sequence of) candidate genes to ensure appropriate sgRNA design (to avoid mismatches), involving a series of sequential steps for comparative analysis of DNA and protein sequences. This procedure enabled the selection of genes, the identification of optimized target regions (conserved and potentially catalytic domains) for knockout, and the design of appropriate sgRNAs.

[0091] After transfection of banana protoplasts with sgRNAs directed against multiple genes in the ethylene biosynthesis pathway, the inventors were able to identify robust genome editing in key genes, such as Ma07_g19730 and Ma04_g35640, and in other genes of their family, to avoid compensation due to redundancy. Such protoplasts were also subjected to a regeneration protocol to obtain banana plants with a long shelf life (see FIGS. 8 - 25A - E).

[0092] Thus, according to one aspect, a method for extending the shelf life of bananas, comprising (a) Exposing banana plant cells to a DNA editing agent directed to a nucleic acid sequence encoding a component in the ethylene biosynthesis pathway of bananas, resulting in a loss-of-function mutation in the nucleic acid sequence encoding the ethylene biosynthesis pathway; (b) Regenerating a plant from the plant cells; A method comprising the above steps is provided.

[0093] As used herein, the term "banana" refers to plants of the genus Musa, including plantains.

[0094] According to certain embodiments, the banana is triploid.

[0095] Other ploidies are envisioned, including diploid and tetraploid.

[0096] As used herein, "plant" refers to the whole plant (one or more), grafted plants (scions), ancestors and descendants of these plants and plant parts, including seeds, fruits, shoots, stems, roots (including tubers), rootstocks, twigs, and plant cells, tissues, and organs.

[0097] According to certain embodiments, the plant part is a fruit.

[0098] According to certain embodiments, the plant part is a seed.

[0099] "Seed" refers to the reproductive unit of angiosperms, which is a reproductive unit that can give rise to another such plant.

[0100] According to certain embodiments, the cell is an embryonic cell.

[0101] According to certain embodiments, the cell is a somatic cell.

[0102] The plant may be in any form, including suspension cultures, protoplasts, embryos, meristematic regions, callus tissues, leaves, gametophytes, sporophytes, pollen, and microspores.

[0103] According to certain embodiments, the plant part contains DNA.

[0104] The following is a non - limiting list of cultivars that can be used in accordance with the present teachings.

[0105] Group AA Diploid Musa acuminata, both wild banana plants and cultivars Chingan banana Lacatan banana Lady Finger banana (Sugar banana) Pisang jari buaya (Crocodile fingers banana) Senorita banana (Monkoy, Arnibal banana, Cuarenta dias, Carinosa, Pisang Empat Puluh Hari, Pisang Lampung)

[12] Sinwobogi banana

[0106] Group AAA Triploid Musa acuminata, both wild banana plants and cultivars Cavendish sub - group “Dwarf Cavendish” “Giant Cavendish” (“Williams”) “Grand Nain” (“Chiquita”) “Masak Hijau” “Robusta” “Red Dacca” Dwarf Red banana Gros Michel banana East African Highland banana (AAA - EA sub - group)

[0107] Group AAAA Tetraploid Musa acuminata, both wild bananas and cultivars Bodles Altafort banana Golden Beauty Banana

[0108] AAAB Group Tetraploid cultivar of a hybrid (Musa×paradisiaca) between Musa acuminata and Musa balbisiana Atan Banana Goldfinger Banana

[0109] AAB Group Triploid cultivar of a hybrid between Musa acuminata and Musa balbisiana. This group includes the Plantain subgroup composed of "pure" Plantains or African Plantains - the center of their diversity is Central Africa and West Africa - where a very large number of cultivars were domesticated, probably after the introduction of ancestral Plantains from Asia some 2000 - 3000 years ago.

[0110] The Iholena and Maoli - Popo’ulu subgroups are called Pacific Plantains.

[0111] Iholena Subgroup - A subgroup of cooking bananas domesticated in the Pacific region Maoli - Popo’ulu Subgroup - A subgroup of cooking bananas domesticated in the Pacific region Maqueno Banana Popoulu Banana Mysore Subgroup - Cooking and dessert bananas

[15] Mysore Banana Pisang Raja Subgroup Pisang Raja Banana Plantain Subgroup French Plantain Green French Banana Horn Plantain & Rhino Horn Banana Nendran Banana Pink French Banana Tiger Banana Pome Subgroup Pome Banana Prata-ana Banana (Dwarf Brazilian Banana, Dwarf Prata) Silk Subtribe Latundan Banana (Silk Banana, Apple Banana) Others Pisang Seribu Banana plu Banana

[0112] AABB Group Tetraploid Cultivar of Hybrid between Malaysian Yam and Ryukyu Yam Kalamagol Banana Pisang Awak (Ducasse Banana)

[0113] AB Group Diploid Cultivar of Hybrid between Malaysian Yam and Ryukyu Yam Ney Poovan Banana

[0114] ABB Group Triploid Cultivar of Hybrid between Malaysian Yam and Ryukyu Yam Blue Java Banana (Ice Cream Banana, Ney mannan, Ash Planten, Pata hina, Dukuru, Vata) Bluggoe Subtribe Bluggoe Banana (also known as orinoco and "burro") Silver Bluggoe Banana Pelipita Banana (Pelipia, Pilipia) Saba Subtribe Saba Banana (Cardaba, Dippig) Cardaba Banana Benedetta Banana

[0115] ABBB Group Tetraploid Cultivar of Hybrid between Malaysian Yam and Ryukyu Yam ​Tiparot banana

[0116] BB group Diploid Musa balbisiana, wild banana

[0117] BBB group Triploid Musa balbisiana, wild banana and cultivated varieties Kluai Lep Chang Kut

[0118] According to certain embodiments, the plant is a plant cell, e.g., a plant cell in an embryo cell suspension.

[0119] According to certain embodiments, the plant cell is a protoplast.

[0120] This protoplast is derived from any plant tissue, e.g., root, leaf, embryo cell suspension, callus or seedling tissue.

[0121] As used herein, "component in the ethylene biosynthesis pathway" refers to a polypeptide, e.g., an enzyme, that is essential for ethylene biosynthesis in banana. Specifically, as reviewed by Pech et al. (2010, Ethylene biosynthesis. Plant hormones: biosynthesis, transduction, action, 3rd ed., Springer, Dordrecht, pp. 115 - 136), ethylene biosynthesis starts from S-adenosylmethionine (SAM) and comprises two key steps (Figure 1).

[0122] The ethylene biosynthesis pathway involves the conversion of methionine to S-adenosyl-methionine (AdoMet, SAM) by AdoMet synthase. 1-Aminocyclopropane-1-carboxylic acid synthase (ACS) [EC4.4.1.14] catalyzes the cyclization of SAM to 1-aminocyclopropane-1-carboxylic acid (ACC), and this cyclization is often considered the rate-limiting reaction in this pathway. ACS also produces 5'-methylthioadenosine (MTA), which is recycled to produce methionine. The final step, the oxygen-dependent conversion of ACC to ethylene, is catalyzed by ACC oxidase (ACO) [EC1.14.17.4]. ACC is converted to ethylene by modification of the carbon C-2 and C-3 of ACC, while C-1 is converted to cyanide and the carboxyl group is converted to carbon dioxide.

[0123] According to certain embodiments, the above AdoMet synthase is banana AdoMet.

[0124] All accession numbers correspond to the published genome of the germplasm collection line named Pahang (2n = 22) Assembly, version 2 of the doubled haploid of M. acuminata (Malayalam banana). correspond to the doubled haploid of M. acuminata (Malayalam banana).

[0125] All accession numbers correspond to the published genome of the germplasm collection line named Pahang (2n = 22) Assembly, version 2 of the doubled haploid of M. acuminata (Malayalam banana).

[0126] According to certain embodiments, ACS is as follows. >Ma01_g07800.1 (SEQ ID NO: 1 >Ma01_g12130.1 (SEQ ID NO: 2); >Ma02_g10500.1 (SEQ ID NO: 3); >Ma03_g12030.1 (SEQ ID NO: 4); >Ma03_g27050.1 (SEQ ID NO: 5); >Ma04_g01260.1 (SEQ ID NO: 6); >Ma04_g24230.1 (Accession No. 7); >Ma04_g31490.1 (Accession No. 8); >Ma04_g35640.1 (Accession No. 9); >Ma04_g37400.1 (Accession No. 10); >Ma05_g08580.1 (Accession No. 11); >Ma05_g13700.1 (Accession No. 12); >Ma09_g19150.1 (Accession No. 13); or >Ma10_g27510.1 (Accession No. 14)

[0127] According to a specific embodiment, the ACO is as follows. >Ma09_g04370.1 (Accession No. 15); >Ma06_g17160.1 (Accession No. 16); >Ma11_g05490.1 (Accession No. 17); >Ma00_g04490.1 (Accession No. 18); >Ma07_g15430.1 (Accession No. 19); >Ma01_g11540.1 (Accession No. 20); >Ma10_g16100.1 (Accession No. 21); >Ma05_g08170.1 (Accession No. 22); >Ma06_g14430.1 (Accession No. 23); >Ma05_g09360.1 (Accession No. 24); >Ma11_g22170.1 (Accession No. 25); >Ma05_g31690.1 (Accession No. 26); >Ma07_g19730.1 (Accession No. 27); >Ma06_g02600.1 (Accession No. 28); >Ma10_g05270.1 (Accession No. 29); >Ma06_g14370.1 (Accession No. 30); >Ma11_g05480.1 (Accession No. 31); >Ma06_g14410.1 (Accession No. 32); >Ma06_g14420.1 (Accession No. 33); >Ma06_g34590.1 (Accession No. 34); >Ma02_g21040.1 (Accession No. 35); >Ma11_g04210.1 (Accession No. 36); >Ma05_g12600.1 (Accession No. 37); >Ma04_g23390.2 (Accession No. 38); >Ma03_g06970.1 (Accession No. 39); >Ma05_g09980.1 (Accession No. 40); >Ma04_g36640.1 (Accession No. 41); >Ma11_g04180.1 (Accession No. 42); >Ma11_g02650.1 (Accession No. 43); or >Ma00_g04770.1 (Accession No. 44)

[0128] According to certain embodiments, the ACO is Ma01_g11540.1 (Accession No. 20) and / or Ma07_g19730.1 (Accession No. 27).

[0129] According to certain embodiments, the ACS is Ma09_g19150.1 (Accession No. 13), Ma04_g35640.1 (Accession No. 9) and / or Ma04_g31490.1 (Accession No. 8).

[0130] Naturally occurring functional homologs of each of the above genes, for example, those having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the above genes and having ACS activity or ACO activity as defined above are also contemplated.

[0131] As used herein, "sequence identity" or "identity" or the literal equivalent as used herein with respect to two nucleic acid or polypeptide sequences includes reference to residues in two sequences that are the same when aligned (sequence compared). When percent sequence identity is used in reference to a protein, residue positions that are not identical often differ by conservative amino acid substitutions, where a conservative amino acid substitution is one in which an amino acid residue is substituted for another amino acid residue having similar chemical properties (e.g., charge or hydrophobicity), and thus does not change the functional properties of the molecule. If sequences differ in conservative substitutions, the percent sequence identity may be adjusted upward to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are considered to have "sequence similarity" or "similarity". Means for making this adjustment are well known to those of skill in the art. Typically, this involves scoring a conservative substitution as a partial mismatch rather than a complete mismatch, thereby increasing the percent sequence identity value. Thus, for example, if identical amino acids are given a score of 1 and non-conservative substitutions are given a score of 0, conservative substitutions are given a score between 0 and 1. The scoring of conservative substitutions is calculated, for example, according to the algorithm of Henikoff S and Henikoff JG. [Amino acid substitution matrices from protein blocks. Proc. Natl. Acad. Sci. U.S.A. 1992, 89(22):10915-9].

[0132] Identity can be determined, for example, using any homology comparison software including, for example, the BlastN software of the National Center of Biotechnology Information (NCBI), using default parameters.

[0133] According to some embodiments of the present invention, the above identity is an overall identity, i.e., an identity over the entire nucleic acid sequence of the present invention, and not an identity over a portion thereof.

[0134] As used herein, "plant" refers to the whole plant(s) (one or more), grafted plants, ancestors and descendants of these plants and plant parts, and includes seeds, fruits, cuttings, stems, roots (including tubers), rootstocks, shoots, and cells, tissues, and organs of the plant.

[0135] The above plants may be in any form including suspension cultures, protoplasts, embryos, meristem regions, callus tissues, leaves, gametophytes, sporophytes, pollen, and microspores.

[0136] According to certain embodiments, the above plant parts contain DNA.

[0137] According to certain embodiments, the above banana plants are of a banana breeding line, more preferably an elite line.

[0138] According to certain embodiments, the above banana plants are of an elite line.

[0139] According to certain embodiments, the above banana plants are of a purebred line.

[0140] According to certain embodiments, the above banana plants are of a banana variety or breeding germplasm.

[0141] The term "breeding line" as used herein, unlike wild variants or landraces, refers to a cultivated banana line having commercially valuable or agronomically desirable characteristics. This term includes reference to elite breeding lines or elite lines, which elite breeding lines or elite lines are commercial F 1Represents a normally inbred plant of a substantially homozygous line used to produce hybrids. Elite breeding lines are obtained by breeding and selection for better agronomic performance, including a number of agronomically desirable traits. Elite plants are any plants derived from elite lines. Better agronomic performance refers to the desired combination of agronomically desirable traits as defined herein, and it is desirable that most, preferably all, of these agronomically desirable traits are improved in elite breeding lines compared to non-elite breeding lines. Elite breeding lines are substantially homozygous and preferably inbred.

[0142] As used herein, the term "elite line" refers to any line obtained from breeding and selection for better agronomic performance. Elite lines preferably have a plurality, preferably at least 3, 4, 5, 6 or more, of the desirable agronomic traits (genes therefor) defined herein.

[0143] The terms "cultivar" and "variety" are used interchangeably herein and represent plants intentionally developed by breeding, e.g., by crossing and selection, for the purpose of being commercialized, e.g., for production of agricultural products for consumption by oneself or for commercialization, for use by farmers and growers. The term "breeding germplasm" represents plants having a biological state other than the "wild" state, which "wild" state means the original uncultivated or natural state of the plant or line species.

