Respiratory syncytial virus vaccine

Abstract

The present disclosure relates to respiratory syncytial virus (RSV) ribonucleic acid (RNA) vaccines, as well as methods of using and compositions comprising such vaccines. [Selected Figure] Figure 1

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 62 / 245,208, filed on October 22, 2015; U.S. Provisional Patent Application No. 62 / 247,563, filed on October 28, 2015; and U.S. Provisional Patent Application No. 62 / 248,250, filed on October 29, 2015, under 35 U.S.C. § 119(e), and each application is incorporated herein by reference in its entirety. This application also claims the benefit of U.S. Provisional Patent Application No. 62 / 245,031, filed on October 22, 2015, under 35 U.S.C. § 119(e), and the said application is incorporated herein by reference in its entirety.

Background Art

[0002] Respiratory syncytial virus (RSV) is a single - stranded negative - sense RNA virus belonging to the genus Pneumovirinae of the family Paramyxoviridae. Symptoms in adults are typically similar to sinus infections or colds, but this infection may also be asymptomatic. In elderly adults (e.g., over 60 years old), RSV infection can progress to bronchiolitis or pneumonia. Symptoms in children are often more severe and include bronchiolitis and pneumonia. In the United States, it is estimated that most children are infected with RSV by the age of 3. The RSV virion consists of an internal nucleocapsid composed of viral RNA bound to the nucleoprotein (N), phosphoprotein (P), and large polymerase protein (L). The nucleocapsid is surrounded by the matrix protein (M) and is encapsulated within a lipid bilayer in which the viral fusion (F) protein, attachment (G) protein, and small hydrophobic protein (SH) are incorporated. The viral genome also encodes two non - structural proteins (NS1 and NS2) that inhibit type I interferon activity and the M2 protein.

[0003] Deoxyribonucleic acid (DNA) vaccination is one technique used to stimulate humoral and cellular immune responses against foreign antigens such as RSV antigens. When genetically engineered DNA (e.g., naked plasmid DNA) is directly injected into a living host, a small number of the host cells produce the antigen directly, resulting in a protective immune response. However, this technique has potential problems, including the possibility of insertional mutagenesis that can cause activation of oncogenes or suppression of tumor suppressor genes.

Summary of the Invention

Means for Solving the Problems

[0004] Using the RNA vaccines of the present disclosure, a balanced immune response including both cellular and humoral immunity against RSV can be induced without, for example, bearing the risk of insertional mutagenesis.

[0005] RNA (e.g., mRNA) vaccines can be utilized in various settings depending on the incidence of infectious diseases or the degree or level of unmet medical needs. RNA vaccines can be used to treat and / or prevent infection by various genotypes, strains, and isolates of RSV. The RNA vaccines provided herein have excellent properties in that they have a greater antibody titer and result in a faster response compared to commercially available antiviral therapies. Without wishing to be bound by theory, it is believed that the RNA vaccines of the present disclosure are well designed to produce an appropriate protein conformation during translation because RNA vaccines utilize natural cellular machinery. Different from conventional vaccines that are manufactured ex vivo and can elicit unwanted cellular responses, the RNA vaccines provided herein are delivered to the cell line in a more natural way.

[0006] Some embodiments of the present disclosure provide an RSV vaccine comprising: (i) at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one respiratory syncytial virus (RSV) antigenic polypeptide or an immunogenic fragment thereof (e.g., an immunogenic fragment capable of eliciting an immune response against RSV), and (ii) a pharmaceutically acceptable carrier.

[0007] In some embodiments, the at least one RNA polynucleotide has at least one chemical modification.

[0008] In some embodiments, the antigenic polypeptide is the glycoprotein G or an immunogenic fragment thereof.

[0009] In some embodiments, the antigenic polypeptide is the glycoprotein F or an immunogenic fragment thereof.

[0010] In some embodiments, at least one antigenic polypeptide is the glycoprotein F, and at least one antigenic polypeptide is selected from G, M, N, P, L, SH, M2, NS1, and NS2.

[0011] In some embodiments, at least one antigenic polypeptide is the glycoprotein F, and at least two antigenic polypeptides are selected from G, M, N, P, L, SH, M2, NS1, and NS2.

[0012] In some embodiments, the RNA vaccine further comprises an adjuvant.

[0013] In some embodiments, at least one RNA polynucleotide is encoded by at least one nucleic acid sequence set forth in SEQ ID NO: 1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258, or 259, or a homolog having at least 80% identity to the nucleic acid sequence set forth in SEQ ID NO: 1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258, or 259. In some embodiments, at least one RNA polynucleotide is encoded by at least one nucleic acid sequence set forth in SEQ ID NO: 1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258, or 259, or a homolog having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.8%, or 99.9%) identity to the nucleic acid sequence set forth in SEQ ID NO: 1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258, or 259. In some embodiments, at least one RNA polynucleotide is encoded by at least one fragment of the nucleic acid sequence set forth in SEQ ID NO: 1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258, or 259 (e.g., a fragment having at least one antigenic sequence or at least one epitope).

[0014] In some embodiments, at least one RNA polynucleotide comprises at least one nucleic acid sequence set forth in any of SEQ ID NOs: 260-280, or a homolog having at least 80% identity with the nucleic acid sequence set forth in any of SEQ ID NOs: 260-280. In some embodiments, at least one RNA polynucleotide comprises at least one nucleic acid sequence set forth in any of SEQ ID NOs: 260-280, or a homolog having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.8% or 99.9%) identity with the nucleic acid sequence set forth in any of SEQ ID NOs: 260-280. In some embodiments, at least one RNA polynucleotide comprises at least one fragment of the nucleic acid sequence set forth in any of SEQ ID NOs: 260-280 (e.g., a fragment having at least one antigenic sequence or at least one epitope).

[0015] In some embodiments, the amino acid sequence of the RSV antigenic polypeptide is the amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4, or a fragment thereof, or a homolog having at least 80% (e.g., 85%, 90%, 95%, 98%, 99%) identity to such sequence.

[0016] In some embodiments, the amino acid sequence of the RSV antigenic polypeptide is the amino acid sequence set forth in SEQ ID NOs: 3, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 243 or 245, or a fragment thereof, or a homolog having at least 80% (e.g., 85%, 90%, 95%, 98%, 99%) identity to such sequence.

[0017] In some embodiments, at least one RNA (e.g., mRNA) polynucleotide encodes an antigenic polypeptide that has at least 90% identity to the amino acid sequences of the present disclosure and has membrane fusion activity. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide that has at least 95% identity to the amino acid sequences of the present disclosure and has membrane fusion activity. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide that has at least 96% identity to the amino acid sequences of the present disclosure and has membrane fusion activity. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide that has at least 97% identity to the amino acid sequences of the present disclosure and has membrane fusion activity. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide that has at least 98% identity to the amino acid sequences of the present disclosure and has membrane fusion activity. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide that has at least 99% identity to the amino acid sequences of the present disclosure and has membrane fusion activity. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide that has 95-99% identity to the amino acid sequences of the present disclosure and has membrane fusion activity.

[0018] In some embodiments, at least one RNA (e.g., mRNA) polynucleotide encodes an antigenic polypeptide having the amino acid sequences of the present disclosure and is a codon-optimized mRNA.

[0019] In some embodiments, at least one RNA (e.g., mRNA) polynucleotide encodes an antigenic polypeptide having the amino acid sequences of the present disclosure and has less than 80% identity to the (corresponding) wild-type mRNA sequence. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide having the amino acid sequences of the present disclosure and has less than 75%, 85% or 95% identity to the wild-type mRNA sequence. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide having the amino acid sequences of the present disclosure and has 30-80%, 40-80%, 50-80%, 60-80%, 70-80%, 75-80% or 78-80% identity to the wild-type mRNA sequence. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide having the amino acid sequences of the present disclosure and has 30-85%, 40-85%, 50-85%, 60-85%, 70-85%, 75-85% or 80-85% identity to the wild-type mRNA sequence. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide having the amino acid sequences of the present disclosure and has 30-90%, 40-90%, 50-90%, 60-90%, 70-90%, 75-90%, 80-90% or 85-90% identity to the wild-type mRNA sequence.

[0020] In some embodiments, at least one RNA (e.g., mRNA) polynucleotide is encoded by a nucleic acid (e.g., DNA) having at least 90% identity to the nucleic acid sequences of the present disclosure. In some embodiments, at least one RNA polynucleotide is encoded by a nucleic acid having at least 95% identity to the nucleic acid sequences of the present disclosure. In some embodiments, at least one RNA polynucleotide is encoded by a nucleic acid having at least 96% identity to the nucleic acid sequences of the present disclosure. In some embodiments, at least one RNA polynucleotide is encoded by a nucleic acid having at least 97% identity to the nucleic acid sequences of the present disclosure. In some embodiments, at least one RNA polynucleotide is encoded by a nucleic acid having at least 98% identity to the nucleic acid sequences of the present disclosure. In some embodiments, at least one RNA polynucleotide is encoded by a nucleic acid having at least 99% identity to the nucleic acid sequences of the present disclosure. In some embodiments, at least one RNA polynucleotide is encoded by a nucleic acid having 95-99% identity to the nucleic acid sequences of the present disclosure.

[0021] In some embodiments, at least one mRNA polynucleotide is encoded by a nucleic acid having the sequences of the present disclosure and has less than 80% identity to the wild-type mRNA sequence. In some embodiments, at least one mRNA polynucleotide is encoded by a nucleic acid having the sequences of the present disclosure and has less than 75%, 85% or 95% identity to the wild-type mRNA sequence. In some embodiments, at least one mRNA polynucleotide is encoded by a nucleic acid having the sequences of the present disclosure and has less than 30-80%, 40-80%, 50-80%, 60-80%, 70-80%, 75-80% or 78-80% identity to the wild-type mRNA sequence. In some embodiments, at least one mRNA polynucleotide is encoded by a nucleic acid having the sequences of the present disclosure and has less than 30-85%, 40-85%, 50-85%, 60-85%, 70-85%, 75-85% or 80-85% identity to the wild-type mRNA sequence. In some embodiments, at least one mRNA polynucleotide is encoded by a nucleic acid having the sequences of the present disclosure and has less than 30-90%, 40-90%, 50-90%, 60-90%, 70-90%, 75-90%, 80-90% or 85-90% identity to the wild-type mRNA sequence.

[0022] In some embodiments, at least one RNA (e.g., mRNA) polynucleotide encodes an antigenic polypeptide having the amino acid sequences of the present disclosure and having at least 80% identity to the wild-type mRNA sequence, but does not contain the wild-type mRNA sequence.

[0023] In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one RSV antigenic polypeptide, and the RNA polynucleotide has at least one chemical modification.

[0024] In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one RSV antigenic polypeptide, the RNA polynucleotide having at least one chemical modification and at least one 5'-end cap, and the RSV vaccine is formulated within lipid nanoparticles.

[0025] In some embodiments, the 5'-end cap is 7mG(5')ppp(5')NlmpNp.

[0026] In some embodiments, the at least one chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, and 2'-O-methyluridine.

[0027] In some embodiments, the lipid nanoparticles comprise a cationic lipid, a PEGylated lipid, a sterol, and a non-cationic lipid. In some embodiments, the cationic lipid is an ionic cationic lipid, the non-cationic lipid is a neutral lipid, and the sterol is cholesterol. In some embodiments, the cationic lipid is selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), bis((Z)-nona-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)-N,N-dimethyl-2-nonylheneicos-12,15-dien-1-amine (L608), and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine (L530).

[0028] In some embodiments, the lipid is

Chemical formula

[0029] In some embodiments, the lipid is

Chemical formula

[0030] Some embodiments of the present disclosure provide an RSV vaccine comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one respiratory syncytial virus (RSV) antigenic polypeptide, wherein at least 80% of the uracils in the open reading frame have a chemical modification and, optionally, is formulated within lipid nanoparticles.

[0031] In some embodiments, 100% of the uracils in the open reading frame have a chemical modification. In some embodiments, the chemical modification is at the 5-position of the uracil. In some embodiments, the chemical modification is N1-methylpseudouridine. In some embodiments, the chemical modification is N1-methylpseudouridine at the 5-position of the uracil. In some embodiments, 100% of the uracils in the open reading frame are modified to include N1-methylpseudouridine.

[0032] Some embodiments of the present disclosure provide a method of inducing an antigen-specific immune response in a subject, comprising administering to the subject an RSV RNA (e.g., mRNA) vaccine in an amount effective to elicit an antigen-specific immune response.

[0033] In some embodiments, the antigen-specific immune response includes a T cell or B cell response or both.

[0034] In some embodiments, the method of eliciting an antigen-specific immune response involves a single administration of an RSV RNA (e.g., mRNA) vaccine. In some embodiments, the method further comprises administering a booster dose of an RSV RNA (e.g., mRNA) vaccine to the subject. The booster vaccine according to the present invention can include any RSV RNA (e.g., mRNA) vaccine disclosed herein and can be the same as the RSV RNA vaccine initially administered. In some embodiments, the same RSV RNA vaccine is administered annually for each RSV season.

[0035] In some embodiments, the RSV RNA (e.g., mRNA) vaccine is administered to the subject by intradermal, intranasal, or intramuscular injection. In some embodiments, the RSV RNA vaccine is administered to the subject by intramuscular injection.

[0036] Also provided herein is an RSV RNA (e.g., mRNA) vaccine for use in a method of inducing an antigen-specific immune response in a subject, the method comprising administering to the subject an RSV vaccine in an amount effective to effect an antigen-specific immune response.

[0037] Further provided herein is the use of an RSV RNA (e.g., mRNA) vaccine in the manufacture of a medicament for use in a method of inducing an antigen-specific immune response in a subject, the method comprising administering to the subject an RSV vaccine in an amount effective to effect an antigen-specific immune response.

[0038] Some aspects of the disclosure provide an RSV RNA (e.g., mRNA) vaccine formulated in an amount effective to effect an antigen-specific immune response in a subject.