[0144] Examples of the term "breeding germplasm" include, but are not limited to, semi-natural, semi-wild, weeds, traditional cultivars, landraces, breeding materials, research materials, breeding lines, synthetic populations, hybrids, founder stock / base populations, inbred lines (parents of hybrid cultivars), segregating populations, mutants / genetic stocks, market classes, and epigenetic / improved cultivars. As used herein, the terms "purebred", "pure line" or "inbred line" are interchangeable and refer to a substantially homozygous plant or plant line obtained by repeated self-pollination and / or backcrossing.

[0145] As used herein, "modifying the genome" refers to introducing at least one mutation into at least one allele encoding a component in the ethylene biosynthesis pathway of banana. According to some embodiments, modifying refers to introducing mutations into each allele of the component in the ethylene biosynthesis pathway. According to at least some embodiments, the mutations on the two alleles of the component in the ethylene biosynthesis pathway are homozygous

[0146] According to some embodiments, the mutations on the two alleles encoding the component in the ethylene biosynthesis pathway are non-complementary.

[0147] According to certain embodiments, the DNA editing agent modifies the target sequence of the component in the ethylene biosynthesis pathway and lacks "off-target" activity, i.e., does not modify other sequences in the banana genome.

[0148] According to certain embodiments, the DNA editing agent has "off-target activity" against non-essential genes in the banana genome.

[0149] Non-essential refers to a gene that does not affect the phenotype of the target genome in an agriculturally valuable manner (e.g., nutritional value, aroma, biomass, yield, biotic / abiotic stress tolerance, etc.) when modified using the DNA editing agent.

[0150] Off-target effects are well known in the art and can be assayed using the methods described herein.

[0151] As used herein, a "loss-of-function" mutation refers to a genomic abnormality that results in a decrease (i.e., dysfunction) in the ability of a component of the ethylene biosynthesis pathway to promote the synthesis of ethylene or its precursor, or the inability to promote the synthesis of ethylene or its precursor.

[0152] As used herein, "decreased ability" refers to the activity of the above component in the ethylene biosynthesis pathway that is decreased compared to the ethylene biosynthesis pathway activity (i.e., ethylene synthesis) of the wild-type enzyme lacking the loss-of-function mutation. According to certain embodiments, the decrease in activity is at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to the activity of the wild-type enzyme under the same assay conditions. Ethylene biosynthesis can be measured in small plant pieces by gas chromatography (GC) or laser-based assays (Cristescu SM, Mandon J, Arslanov D, De Pessemier J, Hermans C, Harren FJM. Current methods for detecting ethylene in plants. Ann Bot-London. 2013;111(3):347-60).

[0153] According to certain embodiments, the loss-of-function mutation does not result in the expression of a component, mRNA or protein of the ethylene biosynthesis pathway (depending on the location of the abnormality in the gene encoding the component of the ethylene biosynthesis pathway).

[0154] According to certain embodiments, the loss-of-function mutation results in the expression of the above component of the ethylene biosynthesis pathway, but this component cannot synthesize ethylene or its precursor, or can only synthesize it inefficiently.

[0155] According to certain embodiments, the loss-of-function mutation is selected from the group consisting of deletions, insertions, insertion-deletions (indels), inversions, substitutions and combinations thereof (e.g., deletions and substitutions, e.g., deletions and SNPs).

[0156] According to certain embodiments, the loss-of-function mutation is less than 1 Kb or less than 0.1 Kb.

[0157] According to certain embodiments, the "loss-of-function" mutation is in the 5' end (e.g., exon 1) of a gene encoding a component of the ethylene biosynthesis pathway so as to inhibit the production of any α-expression product.

[0158] According to certain embodiments, this "loss-of-function" mutation is in any of the genes that can no longer promote (contribute to the synthesis of) ethylene or its precursors, i.e., enable the production of an inactive protein, an expression product. Mutations in the regulatory elements of this gene, such as the promoter, are also presented herein.

[0159] As described above, the banana plant contains a loss-of-function mutation in at least one allele of a gene encoding a component of the ethylene biosynthesis pathway.

[0160] According to certain embodiments, the above mutation is homozygous.

[0161] According to one aspect, a method for extending the storage life of bananas, comprising: (a) subjecting banana plant cells to a DNA editing agent directed to a nucleic acid sequence encoding a component in the ethylene biosynthesis pathway of bananas, to generate a loss-of-function mutation in the nucleic acid sequence encoding the ethylene biosynthesis pathway; and (b) regenerating a plant from the plant cells. A method is provided.

[0162] According to certain embodiments, the method further comprises harvesting fruits from the plant.

[0163] According to certain embodiments, the fruits are harvested still green and firm, 7 to 14 days before ripening. Each adult banana plant produces a single bunch, which is formed by many banana fruits or "fingers", and the banana fruits or "fingers" are grouped in several tiers (FAO, 2014). The banana bunch is cut into "tiers" using a sharp, curved knife or machete (usually involving 2 to 3 people).

[0164] As used herein, "extended shelf life" refers to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90% or even 95% extension of the shelf life of harvested banana fruits having loss-of-function mutations in the genome, as compared to the shelf life of banana plants of the same genetic background without such loss-of-function mutations, when assayed by methods well known in the art (see the Examples section below), and as revealed by the shelf life. The shelf life is estimated by tracking the color and consistency of the fruit.

[0165] The following is an explanation of various non-limiting examples of methods and DNA editing agents used to introduce nucleic acid alterations into target genes, and agents that can be used in accordance with specific embodiments of the present disclosure to carry it out.

[0166] Genome editing using engineered endonucleases - This approach typically refers to a reverse genetics method that uses an engineered nuclease to cut the double strand at a desired location(s) in the genome, creating a specific double-strand break, which is then repaired by endogenous cellular processes such as homologous recombination (HR) or non-homologous end joining (NHEJ). NHEJ binds directly to the DNA ends of the double-strand break, while HR utilizes a homologous donor sequence as a template (i.e., sister chromatids formed during the S phase) to regenerate the lost DNA sequence at the cleavage site. To introduce specific nucleotide modifications into genomic DNA, a donor DNA repair template containing the desired sequence needs to be present during HR (exogenously provided single-stranded DNA or double-stranded DNA).

[0167] Genome editing cannot be carried out using conventional restriction endonucleases. This is because many restriction enzymes recognize several base pairs on DNA as their targets, and these sequences are often found at many locations throughout the genome, resulting in multiple cleavage sites that are not limited to the desired location. To overcome this problem and create site-specific single-strand or double-strand breaks, several distinct classes of nucleases have been discovered and biotechnologically exploited to date. These include meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR / Cas system.

[0168] Meganucleases - Meganucleases are generally classified into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cys box family, and the HNH family. These families are characterized by structural motifs that affect catalytic activity and recognition sequences. For example, members of the LAGLIDADG family are characterized by having either one or two copies of the conserved LAGLIDADG motif. The meganucleases of these four families are widely separated from each other with respect to conserved structural elements, and thus with respect to DNA recognition sequence specificity and catalytic activity. Meganucleases are generally found in microbial species and have the unique property of having very long recognition sequences (>14 bp), which makes meganucleases naturally very specific for cleavage at desired locations.

[0169] This can be exploited to perform site-specific double-strand breaks in genome editing. Those skilled in the art can use these naturally occurring meganucleases, however, the number of such naturally occurring meganucleases is limited. To overcome this problem, mutagenesis and high-throughput screening methods have been used to create meganuclease variants that recognize unique sequences. For example, various meganucleases have been fused to create hybrid enzymes that recognize new sequences.

[0170] Alternatively, the amino acids of the meganuclease's DNA interactivity can be altered to design sequence-specific meganucleases (see, for example, U.S. Patent No. 8,021,867). Meganucleases can be designed using, for example, the methods described in Certo, MT et al., Nature Methods (2012) 9:073-975; U.S. Patent No. 8,304,222; U.S. Patent No. 8,021,867; U.S. Patent No. 8,119,381; U.S. Patent No. 8,124,369; U.S. Patent No. 8,129,134; U.S. Patent No. 8,133,697; U.S. Patent No. 8,143,015; U.S. Patent No. 8,143,016; U.S. Patent No. 8,148,098; or U.S. Patent No. 8,163,514, the entire contents of each of which are hereby incorporated by reference in their entirety. Alternatively, meganucleases having site-specific cleavage properties can be obtained using commercially available technologies, such as the Directed Nuclease Editor (TM) genome editing technology of Precision Biosciences.

[0171] ZFNs and TALENs - Two distinct classes of engineered nucleases, zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), have both been shown to be effective in generating targeted double-strand breaks (Christian et al., 2010; Kim et al., 1996; Li et al., 2011; Mahfouz et al., 2011; Miller et al., 2010).

[0172] Basically, the restriction endonuclease technologies of ZFNs and TALENs involve specific DNA binding Utilize a non-specific DNA cleavage enzyme linked to a domain (each a series of zinc finger domains or TALE repeats). Typically, a restriction enzyme is selected where the DNA recognition site and the cleavage site are separated from each other. The cleavage portion is isolated and then linked to the DNA binding domain, thereby obtaining an endonuclease with very high specificity for the desired sequence. An exemplary restriction enzyme with such characteristics is FokI. In addition, FokI has the advantage that it requires dimerization to have nuclease activity, which means that the specificity is dramatically increased because each nuclease partner recognizes a unique DNA sequence. To enhance this effect, FokI nucleases that can only function as heterodimers and have increased catalytic activity have been genetically engineered. The heterodimeric functional nucleases avoid the possibility of unwanted homodimer activity and thus enhance the specificity of double-strand cleavage.

[0173] Thus, for example, to target a specific site, ZFNs and TALENs are constructed as nuclease pairs, and each member of the pair is designed to bind to adjacent sequences at the target site. Upon transient expression in cells, the nucleases bind to their target sites and the FokI domains heterodimerize to create double-strand breaks. Repair of these double-strand breaks by the non-homologous end joining (NHEJ) pathway often results in small deletions or small sequence insertions. Since each repair made by NHEJ is unique, the use of a single nuclease pair can generate a series of alleles with a range of different deletions at the target site.

[0174] Generally, NHEJ is relatively accurate (about 85% of DSBs in human cells are repaired by NHEJ within about 30 minutes of detection), and in gene editing, the errors of NHEJ are relied upon. This is because when the repair is accurate, the nuclease will continue to cleave until the repair product is mutagenic and the recognition / cleavage site / PAM motif is lost / mutated, or until the transiently introduced nuclease is no longer present.

[0175] Deletions typically range from a few base pairs to several hundred base pairs in length, although larger deletions have been successfully generated in cell culture by using two pairs of nucleases simultaneously (Carlson et al., 2012; Lee et al., 2010). In addition, when a DNA fragment (fragment) having homology to the target region is introduced in combination with the nuclease pair, the double-strand break is repaired via homologous recombination (HR), and specific modifications can be generated (Li et al., 2011; Miller et al., 2010; Urnov et al., 2005).

[0176] Both nuclease portions of ZFN and TALEN have similar characteristics, but the difference between these genetically engineered nucleases lies in their DNA recognition peptides. ZFN depends on Cys2-His2 zinc fingers, and TALEN depends on TALE. These DNA recognition peptide domains both have the feature that they are naturally found in their proteins in combinations of those domains. Cys2-His2 zinc fingers are usually found in repeats separated by 3 bp and in various combinations in various nucleic acid-interacting proteins. On the other hand, TALE is found in a 1:1 recognition ratio between the amino acids recognized in the repeat and the nucleotide pair. Since both zinc fingers and TALE occur in repetitive patterns, different combinations can be tried to create a truly diverse array of sequence specificities. Approaches for creating site-specific zinc finger endonucleases include, for example, among others, modular assembly (zinc fingers associated with trinucleotide sequences are ligated in a row to cover the required sequence), OPEN (low stringency selection of peptide domains vs. trinucleotide nucleotides and subsequent high stringency selection of peptide combinations in a bacterial system vs. the final target), and bacterial one-hybrid screening of zinc finger libraries. ZFN can also be commercially designed and obtained, for example, from Sangamo Biosciences (trademark) (Richmond, California). ning are mentioned. ZFN can also be commercially designed and obtained, for example, from Sangamo Biosciences (trademark) (Richmond, California).

[0177] Methods for designing and obtaining TALENs are described, for example, in Reyon et al., Nature Biotechnology 2012 May;30(5):460-5; Miller et al., Nat Biotechnol. (2011) 29:143-148; Cermak et al., Nucleic Acids Research (2011) 39(12):e82 and Zhang et al., Nature Biotechnology (2011) 29(2):149-53. A recently developed web-based program named Mojo Hand has been introduced by the Mayo Clinic for designing TAL and TALEN constructs for genomic editing applications (accessible at www.talendesign.org). TALENs can also be designed and obtained commercially, for example, from Sangamo Biosciences (trademark) (Richmond, California).

[0178] The T-GEE system (TargetGene’s Genome Editing Engine) - A programmable nucleoprotein molecular complex is provided that contains a polypeptide moiety and a specificity conferring nucleic acid (SCNA) and that can associate in vivo and interact with a predetermined target nucleic acid sequence in a target cell. This programmable nucleoprotein molecular complex can specifically modify and / or edit a target site within the target nucleic acid sequence and / or modify the function of its target nucleic acid sequence. The nucleoprotein composition comprises (a) a polynucleotide molecule encoding a chimeric polypeptide comprising (i) a functional domain capable of modifying a target site and (ii) a linker domain capable of interacting with the specificity conferring nucleic acid, and (b) a specificity conferring nucleic acid (SCNA) comprising (i) a nucleotide sequence complementary to a region of the target nucleic acid adjacent to the target site and (ii) a recognition region capable of specifically binding to the linker domain of the polypeptide. This composition enables accurate, reliable and cost-effective modification of a predetermined nucleic acid sequence target using the high specificity and binding ability of the molecular complex to the target nucleic acid through base pairing of the specificity conferring nucleic acid and the target nucleic acid. This composition has a lower genotoxicity, its assembly is modular, utilizes a single platform that does not require customization, is practical for independent use outside of specialized core facilities, and has a shorter development time and reduced costs.