[0039] Other aspects of the disclosure provide a method of inducing an antigen-specific immune response in a subject, the method comprising administering to the subject an RSV RNA (e.g., mRNA) vaccine described herein in an amount effective to effect an antigen-specific immune response in the subject.

[0040] In some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in the subject increases by at least 1 log compared to a control (e.g., a control vaccine). In some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in the subject increases by 1 - 3 logs compared to a control (e.g., a control vaccine).

[0041] In some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject increases by at least 2-fold compared to a control (e.g., a control vaccine). In some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject increases by at least 5-fold compared to a control (e.g., a control vaccine). In some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject increases by at least 10-fold compared to a control (e.g., a control vaccine). In some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject increases by 2 to 10-fold compared to a control (e.g., a control vaccine).

[0042] In some embodiments, the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has never received an RSV vaccine. In some embodiments, the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has received an attenuated live RSV vaccine or an inactivated RSV vaccine. In some embodiments, the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has received a recombinant or purified RSV protein vaccine. In some embodiments, the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has received an RSV virus-like particle (VLP) vaccine.

[0043] In some embodiments, the effective amount is equivalent to a dose that reduces the standard therapeutic dose of a recombinant RSV protein vaccine by at least 1 / 2, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject who has received the standard therapeutic dose of a recombinant or purified RSV protein vaccine, or an attenuated live RSV vaccine or an inactivated RSV vaccine, or an RSV VLP vaccine.

[0044] In some embodiments, the effective amount is an amount equivalent to a dose that reduces the standard therapeutic dose of the recombinant RSV protein vaccine by at least 1 / 4, and the titer of the anti-RSV antigenic polypeptide antibody produced in the subject is the same as the titer of the anti-RSV antigenic polypeptide antibody produced in a control subject administered the standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live attenuated RSV vaccine or an inactivated RSV vaccine, or an RSV VLP vaccine.

[0045] In some embodiments, the effective amount is an amount equivalent to a dose that reduces the standard therapeutic dose of the recombinant RSV protein vaccine by at least 1 / 10, and the titer of the anti-RSV antigenic polypeptide antibody produced in the subject is the same as the titer of the anti-RSV antigenic polypeptide antibody produced in a control subject administered the standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live attenuated RSV vaccine or an inactivated RSV vaccine, or an RSV VLP vaccine.

[0046] In some embodiments, the effective amount is an amount equivalent to a dose that reduces the standard therapeutic dose of the recombinant RSV protein vaccine by at least 1 / 100, and the titer of the anti-RSV antigenic polypeptide antibody produced in the subject is the same as the titer of the anti-RSV antigenic polypeptide antibody produced in a control subject administered the standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live attenuated RSV vaccine or an inactivated RSV vaccine, or an RSV VLP vaccine.

[0047] In some embodiments, the effective amount is an amount equivalent to a dose that reduces the standard therapeutic dose of the recombinant RSV protein vaccine by at least 1 / 1000, and the titer of the anti-RSV antigenic polypeptide antibody produced in the subject is the same as the titer of the anti-RSV antigenic polypeptide antibody produced in a control subject administered the standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live attenuated RSV vaccine or an inactivated RSV vaccine, or an RSV VLP vaccine.

[0048] In some embodiments, the effective amount is an amount equivalent to reducing the standard therapeutic dose of the recombinant RSV protein vaccine to 1 / 2 to 1 / 1000, and the titer of the anti-RSV antigenic polypeptide antibody produced in the subject is the same as that of the anti-RSV antigenic polypeptide antibody produced in a control subject administered the standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live attenuated RSV vaccine or an inactivated RSV vaccine, or an RSV VLP vaccine.

[0049] In some embodiments, the effective amount is a total dose of 25 μg to 1000 μg, or 50 μg to 1000 μg, or 25 to 200 μg. In some embodiments, the effective amount is a total dose of 50 μg, 100 μg, 200 μg, 400 μg, 800 μg or 1000 μg. In some embodiments, the effective amount is a dose of 25 μg administered to the subject a total of 2 times. In some embodiments, the effective amount is a dose of 50 μg administered to the subject a total of 2 times. In some embodiments, the effective amount is a dose of 100 μg administered to the subject a total of 2 times. In some embodiments, the effective amount is a dose of 200 μg administered to the subject a total of 2 times. In some embodiments, the effective amount is a dose of 400 μg administered to the subject a total of 2 times. In some embodiments, the effective amount is a dose of 500 μg administered to the subject a total of 2 times.

[0050] In some embodiments, the effective amount administered to the subject is a total dose of 50 μg to 1000 μg (RSV RNA (e.g., mRNA) vaccine).

[0051] In some embodiments, the effectiveness (or efficiency) of the RSV RNA (e.g., mRNA) vaccine against RSV is greater than 60%.

[0052] Vaccine efficacy can be evaluated using standard analyses (see, e.g., Weinberg et al., J Infect Dis. 2010 Jun 1;201(11):1607-10). For example, vaccine efficacy can be determined by a double-blind randomized controlled clinical trial. Vaccine efficacy can be expressed as the proportional reduction in the attack rate (AR) between the test cohorts of unvaccinated (ARU) and vaccinated (ARV) individuals, and can be calculated from the relative risk (RR) of disease in the vaccinated group using the following formula. Efficacy = (ARU - ARV) / ARU × 100, and Efficacy = (1 - RR) × 100

[0053] Similarly, vaccine effectiveness can be evaluated using standard analyses (see, e.g., Weinberg et al., J Infect Dis. 2010 Jun 1;201(11):1607-10). Vaccine effectiveness is an assessment of how much a vaccine (which may already have been shown to be highly effective) reduces disease in a population. This measure can evaluate the net balance of the benefits and harmful effects of a vaccination program under more natural conditions than in a comparative clinical trial, not only for the vaccine itself. Vaccine effectiveness is proportional to vaccine efficacy, but is also affected by how well the target group in the population is immunized, and by other non-vaccine-related factors that affect the "actual" outcomes of hospitalization, outpatient visits, or costs. For example, a retrospective case-control analysis can be used that compares the vaccination rates between a series of infectious disease cases and appropriate controls. Vaccine effectiveness can be expressed as a rate difference using the odds ratio (OR) of developing an infectious disease despite vaccination. Effectiveness = (1 - OR) × 100

[0054] In some embodiments, the efficacy (or efficiency) of an RSV RNA (e.g., mRNA) vaccine against RSV is greater than 65%. In some embodiments, the efficacy (or efficiency) of a vaccine against RSV is greater than 70%. In some embodiments, the efficacy (or efficiency) of a vaccine against RSV is greater than 75%. In some embodiments, the efficacy (or efficiency) of a vaccine against RSV is greater than 80%. In some embodiments, the efficacy (or efficiency) of a vaccine against RSV is greater than 85%. In some embodiments, the efficacy (or efficiency) of a vaccine against RSV is greater than 90%.

[0055] In some embodiments, the vaccine immunizes the subject against RSV for up to 1 year (e.g., during one RSV season). In some embodiments, the vaccine immunizes the subject against RSV for up to 2 years. In some embodiments, the vaccine immunizes the subject against RSV for more than 2 years. In some embodiments, the vaccine immunizes the subject against RSV for more than 3 years. In some embodiments, the vaccine immunizes the subject against RSV for more than 4 years. In some embodiments, the vaccine immunizes the subject against RSV for 5 to 10 years.

[0056] In some embodiments, the subject receiving administration of an RSV RNA (e.g., mRNA) vaccine is about 5 years of age or younger, between about 1 and about 5 years of age (e.g., about 1, 2, 3, 4, 5, or 6 years), between about 6 months and about 1 year of age (e.g., about 6, 7, 8, 9, 10, 11, or 12 months), about 6 months of age or younger, or about 12 months of age or younger (e.g., 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 months, or 1 month). In some embodiments, the subject is born at term (e.g., about 37 - 42 weeks). In some embodiments, the subject was born prematurely before about 36 weeks of gestation (e.g., about 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, or 25 weeks), the subject was born prematurely before about 32 weeks of gestation, or the subject was born prematurely between about 32 weeks and about 36 weeks of gestation.

[0057] In some embodiments, the subject is pregnant (e.g., in the first, second, or third trimester) when receiving administration of an RSV RNA (e.g., mRNA) vaccine. RSV mainly causes lower respiratory tract infections in infants and young children. One - third of RSV - related deaths occur within the first year of life, and 99% of these deaths occur in low - resource countries. Since it is extremely common in the United States, almost all children are infected with this virus before their second birthday. Accordingly, the present disclosure provides an RSV vaccine for maternal immunization to improve prevention of mother - to - child transmission of RSV.

[0058] In some embodiments, the subject has a chronic lung disease (e.g., chronic obstructive pulmonary disease (COPD) or asthma). COPD has two forms: chronic bronchitis, which is accompanied by a mucous - producing chronic cough, and emphysema, which is accompanied by progressive lung damage over time. Thus, a subject receiving administration of an RSV RNA (e.g., mRNA) vaccine may have chronic bronchitis or emphysema.

[0059] In some embodiments, the subject has been exposed to RSV, is susceptible to RSV infection, or is at risk of RSV infection.

[0060] In some embodiments, the subject is in an immunocompromised state (there is a disorder of the immune system, such as an immune system disease or an autoimmune disease).

[0061] In some embodiments, the subject is an elderly subject of about 60 years, about 70 years or older (e.g., about 60, 65, 70, 75, 80, 85 or 90 years old).

[0062] In some embodiments, the subject is a young adult between about 20 years and about 50 years old (e.g., about 20, 25, 30, 35, 40, 45 or 50 years old).

[0063] Some aspects of the present disclosure provide an RSV RNA (e.g., mRNA) vaccine containing a signal peptide linked to an RSV antigenic polypeptide. Thus, in some embodiments, the RSV RNA (e.g., mRNA) vaccine contains at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding a signal peptide linked to an RSV antigenic peptide. Also provided herein is a nucleic acid encoding the RSV RNA (e.g., mRNA) vaccine disclosed herein.

[0064] In some embodiments, the RSV antigenic peptide is the RSV attachment protein (G) or an immunogenic fragment thereof. In some embodiments, the RSV antigenic peptide is the RSV fusion (F) glycoprotein or an immunogenic fragment thereof. In some embodiments, the RSV antigenic peptide is the nucleoprotein (N) or an immunogenic fragment thereof. In some embodiments, the RSV antigenic peptide is the phosphoprotein (P) or an immunogenic fragment thereof. In some embodiments, the RSV antigenic peptide is the large polymerase protein (L) or an immunogenic fragment thereof. In some embodiments, the RSV antigenic peptide is the matrix protein (M) or an immunogenic fragment thereof. In some embodiments, the RSV antigenic peptide is the small hydrophobic protein (SH) or an immunogenic fragment thereof. In some embodiments, the RSV antigenic peptide is the non-structural protein 1 (NS1) or an immunogenic fragment thereof. In some embodiments, the RSV antigenic peptide is the non-structural protein 2 (NS2) or an immunogenic fragment thereof.

[0065] In some embodiments, the signal peptide is an IgE signal peptide. In some embodiments, the signal peptide is an IgE HC (Ig heavy chain epsilon-1) signal peptide. In some embodiments, the signal peptide has the sequence MDWTWILFLVAAATRVHS (SEQ ID NO: 281). In some embodiments, the signal peptide is an IgGκ signal peptide. In some embodiments, the signal peptide has the sequence METPAQLLFLLLLWLPDTTG (SEQ ID NO: 282). In some embodiments, the signal peptide is encoded by the sequence TGGAGACTCCCGCTCAGCTGCTGTTTTTGCTCCTCCTATGGCTGCCGGATACCACCGGC (SEQ ID NO: 287) or AUGGAGACUCCCGCUCAGCUGCUGUUUUUGCUCCUCCUAUGGCUGCCGGAUACCACCGGC (SEQ ID NO: 288). In some embodiments, the signal peptide is selected from the Japanese encephalitis PRM signal sequence (MLGSNSGQRVVFTILLLLVAPAYS, SEQ ID NO: 283), the VSVg protein signal sequence (MKCLYLAFLFIGVNCA, SEQ ID NO: 284), and the Japanese encephalitis JEV signal sequence (MWLVSLAIVTACAGA, SEQ ID NO: 285). In some embodiments, the signal peptide is MELLILKANAITTILTAVTFC (SEQ ID NO: 289).

[0066] Also provided herein is an RSV vaccine comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding a membrane-bound respiratory syncytial virus (RSV) F protein, a membrane-bound DS-Cav1 (stable pre-fusion RSV F protein), or a combination of a membrane-bound RSV F protein and a membrane-bound DS-Cav1, and a pharmaceutically acceptable carrier.

[0067] In some embodiments, the RNA polynucleotide comprises the sequence of SEQ ID NO: 5 and / or the sequence of SEQ ID NO: 7.

[0068] In some embodiments, an effective amount of an RSV RNA (e.g., mRNA) vaccine (e.g., a single dose of an RSV vaccine) results in a 2-fold to 200-fold (e.g., about 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200-fold) increase in serum neutralizing antibodies against RSV as compared to a control (e.g., a control vaccine). In some embodiments, a single dose of an RSV RNA (e.g., mRNA) vaccine results in an about 5-fold, 50-fold, or 150-fold increase in serum neutralizing antibodies against RSV as compared to a control (e.g., a control vaccine). In some embodiments, a single dose of an RSV RNA (e.g., mRNA) vaccine results in an about 2-fold to 10-fold or about 40- to 60-fold increase in serum neutralizing antibodies against RSV as compared to a control (e.g., a control vaccine).

[0069] In some embodiments, the serum neutralizing antibodies are against RSV A and / or RSV B.

[0070] In some embodiments, the RSV vaccine is formulated in MC3 lipid nanoparticles (see, e.g., U.S. Patent Application Publication No. 2013 / 0245107A1 and International Application No. WO2010 / 054401).