[0179] The CRISPR-Cas system (also referred to herein as "CRISPR") - Many bacteria and archaea contain an endogenous RNA-based adaptive immune system that can degrade the nucleic acids of invading phages and plasmids. These systems consist of a clustered regularly interspaced short palindromic repeat (CRISPR) nucleotide sequence that produces an RNA component and CRISPR associated (Cas) genes that encode protein components. This CRISPR RNA (crRNA) contains short strands that are homologous to the DNA of specific viruses and plasmids and acts as a guide to direct the Cas nuclease to degrade the complementary nucleic acid of the corresponding pathogen. Studies of the type II CRISPR / Cas system of Streptococcus pyogenes have shown that the following three components form an RNA / protein complex that together is sufficient for sequence-specific nuclease activity: Cas9 nuclease, crRNA containing a 20-base pair that is homologous to the target sequence, and trans-activating crRNA (tracrRNA) (Jinek et al., Science (2012) 337:816-821.).

[0180] It was further demonstrated that a synthetic chimeric guide RNA (gRNA) composed of a fusion of crRNA and tracrRNA can direct Cas9 to cleave a DNA target complementary to the crRNA in vitro. Transient expression of Cas9 in combination with synthetic gRNA has also been demonstrated to be usable to generate targeted double-strand breaks in a variety of different species (Cho et al., 2013; Cong et al., 2013; DiCarlo et al., 2013; Hwang et al., 2013a,b; Jinek et al., 2013; Mali et al., 2013).

[0181] The CRIPSR / Cas system for genome editing contains two distinct components, a gRNA and an endonuclease, such as Cas9.

[0182] gRNAs typically are 20 nucleotide sequences encoding a combination of a target homology sequence (crRNA) and an endogenous bacterial RNA (tracrRNA) that ligates the crRNA to the Cas9 nuclease within a single chimeric transcript. This gRNA / Cas9 complex is recruited to the target sequence by base pairing between the gRNA sequence and complementary genomic DNA. For successful binding of Cas9, the genomic target sequence needs to also contain the correct protospacer adjacent motif (PAM) sequence immediately downstream of the target sequence. Binding of the gRNA / Cas9 complex localizes Cas9 to the genomic target sequence, whereby Cas9 can cleave both strands of the DNA to cause a double-strand break. This double-strand break generated by CRISPR / Cas, like when using ZFNs and TALENs, can be repaired by HR (homologous recombination) or NHEJ (non-homologous end joining) and is susceptible to specific sequence modifications during DNA repair.

[0183] The Cas9 nuclease has two functional domains, RuvC and HNH, which each cleave a different DNA strand. When both of these domains are active, Cas9 causes a double-strand break in genomic DNA.

[0184] A significant advantage of CRISPR / Cas is the high efficiency of this system combined with the ability to easily generate synthetic gRNAs. This allows for the creation of systems that can be readily modified to target variants at different genomic sites and / or different variants at the same site. Additionally, protocols have been established that allow for the simultaneous targeting of multiple genes. The majority of cells with mutations present biallelic mutations in the targeted gene.

[0185] However, due to the apparent flexibility in the base pairing interaction between the gRNA sequence and the genomic DNA target sequence, imperfect matches to the target sequence can also be cleaved by Cas9.

[0186] A modified Cas9 enzyme containing any one of a single inactive catalytic domain, an RuvC domain, or an HNH domain is called a "nickase". Having only one active nuclease domain, Cas9 nickase cleaves only one strand of the target DNA, creating a single-strand break or "nick". Single-strand breaks, or nicks, are usually repaired by single-strand break repair mechanisms involving proteins such as PARP (sensor) and XRCC1 / LIG III complex (ligation) (not limited to these). If single-strand breaks (SSBs) are generated by topoisomerase I poison or drugs that trap PARP1 with naturally occurring SSBs, they will persist. When the cell enters the S phase and the replication fork encounters such an SSB, such an SSB becomes a single-ended DSB with only one end, which can only be repaired by HR. However, two closely spaced nicks on opposite strands introduced by Cas9 nickase are often treated as double-strand breaks in what is called the "double nick" CRISPR system. Double nicks, which are essentially non-parallel DSBs, like other DSBs, can be repaired by HR or NHEJ depending on the desired effect on the gene target, the presence of a donor sequence, and the stage of the cell cycle (HR occurs at very low abundance and can only occur in the S and G2 phases of the cell cycle). Thus, when specificity and reduced off-target effects are very important, the off-target effect will be reduced by using Cas9 nickase to create double nicks by designing two gRNAs using multiple target sequences that are in close proximity and on opposite strands of genomic DNA. This is because neither gRNA alone will create nicks that have a high likelihood of these events, even if it is not impossible to change the genomic DNA.

[0187] A modified form of the Cas9 enzyme containing two inactive catalytic domains (dead Cas9, or dCas9) can still bind to DNA based on gRNA specificity but has no nuclease activity. This dCas9 can be used as a platform for activating or suppressing gene expression by fusing a DNA transcriptional regulator to the inactive enzyme with a known regulatory domain. For example, gene transcription can be blocked by binding dCas9 alone to a target sequence in genomic DNA.

[0188] Several tools are available to assist in selecting and / or designing target sequences, as well as lists of unique gRNAs determined bioinformatically for various genes in various species, such as Target Finder from the Feng Zhang laboratory, Target Finder (E-CRISP) from the Michael Boutros laboratory, RGEN Tools: Cas-OFFinder, CasFinder: A Flexible Algorithm for Identifying Specific Cas9 Targets in Genomes, and CRISPR Optimal Target Finder.

[0189] Non-limiting examples of gRNAs that can be used in the present disclosure include those described in the Examples section below.

[0190] To use the CRISPR system, both the gRNA and Cas9 need to be present in the target cell or delivered as a ribonucleoprotein complex. The insertion vector may contain both cassettes in a single plasmid, or those cassettes may be expressed from two separate plasmids. CRISPR plasmids are commercially available, such as the px330 plasmid from Addgene. Also, the use of clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)-guide RNA technology and Cas endonucleases for modifying plant genomes is at least disclosed by Svitashev et al., 2015, Plant Physiology, 169(2):931-945; Kumar and Jain, 2015, J Exp Bot 66:47-57, and U.S. Patent Application Publication No. 20150082478, which are each incorporated herein by reference in their entirety.

[0191] "Hit and run" or "in-out" - involves a two-step recombination procedure. In the first step, an insertion vector containing a positive / negative dual selection marker cassette is used and the desired sequence change is introduced. This insertion vector contains a single contiguous region homologous to the target locus and is modified to carry the mutation of interest. This targeting construct is linearized with a restriction enzyme at one site within the homologous region, introduced into cells, and positive selection is performed to isolate the homologous recombination event. The DNA carrying the homologous sequences can be a plasmid, single-stranded or double-stranded oligo and They may be provided by. These homologous recombinants contain local duplications separated by intervening vector sequences including the selection cassette. In the second step, the target clone is subjected to negative selection to identify cells that have lost the selection cassette by intrachromosomal recombination between the duplicated sequences. This local recombination event removes the above duplication, and depending on the site of recombination, the allele either retains the introduced mutation or reverts to the wild type. The final result is the introduction of the desired modification without the retention of any foreign sequences.

[0192] The "double-replacement" or "tag and exchange" strategy - involves a two-step selection procedure similar to the above hit and end approach, but requires the use of two different targeting constructs. In the first step, a standard targeting vector with 3' and 5' homology arms is used to insert a positive / negative dual selection cassette near the location where the mutation is to be introduced. After the above system components are introduced into the cells and positive selection is applied, the HR event can be identified. Next, a second targeting vector containing a region homologous to the desired mutation is introduced into the target clone, negative selection is applied, the above selection cassette is removed, and the mutation is introduced. The final allele contains the desired mutation while eliminating the unwanted foreign sequences.

[0193] Site-specific recombinases - Cre recombinase derived from bacteriophage P1 and Flp recombinase derived from the yeast Saccharomyces cerevisiae (budding yeast) are site-specific DNA recombinases that recognize unique 34-base pair DNA sequences (referred to as "Lox" and "FRT", respectively). Sequences adjacent to either the Lox site or the FRT site can be easily removed by site-specific recombination after the expression of Cre recombinase or Flp recombinase, respectively. For example, the Lox sequence consists of an asymmetric 8-base pair spacer region flanked by 13-base pair inverted repeats. Cre binds to these 13-base pair inverted repeats and catalyzes strand cleavage and religation within the spacer region to recombine the 34-base pair lox DNA sequence. The staggered DNA cleavage made by Cre in the spacer region is separated by 6 base pairs and provides an overlapping region that acts as a homology sensor to ensure that only recombination sites with the same overlapping region recombine.

[0194] Basically, the site-specific recombinase system provides a means for the removal of selection cassettes after homologous recombination events. This system also allows for the generation of conditional alleles that can be inactivated or activated either temporally or tissue-specifically. Note that Cre recombinase and Flp recombinase leave a 34-base pair Lox or FRT "scar". The remaining Lox or FRT sites are usually left in the intron or 3' UTR of the modified locus, and current evidence suggests that these sites generally do not significantly interfere with gene function.

[0195] Thus, Cre / Lox and Flp / FRT recombination involves the introduction of a targeting vector with the mutation of interest, two Lox or FRT sequences, and 3' and 5' homology arms typically containing a selection cassette placed between the two Lox or FRT sequences. Positive selection is applied, and homologous recombination events containing the mutation of interest are identified. Transient expression of Cre or Flp in combination with negative selection results in excision of the selection cassette and selection of cells in which the cassette has been lost. The final target allele contains Lox or FRT scars of the exogenous sequences.

[0196] According to certain embodiments, the DNA editing agent is CRISPR-Cas9.

[0197] Exemplary gRNA sequences are presented herein.

[0198] >Ma04_g31490 GACTCTAAGATCAGGGTTAAAGG (SEQ ID NO: 45); >Ma09_g19150 / Ma04_g35640 / Ma04_g31490 GCAGCTAACATCAGGGTTAAAGG (SEQ ID NO: 46).

[0199] According to certain embodiments, the components in the ethylene biosynthesis pathway are selected from the group consisting of Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9), Ma04_g31490 (SEQ ID NO: 8), Ma01_g11540 (SEQ ID NO: 20), and Ma07_g19730 (SEQ ID NO: 27).

[0200] According to certain embodiments, the components in the ethylene biosynthesis pathway are selected from the group consisting of Ma04_g35640 (SEQ ID NO: 9) and Ma07_g19730 (SEQ ID NO: 27).

[0201] According to certain embodiments, the component in the ethylene biosynthesis pathway is selected from the group consisting of Ma09_g19150 (SEQ ID NO: 13), Ma04_g31490 (SEQ ID NO: 8), and Ma01_g11540 (SEQ ID NO: 20).

[0202] According to certain embodiments, the DNA editing agent is directed to nucleic acid coordinates that specifically target a plurality of nucleic acid sequences encoding the component in the ethylene biosynthesis pathway.

[0203] According to certain embodiments, the DNA editing agent comprises a nucleic acid sequence that is at least 99% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 47 to 54 (sgRNA: 183, 184, 188, 189, 190, 191, 194, and 195).

[0204] According to certain embodiments, the DNA editing agent comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence shown in SEQ ID NO: 47 (sgRNA: 183).

[0205] According to certain embodiments, the DNA editing agent comprises the nucleic acid shown in SEQ ID NO: 47 (sgRNA: 183).

[0206] According to certain embodiments, the DNA editing agent comprises a plurality of nucleic acid sequences shown in SEQ ID NOs: 47 to 54 (sgRNA: 183, 184, 188, 189, 190, 191, 194, and 195).

[0207] According to certain embodiments, the DNA editing agent comprises a plurality of nucleic acid sequences shown in SEQ ID NO: 47, SEQ ID NO: 49, and / or SEQ ID NO: 50 (sgRNA: 183, 188, 189).

[0208] According to certain embodiments, the DNA editing agent comprises a plurality of nucleic acid sequences shown in SEQ ID NO: 51 and / or SEQ ID NO: 53 (sgRNA: 190 and 194).

[0209] The DNA editing agent is usually introduced into plant cells using an expression vector.

[0210] Thus, according to one aspect of the present invention, there is provided a nucleic acid construct (construct) comprising a nucleic acid sequence encoding a DNA editing agent that hybridizes to a gene encoding a component of ethylene biosynthesis in banana and enables easy editing of the above gene, wherein this nucleic acid sequence is operable on a cis-acting regulatory element for expressing the above DNA editing agent in banana cells and is provided with a nucleic acid construct that is operably linked.

[0211] Embodiments of the present invention relate to any DNA editing agent such as the above.

[0212] According to a particular embodiment, the genome editing agent comprises an endonuclease, which may include or have an auxiliary unit of a DNA targeting module (e.g., sgRNA, or also referred to herein as "gRNA").

[0213] According to a particular embodiment, the above DNA editing agent is a CRISPR / Cas9 sgRNA.

[0214] According to a particular embodiment, the nucleic acid construct further comprises a nucleic acid sequence encoding an endonuclease of the DNA editing agent (e.g., Cas9 or the above endonuclease).

[0215] According to another particular embodiment, the above endonuclease and sgRNA are encoded from different constructs, whereby each is operably linked to a cis-acting regulatory element (e.g., promoter) that is active in plant cells.

[0216] In certain embodiments of some embodiments of the present invention, the regulatory sequence is a promoter that can be expressed in plants.

[0217] Constructs useful in the methods according to some embodiments may be constructed using recombinant DNA techniques well known to those skilled in the art. Such constructs may be commercially available and suitable for transformation of plants and may be suitable for expression of a gene of interest in transformed cells.

[0218] As used herein, the phrase "expressible in plants" refers to a promoter sequence, including any additional regulatory elements added or contained therein, being able to at least induce, confer, activate or enhance expression in plant cells, tissues or organs, preferably in cells, tissues or organs of monocotyledonous or dicotyledonous plants. Examples of promoters useful in the methods of some embodiments of the present invention include, but are not limited to, Actin, CANV 35S, CaMV19S, GOS2. Promoters that are active in various tissues or at various developmental stages can also be used.

[0219] The nucleic acid sequences of the polypeptides of some embodiments of the present invention may be optimized for plant expression. Examples of such sequence modifications include, but are not limited to, altered G / C content to approach the G / C content commonly found in the plant species of interest, and removal of codons that are irregularly found in plant species, commonly referred to as codon optimization.

[0220] Plant cells may be stably or transiently transformed using the nucleic acid constructs of some embodiments of the present invention. In stable transformation, the nucleic acid molecules of some embodiments of the present invention are integrated into the plant genome, and thus the plant exhibits stable and heritable traits. In transient transformation, the nucleic acid molecules are expressed by the transformed cells but not integrated into the genome, and thus the plant exhibits transient traits.

[0221] According to certain embodiments, the above-mentioned plants are transiently transfected using a DNA editing agent.

[0222] According to certain embodiments, the promoter in the nucleic acid construct is a Pol3 promoter and includes, but is not limited to, examples such as AtU6-29, AtU626, AtU3B, AtU3d, TaU6.

[0223] According to certain embodiments, the promoter in the nucleic acid construct includes a Pol2 promoter. Examples of Pol2 promoters include, but are not limited to, CaMV35S, CaMV19S, ubiquitin, CVMV.

[0224] According to certain embodiments, the promoter in the nucleic acid construct includes a 35S promoter.

[0225] According to certain embodiments, the promoter in the nucleic acid construct includes a U6 promoter.

[0226] According to certain embodiments, the promoter in the nucleic acid construct includes a Pol3 (e.g., U6) promoter operably linked to a nucleic acid agent encoding at least one gRNA and / or a Pol2 (e.g., CamV35S) promoter operably linked to a nucleic acid sequence encoding the genome editing agent or a nucleic acid sequence encoding a fluorescent reporter (as described in certain embodiments hereinafter).

[0227] According to certain embodiments, the construct is useful for transient expression by Agrobacterium-mediated transformation (Helens et al., 2005, Plant Methods 1:13). Methods of transient transformation are further described herein.

[0228] According to certain embodiments, the nucleic acid sequence contained in the construct lacks a sequence homologous to the genome of the plant cell other than any guide sequence in the sgRNA sequence so as to avoid integration into the plant genome.

[0229] In certain embodiments, the nucleic acid construct is a non-integrating construct, and preferably the nucleic acid sequence encoding the fluorescent reporter is also non-integrating. As used herein, "non-integrating" refers to a construct or sequence that is not actively designed to facilitate integration into the genome of the plant of interest. For example, a functional T-DNA vector system for Agrobacterium-mediated genetic transformation is not a non-integrating vector system because this system is actively designed to be integrated into the plant genome. Similarly, a fluorescent reporter gene sequence or selectable marker sequence having flanking sequences homologous to the genome of the plant of interest for promoting homologous recombination of the fluorescent reporter gene sequence or selectable marker sequence into the genome of the plant of interest would not be a non-integrating fluorescent reporter gene sequence or selectable marker sequence.

[0230] A variety of cloning kits can be used according to the teachings of some embodiments of the present invention.

[0231] According to certain embodiments, the nucleic acid construct is a binary vector. Examples of binary vectors are pBIN19, pBI101, pBinAR, pGPTV, pCAMBIA, pBIB-HYG, pBecks, pGreen or pPZP (Hajukiewicz, P. et al., Plant Mol. Biol. 25, 989 (1994), and Hellens et al., Trends in Plant Science 5, 446 (2000)).

[0232] Examples of other vectors that can be used in other methods of DNA delivery (e.g., transfection, electroporation, bombardment, viral inoculation) are pGE-s They are gRNA (Zhang et al., Nat. Comms. 2016 7:12697), pJIT163-Ubi-Cas9 (Wang et al., Nat. Biotechnol 2004 32,947-951), and pICH47742::2x35S-5’UTR-hCas9(STOP)-NOST (Belhan et al., Plant Methods 2013 11;9(1):39).

[0233] Embodiments described herein are methods for selecting cells comprising genome editing events, comprising: (a) transforming cells of a banana plant with a nucleic acid construct comprising a genome editing agent (as described above) and a fluorescent reporter; (b) selecting transformed cells that exhibit fluorescence emitted by the fluorescent reporter using flow cytometry or imaging; (c) culturing the transformed cells comprising genome editing events generated by the DNA editing agent for a time sufficient for loss of expression of the DNA editing agent to obtain cells that comprise genome editing events generated by the DNA editing agent but lack the DNA encoding the DNA editing agent; also relates to a method comprising the steps above.

[0234] According to some embodiments, the method further comprises, after step (c), verifying loss of expression of the fluorescent reporter in the transformed cells.

[0235] According to some embodiments, the method further comprises, after step (c), verifying loss of expression of the DNA editing agent in the transformed cells.

[0236] Non-limiting embodiments of the method are described in the flowchart of FIG. 1.

[0237] According to certain embodiments, the plant is a plant cell, e.g., a plant cell in an embryogenic cell suspension.

[0238] According to certain embodiments, the plant cell is a protoplast.

[0239] This protoplast is derived from any plant tissue, such as roots, leaves, embryonic cell suspensions, callus or seedling tissues.

[0240] There are several methods for introducing DNA into plant cells, for example, using protoplasts, and those skilled in the art will know which one to choose.

[0241] In embodiments of the present invention, the delivery of nucleic acids may be introduced into plant cells by any method known to those skilled in the art in a method for delivering DNA, RNA, peptides and / or proteins or combinations of nucleic acids and peptides to plant cells. Examples of such methods include, but are not limited to: by transformation of protoplasts (see, for example, U.S. Patent No. 5,508,184); by dry / inhibition-mediated DNA uptake (see, for example, Potrykus et al. (1985) Mol. Gen. Genet. 199:183-8); by electroporation (see, for example, U.S. Patent No. 5,384,253); by agitation with silicon carbide fibers (see, for example, U.S. Patent Nos. 5,302,523 and 5,464,765); by Agrobacterium-mediated transformation (see, for example, U.S. Patent Nos. 5,563,055, 5,591,616, 5,693,512, 5,824,877, 5,981,840 and 6,384,301); by acceleration of DNA-coated particles (see, for example, U.S. Patent Nos. 5,015,580, 5,550,318, 5,538,880, 6,160,208, 6,399,861 and 6,403,865) and by nanoparticles, nanocarriers and cell-penetrating peptides (WO 201126644A2; WO 2009046384A1; WO 2008148223A1).

[0242] As other methods of transfection (transformation), the use of transfection reagents (e.g., Lipofectin, ThermoFisher), dendrimers (Kukowska-Latallo, J.F. et al., 1996, Proc. Natl. Acad. Sci. USA 93, 4897-902), cell-penetrating peptides (Mae et al., 2005, Internalisation of cell-penetrating peptides into tobacco protoplasts, Biochimica et Biophysica Acta 1669(2):101-7) or polyamines (Zhang and Vinogradov, 2010, Short biodegradable polyamines for gene delivery and transfection of brain capillary endothelial cells, J Control Release, 143(3):359-366) can be mentioned.

[0243] According to certain embodiments, the introduction of DNA into plant cells (e.g., protoplasts) is performed by electroporation.

[0244] According to certain embodiments, the introduction of DNA into plant cells (e.g., protoplasts) is performed by biolistics / microprojectile bombardment.

[0245] According to certain embodiments, to introduce DNA into protoplasts, the method includes polyethylene glycol (PEG)-mediated DNA uptake. For further details, see Karesch et al. (1991) Plant Cell Rep. 9:575-578; Mathur et al. (1995) Plant Cell Rep. 14:221-226; Negrutiu et al. (1987) Plant Cell Mol. Biol. 8:363-373. Next, the protoplasts are cultured under conditions that allow the protoplasts to develop cell walls, initiate division to form callus, develop shoots and roots, and regenerate whole plants.

[0246] Transient transformation can also be achieved by viral infection using modified plant viruses.

[0247] Viruses that have been shown to be useful for transformation of plant hosts include CaMV, TMV, TRV, and BV. Transformation of plants using plant viruses is described in U.S. Patent No. 4,855,237 (BGV), European Patent Application Publication No. 67,553 (TMV), Japanese Patent Application Laid-Open No. 63-14693 (TMV), European Patent Application Publication No. 194,809 (BV), European Patent Application Publication No. 278,667 (BV); and Gluzman, Y. et al., Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pages 172-189 (1988). Pseudovirus particles for use in expressing foreign DNA in many hosts including plants are described in International Publication Pamphlet No. 87 / 06261.

[0248] The construction of plant RNA viruses for the introduction and expression of non-viral foreign nucleic acid sequences in plants is demonstrated by the above references and Dawson, W. O. et al., Virology (1989) 172:285-292; Takamatsu et al., EMBO J. (1987) 6:307-311; French et al., Science (1986) 231:1294-1297; and Takamatsu et al., FEBS Letters (1990) 269:73-76.

[0249] If the virus is a DNA virus, suitable modifications can be made to the virus itself. Alternatively, for the simplicity of constructing the desired viral vector having foreign DNA, the viral DNA may first be cloned into a bacterial plasmid. Thereafter, this viral DNA can be removed from the plasmid. If the virus is a DNA virus, it is possible for the bacterial origin of replication to be ligated to the viral DNA, and the viral DNA is then replicated by that bacterium. The transcription and translation of this DNA results in coat proteins that will encapsulate the viral DNA. If the virus is an RNA virus, the virus is generally cloned as cDNA and inserted into a plasmid. This plasmid is then used to generate all of the above constructs. The RNA virus is produced by transcription of the viral sequences of the plasmid and translation of the viral genes to yield the coat protein(s) that encapsulate the viral RNA.

[0250] The construction of plant RNA viruses for the introduction of non-viral foreign nucleic acid sequences such as those contained in the constructs of some embodiments of the present invention and for expression in plants is demonstrated by the above references and the specification of U.S. Patent No. 5,316,931.

[0251] In one embodiment, a natural coat protein coding sequence is deleted from the viral nucleic acid, and a non-natural plant viral coat protein coding sequence, and a non-natural promoter that can be expressed in a plant host, package the recombinant plant viral nucleic acid, and ensure systemic infection of the host by the recombinant plant viral nucleic acid, preferably a subgenomic promoter of the non-natural coat protein coding sequence, is inserted. Alternatively, the coat protein gene may be inactivated by inserting a non-natural nucleic acid sequence therein so that a protein is produced. This recombinant plant viral nucleic acid may contain one or more additional non-natural subgenomic promoters. Each non-natural subgenomic promoter can transcribe or express an adjacent gene or nucleic acid sequence in a plant host and cannot recombine with each other or with the natural subgenomic promoter. When multiple nucleic acid sequences are included, the non-natural (foreign) nucleic acid sequence may be inserted adjacent to the natural plant viral subgenomic promoter or the natural and non-natural plant viral subgenomic promoters. This non-natural nucleic acid sequence is transcribed or expressed in the host plant under the control of the subgenomic promoter, and a desired product is produced.

[0252] In a second embodiment, a recombinant plant viral nucleic acid is provided as in the first embodiment, except that the natural coat protein coding sequence is placed adjacent to one of the non-natural coat protein subgenomic promoters instead of the non-natural coat protein coding sequence.

[0253] In the third embodiment, there is provided a recombinant plant viral nucleic acid in which the natural coat protein gene is adjacent to its subgenomic promoter, and one or more non-natural subgenomic promoters are inserted into the viral nucleic acid. The inserted non-natural subgenomic promoter can transcribe or express an adjacent gene in a plant host and cannot recombine with each other or with the natural subgenomic promoter. The non- natural nucleic acid sequence may be inserted adjacent to this non-natural subgenomic plant viral promoter.

[0254] In the fourth embodiment, a recombinant plant viral nucleic acid is provided as in the third embodiment, except that the natural coat protein coding sequence is replaced by a non-natural coat protein coding sequence.

[0255] The viral vector is encapsulated by a coat protein encoded by a recombinant plant viral nucleic acid for producing a recombinant plant virus. This recombinant plant viral nucleic acid or recombinant plant virus is used to infect a suitable host plant. This recombinant plant viral nucleic acid enables replication in a host, spread throughout the host, and transcription or expression of one or more foreign genes (isolated nucleic acids) in the host for producing a desired protein.

[0256] Regardless of the transformation / infection method used, the present teachings further relate to any cell, such as a plant cell (e.g., protoplast) or a bacterial cell, containing the nucleic acid construct(s) described herein.

[0257] After transformation, the cells are subjected to flow cytometry to select transformed cells that exhibit fluorescence emitted by a fluorescent reporter (i.e., a fluorescent protein).

[0258] As used herein, "fluorescent protein" refers to a polypeptide that emits fluorescence and is usually detectable by flow cytometry or imaging, and can therefore be used as a basis for the selection of cells expressing such a protein.

[0259] Examples of fluorescent proteins that can be used as reporters are green fluorescent protein (GFP), blue fluorescent protein (BFP), and red fluorescent protein dsRed. A non-limiting list of fluorescent reporters or other reporters includes proteins detectable by luminescence (e.g., luciferase) or proteins detectable by colorimetric analysis (e.g., GUS). According to certain embodiments, the fluorescent reporter is DsRed or GFP.

[0260] This analysis is usually performed within 24 to 72 hours, such as within 48 to 72 hours or within 24 to 28 hours, after transformation. To ensure transient expression, antibiotic selection, such as an antibiotic against a selectable marker, is not used. The culture may still contain an antibiotic, but it is not against a selectable marker.

[0261] Flow cytometry of plant cells is usually performed by Fluorescence Activated Cell Sorting (FACS). Fluorescence Activated Cell Sorting (FACS) is a well-known method for separating particles, including cells, based on the fluorescence characteristics of the particles (see, for example, Kamarch, 1987, Methods Enzymol, 151:150-165).

[0262] For example, FACS of GFP-positive cells utilizes visualization of the green-to-red emission spectrum of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by an increase in the ratio of green emission to red emission.

[0263] The following is a non-binding protocol modified from Bastiaan et al., J Vis Exp. 2010;(36):1673. This document is incorporated herein by reference. FACS devices are commercially available, for example, FACSMelody (BD), FACSAria (BD).