[0071] Also provided herein is a method of inducing an antigen-specific immune response in a subject, the method comprising administering to the subject an RSV RNA (e.g., mRNA) vaccine comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding a membrane-bound RSV F protein, a membrane-bound DS-Cav1 (pre-stabilized pre-fusion RSV F protein), or a combination of a membrane-bound RSV F protein and a membrane-bound DS-Cav1, and a pharmaceutically acceptable carrier, in an amount effective to result in an antigen-specific immune response in the subject.

[0072] In some embodiments, the method further comprises administering a booster dose of an RSV RNA (e.g., mRNA) vaccine. In some embodiments, the method further comprises administering a second booster dose of an RSV vaccine.

[0073] In some embodiments, the efficacy of an RNA vaccine RNA (e.g., mRNA) can be significantly improved when combined with a flagellin adjuvant, particularly when an mRNA encoding one or more antigens is combined with an mRNA encoding flagellin.

[0074] An RNA (e.g., mRNA) vaccine combined with a flagellin adjuvant (e.g., an mRNA-encoded flagellin adjuvant) has excellent properties in that it can provide a greater antibody titer and a faster response compared to commercially available vaccine formulations. Without wishing to be bound by theory, it is believed that RNA vaccines, such as mRNA polynucleotides, etc., are well-designed to generate appropriate protein conformations for both antigens and adjuvants during translation because RNA (e.g., mRNA) vaccines utilize natural cellular machinery. Unlike conventional vaccines that are manufactured ex vivo and can induce unwanted cellular responses, RNA (e.g., mRNA) vaccines are delivered to cell lines in a more natural way.

[0075] Some embodiments of the present disclosure provide an RNA (e.g., mRNA) vaccine comprising at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one antigenic polypeptide or an immunogenic fragment thereof (e.g., an immunogenic fragment capable of inducing an immune response against the antigenic polypeptide) and at least one RNA (e.g., mRNA polynucleotide) having an open reading frame encoding a flagellin adjuvant.

[0076] In some embodiments, at least one flagellin polypeptide (e.g., the encoded flagellin polypeptide) is a flagellin protein. In some embodiments, at least one flagellin polypeptide (e.g., the encoded flagellin polypeptide) is an immunogenic flagellin fragment. In some embodiments, at least one flagellin polypeptide and at least one antigenic polypeptide are encoded by a single RNA (e.g., mRNA) polynucleotide. In other embodiments, at least one flagellin polypeptide and at least one antigenic polypeptide are encoded by different RNA polynucleotides, respectively.

[0077] In some embodiments, at least one flagellin polypeptide has at least 80%, at least 85%, at least 90% or at least 95% identity to a flagellin polypeptide having the sequences of SEQ ID NOs: 173-175.

[0078] In some embodiments, the nucleic acid vaccine described herein is chemically modified. In other embodiments, the nucleic acid vaccine is unmodified.

[0079] Yet another aspect provides a composition and method for vaccinating a subject, comprising administering to the subject a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first respiratory virus antigenic polypeptide, wherein the RNA polynucleotide does not contain a stabilizing element and no adjuvant is co-formulated or co-administered with the vaccine.

[0080] In another aspect, the present invention includes administering to a subject a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first viral antigenic polypeptide, wherein the nucleic acid vaccine is administered to the subject at a dose of 10 μg / kg to 400 μg / kg. A composition and method for vaccinating a subject. In some embodiments, the dose of the RNA polynucleotide is 1-5 μg, 5-10 μg, 10-15 μg, 15-20 μg, 10-25 μg, 20-25 μg, 20-50 μg, 30-50 μg, 40-50 μg, 40-60 μg, 60-80 μg, 60-100 μg, 50-100 μg, 80-120 μg, 40-120 μg, 40-150 μg, 50-150 μg, 50-200 μg, 80-200 μg, 100-200 μg, 120-250 μg, 150-250 μg, 180-280 μg, 200-300 μg, 50-300 μg, 80-300 μg, 100-300 μg, 40-300 μg, 50-350 μg, 100-350 μg, 200-350 μg, 300-350 μg, 320-400 μg, 40-380 μg, 40-100 μg, 100-400 μg, 200-400 μg or 300-400 μg / dose. In some embodiments, the nucleic acid vaccine is administered to the subject by intradermal injection or intramuscular injection. In some embodiments, the nucleic acid vaccine is administered to the subject on day 0. In some embodiments, a second dose of the nucleic acid vaccine is administered to the subject on day 21.

[0081] In some embodiments, the nucleic acid vaccine administered to a subject contains an RNA polynucleotide at a dose of 25 μg. In some embodiments, the nucleic acid vaccine administered to a subject contains an RNA polynucleotide at a dose of 100 μg. In some embodiments, the nucleic acid vaccine administered to a subject contains an RNA polynucleotide at a dose of 50 μg. In some embodiments, the nucleic acid vaccine administered to a subject contains an RNA polynucleotide at a dose of 75 μg. In some embodiments, the nucleic acid vaccine administered to a subject contains an RNA polynucleotide at a dose of 150 μg. In some embodiments, the nucleic acid vaccine administered to a subject contains an RNA polynucleotide at a dose of 400 μg. In some embodiments, the nucleic acid vaccine administered to a subject contains an RNA polynucleotide at a dose of 200 μg. In some embodiments, the RNA polynucleotide accumulates at a level 100-fold higher in local lymph nodes compared to distal lymph nodes. In other embodiments, the nucleic acid vaccine is chemically modified, and in other embodiments, the nucleic acid vaccine is not chemically modified.

[0082] Aspects of the invention provide a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic polypeptide, wherein the RNA polynucleotide does not contain a stabilizing element and a pharmaceutically acceptable carrier or excipient, and no adjuvant is included in the vaccine. In some embodiments, the stabilizing element is a histone stem-loop. In some embodiments, the stabilizing element is a nucleic acid sequence having a higher GC content compared to the wild-type sequence.

[0083] Aspects of the invention provide a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic polypeptide, wherein the RNA polynucleotide is present in a formulation for in vivo administration to a host and confers an antibody titer that exceeds the antibody possession criterion for the first antigen by a percentage acceptable to a human subject. In some embodiments, the titer of the antibody produced by the mRNA vaccine of the invention is the titer of a neutralizing antibody. In some embodiments, the titer of the neutralizing antibody is greater than that of a protein vaccine. In other embodiments, the titer of the neutralizing antibody produced by the mRNA vaccine of the invention is greater than that of an adjuvant-added protein vaccine. In still other embodiments, the titer of the neutralizing antibody produced by the mRNA vaccine of the invention is 1,000-10,000, 1,200-10,000, 1,400-10,000, 1,500-10,000, 1,000-5,000, 1,000-4,000, 1,800-10,000, 2,000-10,000, 2,000-5,000, 2,000-3,000, 2,000-4,000, 3,000-5,000, 3,000-4,000 or 2,000-2,500. The neutralizing titer is typically expressed as the maximum serum dilution required to achieve a 50% reduction in the number of plaques.

[0084] Also provided is a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic polypeptide, wherein the RNA polynucleotide is present in a formulation for in vivo administration to a host and induces a high antibody titer that persists longer than the antibody titer induced by an mRNA vaccine encoding a first antigenic polypeptide formulated with an adjuvant or having a stabilizing element. In some embodiments, the RNA polynucleotide is formulated to produce neutralizing antibodies within one week after a single administration. In some embodiments, the adjuvant is selected from cationic peptides and immunostimulatory nucleic acids. In some embodiments, the cationic peptide is protamine.

[0085] Some embodiments provide a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame that includes at least one chemical modification and optionally no nucleotide modifications, wherein the open reading frame encodes a first antigenic polypeptide, and wherein the RNA polynucleotide is present in a formulation for in vivo administration to a host such that the antigen expression level in the host significantly exceeds the antigen expression level provided by an mRNA vaccine encoding a first antigenic polypeptide having a stabilizing element or formulated with an adjuvant.

[0086] Other embodiments provide a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame that includes at least one chemical modification and optionally no nucleotide modifications, wherein the open reading frame encodes a first antigenic polypeptide, and wherein the RNA polynucleotide is at least 1 / 10 less than the RNA polynucleotide required for an unmodified mRNA vaccine to provide an equivalent antibody titer. In some embodiments, the RNA polynucleotide is present at a dose of 25 - 100 μg.

[0087] Embodiments of the invention also provide a vaccine unit dosage formulated for delivery to a human subject, comprising 10 μg - 400 μg of one or more RNA polynucleotides having an open reading frame that includes at least one chemical modification and optionally no nucleotide modifications, wherein the open reading frame encodes a first antigenic polypeptide, and a pharmaceutically acceptable carrier or excipient. In some embodiments, the vaccine further comprises cationic lipid nanoparticles.

[0088] Aspects of the present invention provide a method of forming, maintaining, or restoring antigenic memory against a respiratory virus strain in an individual or population of individuals, the method comprising administering to the individual or population an antigenic memory booster nucleic acid vaccine, the nucleic acid vaccine comprising: (a) at least one RNA polynucleotide, which comprises at least one chemical modification, optionally comprises no nucleotide modification, and comprises two or more codon-optimized open reading frames, the open reading frames encoding a series of reference antigenic polypeptides, and (b) optionally a pharmaceutically acceptable carrier or excipient. In some embodiments, the vaccine is administered to the individual via a route selected from the group consisting of intramuscular administration, intradermal administration, and subcutaneous administration. In some embodiments, the administration step comprises contacting an apparatus suitable for injection of the composition with the muscle tissue of the subject. In some embodiments, the administration step comprises contacting an apparatus suitable for injection of the composition with the muscle tissue of the subject in combination with electroporation.

[0089] Aspects of the present invention provide a method of vaccinating a subject, the method comprising administering to the subject a single dose of 25 μg / kg to 400 μg / kg of a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic polypeptide in an effective amount to vaccinate the subject.

[0090] Another aspect provides a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame comprising at least one chemical modification, the open reading frame encoding a first antigenic polypeptide, wherein the RNA polynucleotide is at least 1 / 10 less than the RNA polynucleotide required for an unmodified mRNA vaccine to provide an equivalent antibody titer. In some embodiments, the RNA polynucleotide is present in a dose of 25 to 100 μg.

[0091] Another aspect provides a nucleic acid vaccine comprising an LNP-formulated RNA polynucleotide having an open reading frame that does not contain (is unmodified) nucleotide modifications and that encodes a first antigenic polypeptide, wherein the RNA polynucleotide is at least 1 / 10 less than the RNA polynucleotide required for an unmodified mRNA vaccine not formulated with LNP to provide an equivalent antibody titer. In some embodiments, the RNA polynucleotide is present at a dose of 25 - 100 μg.

[0092] The data shown in the examples demonstrate that use of the formulations of the present invention results in a marked improvement in the immune response. Both chemically modified RNA vaccines and unmodified RNA vaccines are useful in the present invention. Surprisingly, in contrast to the prior art direction that it is preferred to use unchemically modified mRNA for vaccine manufacture and formulate it in a carrier, chemically modified mRNA-LNP vaccines are described herein as having a significantly lower required effective mRNA dose than unmodified mRNA, i.e., at least 1 / 10 less than unmodified mRNA formulated in a carrier other than LNP. The RNA vaccines of the present invention, both chemically modified and unmodified, provide a better immune response than mRNA vaccines formulated in different lipid carriers.

[0093] In another aspect, the present invention includes a method of treating an elderly subject 60 years of age or older, comprising administering to the subject in an effective amount a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a respiratory virus antigenic polypeptide, thereby vaccinating the subject.

[0094] In another aspect, the present invention includes a method of treating a juvenile subject 17 years of age or younger, comprising administering to the subject in an effective amount a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a respiratory virus antigenic polypeptide, thereby vaccinating the subject.

[0095] In other aspects, the invention encompasses a method of treating an adult subject, comprising administering to the subject an effective amount of a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a respiratory virus antigenic polypeptide, thereby vaccinating the subject.

[0096] In some aspects, the invention is a method of vaccinating a subject with a combination vaccine comprising at least two nucleic acid sequences encoding respiratory antigens, wherein the dose of the vaccine is a combination treatment dose and the dose of each individual nucleic acid encoding an antigen is a sub-therapeutic dose. In some embodiments, the combination dose is 25 μg of RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the combination dose is 100 μg of RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the combination dose is 50 μg of RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the combination dose is 75 μg of RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the combination dose is 150 μg of RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the combination dose is 400 μg of RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the sub-therapeutic dose of each individual nucleic acid encoding an antigen is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 μg. In other embodiments, the nucleic acid vaccine is chemically modified, and in other embodiments, the nucleic acid vaccine is not chemically modified.

[0097] In some embodiments, the RNA polynucleotide is one of SEQ ID NO: 1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258 or 259 and includes at least one chemical modification. In other embodiments, the RNA polynucleotide is one of SEQ ID NO: 1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258 or 259 and does not include any nucleotide modifications or is unmodified. In still other embodiments, at least one RNA polynucleotide encodes an antigenic protein of any one of SEQ ID NO: 3, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 243 or 245 and includes at least one chemical modification. In other embodiments, the RNA polynucleotide encodes an antigenic protein of any one of SEQ ID NO: 3, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 243 or 245 and does not include any nucleotide modifications or is unmodified.

[0098] Details of various embodiments of the present invention are described in the following mode for carrying out the invention. Other features, objects and advantages of the present invention will become apparent from the mode for carrying out the invention, the drawings and the claims.

[0099] The foregoing and other objects, features and advantages will become apparent from the following description of specific embodiments of the present invention shown in the accompanying drawings. In the drawings, the same reference numerals refer to the same parts throughout the various figures. The drawings are not necessarily to scale and emphasis is placed on illustrating the principles of the various embodiments of the present invention.