[0264] The flow stream is set using a 100 μm nozzle and a sheath pressure of 20 psi (about 0.138 MPa). The cell density and sample injection rate can be adjusted for a particular experiment based on whether the best yield or the largest achievable rate, for example, 10,000,000 cells / ml or less, is desired. To prevent sedimentation of protoplasts, the sample is agitated on the FACS. If FACS clogging becomes a problem, there are three possible troubleshooting steps: 1. Perform backflow of the sample line, 2. Dilute the protoplast suspension to lower the density, 3. Clean the protoplast solution by repeating the filtration step after centrifugation and resuspension. This device is prepared to measure forward scatter light (FSC), side scatter light (SSC) after excitation by a 488 nm laser, and emissions at 530 / 30 nm for GFP and 610 / 20 nm for red spectral autofluorescence (RSA). These are substantially the only parameters used to isolate GFP-positive protoplasts. The following voltage settings can be used: FSC -60V, SSC 250V, GFP 350V, and RSA 335V. Note that the optimal voltage settings vary for each FACS and need to be adjusted throughout the useful life of the cell sorter.

[0265] The process begins by assembling a dot plot of forward scattered light versus side scattered light. A voltage setpoint is applied such that the measured events fall at the center of the plot. Next, a dot plot of green fluorescence signal versus red fluorescence signal is created. When looking at the wild-type (non-GFP) protoplast suspension, a voltage setpoint is applied such that the measured events give a diagonal population that clusters in the center of the plot. The protoplast suspension derived from the GFP marker line will generate a distinct population of green fluorescent events that are never seen in the wild-type sample. Compensation constraints are set to adjust for spectral overlap between GFP and RSA. The appropriate compensation constraint setpoint will allow for better separation of GFP-positive protoplasts from non-GFP protoplasts and debris. The constraints used in this application are as follows: RSA, minus 17.91% GFP. Gates are set to identify GFP-positive events, and a negative control of non-GFP protoplasts is needed to assist in defining the gate boundaries. A forward scatter light cutoff is performed to exclude small debris from the analysis. GFP-positive events are visualized on the FSC vs SSC plot to help determine the placement of the cutoff. For example, the cutoff is set at 5,000. Note that FACS will count debris as sort events, and samples with high levels of debris may have a different percentage of GFP-positive events than expected. This is not necessarily a problem. However, the more debris in the sample, the longer the sort will take. Depending on the experiment and the abundance of the cell type being analyzed, the FACS accuracy mode is set to pursue either the optimal yield or optimal purity of the sorted cells.

[0266] After FACS sorting, a positively selected pool of transformed plant cells (e.g., protoplasts) presenting a fluorescent marker is collected, and an aliquot may be used to test this DNA editing event (optional step. See Figure 1). Alternatively (or following any validation step), clones are cultured in the absence of selection (e.g., an antibiotic against a selectable marker) until clones develop into colonies, i.e., clones (at least 28 days) and microcalli. After at least 60 - 100 days in culture (e.g., at least 70 days, at least 80 days), a portion of the callus cells is analyzed (validated) for the presence of the DNA editing event and the presence of the DNA editing agent, i.e., the loss of the DNA sequence encoding that DNA editing agent (which indicates the transient nature of the method).

[0267] Thus, clones are verified for the presence of DNA editing events, also referred to herein as "mutations" or "edits", depending on the type of editing sought, e.g., insertions, deletions, insertion - deletions (indels), inversions, substitutions, and combinations thereof.

[0268] According to certain embodiments, the genome editing event comprises a deletion, a single - base pair substitution, or the insertion of genetic material from a second plant that could not otherwise be introduced into the plant of interest by conventional breeding.

[0269] According to certain embodiments, the genome editing event does not include the introduction of foreign DNA into the genome of the plant of interest that would not be expected to be introduced through conventional breeding.

[0270] Methods for detecting array changes are well known in the art and include, but are not limited to, DNA sequencing (e.g., next-generation sequencing), electrophoresis, enzyme-based mismatch detection assays, and hybridization assays such as PCR, RT-PCR, RNase protection, in situ hybridization, primer extension, Southern blot, Northern blot, and dot blot analysis. Various methods used for the detection of single nucleotide polymorphisms (SNPs), such as T7 endonuclease with PCR, heteroduplexes, and Sanger sequencing, can also be used.

[0271] Another method for verifying the presence of DNA editing events, such as indels, includes mismatch cleavage assays that utilize structure-selective enzymes (e.g., endonucleases) that recognize and cleave mismatched DNA.

[0272] Mismatch cleavage assays are a simple and cost-effective method for detecting indels and are therefore a representative procedure for detecting mutations induced by genome editing. This assay uses an enzyme that cleaves heteroduplex DNA at the mismatch site and an additional helical loop formed by multiple nucleotides to give two or more fragments. A PCR product of approximately 300-1000 bp is generated by removing the predicted nuclease cleavage site so that the resulting fragments are not similar in size and can be easily separated by conventional gel electrophoresis or high-performance liquid chromatography (HPLC). End-labeled digestion products can also be analyzed by automated gel electrophoresis or capillary electrophoresis. The frequency of indels at a locus can be estimated by measuring the integrated intensities of the PCR amplification products and the cleaved DNA bands. The digestion step takes 15-60 minutes, and when the DNA preparation step and the PCR step are added, the entire assay can be completed in less than 3 hours.

[0273] Two alternative enzymes are commonly used in this assay. T7 endonuclease 1 (T7E1) is a resolvase that recognizes and cleaves mismatched DNA at the first, second, or third phosphodiester bond upstream of the mismatch. The sensitivity of T7E1-based assays is 0.5–5%. In contrast, Surveyor™ nuclease (Transgenomic Inc., Omaha, Nebraska, USA) is a member of the CEL family of mismatch-specific nucleases derived from celery. This recognizes and cleaves the mismatch portion resulting from the presence of a single nucleotide polymorphism (SNP) or small indel, cleaving both DNA strands downstream of the mismatch. This nuclease can detect indels up to 12 nt and is sensitive to mutations present at a low frequency of approximately 3%, i.e., one in 32 copies.

[0274] Yet another method for verifying the presence of an editing event involves high-resolution melting curve analysis.

[0275] High-resolution melting curve analysis (HRMA) involves amplifying a DNA sequence spanning a genomic target (90–200 bp) by real-time PCR incorporating a fluorescent dye, followed by melting curve analysis of the amplification product. HRMA is based on the loss of fluorescence when the intercalating dye is released from double-stranded DNA during thermal denaturation. This analysis records the temperature-dependent denaturation profile of the amplification product and detects whether the melting process involves one or more molecular species.

[0276] Yet another method is the heteroduplex mobility assay. Mutations can also be detected by directly analyzing the re-hybridized PCR fragments by native polyacrylamide gel electrophoresis (PAGE). This method takes advantage of the difference in the migration of heteroduplex DNA and homoduplex DNA in a polyacrylamide gel. The angle between the matched and mismatched DNA strands caused by indels means that under native conditions, heteroduplex DNA migrates at a significantly slower rate than homoduplex DNA, and they can be easily distinguished based on their mobility. Fragments of 140 - 170 bp can be separated in a 15% polyacrylamide gel. The sensitivity of such an assay can approach 0.5% under optimal conditions, which is close to that of T7E1. After re-annealing of the PCR products, the electrophoretic part of this assay takes about 2 hours.

[0277] Other methods for verifying the presence of editing events are described in detail in Zischewski 2017 Biotechnol. Advances 1(1):95 - 104.

[0278] It will be appreciated that the positive clones may be homozygous or heterozygous for the DNA editing event. One of ordinary skill in the art selects the clones for further culture / regeneration according to the intended use.

[0279] Clones presenting the presence of the desired DNA editing event are further analyzed for the presence of the DNA editing agent, i.e., the loss of the DNA sequence encoding the DNA editing agent (which indicates the transient nature of the method).

[0280] This can be done, for example, by analyzing the expression of the DNA editing agent (e.g., at the mRNA, protein level) by fluorescence detection of GFP or q-PCR.

[0281] Alternatively or in addition, the cells are analyzed for the presence of the nucleic acid construct or a portion thereof described herein, e.g., a reporter polypeptide or the nucleic acid sequence encoding the DNA editing agent.

[0282] Does not show DNA encoding a fluorescent reporter or DNA editing agent (e.g., confirmed by any of the other methods such as fluorescence microscopy, q-PCR and / or Southern blot, PCR, sequencing, etc.), but clones containing the desired DNA editing event(s) [mutation(s)] are isolated for further processing.

[0283] Therefore, these clones can be stored (e.g., cryopreserved).

[0284] Alternatively, cells (e.g., protoplasts) may first grow into a group of plant cells that develop into callus, and then be regenerated into whole plants by regenerating shoots from that callus using plant tissue culture methods (caulogenesis). Growth of protoplasts into callus and regeneration of shoots require an appropriate balance of plant growth regulators in tissue culture media that can be determined for each plant species.

[0285] Protoplasts may also be used for plant breeding using a technique called protoplast fusion. Protoplasts derived from different species are induced to fuse by using an electric field or a solution of polyethylene glycol This technique may be used to generate somatic hybrids in tissue culture.

[0286] Methods for protoplast regeneration are well known in the art. Several factors, namely genotype, donor tissue and its pretreatment, enzymatic treatment for protoplast isolation, methods of protoplast culture, culture, medium, and physical environment, affect the isolation, culture, and regeneration of protoplasts. For a detailed review, see Maheshwari et al., 1986, Differentiation of Protoplasts and of Transformed Plant Cells: 3-36. Springer-Verlag, Berlin.

[0287] The regenerated plants may be further subjected to further breeding and selection if considered appropriate by those skilled in the art.

[0288] The above-mentioned plants or their cells lack a transgene encoding a DNA editing agent.

[0289] The phenotype of the final line, plant or intermediate breeding product can be analyzed, for example, by determining the sequence of a gene encoding a component of the ethylene biosynthesis pathway, its expression at the level (amount) of mRNA or protein, the activity of that protein, and / or analyzing the characteristics (storage life) of the fruit, etc.

[0290] Ethylene production: Ethylene biosynthesis can be measured in small plant pieces by gas chromatography (GC) or laser-based assays (Cristescu SM, Mandon J, Arslanov D, De Pessemier J, Hermans C, Harren FJM. Current methods for detecting ethylene in plants. Ann Bot-London. 2013;111(3):347-60).

[0291] As described herein and in the examples below, the inventors were able to transform bananas using a genome editing agent(s) while avoiding stable genetic recombination.

[0292] Therefore, the methodology of the present invention enables genome editing without the incorporation of selectable or screenable reporters.

[0293] Thus, embodiments of the present invention further relate to plants, plant cells and processed plant products comprising the gene editing event(s) generated according to the teachings of the present invention.

[0294] Thus, the teachings of the present invention also relate to a part of the plants described herein or a processed product thereof.

[0295] Banana fruits, products based on banana fruits, and methods for their production are envisioned using the plants described herein.

[0296] Banana by-products such as peels, leaves, pseudostems, stalks, and inflorescences, and methods for their production, are also envisioned for various food and non-food applications, serving as sources of thickeners, colorants, and flavors, alternative sources for macronutrients and micronutrients, dietary supplements, livestock feed, natural fibers, and sources of natural bioactive compounds and biofertilizers.

[0297] According to certain embodiments, the processed product contains DNA.

[0298] During the term of the patent resulting from this application, many related DNA editing agents are expected to be developed, and the scope of the term DNA editing agent is intended to pre-include all such new technologies.

[0299] As used herein, the term "about" refers to ±10%.

[0300] The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to".

[0301] The term "consisting of" means "including and limited to".

[0302] The term "consisting essentially of" means that a composition, method, or structure may include additional ingredients, steps, and / or components, but only if such additional ingredients, steps, and / or components do not substantially change the basic novel features of the claimed composition, method, or structure.

[0303] As used herein, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, and mixtures thereof.

[0304] Throughout this application, various embodiments of the invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges and individual numerical values within that range. For example, a description of a range such as 1-6 should be considered to have specifically disclosed sub-ranges such as 1-3, 1-4, 1-5, 2-4, 2-6, 3-6, etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

[0305] Whenever a numerical range is indicated herein, it is intended to include any cited numerical value (fractional or integral) within the indicated range. The phrases "ranging between" a first indicated number and a second indicated number, and "ranging from" a first indicated number "to" a second indicated number are used interchangeably herein and are intended to include the first and second indicated numbers and all the fractional and integral numbers therebetween.

[0306] As used herein, the term "method" refers to ways, means, techniques, and procedures for accomplishing a given task, including, but not limited to, ways, means, techniques, and procedures that are known to those of skill in the art of chemistry, pharmacology, biology, biochemistry, and medicine, or that are readily developed from known ways, means, techniques, and procedures by those of skill in the art of chemistry, pharmacology, biology, biochemistry, and medicine.

[0307] When reference is made to a particular sequence listing, such reference should be understood to also encompass sequences that substantially correspond to the complementary sequence, e.g., sequences that contain minor sequence changes resulting from sequencing errors, cloning errors, or other alterations resulting in base substitutions, deletions, or additions. However, the frequency of such changes is less than 1 in 50 nucleotides, or less than 1 in 100 nucleotides, or less than 1 in 200 nucleotides, or less than 1 in 500 nucleotides, or less than 1 in 1000 nucleotides, or less than 1 in 5,000 nucleotides, or less than 1 in 10,000 nucleotides.

[0308] It is understood that any SEQ ID NO disclosed in this application can refer to either a DNA sequence or an RNA sequence, depending on the context in which the SEQ ID NO is referred to, even if the SEQ ID NO is represented only in DNA sequence format or RNA sequence format. For example, a given SEQ ID NO is represented in DNA sequence format (e.g., T is written for thymine), but can refer to either the DNA sequence corresponding to a given nucleic acid sequence, or the RNA sequence of an RNA molecule nucleic acid sequence. Similarly, some sequences are represented in RNA sequence format (e.g., U for uracil), which, depending on the actual type of molecule being described, can refer to either the sequence of an RNA molecule, including dsRNA, or the sequence of a DNA molecule that corresponds to the depicted RNA sequence. In any case, both DNA and RNA molecules having the disclosed sequences with any substitutions are envisioned.