Brief Description of the Drawings

[0100]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6-1

Figure 6-2

Figure 7-1

Figure 7-2

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Mode for Carrying Out the Invention

[0101] Embodiments of the present disclosure provide an RNA (e.g., mRNA) vaccine comprising a (at least one) polynucleotide encoding a respiratory syncytial virus (RSV) antigen. RSV is a single-stranded negative-sense RNA virus of the genus Pneumovirinae. This virus has at least two antigenic subgroups known as type A and type B, mainly due to differences in the surface G glycoprotein. Two RSV surface glycoproteins, G and F, mediate the binding and attachment to respiratory epithelial cells. The F surface glycoprotein mediates the fusion of adjacent cells, resulting in the formation of syncytial cells. RSV is the most common cause of bronchiolitis. Most infected adults develop mild cold-like symptoms such as congestion, low-grade fever, and wheezing. Infants and children may present with more severe symptoms such as bronchiolitis and pneumonia. This disease can infect humans through contact with respiratory secretions.

[0102] The RSV genome encodes at least three surface glycoproteins (including F, G, and SH), four nucleocapsid proteins (including L, P, N, and M2), and one matrix protein M. The glycoprotein F induces virus entry by fusion between the virion and the host membrane. The glycoprotein G is a type II transmembrane glycoprotein and is the major attachment protein. SH is a short integral membrane protein. The matrix protein M is present in the inner layer of the lipid bilayer and aids in virion formation. The nucleocapsid proteins L, P, N, and M2 regulate the replication and transcription of the RSV genome. It is thought that glycoprotein G tethers and stabilizes virus particles on the surface of bronchial epithelial cells, and glycoprotein F interacts with cellular glycosaminoglycans to mediate fusion with the host cell and delivery of the RSV virion contents into the host cell (Krzyzaniak MA et al. PLoS Pathog 2013;9(4)).

[0103] The RSV RNA (e.g., mRNA) vaccines provided herein can be used to induce a balanced immune response that includes both cellular and humoral immunity without many of the risks associated with DNA vaccination.

[0104] The entire content of International Application No. PCT / US2015 / 02740 is incorporated herein by reference.

[0105] The mRNA vaccines described herein have been found to be superior to current vaccines in several respects. First, lipid nanoparticle (LNP) delivery is superior to other formulations including the protamine-based means described in the literature and does not require additional adjuvants. The use of LNP enables effective delivery of chemically modified or unmodified mRNA vaccines. Furthermore, it has been shown herein that LNP-formulated mRNA vaccines are significantly superior to conventional vaccines, both modified and unmodified. In some embodiments, the mRNA vaccines of the invention are at least 10-fold, 20-fold, 40-fold, 50-fold, 100-fold, 500-fold, or 1,000-fold superior to conventional vaccines.

[0106] Functional RNA vaccines, including mRNA vaccines and self-replicating RNA vaccines, have been attempted to be produced, but the therapeutic efficacy of these RNA vaccines has not yet been fully established. Quite surprisingly, the inventors have found, according to aspects of the present invention, a class of formulations for in vivo delivery of mRNA vaccines that result in a significantly enhanced and in many ways synergistic immune response, including an increase in functional antibody production with antigen generation and neutralizing capacity. These results can be achieved even when extremely low doses of mRNA are administered compared to the doses of mRNA used in other types of lipid-based formulations. The formulations of the present invention have shown an unexpectedly significant in vivo immune response sufficient to establish the effectiveness of functional mRNA vaccines as prophylactic and therapeutic agents. Furthermore, self-replicating RNA vaccines rely on the viral replication pathway to deliver sufficient RNA to cells to elicit an immunogenic response. The formulations of the present invention do not require viral replication to produce sufficient protein to elicit a strong immune response. Thus, the mRNA of the present invention is not self-replicating RNA and does not contain components necessary for viral replication.

[0107] The present invention, in some aspects, relates to the surprising discovery that lipid nanoparticle (LNP) formulations significantly enhance the effectiveness of RNA vaccines, including chemically modified and unmodified mRNA vaccines. The effectiveness of LNP-formulated mRNA vaccines has been tested in vivo using several different antigens. The results presented herein demonstrate the unexpectedly superior effectiveness of LNP-formulated mRNA vaccines compared to other commercially available vaccines.

[0108] In addition to eliciting an enhanced immune response, the formulations of the present invention elicit a more rapid immune response at lower doses than other vaccines tested. The mRNA-LNP formulations of the present invention also result in a quantitatively and qualitatively better immune response compared to vaccines formulated with different carriers.

[0109] The data described herein demonstrate that the formulations of the present invention have provided unexpectedly significant improvements over existing antigen vaccines. Further, the mRNA-LNP formulations of the present invention are superior to other vaccines even when the mRNA dosage is lower than that of other vaccines. Various mRNA vaccines formulated with MC3 LNP were compared with protein antigen vaccines in mice. The data showed that, compared to existing vaccines, the mRNA vaccines gave higher neutralizing antibody titers and much higher cellular immune responses than protein antigens, resulting in strong CD4+ and CD8+ immune responses biased towards Th1 and a reduction in lung virus in mice. While virus was recovered from only one animal with a low-dose protein / adjuvant vaccine formulation, no virus was recovered from the lungs of any of the mice immunized with the RSV mRNA vaccine formulated with MC3 LNP. Marked neutralizing antibody titers were also achieved in rats and monkeys.

[0110] The LNPs used in the tests described herein have been previously used in various animal models and humans for delivering siRNA. Considering the observations made regarding siRNA delivery by LNP formulations, the fact that LNPs are useful for vaccines is quite surprising. Therapeutic delivery of LNP-formulated siRNA has been observed to cause undesirable inflammatory responses associated with transient IgM responses, typically leading to reduced antigen production and a decrease in the immune response. In contrast to the findings observed for siRNA, it is shown herein that the LNP-mRNA formulations of the present invention result in an increase in IgG levels sufficient for prophylactic and therapeutic methods, rather than a transient IgM response.

[0111] Nucleic acid / polynucleotide The RSV vaccines provided herein comprise at least one (or more) ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one RSV antigenic polypeptide. The term "nucleic acid" in its broadest sense includes any compound and / or substance that comprises a polymer of nucleotides. These polymers are referred to as polynucleotides.

[0112] In some embodiments, at least one RNA polynucleotide is encoded by at least one nucleic acid sequence set forth in SEQ ID NO: 1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258 or 259, or a homolog having at least 80% identity with the nucleic acid sequence set forth in SEQ ID NO: 1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258 or 259. In some embodiments, at least one RNA polynucleotide is encoded by at least one nucleic acid sequence set forth in SEQ ID NO: 1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258 or 259, or a homolog having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.8% or 99.9%) identity with the nucleic acid sequence set forth in SEQ ID NO: 1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258 or 259. In some embodiments, at least one RNA polynucleotide is encoded by at least one fragment of the nucleic acid sequence set forth in SEQ ID NO: 1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258 or 259 (e.g., a fragment having at least one antigenic sequence or at least one epitope). In some embodiments, at least one RNA polynucleotide has at least one chemical modification. In some embodiments, at least one RNA polynucleotide is an mRNA polynucleotide, and each uracil (100% of uracils) of the mRNA polynucleotide is chemically modified. In some embodiments, at least one RNA polynucleotide is an mRNA polynucleotide, and each uracil (100% of uracils) of the mRNA polynucleotide is chemically modified to include N1-methylpseudouridine.

[0113] In some embodiments, the amino acid sequence of the RSV antigenic polypeptide is the amino acid sequence set forth in SEQ ID NO: 3, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 243 or 245, or a (antigenic) fragment thereof, or a homolog having at least 80% (e.g., 85%, 90%, 95%, 98%, 99%) identity to said sequence.

[0114] Nucleic acids (also referred to as polynucleotides) can be, for example, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA, e.g., including LNA having a β-D-ribo configuration, α-LNA having an α-L-ribo configuration (a diastereomer of LNA), 2'-amino-LNA having a 2'-amino functional group, and 2'-amino-α-LNA having a 2'-amino functional group), ethylene nucleic acid (ENA), cyclohexenyl nucleic acid (CeNA), or chimeras or combinations thereof, or can include these.

[0115] In some embodiments, the polynucleotide of the present disclosure functions as messenger RNA (mRNA). "Messenger RNA" (mRNA) refers to any polynucleotide that encodes a (at least one) polypeptide (a natural, non-natural, or modified amino acid polymer) and that can be translated to produce the encoded polypeptide in vitro, in vivo, in situ, or ex vivo. Those skilled in the art will understand that, unless otherwise specified, the polynucleotide sequences described in this application use "T" when representing a DNA sequence, and when the sequence represents RNA (e.g., mRNA), "T" is replaced by "U". Thus, any RNA polynucleotide encoded by a DNA identified by a specific sequence identifier can include the corresponding RNA (e.g., mRNA) sequence encoded by the DNA, where each "T" in the DNA sequence is replaced by "U".

[0116] The basic components of an mRNA molecule typically include at least one coding region, a 5' untranslated region (UTR), a 3' UTR, a 5' cap, and a polyA tail. The polynucleotides of the present disclosure can function as mRNA, but can be distinguished from wild-type mRNA by their designed functional and / or structural features, which help to solve existing problems related to effective polypeptide expression using nucleic acid therapies.

[0117] In some embodiments, the RNA polynucleotide (e.g., mRNA) of the RSV vaccine encodes from 2 to 10, 2 to 9, 2 to 8, 2 to 7, 2 to 6, 2 to 5, 2 to 4, 2 to 3, 3 to 10, 3 to 9, 3 to 8, 3 to 7, 3 to 6, 3 to 5, 3 to 4, 4 to 10, 4 to 9, 4 to 8, 4 to 7, 4 to 6, 4 to 5, 5 to 10, 5 to 9, 5 to 8, 5 to 7, 5 to 6, 6 to 10, 6 to 9, 6 to 8, 6 to 7, 7 to 10, 7 to 9, 7 to 8, 8 to 10, 8 to 9, or 9 to 10 antigenic polypeptides. In some embodiments, the RNA polynucleotide (e.g., mRNA) of the RSV RNA (e.g., mRNA) vaccine encodes at least 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 antigenic polypeptides. In some embodiments, the RNA polynucleotide (e.g., mRNA) of the RSV vaccine encodes at least 100 antigenic polypeptides or at least 200 antigenic polypeptides. In some embodiments, the RNA polynucleotide (e.g., mRNA) of the RSV vaccine encodes from 1 to 10, 5 to 15, 10 to 20, 15 to 25, 20 to 30, 25 to 35, 30 to 40, 35 to 45, 40 to 50, 1 to 50, 1 to 100, 2 to 50, or 2 to 100 antigenic polypeptides.

[0118] The polynucleotides (e.g., mRNA) of the present disclosure are codon-optimized in some embodiments. Codon optimization methods are known in the art and can be used as described herein. Using codon optimization, in some embodiments, the codon frequencies in the target organism and the host organism are matched to ensure proper folding, the GC content is biased to improve mRNA stability or reduce secondary structure, tandem repeat codons or base runs that may impair the gene construct or expression are minimized, transcription and translation control regions are customized, protein transport sequences are inserted or removed, post-translational modification sites (e.g., glycosylation sites) are removed / added to the encoded protein, protein domains are added, removed or shuffled, restriction sites are inserted or deleted, ribosome binding sites and mRNA degradation sites are modified, the translation rate is adjusted to allow proper folding of various domains of the protein, or problematic secondary structures within the polynucleotide can be reduced or eliminated. Tools, algorithms and services for codon optimization are known in the art and non-limiting examples include services by GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and / or proprietary methods. In some embodiments, an optimization algorithm is used to optimize the open reading frame (ORF) sequence.

[0119] In some embodiments, the codon-optimized sequence shares less than 95% sequence identity with the native or wild-type sequence (e.g., the native or wild-type mRNA sequence encoding the polypeptide or protein of interest (e.g., an antigenic protein or polypeptide)). In some embodiments, the codon-optimized sequence shares less than 90% sequence identity with the native or wild-type sequence (e.g., the native or wild-type mRNA sequence encoding the polypeptide or protein of interest (e.g., an antigenic protein or polypeptide)). In some embodiments, the codon-optimized sequence shares less than 85% sequence identity with the native or wild-type sequence (e.g., the native or wild-type mRNA sequence encoding the polypeptide or protein of interest (e.g., an antigenic protein or polypeptide)). In some embodiments, the codon-optimized sequence shares less than 80% sequence identity with the native or wild-type sequence (e.g., the native or wild-type mRNA sequence encoding the polypeptide or protein of interest (e.g., an antigenic protein or polypeptide)). In some embodiments, the codon-optimized sequence shares less than 75% sequence identity with the native or wild-type sequence (e.g., the native or wild-type mRNA sequence encoding the polypeptide or protein of interest (e.g., an antigenic protein or polypeptide)).

[0120] In some embodiments, the codon-optimized sequence shares 65% to 85% (e.g., about 67% to about 85% or about 67% to about 80%) sequence identity with the native or wild-type sequence (e.g., the native or wild-type mRNA sequence encoding the polypeptide or protein of interest (e.g., an antigenic protein or polypeptide)). In some embodiments, the codon-optimized sequence shares 65% to 75% or about 80% sequence identity with the native or wild-type sequence (e.g., the native or wild-type mRNA sequence encoding the polypeptide or protein of interest (e.g., an antigenic protein or polypeptide)).