[0309] It is understood that, for the sake of clarity, certain features of the invention described with respect to separate embodiments may be provided in combination in a single embodiment. Conversely, for the sake of brevity, the various features of the invention described with respect to a single embodiment may be provided separately or in any suitable subcombination or, as appropriate, in any other described embodiment of the invention. Specific features described with respect to various embodiments are not to be considered essential features of those embodiments, except in cases where the embodiment would not be operative without those elements.

[0310] The various embodiments and aspects of the invention described hereinabove and claimed in the appended claims are experimentally supported by the following examples.

[0311] As used herein, the term "about" refers to ±10%.

[0312] The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to".

[0313] The term "consisting of" means "including and limited to".

[0314] The term "consisting essentially of" means that a composition, method or structure may include additional ingredients, steps and / or components, but only if such additional ingredients, steps and / or components do not substantially change the basic novel features of the claimed composition, method or structure.

[0315] As used herein, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, and mixtures thereof.

[0316] Throughout this application, various embodiments of the invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges and individual numerical values within that range. For example, a description of a range such as 1-6 should be considered to have specifically disclosed sub-ranges such as 1-3, 1-4, 1-5, 2-4, 2-6, 3-6, etc., and individual numbers within that range, such as 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

[0317] Whenever a numerical range is indicated herein, it is intended that the range include any recited numerical value (fractional or integral) within the indicated range. The phrases "ranging between" and "ranging from" the first recited number to the second recited number are used interchangeably herein and are intended to include the first and second recited numbers and all fractional and integral values therebetween.

[0318] As used herein, the term "method" refers to a way, means, technique, and procedure for accomplishing a given task, and includes, but is not limited to, those that are known to, or readily developed from those known to, persons of ordinary skill in the fields of chemistry, pharmacology, biology, biochemistry, and medicine.

[0319] As used herein, the term "treating" includes precluding the progression of a condition, substantially inhibiting, slowing or reversing a condition, substantially improving the clinical or aesthetical symptoms of a condition, or substantially preventing the appearance of the clinical or aesthetical symptoms of a condition.

[0320] When referring to a particular sequence listing, such reference is understood to also include sequences that substantially correspond to its complementary sequence, e.g., sequences that result from sequencing errors, cloning errors, or other alterations that result in minor sequence variations, or base substitutions, deletions or insertions, provided that the frequency of such changes is less than 1 in 50 nucleotides, or less than 1 in 100 nucleotides, or less than 1 in 200 nucleotides, or less than 1 in 500 nucleotides, or less than 1 in 1000 nucleotides, or less than 1 in 5,000 nucleotides, or less than 1 in 10,000 nucleotides.

[0321] It is understood that any SEQ ID NO. disclosed in the present application can refer to either a DNA sequence or an RNA sequence, depending on the context in which the SEQ ID NO. is recited, even if the SEQ ID NO. is only represented in the DNA sequence format or the RNA sequence format. For example, a certain SEQ ID NO. is represented in the DNA sequence format (e.g., written as T for thymine), but it can refer to either a DNA sequence or an RNA sequence of an RNA molecule nucleic acid sequence. Similarly, some sequences are represented in the RNA sequence format (e.g., written as U for uracil), depending on the actual type of the molecule being described, but it can refer to either the sequence of an RNA molecule including dsRNA, or the sequence of a DNA molecule corresponding to the indicated RNA sequence. In any case, both DNA molecules and RNA molecules having the disclosed sequences with any substitutions are contemplated.

[0322] For clarity, it is understood that certain features of the invention described with respect to separate embodiments may be provided in combination in a single embodiment. Conversely, for brevity, the various features of the invention described with respect to a single embodiment may be provided separately or in any suitable sub-combination, or as appropriate in any other described embodiment of the invention. Specific features described with respect to various embodiments should not be considered essential features of those embodiments, except where the embodiment would be inoperative without those elements. The various embodiments and aspects of the invention described hereinabove and claimed in the appended claims are experimentally supported by the following examples.

[0323] The following examples are referred to hereinafter, which, together with the above description, illustrate some embodiments of the invention without limiting the same.

Examples

[0324] Reference is now made to the following examples, which, together with the above description, illustrate some embodiments of the invention without limiting the same.

[0325] Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are well explained in the literature. See, for example, the following: "Molecular Cloning: A laboratory Manual", Sambrook et al., (1989); "Current Protocols in Molecular Biology", Volumes I - III, Ausubel, R.M. (ed.) (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds.) "Genome Analysis: A Laboratory Manual Series", Volumes 1 - 4, Cold Spring Harbor Laboratory Press, New York (1998); U.S. Patent No. 4,666,828; U.S. Patent No. 4,683,202; U.S. Patent No. 4,801,531; U.S. Patent No. 5,192,659 and the methodology shown in U.S. Patent No. 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I - III, Cellis, J.E. (ed.) (1994); Freshney, "Culture of Animal Cells - A Manual of Basic Technique" by Wiley-Liss, N.Y. (1994), 3rd Edition; "Current Protocols in Immunology", Volumes I - III, Coligan J.E.Stites, D.P. (ed.) (1994); Stites, D.P. et al. (eds.), "Basic and Clinical Immunology" (8th ed.), Appleton & Lange, Norwalk, CT (1994); Mishell, R.I. and Shiigi, S.M. (eds.), "Selected Methods in Cellular Immunology", W.H.Freeman and Co., New York, NY (1980); Available immunoassays are described in detail in the patent and scientific literature. See, for example, U.S. Patent No. 3,791,932; U.S. Patent No. 3,839,153; U.S. Patent No. 3,850,752; U.S. Patent No. 3,850,578; U.S. Patent No. 3,853,987; U.S. Patent No. 3,867,517; U.S. Patent No. 3,879,262; U.S. Patent No. 3,901,654; U.S. Patent No. 3,935,074; U.S. Patent No. 3,984,533; U.S. Patent No. 3,996,345; U.S. Patent No. 4,034,074; U.S. Patent No. 4,098,876; U.S. Patent No. 4,879,219; U.S. Patent No. 5,011,771 and U.S. Patent No. 5,281,521; "Oligonucleotide Synthesis", Gait, M.J. (ed.) (1984); "Nucleic Acid Hybridization", Ham. eds., B.D., and Higgins S.J. (1985); "Transcription and Translation", eds., Hames, B.D., and Higgins S.J. (1984); "Animal Cell Culture", ed., Freshney, R.I. (1986); "Immobilized Cells and Enzymes", IRL Press, (1986); "A Practical Guide to Molecular Cloning", Perbal, B., (1984) and "Methods in Enzymology", Volumes 1 - 317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, California (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual", CSHL Press (1996); all of these are hereby incorporated by reference as if fully set forth herein. Other general references are provided throughout this specification. The procedures in these references are considered to be well known in the art and are provided for the convenience of the reader. All information contained in the above references is hereby incorporated by reference into this specification.

[0326] Materials and Methods Generation and Maintenance of Embryogenic Callus and Cell Suspensions Embryogenic calli are generated from initial explants such as immature male flowers or shoot tips as described by Ma, 1988 (Ma S.S. 1991 Somatic embryogenesis and plant regeneration from cell suspension culture of banana. Proceedings of Symposium on Tissue culture of horticultural crops, Taipei, Taiwan, March 8 - 9, 1988, pp. 181 - 188) and Schoofs, 1997 (Schoofs H. 1997. The origin of embryogenic cells in Musa. PhD thesis, KU Leuven, Belgium). The embryogenic cell suspension is initiated in a liquid medium from newly generated highly embryogenic calli. 80% of this medium was renewed every 12 - 14 days until the first cell suspension was well established (6 - 9 months).

[0327] sgRNA cloning The transfection plasmid used was composed of four modules including: 1. eGFP driven by the CaMV35s promoter terminated by the G7 terminator sequence; 2. Cas9 (optimized for human codons) driven by the CaMV35s promoter terminated by the Mas terminator sequence; 3. the AtU6 promoter driving the sgRNA for guide 1; 4. the AtU6 promoter driving the sgRNA for guide 2. Binary vectors such as pCAMBIA or pRI - 201 - AN DNA can be used.

[0328] Verification of the gene editing system by targeting the exogenous reporter gene GFP The non-genetic recombination GE system proposed here was verified and optimized by targeting the DNA of the foreign gene (GFP). To analyze the strength of different RNA polymerase III (pol-III) promoters, sgRNAs were designed to target eGFP in the above CRISPR Cas9 complex, and then the effects of different promoters on knocking out eGFP expression in transformed cells were tested.

[0329] Specifically, plasmids (e.g., pBluescript, pUC19) contained four transcription units driven by different pol-II and pol-III promoters (e.g., CAMV35S, U6), Cas9, eGFP, dsRED, and sgRNA-GFP. These plasmids were transfected into protoplast cultures and analyzed by FACS after an incubation time of 24 - 72 hours. The high frequency in dsRED (or mCherry, RFP) expression indicated high transfection efficiency, and the low frequency in eGFP expression indicated successful gene editing by CRISPR-Cas9. Therefore, the line showing the lowest eGFP:dsRED expression ratio was the selected pol-III promoter because it caused the highest percentage of eGFP inactivation by the CRISPR Cas9 complex. For transient expression, plasmids containing four transcription units were used. The first transcription unit contained the CaMV-35S promoter driving the expression of Cas9 and the tobacco mosaic virus (TMV) terminator. The next transcription unit consisted of another CaMV-35S promoter driving the expression of eGFP and the nos terminator. The third and fourth transcription units each contained the Arabidopsis thaliana U6 promoter expressing the sgRNA for the target gene (as described above, each vector contained two sgRNAs).

[0330] Final plasmid design Protoplast isolation

[0331] Plant materials (e.g., leaves, callus, cell suspension) were incubated in a digestion solution (1% cellulase, 0.5% macerozyme, 0.5% driselase, 0.4 M mannitol, 154 mM NaCl, 20 mM KCl, 20 mM MES pH 5.6, 10 mM CaCl2) at room temperature for 4 - 24 hours with gentle shaking to isolate protoplasts. After digestion, the remaining plant materials were washed with W5 solution (154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 2 mM MES pH 5.6), and the protoplast suspension was filtered through a 40 μm filter. After centrifugation at 80 g for 3 minutes at room temperature, the protoplasts were resuspended in 2 ml of W5 buffer and sedimented by gravity on ice. The final protoplast pellet was resuspended in 2 ml of MMg (0.4 M mannitol, 15 mM MagCl2, 4 mM MES pH 5.6), and the protoplast concentration was determined using a hemocytometer. The protoplast viability was estimated using trypan blue staining.

[0332] Polyethylene glycol (PEG)-mediated plasmid transfection. PEG-transfection of banana protoplasts was performed using a modified version of the strategy reported by Wang et al. (2015) [Wang, H. et al., An efficient PEG-mediated transient gene expression system in grape protoplasts and its application in subcellular localization studies of flavonoids biosynthesis enzymes. Scientia Horticulturae, 2015. 191: 82 - 89]. Protoplasts were adjusted to 2 - 5×10 6Resuspended to a density of protoplasts / ml. 100 - 200 μl of the protoplast suspension was added to the tube containing the plasmid. The plasmid:protoplast ratio greatly affects the transformation efficiency, and thus the plasmid concentration range in the protoplast suspension, 5 - 300 μg / μl, was assayed. PEG solution (100 - 200 μl) was added to this mixture and incubated at 23°C for various lengths of time in the range of 10 - 60 minutes. The PEG4000 concentration was optimized, and the range of 20 - 80% PEG4000 in the solution containing 200 - 400 mM mannitol and 100 - 500 mM CaCl 2 was assayed. The protoplasts were then washed in W5, centrifuged at 80 g for 3 minutes, resuspended in 1 ml of W5 in advance, and incubated at 23°C in the dark. After incubation for 24 - 72 hours, fluorescence was detected by microscopy.

[0333] Electroporation Plasmids containing Pol2-driven GFP / RFP, Pol2-driven NLS-Cas9, and Pol3-driven sgRNA targeting the relevant genes (see the list in Table 2 above) were introduced into the above cells using electroporation (BIORAD - GenePulserII; Miao and Jian 2007 Nature Protocols 2(10):2348 - 2353). 500 μl of protoplasts was transferred to an electroporation cuvette and mixed with 100 μl of plasmid (10 - 40 μg DNA). The protoplasts were subjected to electroporation at 130 V and 1,000 F and incubated at room temperature for 30 minutes. 1 ml of protoplast medium was added to each cuvette, and this protoplast suspension was poured into a small Petri dish. After incubation for 24 - 48 hours, fluorescence was detected by microscopy.

[0334] FACS sorting of fluorescent protein-expressing cells Forty-eight hours after plasmid / RNA delivery, cells were harvested and sorted for fluorescent protein expression using a flow cytometer to enrich for GFP / editor-expressing cells [Chiang, T.W. et al., CRISPR-Cas9(D10A) nickase-based genotypic and phenotypic screening to enhance genome editing. Sci Rep, 2016. 6: p.24356]. This enrichment step enables the omission of antibiotic selection and the collection of only cells transiently expressing the fluorescent protein, Cas9, and sgRNA. These cells can be further tested for editing of the target gene by non-homologous end joining (NHEJ) and the corresponding loss of gene expression.

[0335] Colony formation A portion of the fluorescent protein-positive cells was sampled and used for DNA extraction and genomic editing (GE) testing, and a portion was plated at high dilution in a liquid medium and allowed to form colonies for 28 - 35 days. Colonies were picked, grown, and divided into two aliquots. One aliquot was used for DNA extraction and genomic editing (GE) testing and CRISPR DNA-free testing (see below), and the other was kept in culture medium until its status was verified. Only those clearly shown to be GE and CRISPR DNA-free were selected for the next step.

[0336] Twenty days later in the dark (starting from the separation for GE analysis, i.e., day 60. So overall day 80), the colonies were transferred to the same medium except that the glucose was reduced to (0.46 M) and 0.4% agarose, and incubated at low light. After six weeks, the agarose was sliced and placed in a protoplast medium containing 0.31 M glucose and 0.2% Gelrite®. After one month, the protocolonies (i.e., callus) were subcultured into a regeneration medium (half-strength MS + B5 vitamins, 20 g / l sucrose). The regenerated plantlets were placed on a solid medium (0.8% agar) at 28 °C under low light. After two months, the plantlets were transferred to soil and placed in a greenhouse with 80 - 100% humidity.

[0337] Screening for gene modification and absence of CRISPR system DNA From each colony, DNA was extracted from an aliquot of GFP-sorted protoplasts (any step), and from protoplast-derived colonies, and a PCR reaction was carried out using primers flanking the target gene. Measurements were taken to sample colonies as the positive colonies were to be used for plant regeneration. A control reaction from protoplasts subjected to the same method except not using Cas9-sgRNA was included and considered wild type (WT). The PCR products were then separated on an agarose gel to detect any change in product size compared to WT. PCR reaction products different from the WT product were cloned into pBLUNT or PCR-TOPO (Invitrogen). Alternatively, sequencing was used to verify the above editing events. The resulting colonies were collected, plasmids were isolated, and sequenced to determine the nature of the mutations. To verify the absence of CRISPR system DNA / RNA and to detect mutations at the genomic DNA level, clones (colonies or calli) with mutations predicted to result in domain alterations or complete loss of the corresponding protein were selected for whole-genome sequencing. Positive clones presenting the desired GE were first tested for GFP expression by microscopy analysis (compared to WT). Next, GFP-negative plants were tested for the presence of the Cas9 cassette by PCR using primers specific to either the Cas9 sequence or any other sequence of its expression cassette (or next-generation sequencing, NGS). Other regions of the above constructs can also be tested to confirm that nothing of the original construct is in the genome.

[0338] Plant regeneration

[0339] Plant regeneration Ethylene production: Ethylene biosynthesis can be measured in small plant pieces by gas chromatography (GC) or laser-based assays (Cristescu et al., 2013, supra).

[0340] Example 2 Genome editing in banana ACS and ACO genes and plant regeneration [Table 1]

[0341] The sgRNAs and target sequences are described in Figure 26.

[0342] A robust protocol for efficient isolation of protoplasts from Musa malaccensis cell suspensions was carried out according to Example 1 above. Subsequently, the protoplasts were transfected with a plasmid carrying the CRISPR / Cas9 machinery for targeting the genes of interest (endogenous ACS and ACO genes), and cells expressing the reporter were enriched using FACS sorting. To achieve this, the inventors (i) generated and maintained embryogenic material, (ii) isolated protoplasts from the material, (iii) transfected with specific plasmids targeting the ACS gene and / or ACO gene, (iv) enriched cells expressing a fluorescent marker as a proxy for cells carrying the CRISPR / Cas9 complex and the sgRNA targeting the gene of interest (e.g., mCherry), and (v) advanced the sorted protoplasts into the protoplast regeneration pipeline to regenerate vegetative bodies.

[0343] To test whether viable protoplasts could be recovered from Musa acuminata plant material, banana plant material (cell suspension) was incubated in a digestion solution at room temperature for 4 - 24 hours with gentle shaking. After digestion, the plant material was washed, filtered, and resuspended in 2 ml of MMG buffer (0.4 M mannitol, 15 mM MagCl2, 4 mM MES pH 5.6). The protoplast concentration was determined and adjusted to 1×10 6 Next, the DNA plasmid pAC2010 (carrying mCherry as a fluorescent marker) was incubated with banana-derived protoplasts in the presence of polyethylene glycol (PEG). The expression of mCherry in these protoplasts was detected by fluorescence microscopy 3 days after transfection (Figure 3).

[0344] The next step in recovering gene-edited plants is to deliver the CRISPR / Cas9 complex and the sgRNA targeting the gene of interest into banana protoplasts, concentrate the cells carrying such a complex by fluorescence-activated cell sorting (FACS), and thereby separate the successfully transfected banana cells that transiently express the above fluorescent protein, Cas9, and the above sgRNA. Using FACS, positive mCherry-expressing protoplasts were concentrated and collected (Figure 4A). It was confirmed that the sorted protoplasts were still intact and actually expressed the fluorescent marker as seen by fluorescence microscopy (Figure 4B).

[0345] Next, the transient nature of the transfection of the CRISPR / Cas9 complex and sgRNA targeting the gene of interest in banana protoplasts was examined. Since all of our plasmids consist of a fluorescent marker (e.g., dsRed, mCherry), Cas9, and sgRNAs (controlled by the U6 promoter and targeting the endogenous gene of interest), the expression of the above fluorescent marker in the transfected banana protoplasts was observed over time, and the number of mCherry-positive protoplasts was used as a proxy to obtain an indication of how long the CRISPR / Cas9 complex and sgRNA could be expressed (Figs. 5A - 5C). Using FACS, the percentage of mCherry-positive banana protoplasts was quantified over time, and the total number of mCherry-positive banana protoplasts at 3 days post transfection (3dpt) was set to 100%. Already at 10dpt, the mCherry-positive banana protoplasts had decreased by 30% of the initial number of mCherry-positive banana protoplasts, and by 25dpt, it was found that almost 80% of the transfected banana protoplasts showed no fluorescence (Fig. 5C). Even in unsorted banana protoplasts, mCherry expression was monitored microscopically at 3dpt (Fig. 5A; Fig. 6A), 6dpt (Fig. 6A), and 10dpt (Fig. 5B; Fig. 6A), thereby confirming that mCherry expression actually decreased over time. Furthermore, fluorescence microscopy of sorted banana protoplasts showed a progressive decrease in the number and intensity of mCherry-positive protoplasts (Fig. 6B), as seen by FACS (Fig. 4A). Taking all these together, these results indicate that the expression of vectors carrying the CRISPR / Cas9 complex and sgRNA is transient and that further Cas9 activity or integration into the plant genome is not expected.

[0346] Reducing ethylene levels in banana plants may lead to an extended shelf life of banana fruits. However, attempts have been made to knock out genes involved in ethylene biosynthesis, such as the highlighted ACS and ACO (Figures 7A, 7B), in order to reduce ethylene levels in banana plants. However, the banana genome contains multiple sequences that are homologous to these genes.

[0347] To identify genes within the banana genome that encode functional ACS and ACO, homologous sequences from characterized pathways in model or crop species were identified. This process aims at reconstructing the evolutionary history of the genes by phylogenetic analysis, screening candidates by verifying the expression of candidates in general and target tissues, and sequencing candidate genes to ensure appropriate sgRNA design (to avoid mismatches), involving a series of sequential steps for comparative analysis of DNA and protein sequences. This procedure enabled the selection of genes, the identification of optimized target regions (conserved and potentially catalytic domains) for knockout, and the design of appropriate sgRNAs.

[0348] This pipeline is based on the assumption that homologous proteins with a common ancestor may have similar functions, and by performing phylogenetic reconstruction, gene families are established and evaluated for functional diversity in the context of evolution. This is particularly important for plant species that have experienced large-scale genome duplications and developed gene families. However, paralogs within a gene family do not necessarily have the same function, and part of this process will target selected genes within the family, either individually or as a group considering redundancy.

[0349] Put simply, the synthesis of ethylene involves a three-step reaction. The enzyme S-adenosyl-methionine synthase (S-AdoMet) catalyzes the adenosylation of methionine. Subsequently, S-AdoMet is metabolized by the enzyme ACC synthase (ACS) into the first compound involved in ethylene biosynthesis, 1-aminocyclopropane-1-carboxylic acid (ACC). Finally, ACC is converted into ethylene by the enzyme ACC oxidase (ACO) (Figure 7A) (Cara and Giovannoni. 2008. Plant Science. Vol. 175, pp. 106-113). During ripening, in climacteric fruits such as bananas, both ACC synthase (ACS) and ACC oxidase (ACO) are induced and contribute to the regulation of ethylene biosynthesis (Figure 7B) (Liu et al., 1999. Plant Physiology. Vol. 121, pp. 1257-1265). The regulation of ethylene has been proposed as a two-system process, in which System 1 is functional during normal vegetative growth, ethylene has a self-inhibitory role, and is involved in producing basal ethylene levels detected in all tissues, including non-climacteric fruit tissues, while System 2 functions during the ripening and perhaps senescence of climacteric fruits (Figures 7A - 7B). During the transition stage, ripening regulatory genes such as RIN and CNR have been identified, as well as the induction of a specific ACS gene (LeACS4) that leads to the autocatalytic reaction of ethylene, which provides negative feedback to System 1. In addition, other ACS genes and ACO genes (LeACS2, 4 and LeACO1, 4) are induced, and these are involved in high ethylene production via System 2 (Figure 7A) (Cara and Giovannoni. 2008. Plant Science. Vol. 175, pp. 106-113).

[0350] The whole-genome sequence analysis of Musa acuminata has revealed specific ancestral whole-genome duplication (WGD) and gene fractionation in the Musa genus lineage The impact has been clarified (D’Hont et al., 2012. Nature, Vol. 488; Martin et al., 2016. BMC Genomics. 17:243). Furthermore, it has been reported that several banana gene families involved in ethylene biosynthesis and signaling evolved through WGD and were preferentially retained (Jourda et al., 2014. New Phytologist, Vol. 202, pp. 986-1000). Interestingly, the major genes in this ethylene pathway evolved, and the gene expression profiles suggested functional redundancy for some of the genes derived from WGD (Jourda et al., 2014. New Phytologist, Vol. 202, pp. 986-1000). Therefore, careful evaluation is required for the selection of candidate genes.

[0351] The ethylene biosynthesis pathway has been well studied in tomato, and the ACS and ACO genes involved in the processes following systems 1 and 2 have been characterized. These characterized genes were used as query sequences. These genes are highlighted in Figures 9 and 10 for ACS and ACO, respectively. The similarity search revealed that both the ACS family and the ACO family are present in banana (Figures 8 and 9, respectively), and several ACS and ACO gene candidates were selected for further study. Sequencing of these candidates in clearly different banana varieties enabled the specific design and selection of the sgRNAs shown in Figure 10. In addition, to gain some insights into the possible roles of these genes, all publicly available expression data of ripening banana fruits were searched for all ACS and ACO candidate genes (ACS: Ma09_g19150; Ma04_g35640; Ma04_g31490. ACO: Ma01_g11540; Ma07_g19730) (Figures 11 and 12, respectively). The RPKM data of each gene from the banana transcriptome database indicated that ACS Ma04_g35640 and ACO Ma07_g19730 are candidate genes to be targeted for reducing ethylene biosynthesis (Figures 11 and 12, respectively). Embodiments of the present invention also contemplate targeting other ACO genes and / or ACS genes to obtain a robust phenotype.

[0352] The ACS genes (Ma09_g19150; Ma04_g35640; Ma04_g31490) were targeted using the two pairs of sgRNAs shown in Figures 13A, 14A, and 15A. These sgRNAs are located between exon 1 and exon 3 of the above candidate genes, and these regions were selected because they are highly conserved among all three candidate genes. Similarly, the ACO genes (Ma01_g11540; Ma07_g19730) were targeted using the two pairs of sgRNAs shown in Figures 6A and 17A. These sgRNAs are located between exon 1 and exon 4 of the above two candidate genes, and although they are designed individually for each gene, they are combined in the transfection plasmid. The sgRNAs were cloned into a transfection plasmid containing mCherry, Cas9, and two sgRNAs driven by the U6 pol3 promoter.

[0353] Next, the CRISPR / Cas9 complex and the sgRNAs targeting the ACS candidate genes and ACO candidate genes were transfected into banana protoplasts, and cells carrying such complexes were enriched by fluorescence-activated cell sorting (FACS). Using the mCherry marker, on the third day after transfection (3 dpt), the transfected banana cells transiently expressing the above fluorescent protein, Cas9, and the above sgRNAs were separated, sorted, and mCherry-positive banana protoplasts were collected. At 6 dpt, DNA was extracted from 5000 sorted protoplasts (Qiagen Plan Dneasy extraction kit). Nested PCR was performed using the primers shown in Figures 13A, 14A, 15A, 16A, and 17A to improve sensitivity. Agarose gels of the amplified regions for all candidate ACS genes and ACO genes are shown in Figures 13B, 14B, 15B, 16B, and 17B. A distinct deletion of approximately 350 bp was observed only for the ACO gene Ma01_g11540 (Figure 17B).

[0354] To evaluate whether the above sgRNA and the above CRISPR / Cas9 complex are active and induce genome editing events in all other ACS genes and ACO genes, a T7E1 assay was performed. It was found that all combinations of sgRNAs induced genome editing events in all ACS genes and ACO genes (ACS: Ma09_g19150; Ma04_g35640; Ma04_g31490. ACO: Ma01_g11540; Ma07_g19730) (Figures 13C, 14C, 15C, 16C, 17C). Furthermore, by cloning and sequencing, the T7E1 results for some of the above genes were confirmed, and it was found that some of the sgRNAs used actually induced indels, as shown in Figures 13D, 15D, 18, 19, 20A, 20B. In conclusion, these results demonstrate that the CRISPR / Cas9 system can be successfully used to introduce precise mutations into endogenous ACS genes and ACO genes, and that the design and selection of sgRNAs affect the efficiency of genome editing.

[0355] In parallel, further sorted mCherry-positive protoplasts were advanced to protoplast regeneration. Briefly, the sorted protoplasts were plated at high dilution in a liquid medium and allowed to form colonies for 28 - 35 days. The colonies were collected, grown, and divided into two aliquots. One aliquot was used for DNA extraction and genome editing (GE) testing as well as CRISPR DNA-free testing, and the other was kept in the culture medium until its status was verified. Only those that clearly showed being GE and CRISPR DNA-free were selected for the next step.

[0356] After 20 days in the dark (starting from when separated for GE analysis, i.e., the 60th day. Thus, on the 80th day overall), the colonies were transferred to the same medium except that the glucose was reduced to 0.46 M and the agarose to 0.4%, and incubated at low light intensity. After 6 weeks, the agarose was sliced and placed in a protoplast medium containing 0.31 M glucose and 0.2% Gelrite®. After 1 month, the protocolonies (i.e., calli) were subcultured into a regeneration medium (half-strength MS + B5 vitamins, 20 g / l sucrose) (Figs. 23A - 23E). Next, mature embryos were passed through a germination medium (GM) containing MS salts and vitamins, and the embryos began to germinate in this medium 1 - 2 weeks after transfer. After 3 - 4 weeks, the germinated embryos are ready to be transferred to a proliferation medium for shoot elongation (Figs. 24A - D).