[0121] In some embodiments, the RSV vaccine comprises an open reading frame encoding at least one RSV antigenic polypeptide having at least one modification, at least one RNA polynucleotide having at least one 5′-end cap, and is formulated within lipid nanoparticles. 5′-capping of the polynucleotide can be achieved simultaneously during the in vitro transcription reaction by using the following chemical RNA cap analogs according to the manufacturer's protocol to generate a 5′-guanosine cap structure: 3′-O-Me-m7G(5′)ppp(5′)G [ARCA cap]; G(5′)ppp(5′)A; G(5′)ppp(5′)G; m7G(5′)ppp(5′)A; m7G(5′)ppp(5′)G (New England BioLabs (Ipswich, MA)). 5′-capping of the modified RNA can be achieved post-transcriptionally by using a vaccinia virus capping enzyme to generate a “cap 0” structure: m7G(5′)ppp(5′)G (New England BioLabs (Ipswich, MA)). The cap 1 structure can be generated by using both a vaccinia virus capping enzyme and a 2′-O methyltransferase to generate m7G(5′)ppp(5′)G-2′-O-methyl. The cap 2 structure can be generated from the cap 1 structure by using a 2′-O methyltransferase to 2′-O-methylate the third 5′-nucleotide. The cap 3 structure can be generated from the cap 2 structure by using a 2′-O methyltransferase to 2′-O-methylate the fourth 5′-nucleotide. The enzymes may be from recombinant sources.

[0122] The modified mRNA has a stability of 12-18 hours or more than 18 hours, such as 24, 36, 48, 60, 72 or more than 72 hours when transfected into mammalian cells.

[0123] In some embodiments, the codon-optimized RNA can have an increased G / C level. The G / C content of a nucleic acid molecule (e.g., mRNA) can affect the stability of the RNA. RNA with an increased amount of guanine (G) and / or cytosine (C) residues can be functionally more stable than RNA containing a large amount of adenine (A) and thymine (T) or uracil (U) nucleotides. As an example, WO02 / 098443 discloses a pharmaceutical composition containing mRNA stabilized by sequence modification in the translation region. Due to the degeneracy of the genetic code, this modification is made by replacing existing codons with codons that promote greater RNA stability without changing the resulting amino acid. This approach is limited to the coding region of the RNA.

[0124] Antigen / antigenic polypeptide RSV is known to have at least two antigenic subgroups (A and B). This antigenic dimorphism is mainly due to differences in the surface G glycoprotein. The two surface glycoproteins G and F are present in the envelope and mediate adsorption and fusion with respiratory epithelial cells. The F protein also mediates the fusion of adjacent cells to form characteristic syncytial cells, which gives the virus its name. The epidemiological and biological importance of the two RSV antigenic variants is not clearly understood. However, there is some evidence suggesting that type A infections tend to be more severe.

[0125] The RSV genome is approximately 15,000 nucleotides long and is composed of single-stranded RNA with a negative polarity. The RSV genome has 10 genes encoding 11 proteins and two M2 open reading frames. The genome is sequentially transcribed from NS1 to L, and the expression decreases along its length.

[0126] NS1 and NS2 inhibit type I interferon activity. In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a product of NS1, NS2, or an immunogenic fragment thereof.

[0127] N encodes a nucleocapsid protein that associates with the genomic RNA to form the nucleocapsid. In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding the nucleocapsid protein or an immunogenic fragment thereof.

[0128] M encodes a matrix protein required for virus assembly. In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding the matrix protein or an immunogenic fragment thereof.

[0129] SH, G, and F form the virus coat. The G protein is a highly glycosylated surface protein that functions as an attachment protein. The F protein is another important surface protein that enables virus entry into the cytoplasm and syncytium formation by mediating fusion. In both subtypes of RSV, the F protein is homologous and is neutralized by antibodies directed against the F protein. In contrast, the G protein is highly divergent between the two subtypes. In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding SH, G, or F protein or a combination thereof or an immunogenic fragment thereof.

[0130] Nucleolin on the cell surface is a receptor for the RSV fusion protein. Inhibition of the interaction between nucleolin and the RSV fusion protein has been shown to have a therapeutic effect against RSV infection in cell cultures and animal models. In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding nucleolin or an immunogenic fragment thereof.

[0131] M2 is a second matrix protein also required for transcription and encodes M2-1 (elongation factor) and M2-2 (transcription regulation). M2 contains a CD8 epitope. In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding the second matrix protein or an immunogenic fragment thereof.

[0132] L encodes an RNA polymerase. In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding the RNA polymerase (L) or an immunogenic fragment thereof.

[0133] The phosphoprotein P is a cofactor for the L protein. In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding the phosphoprotein P or an immunogenic fragment thereof.

[0134] Some embodiments of the present disclosure provide an RSV vaccine comprising at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding the glycoprotein G or an immunogenic fragment thereof (e.g., an immunogenic fragment capable of eliciting an immune response against RSV).

[0135] Some embodiments of the present disclosure provide an RSV vaccine comprising at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a glycoprotein F or an immunogenic fragment thereof (e.g., an immunogenic fragment capable of eliciting an immune response against RSV).

[0136] Some embodiments of the present invention disclose an RSV vaccine comprising at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a polypeptide in a post-fusion form or an immunogenic fragment thereof. Further embodiments of the present invention disclose an RSV vaccine comprising at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a polypeptide in a pre-fusion form or an immunogenic fragment thereof. In some embodiments, the polypeptide or an antigenic fragment thereof comprises a glycoprotein in a pre-fusion conformation, e.g., but not limited to, pre-fusion glycoprotein F or DS-CAV1. Without wishing to be bound by theory, certain polypeptides or antigenic fragments thereof may contain more epitopes for neutralizing antibodies when in a pre-fusion conformation as compared to the post-fusion conformation of the same protein or an immunogenic fragment thereof. For example, pre-fusion glycoprotein F or an immunogenic fragment thereof has an antigenic site ( "antigenic site 0") unique to the distal tip of its membrane. Antigenic site 0 may include, but is not essential to, residues 62-69 and 196-209 of the RSV F protein sequence. In some cases, pre-fusion polypeptides or immunogenic fragments thereof, such as pre-fusion glycoprotein F or an immunogenic fragment thereof, may exhibit an immune response several times greater than that achieved by the post-fusion polypeptide or an immunogenic fragment thereof. The pre-fusion RSV glycoprotein and methods of using the same are described in WO / 2014 / 160463, which is incorporated herein by reference in its entirety.

[0137] In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a glycoprotein F or glycoprotein G obtained from the RSV A2 strain (RSV A2) or an immunogenic fragment thereof. Other RSV strains, including subtype A strains and subtype B strains, are also encompassed by the present disclosure.

[0138] In some embodiments, the RSV vaccine has at least one RNA (e.g., mRNA) having at least one modification, including but not limited to at least one chemical modification.

[0139] In some embodiments, the RSV antigenic polypeptide is longer than 25 amino acids and shorter than 50 amino acids. Thus, the polypeptide includes gene products, natural polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments, and other equivalents, variants, and analogs as described above. The polypeptide may be a single molecule or a multimolecular complex such as a dimer, trimer, or tetramer. The polypeptide may also include single-chain polypeptides or multichain polypeptides such as antibodies or insulin, which may be associated or linked. Disulfide bonds are most commonly found in multichain polypeptides. The term polypeptide may also be applied to amino acid polymers in which at least one amino acid residue is an artificial chemical analog of the corresponding natural amino acid.

[0140] The term "polypeptide variant" refers to a molecule whose amino acid sequence is different from the native or reference sequence. Amino acid sequence variants may have substitutions, deletions, and / or insertions at specific positions within the amino acid sequence compared to the native or reference sequence. Typically, the variant has at least 50% identity to the native or reference sequence. In some embodiments, the variant shares at least 80% or at least 90% identity with the native or reference sequence.

[0141] In some embodiments, “variant mimics” are provided. As used herein, “variant mimics” contain at least one amino acid that can mimic an activation sequence. For example, glutamic acid can act as a mimic of phosphorylated threonine and / or phosphorylated serine. Alternatively, a variant mimic can result in inactivation or produce an inactivated product containing the mimic. For example, phenylalanine can act as an inactivating substitution for tyrosine, and alanine can act as an inactivating substitution for serine.

[0142] “Ortholog” refers to genes of different species that have evolved from a common ancestral gene by speciation. Typically, orthologs retain the same function during evolution. Identification of orthologs is important for reliable prediction of gene function in newly sequenced genomes.

[0143] “Analog” means including polypeptide variants that have differences, such as substitutions, additions or deletions of amino acid residues, but still retain one or more of the properties of the parent polypeptide or starting polypeptide.

[0144] “Paralog” is a gene (or protein) related by duplication within a genome. Orthologs retain the same function during evolution, while paralogs have evolved new functions, even if they are related to the original function.

[0145] The present disclosure provides several types of compositions based on polynucleotides or polypeptides, including variants and derivatives. These include, for example, variants and derivatives by substitution, insertion deletion, and covalent bonding. The term “derivative” is used synonymously with the term “variant”, but generally refers to a molecule that has been modified and / or changed in any way compared to a reference molecule or starting molecule.

[0146] Accordingly, polynucleotides encoding peptides or polypeptides containing substitutions, insertions and / or additions, deletions, and covalent modifications with respect to a reference sequence, particularly a polypeptide sequence disclosed herein, are included within the scope of the present disclosure. For example, sequence tags or amino acids such as one or more lysines can be added to a peptide sequence (e.g., at the N-terminus or C-terminus). Sequence tags can be used for the detection, purification, or positioning of peptides. Lysine can be used to increase the solubility of a peptide or to enable biotinylation. Alternatively, amino acid residues located in the carboxy-terminal and amino-terminal regions of the amino acid sequence of a peptide or protein can be optionally deleted to provide a truncated sequence. Alternatively, depending on the use of the sequence, e.g., expressing the sequence as part of a larger sequence that is soluble or linked to a solid support, certain amino acids (e.g., the C-terminal residue or the N-terminal residue) can be deleted. In alternative embodiments, sequences for signal sequences, termination sequences, transmembrane domains, linkers, multimerization domains (e.g., foldon regions, etc.), and equivalents (or sequences encoding them) can be replaced with alternative sequences that achieve the same or similar functions. Such sequences can be readily identified by those skilled in the art. It should also be understood that some of the sequences provided herein contain sequence tags or terminal peptide sequences (e.g., at the N-terminus or C-terminus) that can be deleted, for example, immediately prior to the preparation of an RNA (e.g., mRNA) vaccine.

[0147] A "substitution variant" with respect to a polypeptide is one in which at least one amino acid residue in the native or starting sequence has been deleted and replaced at the same position with another amino acid. The substitution can be a single substitution in which only one amino acid in the molecule is replaced, or multiple substitutions in which two or more amino acids in the same molecule are replaced.

[0148] As used herein, the term "conservative amino acid substitution" refers to a substitution that replaces an amino acid normally present in a sequence with another amino acid having a similar size, charge or polarity. Examples of conservative substitutions include substitutions that make non-polar (hydrophobic) residues, such as isoleucine, valine and leucine, into another non-polar residue. Similarly, examples of conservative substitutions include substitutions that make one polar (hydrophilic) residue into another polar residue, for example, substitutions between arginine and lysine, between glutamine and asparagine, and between glycine and serine. In addition, substitutions that make a basic residue, such as lysine, arginine or histidine, into another basic residue, or substitutions that make one acidic residue, such as aspartic acid or glutamic acid, into another acidic residue are further examples of conservative substitutions. Examples of non-conservative substitutions include substitutions that make a non-polar (hydrophobic) amino acid residue, such as isoleucine, valine, leucine, alanine or methionine, into a polar (hydrophilic) residue, such as cysteine, glutamine, glutamic acid or lysine, and / or substitutions that make a polar residue into a non-polar residue.

[0149] A "feature" with respect to a polypeptide or polynucleotide is defined as a distinct, amino acid sequence-based or nucleotide-based component of the molecule. Features of a polypeptide encoded by a polynucleotide include surface expression, local higher-order structural shape, folding, loops, half-loops, domains, half-domains, sites, termini or any combination thereof.

[0150] As used herein with respect to a polypeptide, the term "domain" refers to a polypeptide motif having one or more identifiable structural or functional features or properties (e.g., binding ability, function as a site of protein-protein interaction).

[0151] As used herein with respect to a polypeptide, the term "moiety" is used synonymously with "amino acid residue" and "amino acid side chain" when it relates to amino acid-based embodiments. As used herein with respect to a polypeptide, the term "moiety" is used synonymously with "nucleotide" when it relates to nucleotide-based embodiments. A moiety represents a position within a peptide or polypeptide or polynucleotide that can be modified, manipulated, altered, derivatized, or changed within a polypeptide-based molecule or polynucleotide-based molecule.

[0152] As used herein with respect to a polypeptide or polynucleotide, the term "end" refers to the ends of the polypeptide or polynucleotide, respectively. Such ends are not limited to only the first or last positions of the polypeptide or polynucleotide, and may include amino acids or nucleotides added to the terminal regions. A polypeptide-based molecule may be characterized as having both an N-terminus (ending with an amino acid having a free amino group (NH 2 ) and a C-terminus (ending with an amino acid having a free carboxyl group (COOH)). A protein may, in some cases, be composed of multiple polypeptide chains joined together by disulfide bonds or non-covalent forces (multimer, oligomer). These proteins have multiple N-termini and C-termini. Alternatively, the ends of a polypeptide may be modified to begin or end with a non-polypeptide-based moiety, such as an organic conjugate, depending on the circumstances.

[0153] As will be recognized by those skilled in the art, protein fragments, functional protein domains, and homologous proteins are also considered to be within the scope of the polypeptide of interest. For example, any protein fragment of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more than 100 amino acids in length of a reference protein (i.e., a polypeptide sequence that is at least 1 amino acid residue shorter than the reference polypeptide sequence but otherwise identical) is provided herein. In another example, any protein containing a stretch of 20, 30, 40, 50 or 100 amino acids that is 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% identical to any of the sequences described herein can be utilized in accordance with the present disclosure. In some embodiments, the polypeptide contains 2, 3, 4, 5, 6, 7, 8, 9, 10 or more mutations relative to any of the sequences described or referenced herein, as shown. In some embodiments, the protein fragment is longer than 25 amino acids and shorter than 50 amino acids.

[0154] The polypeptide molecule or polynucleotide molecule of the present disclosure may share a certain degree of sequence similarity or sequence identity with a reference molecule (e.g., a reference polypeptide or a reference polynucleotide), e.g., a molecule described in the art (e.g., an engineered or designed molecule or a wild-type molecule). The term "identity" refers to the relationship between the sequences of two or more polypeptides or polynucleotides determined by comparing the sequences, as is known in the art. In the art, identity also means the degree of sequence relationship between sequences determined by the number of matches between strings of two or more amino acid residues or nucleic acid residues. Identity is evaluated as the percentage of identical matches between the smaller of two or more sequences with a gap alignment (if any) processed by a specific mathematical model or computer program (e.g., an "algorithm"). The identity of related peptides can be easily calculated by known methods. The "percent identity" applied to a polypeptide or polynucleotide sequence is defined as the percentage of residues in the candidate sequence of amino acids or nucleic acids (amino acid residues or nucleic acid residues) that are identical to the residues in the amino acid sequence or nucleic acid sequence of a second sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity. Methods and computer programs for alignment are well known in the art. It is understood that identity depends on the calculation of percent identity, but the value can vary depending on the gaps and penalties introduced into the calculation. Generally, a variant of a particular polynucleotide or polypeptide has at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% but less than 100% sequence identity to the sequence of a particular reference polynucleotide or polypeptide as determined by sequence alignment programs and parameters described herein and known to those of skill in the art.Such alignment tools include those of the BLAST suite (Stephen F. Altschul, et al., (1997), “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs”, Nucleic Acids Res. 25:3389-3402). Another widely used local alignment method is based on the Smith-Waterman algorithm (Smith, T.F. & Waterman, M.S. (1981) “Identification of common molecular subsequences.” J. Mol. Biol. 147:195-197). A common global alignment method based on dynamic programming is the Needleman-Wunsch algorithm (Needleman, S.B. & Wunsch, C.D. (1970) “A general method applicable to the search for similarities in the amino acid sequences of two proteins.” J. Mol. Biol. 48:443-453.). More recently, the Fast Optimal Global Sequence Alignment Algorithm (FOGSAA) has been developed, which is said to generate global alignments of nucleotide and protein sequences faster than other optimal global alignment methods, including the Needleman-Wunsch algorithm. Other tools are described herein specifically in the definition of “identity” below.

[0155] As used herein, the term "homology" refers to the overall relationship between macromolecules, such as between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Macromolecules (e.g., nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules) that share a threshold level of similarity or identity determined by alignment of matching residues are said to be homologous. Homology is a qualitative term describing the relationship between molecules and can be based on quantitative similarity or identity. Similarity or identity is a quantitative term defining the degree of sequence match between two compared sequences. In some embodiments, macromolecules are considered to be "homologous" to each other if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identical or similar. The term "homologous" necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences). Two polynucleotide sequences are considered homologous if the polypeptides encoded by the sequences are at least 50%, 60%, 70%, 80%, 90%, 95% or even 99% for at least one stretch of at least 20 amino acids. In some embodiments, homologous polynucleotide sequences are characterized by the ability to encode at least a stretch of 4 - 5 amino acids uniquely specified. In the case of polynucleotide sequences less than 60 nucleotides in length, homology is determined by the ability to encode at least a stretch of 4 - 5 amino acids uniquely specified. Two protein sequences are considered homologous if the proteins are at least 50%, 60%, 70%, 80% or 90% identical for at least one stretch of at least 20 amino acids.

[0156] Identity suggests that the arrays being compared have diverged from a common evolutionary origin. The term "homolog" refers to a first amino acid or nucleic acid sequence (e.g., a gene (DNA or RNA) or protein sequence) that is related to a second amino acid or nucleic acid sequence by derivation from a common ancestral sequence. The term "homolog" can apply to relationships between genes and / or proteins separated by an event of speciation and / or to relationships between genes and / or proteins separated by an event of gene duplication.

[0157] Multicomponent and multi - protein vaccines The present disclosure encompasses RSV vaccines comprising a plurality of RNA (e.g., mRNA) polynucleotides each encoding a single antigenic polypeptide, and RSV vaccines comprising a single RNA polynucleotide encoding more than one antigenic polypeptide (e.g., as a fusion polypeptide). Thus, a vaccine composition comprising an RNA polynucleotide having an open reading frame encoding a first RSV antigenic polypeptide and an RNA polynucleotide having an open reading frame encoding a second RSV antigenic polypeptide encompasses (a) a vaccine comprising a first RNA polynucleotide encoding a first RSV antigenic polypeptide and a second RNA polynucleotide encoding a second RSV antigenic polypeptide, and (b) a vaccine comprising a single RNA polynucleotide encoding the first and second RSV antigenic polypeptides (e.g., as a fusion polypeptide). It should be understood that the RSV RNA vaccines of the present disclosure, in some embodiments, comprise 2 to 10 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) or more RNA polynucleotides each having an open reading frame encoding a different RSV antigenic polypeptide (or a single RNA polynucleotide encoding 2 to 10 or more different RSV antigenic polypeptides).In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding the RSV fusion (F) glycoprotein, an RNA polynucleotide having an open reading frame encoding the RSV attachment (G) protein, an RNA polynucleotide having an open reading frame encoding the RSV nucleoprotein (N), an RNA polynucleotide having an open reading frame encoding the RSV phosphoprotein (P), an RNA polynucleotide having an open reading frame encoding the RSV large polymerase protein (L), an RNA polynucleotide having an open reading frame encoding the RSV matrix protein (M), an RNA polynucleotide having an open reading frame encoding the RSV small hydrophobic protein (SH), an RNA polynucleotide having an open reading frame encoding the RSV nonstructural protein 1 (NS1), and an RNA polynucleotide having an open reading frame encoding the RSV nonstructural protein 2 (NS2). In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding the RSV fusion (F) protein and an RNA polynucleotide having an open reading frame encoding the RSV attachment protein (G). In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding the RSV F protein. In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding the RSV N protein. In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding the RSV M protein. In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding the RSV L protein.In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding an RSV P protein. In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding an RSV SH protein. In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding an RSV NS1 protein. In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding an RSV NS2 protein.

[0158] In some embodiments, the RNA polynucleotide encodes an RSV antigenic polypeptide fused to a signal peptide (e.g., SEQ ID NO: 281 or SEQ ID NO: 282). Accordingly, provided is an RSV vaccine comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding a signal peptide linked to an RSV antigenic peptide.

[0159] Furthermore, provided herein is an RSV vaccine comprising any RSV antigenic polypeptide disclosed herein (e.g., F, G, M, N, L, P, SH, NS1, NS2 or any antigenic fragment thereof) fused to a signal peptide. The signal peptide can be fused to the N-terminus or C-terminus of the RSV antigenic polypeptide.

[0160] Signal peptide In some embodiments, the antigenic polypeptide encoded by the RSV polynucleotide comprises a signal peptide. The signal peptide comprises a 15-60 amino acid protein at the N-terminus and is typically required for translocation across membranes in the secretory pathway and thus generally controls the entry of most proteins into the secretory pathway in both eukaryotic and prokaryotic organisms. The signal peptide generally consists of three regions: an N-terminal region of varying length (usually containing positively charged amino acids), a hydrophobic region, and a short carboxy-terminal peptide region. In eukaryotes, the signal peptide of a nascent precursor protein (preprotein) directs the ribosome towards the rough endoplasmic reticulum (ER) membrane and initiates the transport of the elongating peptide chain across the membrane. However, the signal peptide is not involved in the final destination of the mature protein. Secreted proteins lacking an address tag in their sequence are usually secreted into the external environment. The signal peptide is either cleaved from the precursor protein by signal peptidase present in the endoplasmic reticulum (ER) or remains uncleaved and functions as a membrane anchor. In recent years, more advanced insights into signal peptides have been derived, and it has been shown that the functions and immunodominance of certain signal peptides are far more diverse than previously anticipated.

[0161] Signal peptides typically function to facilitate the targeting of newly synthesized proteins to the endoplasmic reticulum (ER) for processing. ER processing generates mature envelope proteins, where the signal peptide is typically cleaved by the host cell's signal peptidase. Signal peptides can also facilitate the targeting of proteins to the cell membrane. The RSV vaccines of the present disclosure can include, for example, an RNA polynucleotide encoding an artificial signal peptide, wherein the sequence encoding the signal peptide is operably linked to and in-frame with the coding sequence of the RSV antigenic polypeptide. Thus, the RSV vaccines of the present disclosure produce, in some embodiments, an antigenic polypeptide comprising an RSV antigenic polypeptide fused to a signal peptide. In some embodiments, the signal peptide is fused to the N-terminus of the RSV antigenic polypeptide. In some embodiments, the signal peptide is fused to the C-terminus of the RSV antigenic polypeptide.

[0162] In some embodiments, the signal peptide fused to the RSV antigenic polypeptide is an artificial signal peptide. In some embodiments, the artificial signal peptide fused to the RSV antigenic polypeptide encoded by an RSV RNA (e.g., mRNA) vaccine is obtained from an immunoglobulin protein, such as an IgE signal peptide or an IgG signal peptide. In some embodiments, the signal peptide fused to the RSV antigenic polypeptide encoded by an RSV RNA (e.g., mRNA) vaccine is an Ig heavy chain ε-1 signal peptide (IgE HC SP) having the sequence of MDWTWILFLVAAATRVHS (SEQ ID NO: 281). In some embodiments, the signal peptide fused to the RSV antigenic polypeptide encoded by an RSV RNA (e.g., mRNA) vaccine is an HAH signal peptide (IgGkSP) of the IgGk chain V-III region having the sequence of METPAQLLFLLLLWLPDTTG (SEQ ID NO: 282). In some embodiments, the RSV antigenic polypeptide encoded by an RSV RNA (e.g., mRNA) vaccine has an amino acid sequence set forth in one of SEQ ID NOs: 1 to 28 fused to the signal peptide of SEQ ID NO: 281 or SEQ ID NO: 282. The examples disclosed herein are not intended to be limiting, and any signal peptide known in the art to facilitate targeting of a protein to the ER for processing and / or targeting of a protein to the cell membrane can be used in accordance with the present disclosure.

[0163] The signal peptide can have a length of 15 to 60 amino acids. For example, the signal peptide can have a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 or 60 amino acids. In some embodiments, the signal peptide can have a length of 20 to 60, 25 to 60, 30 to 60, 35 to 60, 40 to 60, 45 to 60, 50 to 60, 55 to 60, 15 to 55, 20 to 55, 25 to 55, 30 to 55, 35 to 55, 40 to 55, 45 to 55, 50 to 55, 15 to 50, 20 to 50, 25 to 50, 30 to 50, 35 to 50, 40 to 50, 45 to 50, 15 to 45, 20 to 45, 25 to 45, 30 to 45, 35 to 45, 40 to 45, 15 to 40, 20 to 40, 25 to 40, 30 to 40, 35 to 40, 15 to 35, 20 to 35, 25 to 35, 30 to 35, 15 to 30, 20 to 30, 25 to 30, 15 to 25, 20 to 25 or 15 to 20 amino acids.

[0164] The signal peptide is typically cleaved from the nascent polypeptide at the cleavage site during ER processing. The mature RSV antigenic polypeptide produced by the RSV RNA vaccine of the present disclosure typically does not contain a signal peptide.

[0165] Chemical modification The RNA (e.g., mRNA) vaccine of the present disclosure, in some embodiments, comprises at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one respiratory syncytial virus (RSV) antigenic polypeptide, and the RNA comprises at least one chemical modification.

[0166] The terms "chemical modification" and "chemically modified (chemically modified form)" refer to modifications in at least one of the position, pattern, percentage, or population of ribonucleosides or deoxyribonucleosides of adenosine (A), guanosine (G), uridine (U), thymidine (T), or cytidine (C). Generally, these terms do not refer to ribonucleotide modifications in the naturally occurring 5'-terminal mRNA cap portion.

[0167] Modifications of polynucleotides include, but are not limited to, those described herein, including modifications including chemical modifications, but are not explicitly limited thereto. Polynucleotides (e.g., RNA polynucleotides such as mRNA polynucleotides) can include natural and non-natural modifications, or polynucleotides can include combinations of natural and non-natural modifications. Polynucleotides can include any useful modifications, for example, modifications of sugars, nucleobases, or internucleoside linkages (e.g., phosphates, phosphodiester linkages, or linkages to the phosphodiester backbone).

[0168] With respect to polypeptides, the term "modification" refers to modifications to the standard set of 20 amino acids. Polypeptides provided herein are considered "modified" even when they contain amino acid substitutions, insertions, or combinations of substitutions and insertions.

[0169] Polynucleotides (e.g., RNA polynucleotides such as mRNA polynucleotides) include, in some embodiments, various (more than one) different modifications. In some embodiments, a particular region of a polynucleotide contains one, two, or more (optionally different) nucleoside or nucleotide modifications. In some embodiments, a modified RNA polynucleotide (e.g., a modified mRNA polynucleotide), when introduced into a cell or an organism, exhibits reduced degradation in each of the cell or the organism as compared to an unmodified polynucleotide. In some embodiments, a modified RNA polynucleotide (e.g., a modified mRNA polynucleotide), when introduced into a cell or an organism, may exhibit reduced immunogenicity (e.g., reduced innate response) in each of the cell or the organism.

[0170] Polynucleotides (e.g., RNA polynucleotides such as mRNA polynucleotides) include, in some embodiments, non-natural modified nucleotides introduced during or after polynucleotide synthesis to achieve a desired function or property. Modifications may be present in the internucleotide linkage, the purine or pyrimidine base, or the sugar. Modifications can be introduced at the end of the chain or elsewhere in the chain using chemical synthesis or polymerase enzymes. Any region of the polynucleotide can be chemically modified.