[0357] In addition, banana embryogenic cell suspensions (ECS) were bombarded with the same plasmids (pAC2007, pAC2008, pAC2010, pAC2011, and pAC2012) used for transfection in order to extend the shelf life. Three-day-old ECS after bombardment, the cells were transferred to a proliferation medium, and as embryos developed from the bombarded ECS, the embryos were passed through an embryo development medium (EDM) and a maturation medium (Figs. 25A - E).

[0358] While the invention has been described in conjunction with its specific embodiments, it will be apparent to those skilled in the art that many alternatives, modifications, and variations will be obvious. Accordingly, it is intended to embrace all such alternatives, modifications, and variations that fall within the spirit and broad scope of the appended claims.

[0359] All publications, patents, and patent applications mentioned herein are hereby incorporated by reference in their entirety to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. In addition, any citation or identification of a reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. Where section headings are used They should be construed as not necessarily being limiting.

Claims

1. 1. A banana plant comprising a genome that includes a loss-of-function mutation in a nucleic acid sequence encoding a component in the ethylene biosynthetic pathway of the banana, The banana plant is 1. A banana plant comprising a genome that includes a loss-of-function mutation in a nucleic acid sequence encoding a component in the ethylene biosynthetic pathway of the banana, said component is selected from the group consisting of Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9), Ma04_g31490 (SEQ ID NO: 8), Ma01_g11540 (SEQ ID NO: 20) and Ma07_g19730 (SEQ ID NO: 27); For Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9), and / or Ma04_g31490 (SEQ ID NO: 8), the loss-of-function mutation is present between exon 1 and exon 3 of the nucleic acid sequence; For Ma01_g11540 (SEQ ID NO: 20) and / or Ma07_g19730 (SEQ ID NO: 27), the loss-of-function mutation is present between exon 1 and exon 4 of the nucleic acid sequence, but not in banana plants; Banana plant.

2. 1. A banana plant part comprising a genome that includes a loss-of-function mutation in a nucleic acid sequence encoding a component in the ethylene biosynthetic pathway of the banana, The banana plant part 1. A banana plant part comprising a genome that includes a loss-of-function mutation in a nucleic acid sequence encoding a component in the ethylene biosynthetic pathway of the banana, said component is selected from the group consisting of Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9), Ma04_g31490 (SEQ ID NO: 8), Ma01_g11540 (SEQ ID NO: 20) and Ma07_g19730 (SEQ ID NO: 27); For Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9), and / or Ma04_g31490 (SEQ ID NO: 8), the loss-of-function mutation is present between exon 1 and exon 3 of the nucleic acid sequence; For Ma01_g11540 (SEQ ID NO: 20) and / or Ma07_g19730 (SEQ ID NO: 27), the loss-of-function mutation is present between exon 1 and exon 4 of the nucleic acid sequence; Not a banana plant part, Banana plant parts.

3. 1. A method for extending the shelf life of bananas, comprising: (a) subjecting a banana plant cell to a DNA editing agent directed to a nucleic acid sequence encoding a component in the ethylene biosynthetic pathway of the banana to generate a loss-of-function mutation in the nucleic acid sequence encoding the ethylene biosynthetic pathway; (b) regenerating a plant from the plant cell. A method comprising: The method is a method for extending the shelf life of bananas, comprising: (a) subjecting a banana plant cell to a DNA editing agent directed to a nucleic acid sequence encoding a component in the ethylene biosynthetic pathway of the banana to generate a loss-of-function mutation in the nucleic acid sequence; (b) regenerating a plant from the plant cell. Equipped with said component is selected from the group consisting of Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9), Ma04_g31490 (SEQ ID NO: 8), Ma01_g11540 (SEQ ID NO: 20) and Ma07_g19730 (SEQ ID NO: 27); For Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9), and / or Ma04_g31490 (SEQ ID NO: 8), the DNA editing agent targets between exon 1 and exon 3 of the nucleic acid sequence; For Ma01_g11540 (SEQ ID NO: 20) and / or Ma07_g19730 (SEQ ID NO: 27), the DNA editing agent targets between exon 1 and exon 4 of the nucleic acid sequence; It is not a method, method.

4. The method of claim 3 further comprising harvesting fruit from the plant.

5. 2. The plant of claim 1, wherein the plant lacks a transgene encoding a DNA editing agent directed against a nucleic acid sequence encoding a component in the ethylene biosynthetic pathway of banana.

6. The plant of claim 1 or claim 5, wherein the mutation is homozygous.

7. 7. The plant or an ancestor thereof of claim 1, claim 5 or claim 6, which has been treated with a DNA editing agent directed to the genomic sequence encoding the component in the ethylene biosynthetic pathway.

8. 8. The plant of claim 1, wherein the mutation is selected from the group consisting of a deletion, an insertion, an insertion / deletion (indel) and a substitution.

9. 8. The plant of any one of claims 1 and 5 to 7, wherein the components in the ethylene biosynthetic pathway are selected from the group consisting of 1-aminocyclopropane-1-carboxylic acid synthase (ACS) and ACC oxidase (ACO).

10. The plant according to any one of claims 5 to 9, wherein the DNA editing agent is a DNA editing system selected from the group consisting of meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and CRISPR-Cas.

11. The plant according to any one of claims 5 to 9, wherein the DNA editing agent is a DNA editing system comprising CRISPR-Cas.

12. 12. The plant of any one of claims 1 and 5 to 11, wherein the components in the ethylene biosynthetic pathway are selected from the group consisting of Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9), Ma04_g31490 (SEQ ID NO: 8), Ma01_g11540 (SEQ ID NO: 20) and Ma07_g19730 (SEQ ID NO: 27).

13. for Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9) and / or Ma04_g31490 (SEQ ID NO: 8), the DNA editing agent does not target between exon 1 and exon 3 of the nucleic acid sequence; For Ma01_g11540 (SEQ ID NO: 20) and / or Ma07_g19730 (SEQ ID NO: 27), the DNA editing agent does not target between exon 1 and exon 4 of the nucleic acid sequence; The plant according to claim 12.

14. A plant described in any one of claims 1 and 5 to 13, wherein the DNA editing agent is directed to a nucleic acid coordinate that specifically targets multiple nucleic acid sequences encoding the components in the ethylene biosynthetic pathway.

15. The plant of any one of claims 1 and 5 to 13, wherein the DNA editing agent comprises a nucleic acid sequence that is at least 99% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 47 to SEQ ID NO:

54.

16. A plant described in any one of claims 1 and 5 to 13, wherein the DNA editing agent comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO:

47.

17. The plant of any one of claims 1 and 5 to 13, wherein the DNA editing agent comprises a nucleic acid set forth in SEQ ID NO:

47.

18. The plant according to any one of claims 1 and 5 to 13, wherein the DNA editing agent comprises a plurality of nucleic acid sequences shown in SEQ ID NO: 47 to SEQ ID NO:

54.

19. A plant described in any one of claims 1 and 5 to 13, wherein the DNA editing agent comprises a plurality of nucleic acid sequences shown in SEQ ID NO: 47, SEQ ID NO: 49 or SEQ ID NO:

50.

20. A plant described in any one of claims 1 and 5 to 13, wherein the DNA editing agent comprises a plurality of nucleic acid sequences shown in SEQ ID NO:51 and SEQ ID NO:

53.

21. 21. The plant of claim 1, wherein the banana plant is non-transgenic.

22. 3. The plant part of claim 2, wherein the plant part lacks a transgene encoding a DNA editing agent directed against a nucleic acid sequence encoding a component in the ethylene biosynthetic pathway of banana.

23. 23. The plant part of claim 2 or claim 22, wherein the mutation is homozygous.

24. 24. A plant part or an ancestor thereof as described in claim 2, claim 22 or claim 23, which has been treated with a DNA editing agent directed to the genomic sequence encoding the component in the ethylene biosynthetic pathway.

25. 25. A plant part according to any one of claims 2 and 22 to 24, wherein the mutation is selected from the group consisting of a deletion, an insertion, an insertion / deletion (indel) and a substitution.

26. 25. The plant part of any one of claims 2 and 22 to 24, wherein the components in the ethylene biosynthetic pathway are selected from the group consisting of 1-aminocyclopropane-1-carboxylic acid synthase (ACS) and ACC oxidase (ACO).

27. The plant part according to any one of claims 22 to 26, wherein the DNA editing agent is a DNA editing system selected from the group consisting of meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and CRISPR-Cas.

28. The plant part according to any one of claims 22 to 26, wherein the DNA editing agent is a DNA editing system comprising CRISPR-Cas.

29. 29. A plant part according to any one of claims 2 and 22 to 28, wherein the components in the ethylene biosynthetic pathway are selected from the group consisting of Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9), Ma04_g31490 (SEQ ID NO: 8), Ma01_g11540 (SEQ ID NO: 20) and Ma07_g19730 (SEQ ID NO: 27).

30. for Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9) and / or Ma04_g31490 (SEQ ID NO: 8), the DNA editing agent does not target between exon 1 and exon 3 of the nucleic acid sequence; For Ma01_g11540 (SEQ ID NO: 20) and / or Ma07_g19730 (SEQ ID NO: 27), the DNA editing agent does not target between exon 1 and exon 4 of the nucleic acid sequence; 30. A plant part according to claim 29.

31. 31. The plant part of claim 2, and any one of claims 22 to 30, wherein the DNA editing agent is directed to a nucleic acid coordinate that specifically targets multiple nucleic acid sequences encoding the components in the ethylene biosynthetic pathway.

32. The plant part of any one of claims 2 and 22 to 30, wherein the DNA editing agent comprises a nucleic acid sequence that is at least 99% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 47 to SEQ ID NO:

54.

33. 31. The plant part of claim 2, and any one of claims 22 to 30, wherein the DNA editing agent comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO:

47.

34. The plant part of claim 2 and any one of claims 22 to 30, wherein the DNA editing agent comprises a nucleic acid set forth in SEQ ID NO:

47.

35. The plant part according to any one of claims 2 and 22 to 30, wherein the DNA editing agent comprises a plurality of nucleic acid sequences set forth in SEQ ID NO: 47 to SEQ ID NO:

54.

36. 31. The plant part of claim 2, wherein the DNA editing agent comprises a plurality of nucleic acid sequences set forth in SEQ ID NO: 47, SEQ ID NO: 49 or SEQ ID NO:

50.

37. 31. The plant part of claim 2, wherein the DNA editing agent comprises a plurality of nucleic acid sequences set forth in SEQ ID NO:51 and SEQ ID NO:

53.

38. 38. A plant part according to any one of claims 2 and 22 to 37 which is a fruit.

39. The plant part of claim 38, wherein the fruit is dried.

40. 40. The plant part of claim 38 or 39, wherein the fruit is processed.

41. 41. The plant part of any one of claims 2 and 22 to 40, wherein the banana plant is non-transgenic.

42. The method of claim 3 or claim 4, wherein the plant lacks a transgene encoding the DNA editing agent.

43. 43. The method of any one of claims 3, 4 and 42, wherein the mutation is homozygous.

44. 44. The method of any one of claims 3, 4, 42 and 43, wherein the mutation is selected from the group consisting of a deletion, an insertion, an insertion / deletion (indel) and a substitution.

45. 44. The method of any one of claims 3, 4, 42 and 43, wherein the components in the ethylene biosynthetic pathway are selected from the group consisting of 1-aminocyclopropane-1-carboxylic acid synthase (ACS) and ACC oxidase (ACO).

46. The method of any one of claims 3, 4 and 42 to 45, wherein the DNA editing agent is a DNA editing system selected from the group consisting of meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and CRISPR-Cas.

47. The method of any one of claims 3, 4 and 42 to 45, wherein the DNA editing agent is a DNA editing system comprising CRISPR-Cas.

48. 48. The method of any one of claims 3, 4, and 42-47, wherein the components in the ethylene biosynthetic pathway are selected from the group consisting of Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9), Ma04_g31490 (SEQ ID NO: 8), Ma01_g11540 (SEQ ID NO: 20) and Ma07_g19730 (SEQ ID NO: 27).

49. for Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9) and / or Ma04_g31490 (SEQ ID NO: 8), the DNA editing agent does not target between exon 1 and exon 3 of the nucleic acid sequence; For Ma01_g11540 (SEQ ID NO: 20) and / or Ma07_g19730 (SEQ ID NO: 27), the DNA editing agent does not target between exon 1 and exon 4 of the nucleic acid sequence; 49. The method of claim 48.

50. The method of any one of claims 3, 4 and 42 to 49, wherein the DNA editing agent is directed to a nucleic acid coordinate that specifically targets multiple nucleic acid sequences encoding the components in the ethylene biosynthetic pathway.

51. The method of any one of claims 3, 4, and 42 to 49, wherein the DNA editing agent comprises a nucleic acid sequence that is at least 99% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NO:47 to SEQ ID NO:

54.

52. 50. The method of any one of claims 3, 4 and 42 to 49, wherein the DNA editing agent comprises a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO:

47.

53. The method of any one of claims 3, 4 and 42 to 49, wherein the DNA editing agent comprises a nucleic acid set forth in SEQ ID NO:

47.

54. The method of any one of claims 3, 4 and 42 to 49, wherein the DNA editing agent comprises a plurality of nucleic acid sequences set forth in SEQ ID NO: 47 to SEQ ID NO:

54.

55. The method of any one of claims 3, 4 and 42 to 49, wherein the DNA editing agent comprises a plurality of nucleic acid sequences set forth in SEQ ID NO: 47, SEQ ID NO: 49 or SEQ ID NO:

50.

56. The method of any one of claims 3, 4 and 42 to 49, wherein the DNA editing agent comprises a plurality of nucleic acid sequences set forth in SEQ ID NO:51 and SEQ ID NO:

53.

57. 57. The method of any one of claims 3, 4 and 42 to 56, wherein the banana plant is non-transgenic.

Images