[0171] The present disclosure provides modified nucleosides and nucleotides of polynucleotides (e.g., RNA polynucleotides such as mRNA polynucleotides). "Nucleoside" refers to a compound containing a sugar molecule (e.g., pentose or ribose) or a derivative thereof, in combination with an organic base (e.g., purine or pyrimidine) or a derivative thereof (also referred to herein as "nucleic acid base"). "Nucleotide" refers to a nucleoside containing a phosphate group. Modified nucleotides can be synthesized by any useful method, e.g., chemically, enzymatically or recombinantly, to include one or more modified nucleosides or unnatural nucleosides. A polynucleotide can include one or more regions of linked nucleosides. Such regions can have various backbone linkages. The linkage can be a standard phosphodiester linkage, in which case the polynucleotide will include regions of nucleotides.

[0172] Base pairing of modified nucleotides encompasses not only the standard adenosine-thymine, adenosine-uracil or guanosine-cytosine base pairs, but also base pairs formed between nucleotides and / or modified nucleotides that include non-standard or modified bases, where the arrangement of hydrogen bond donors and hydrogen bond acceptors enables hydrogen bonding between non-standard and standard bases, or between two complementary non-standard base structures (e.g., such as those in a polynucleotide having at least one chemical modification). An example of such non-standard base pairing is the base pairing between inosine of a modified nucleotide and adenine, cytosine or uracil. Any combination of bases / sugars or linkers can be incorporated into the polynucleotides of the present disclosure.

[0173] Modifications of polynucleotides (e.g., RNA polynucleotides such as mRNA polynucleotides) useful in the compositions, vaccines, methods, and synthetic procedures of the present disclosure, including but not limited to chemical modifications, include, but are not limited to, the following: 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-methyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6-glycylcarbamoyladenosine, N6-isopentenyladenosine, N6-methyladenosine, N6-threonylcarbamoyladenosine, 1,2'-O-dimethyladenosine, 1-methyladenosine, 2'-O-methyladenosine, 2'-O-ribosyladenosine (phosphate), 2-methyladenosine, 2-methylthio-N6 isopentenyladenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyladenosine, 2'-O-methyladenosine, 2'-O-ribosyladenosine (phosphate), isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, N6,2'-O-dimethyladenosine, N6,2'-O-dimethyladenosine, N6,N6,2'-O-trimethyladenosine, N6,N6-dimethyladenosine, N6-acetyladenosine, N6-hydroxynorvalylcarbamoyladenosine, N6-methyl-N6-threonylcarbamoyladenosine, 2-methyladenosine, 2-methylthio-N6-isopentenyladenosine, 7-deaza-adenosine, N1-methyl-adenosine, N6,N6(dimethyl)adenine, N6-cis-hydroxy-isopentenyl-adenosine, α-thio-adenosine, 2(amino)adenine, 2(aminopropyl)adenine, 2(methylthio)N6(isopentenyl)adenine, 2-(alkyl)adenine, 2-(aminoalkyl)adenine, 2-(aminopropyl)adenine, 2-(halo)adenine, 2-(halo)adenine, 2-(propyl)adenine, 2'-amino-2'-deoxy-ATP, 2'-azido-2'-deoxy-ATP, 2'-deoxy-2'-a-aminoadenosine TP, 2'-deoxy-2'-a-azidoadenosine TP, 6(alkyl)adenine, 6(methyl)adenine, 6-(alkyl)adenine, 6-(methyl)adenine, 7(deaza)adenine, 8(alkenyl)adenine, 8(alkynyl)adenine, 8(amino)adenine, 8(thioalkyl)adenine, 8-(alkenyl)adenine, 8-(alkyl)adenine, 8-(alkynyl)adenine, 8-(amino)adenine, 8-(halo)adenine, 8-(hydroxyl)adenine, 8-(thioalkyl)adenine, 8-(thiol)adenine, 8-azido-adenosine, azaadenine, deazaadenine, N6(methyl)adenine, N6-(isopentyl)adenine, 7-deaza-8-aza-adenosine, 7-methyladenine, 1-deazaadenosine TP, 2'fluoro-N6-Bz-deoxyadenosine TP, 2'-OMe-2-amino-ATP, 2'O-methyl-N6-Bz-deoxyadenosine TP, 2'-a-ethynyladenosine TP, 2-aminoadenine, 2-aminoadenosine TP, 2-amino-ATP, 2'-a-trifluoromethyladenosine TP, 2-azidoadenosine TP, 2'-b-ethynyladenosine TP, 2-bromoadenosine TP, 2'-b-trifluoromethyladenosine TP, 2-chloroadenosine TP, 2'-deoxy-2',2'-Difluoroadenosine TP, 2'-Deoxy-2'-a-mercaptoadenosine TP, 2'-Deoxy-2'-a-thiomethoxyadenosine TP, 2'-Deoxy-2'-b-aminoadenosine TP, 2'-Deoxy-2'-b-azidoadenosine TP, 2'-Deoxy-2'-b-bromoadenosine TP, 2'-Deoxy-2'-b-chloroadenosine TP, 2'-Deoxy-2'-b-fluoroadenosine TP, 2'-Deoxy-2'-b-iodoadenosine TP, 2'-Deoxy-2'-b-mercaptoadenosine TP, 2'-Deoxy-2'-b-thiomethoxyadenosine TP, 2-Fluoroadenosine TP, 2-Iodoadenosine TP, 2-Mercaptoadenosine TP, 2-Methoxy-adenine, 2-Methylthio-adenine, 2-Trifluoromethyladenosine TP, 3-Deaza-3-bromoadenosine TP, 3-Deaza-3-chloroadenosine TP, 3-Deaza-3-fluoroadenosine TP, 3-Deaza-3-iodoadenosine TP, 3-Deazaadenosine TP, 4'-Azidoadenosine TP, 4'-Carbocyclic Adenosine TP, 4'-Ethynyladenosine TP, 5'-Homo-adenosine TP, 8-Aza-ATP, 8-Bromo-adenosine TP, 8-Trifluoromethyladenosine TP, 9-Deazaadenosine TP, 2-Aminopurine, 7-Deaza-2,6-diaminopurine, 7-Deaza-8-aza-2,6-diaminopurine, 7-Deaza-8-aza-2-aminopurine, 2,6-Diaminopurine, 7-Deaza-8-aza-adenine, 7-Deaza-2-aminopurine, 2-Thiocytidine, 3-Methylcytidine, 5-Formylcytidine, 5-Hydroxymethylcytidine, 5-Methylcytidine, N4-Acetylcytidine, 2'-O-Methylcytidine, 2'-O-Methylcytidine, 5,2'-O-Dimethylcytidine, 5-Formyl-2'-O-Methylcytidine, Lysidine, N4,2'-O-Dimethylcytidine, N4-Acetyl-2'-O-Methylcytidine, N4-Methylcytidine, N4,N4-Dimethyl-2’-OMe-cytidine TP, 4-Methylcytidine, 5-Aza-cytidine, Pseudoisocytidine, Pyrrolocytidine, α-Thio-cytidine, 2-(Thio)cytosine, 2’-Amino-2’-deoxy-CTP, 2’-Azido-2’-deoxy-CTP, 2’-Deoxy-2’-a-aminocytidine TP, 2’-Deoxy-2’-a-azidocytidine TP, 3(Deaza)5(aza)cytosine, 3(Methyl)cytosine, 3-(Alkyl)cytosine, 3-(Deaza)5(aza)cytosine, 3-(Methyl)cytidine, 4,2’-O-Dimethylcytidine, 5(Halo)cytosine, 5(Methyl)cytosine, 5(Propynyl)cytosine, 5(Trifluoromethyl)cytosine, 5-(Alkyl)cytosine, 5-(Alkynyl)cytosine, 5-(Halo)cytosine, 5-(Propynyl)cytosine, 5-(Trifluoromethyl)cytosine, 5-Bromo-cytidine, 5-Iodo-cytidine, 5-Propynylcytosine, 6-(Azo)cytosine, 6-Aza-cytidine, Azacytidine, Deazacytidine, N4(Acetyl)cytosine, 1-Methyl-1-deaza-pseudoisocytidine, 1-Methyl-pseudoisocytidine, 2-Methoxy-5-methyl-cytidine, 2-Methoxy-cytidine, 2-Thio-5-methyl-cytidine, 4-Methoxy-1-methyl-pseudoisocytidine, 4-Methoxy-pseudoisocytidine, 4-Thio-1-methyl-1-deaza-pseudoisocytidine, 4-Thio-1-methyl-pseudoisocytidine, 4-Thio-pseudoisocytidine, 5-Aza-zeberine, 5-Methyl-zeberine, Pyrrolopseudoisocytidine, Zeberine, (E)-5-(2-Bromo-vinyl)cytidine TP, 2,2’-Anhydro-cytidine TP hydrochloride, 2’Fluoro-N4-Bz-cytidine TP, 2’Fluoro-N4-Acetyl-cytidine TP, 2’-O-Methyl-N4-Acetyl-cytidine TP, 2’O-Methyl-N4-Bz-cytidine TP, 2’-a-Ethynylcytidine TP, 2’-a-Trifluoromethylcytidine TP, 2’-b-Ethynylcytidine TP, 2’-b-Trifluoromethylcytidine TP, 2’-Deoxy-2’,2'-Difluorocytidine TP, 2'-Deoxy-2'-α-mercaptocytidine TP, 2'-Deoxy-2'-α-thiomethoxycytidine TP, 2'-Deoxy-2'-β-aminocytidine TP, 2'-Deoxy-2'-β-azidocytidine TP, 2'-Deoxy-2'-β-bromocytidine TP, 2'-Deoxy-2'-β-chlorocytidine TP, 2'-Deoxy-2'-β-fluorocytidine TP, 2'-Deoxy-2'-β-iodocytidine TP, 2'-Deoxy-2'-β-mercaptocytidine TP, 2'-Deoxy-2'-β-thiomethoxycytidine TP, 2'-O-Methyl-5-(1-propynyl)cytidine TP, 3'-Ethynylcytidine TP, 4'-Azidocytidine TP, 4'-Carbocyclic cytidine TP, 4'-Ethynylcytidine TP, 5-(1-propynyl)ara-cytidine TP, 5-(2-Chloro-phenyl)-2-thiocytidine TP, 5-(4-Amino-phenyl)-2-thiocytidine TP, 5-Aminoallyl-CTP, 5-Cyanocytidine TP, 5-Ethynylara-cytidine TP, 5-Ethynylcytidine TP, 5'-Homo-cytidine TP, 5-Methoxycytidine TP, 5-Trifluoromethyl-cytidine TP, N4-Aminocytidine TP, N4-Benzoyl-cytidine TP, Pseudoisocytidine, 7-Methylguanosine, N2,2'-O-Dimethylguanosine, N2-Methylguanosine, Wyosine, 1,2'-O-Dimethylguanosine, 1-Methylguanosine, 2'-O-Methylguanosine, 2'-O-Ribosylguanosine (phosphate), 2'-O-Methylguanosine, 2'-O-Ribosylguanosine (phosphate), 7-Aminomethyl-7-deazaguanosine, 7-Cyano-7-deazaguanosine, Archaeosine, Methylwyosine, N2,7-Dimethylguanosine, N2,N2,2'-O-Trimethylguanosine, N2,N2,7-Trimethylguanosine, N2,N2-Dimethylguanosine, N2,7,2'-O-trimethylguanosine, 6-thio-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, N1-methyl-guanosine, α-thio-guanosine, 2(propyl)guanine, 2-(alkyl)guanine, 2'-amino-2'-deoxy-GTP, 2'-azido-2'-deoxy-GTP, 2'-deoxy-2'-a-aminoguanosine TP, 2'-deoxy-2'-a-azidoguanosine TP, 6(methyl)guanine, 6-(alkyl)guanine, 6-(methyl)guanine, 6-methyl-guanosine, 7(alkyl)guanine, 7(deaza)guanine, 7(methyl)guanine, 7-(alkyl)guanine, 7-(deaza)guanine, 7-(methyl)guanine, 8(alkyl)guanine, 8(alkynyl)guanine, 8(halo)guanine, 8(thioalkyl)guanine, 8-(alkenyl)guanine, 8-(alkyl)guanine, 8-(alkynyl)guanine, 8-(amino)guanine, 8-(halo)guanine, 8-(hydroxyl)guanine, 8-(thioalkyl)guanine, 8-(thiol)guanine, azaguanine, deazaguanine, N(methyl)guanine, N-(methyl)guanine, 1-Me-GTP, 2'fluoro-N2-isobutyl-guanosine TP, 2'O-methyl-N2-isobutyl-guanosine TP, 2'-a-ethynylguanosine TP, 2'-a-trifluoromethylguanosine TP, 2'-b-ethynylguanosine TP, 2'-b-trifluoromethylguanosine TP, 2'-deoxy-2',2'-Difluoroguanosine TP, 2'-Deoxy-2'-α-mercapto guanosine TP, 2'-Deoxy-2'-α-thiomethoxy guanosine TP, 2'-Deoxy-2'-β-aminoguanosine TP, 2'-Deoxy-2'-β-azidoguanosine TP, 2'-Deoxy-2'-β-bromoguanosine TP, 2'-Deoxy-2'-β-chloroguanosine TP, 2'-Deoxy-2'-β-fluoroguanosine TP, 2'-Deoxy-2'-β-iodoguanosine TP, 2'-Deoxy-2'-β-mercapto guanosine TP, 2'-Deoxy-2'- b-thiomethoxyguanosine TP, 4'-azidoguanosine TP, 4'-carbocyclic guanosine TP, 4'-ethynylguanosine TP, 5'-homo-guanosine TP, 8-bromoguanosine TP, 9-deazaguanosine TP, N2-isobutyl-guanosine TP, 1-methylinosine, inosine, 1,2'-O-dimethylinosine, 2'-O-methylinosine, 7-methylinosine, 2'-O-methylinosine, epoxyqueosine, galactosyl-queosine, mannosylqueosine, queosine, allylamino-thymidine, azathymidine, deazathymidine, deoxy-thymidine, 2'-O-methyluridine, 2-thiouridine, 3-methyluridine, 5-carboxymethyluridine, 5-hydroxyuridine, 5-methyluridine, 5-taurinomethyl-2-thiouridine, 5-taurinomethyluridine, dihydrouridine, pseudouridine, (3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3-(3-amino-5-carboxypropyl)pseudouridine, 1-methylpseudouridine, 1-ethyl-pseudouridine, 2'-O-methyluridine, 2'-O-methylpseudouridine, 2'-O-methyluridine, 2-thio-2'-O-methyluridine, 3-(3-amino-3-carboxypropyl)uridine, 3,2'-O-dimethyluridine, 3-methyl-pseudouridine TP, 4-thiouridine, 5-(carboxyhydroxymethyl)uridine, 5-(carboxyhydroxymethyl)uridine methyl ester, 5,2'-O-dimethyluridine, 5,6-Dihydro-uridine, 5-aminomethyl-2-thiouridine, 5-carbamoylmethyl-2'-O-methyluridine, 5-carbamoylmethyluridine, 5-carboxyhydroxymethyluridine, 5-carboxyhydroxymethyluridine methyl ester, 5-carboxymethylaminomethyl-2'-O-methyluridine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, 5-carboxymethylaminomethyluridine, 5-carbamoylmethyluridine TP, 5-methoxycarbonylmethyl-2'-O-methyluridine, 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, 5-methyluridine,), 5-methoxyuridine, 5-methyl-2-thiouridine, 5-methylaminomethyl-2-selenouridine, 5-methylaminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methyldihydrouridine, 5-oxyacetic acid-uridine TP, 5-oxyacetic acid-methyl ester-uridine TP, N1-methyl-pseudouridine, N1-ethyl-pseudouridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 3-(3-amino-3-carboxypropyl)-uridine TP, 5-(isopentenylaminomethyl)-2-thiouridine TP, 5-(isopentenylaminomethyl)-2'-O-methyluridine TP, 5-(isopentenylaminomethyl)uridine TP, 5-propynyluracil, α-thio-uridine, 1(aminoalkylaminocarbonylethylenyl)-2(thio)-pseudouracil, 1(aminoalkylaminocarbonylethylenyl)-2,4-(dithio)pseudouracil, 1(aminoalkylaminocarbonylethylenyl)-4(thio)pseudouracil, 1(aminoalkylaminocarbonylethylenyl)-pseudouracil, 1(aminocarbonylethylenyl)-2(thio)-pseudouracil, 1(aminocarbonylethylenyl)-2,4-(dithio)pseudouracil, 1(aminocarbonylethylenyl)-4(thio)pseudouracil, 1(aminocarbonylethylenyl)-pseudouracil, 1-substituted 2(thio)-pseudouracil, 1-substituted 2,4-(dithio)pseudouracil, 1-substituted 4(thio)pseudouracil, 1-substituted pseudouracil, 1-(aminoalkylamino-carbonylethylenyl)-2-(thio)-pseudouracil, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine TP, 1-methyl-3-(3-amino-3-carboxypropyl)pseudo-UTP, 1-methyl-pseudo-UTP, 1-ethyl-pseudo-UTP, 2(thio)pseudouracil, 2'-deoxyuridine, 2'-fluorouridine, 2-(thio)uracil, 2,4-(dithio)pseudouracil, 2'-methyl, 2'-amino, 2'-azido, 2'-fluoro-guanosine, 2'-amino-2'-deoxy-UTP, 2'-azido-2'-deoxy-UTP, 2'-azido-deoxyuridine TP, 2'-O-methylpseudouridine, 2'-deoxyuridine, 2'-fluorouridine, 2'-deoxy-2'-a-aminouridine TP, 2'-deoxy-2'-a-azidouridine TP, 2-methylpseudouridine, 3(3-amino-3-carboxypropyl)uracil, 4(thio)pseudouracil, 4-(thio)pseudouracil, 4-(thio)uracil, 4-thiouracil, 5(1,3-diazol-1-alkyl)uracil, 5(2-aminopropyl)uracil, 5(aminoalkyl)uracil, 5(dimethylaminoalkyl)uracil, 5(guanidiniumalkyl)uracil, 5(methoxycarbonylmethyl)-2-(thio)uracil, 5(methoxycarbonyl-methyl)uracil, 5(methyl)2(thio)uracil, 5(methyl)2,4(dithio)uracil, 5(methyl)4(thio)uracil, 5(methylaminomethyl)-2(thio)uracil, 5(methylaminomethyl)-2,4(dithio)uracil, 5(methylaminomethyl)-4(thio)uracil, 5(propynyl)uracil, 5(trifluoromethyl)uracil, 5-(2-aminopropyl)uracil, 5-(alkyl)-2-(thio)pseudouracil, 5-(alkyl)-2,4(dithio)pseudouracil, 5-(alkyl)-4(thio)pseudouracil, 5-(alkyl)pseudouracil, 5-(alkyl)uracil, 5-(alkynyl)uracil, 5-(allylamino)uracil, 5-(cyanoalkyl)uracil, 5-(dialkylaminoalkyl)uracil, 5-(dimethylaminoalkyl)uracil, 5-(guanidiniumalkyl)uracil, 5-(halo)uracil, 5-(1,3-diazol-1-alkyl)uracil, 5-(methoxy)uracil, 5-(methoxycarbonylmethyl)-2-(thio)uracil, 5-(methoxycarbonyl-methyl)uracil, 5-(methyl)2(thio)uracil, 5-(methyl)2,4(dithio)uracil, 5-(methyl)4(thio)uracil, 5-(methyl)-2-(thio)pseudouracil, 5-(methyl)-2,4(dithio)pseudouracil, 5-(methyl)-4(thio)pseudouracil, 5-(methyl)pseudouracil, 5-(methylaminomethyl)-2(thio)uracil, 5-(methylaminomethyl)-2,4(thio)uracil, 5-(methylaminomethyl)-4-(thio)uracil, 5-(propynyl)uracil, 5-(trifluoromethyl)uracil, 5-aminoallyl-uridine, 5-bromo-uridine, 5-iodo-uridine, 5-uracil, 6(azo)uracil, 6-(azo)uracil, 6-azauridine, allylamino-uracil, azauracil, deazauracil, N3(methyl)uracil, pseudouridine-1-2-ethanoic acid, pseudouridine, 4-thio-pseudouridine triphosphate, 1-carboxymethyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 1-propynyl-uridine, 1-taurinomethyl-1-methyl-uridine, 1-taurinomethyl-4-thio-uridine, 1-taurinomethyl-pseudouridine, 2-methoxy-4-thio-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-azauridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-azauridine, dihydropseudouridine, (±)1-(2-hydroxypropyl)pseudouridine triphosphate, (2R)-1-(2-hydroxypropyl)pseudouridine triphosphate, (2S)-1-(2-hydroxypropyl)pseudouridine triphosphate, (E)-5-(2-bromo-vinyl)ara-uridine triphosphate, (E)-5-(2-bromo-vinyl)uridine triphosphate, (Z)-5-(2-bromo-vinyl)ara-uridine triphosphate, (Z)-5-(2-bromo-vinyl)uridine triphosphate, 1-(2,2,2-trifluoroethyl)-pseudouridine triphosphate, 1-(2,2,3,3,3-pentafluoropropyl)pseudouridine triphosphate, 1-(2,2-diethoxyethyl)pseudouridine triphosphate, 1-(2,4,6-trimethylbenzyl)pseudouridine triphosphate, 1-(2,4,6-trimethyl-benzyl)pseudouridine triphosphate, 1-(2,4,6-Trimethyl-phenyl)pseudo-UTP, 1-(2-Amino-2-carboxyethyl)pseudo-UTP, 1-(2-Amino-ethyl)pseudo-UTP, 1-(2-Hydroxyethyl)pseudouridine TP, 1-(2-Methoxyethyl)pseudouridine TP, 1-(3,4-Bis-trifluoromethoxybenzyl)pseudouridine TP, 1-(3,4-Dimethoxybenzyl)pseudouridine TP, 1-(3-Amino-3-carboxypropyl)pseudo-UTP, 1-(3-Amino-propyl)pseudo-UTP, 1-(3-Cyclopropyl-prop-2-ynyl)pseudouridine TP, 1-(4-Amino-4-carboxybutyl)pseudo-UTP, 1-(4-Amino-benzyl)pseudo-UTP, 1-(4-Amino-butyl)pseudo-UTP, 1-(4-Amino-phenyl)pseudo-UTP, 1-(4-Azidobenzyl)pseudouridine TP, 1-(4-Bromobenzyl)pseudouridine TP, 1-(4-Chlorobenzyl)pseudouridine TP, 1-(4-Fluorobenzyl)pseudouridine TP, 1-(4-Iodobenzyl)pseudouridine TP, 1-(4-Methanesulfonylbenzyl)pseudouridine TP, 1-(4-Methoxybenzyl)pseudouridine TP, 1-(4-Methoxy-benzyl)pseudo-UTP, 1-(4-Methoxy-phenyl)pseudo-UTP, 1-(4-Methylbenzyl)pseudouridine TP, 1-(4-Methyl-benzyl)pseudo-UTP, 1-(4-Nitrobenzyl)pseudouridine TP, 1-(4-Nitro-benzyl)pseudo-UTP, 1(4-Nitro-phenyl)pseudo-UTP, 1-(4-Thiomethoxybenzyl)pseudouridine TP, 1-(4-Trifluoromethoxybenzyl)pseudouridine TP, 1-(4-Trifluoromethylbenzyl)pseudouridine TP, 1-(5-Amino-pentyl)pseudo-UTP, 1-(6-Amino-hexyl)pseudo-UTP, 1,6-Dimethyl-pseudo-UTP, 1-[3-(2-{2-[2-(2-Aminoethoxy)-ethoxy]-ethoxy}-ethoxy)-propionyl]pseudouridine TP, 1-{3-[2-(2-Aminoethoxy)-ethoxy]-propionyl}pseudouridine TP, 1-Acetylpseudouridine TP, 1-Alkyl-6-(1-propynyl)-pseudo-UTP, 1-Alkyl-6-(2-propynyl)-pseudo-UTP, 1-Alkyl-6-allyl-pseudo-UTP, 1-Alkyl-6-ethynyl-pseudo-UTP, 1-Alkyl-6-homoallyl-pseudo-UTP, 1-Alkyl-6-vinyl-pseudo-UTP, 1-Allylpseudouridine TP, 1-Aminomethyl-pseudo-UTP, 1-Benzoylpseudouridine TP, 1-Benzyloxymethylpseudouridine TP, 1-Benzyl-pseudo-UTP, 1-Biotinyl- PEG2-pseudouridine TP, 1-biotinylpseudouridine TP, 1-butyl-pseudo-UTP, 1-cyanomethylpseudouridine TP, 1-cyclobutylmethyl-pseudo-UTP, 1-cyclobutyl-pseudo-UTP, 1-cycloheptylmethyl-pseudo-UTP, 1-cycloheptyl-pseudo-UTP, 1-cyclohexylmethyl-pseudo-UTP, 1-cyclohexyl-pseudo-UTP, 1-cyclooctylmethyl-pseudo-UTP, 1-cyclooctyl-pseudo-UTP, 1-cyclopentylmethyl-pseudo-UTP, 1-cyclopentyl-pseudo-UTP, 1-cyclopropylmethyl-pseudo-UTP, 1-cyclopropyl-pseudo-UTP, 1-ethyl-pseudo-UTP, 1-hexyl-pseudo-UTP, 1-homoallylpseudouridine TP, 1-hydroxymethylpseudouridine TP, 1-iso-propyl-pseudo-UTP, 1-Me-2-thio-pseudo-UTP, 1-Me-4-thio-pseudo-UTP, 1-Me-alpha-thio-pseudo-UTP, 1-methanesulfonylmethylpseudouridine TP, 1-methoxymethylpseudouridine TP, 1-methyl-6-(2,2,2-trifluoroethyl)pseudo-UTP, 1-methyl-6-(4-morpholino)pseudo-UTP, 1-methyl-6-(4-thiomorpholino)pseudo-UTP, 1-methyl-6-(substituted phenyl)pseudo-UTP, 1-methyl-6-amino-pseudo-UTP, 1-methyl-6-azido-pseudo-UTP, 1-methyl-6-bromo-pseudo-UTP, 1-methyl-6-butyl-pseudo-UTP, 1-methyl-6-chloro-pseudo-UTP, 1-methyl-6-cyano-pseudo-UTP, 1-methyl-6-dimethylamino-pseudo-UTP, 1-methyl-6-ethoxy-pseudo-UTP, 1-methyl-6-ethylcarboxylate-pseudo-UTP, 1-methyl-6-ethyl-pseudo-UTP, 1-methyl-6-fluoro-pseudo-UTP, 1-methyl-6-formyl-pseudo-UTP, 1-methyl-6-hydroxyamino-pseudo-UTP, 1-methyl-6-hydroxy-pseudo-UTP, 1-methyl-6-iodo-pseudo-UTP, 1-methyl-6-iso-propyl-pseudo-UTP,1-methyl-6-methoxy-psido-UTP, 1-methyl-6-methylamino-psido-UTP, 1-methyl-6-phenyl-psido-UTP, 1-methyl-6-propyl-psido-UTP, 1-methyl-6-tert-butyl-psido-UTP, 1-methyl-6-trifluoromethoxy-psido-UTP, 1-methyl-6-trifluoromethyl-psido-UTP, 1-morpholinomethylpsidouridine TP, 1-pentyl-psido-UTP, 1-phenyl-psido-UTP, 1-pivaloylpsidouridine TP, 1-propargylpsidouridine TP, 1-propyl-psido-UTP, 1-propynyl-psidouridine, 1-p-tolyl-psido-UTP, 1-tert-butyl-psido-UTP, 1-thiomethoxymethylpsidouridine TP, 1-thiomorpholinomethylpsidouridine TP, 1-trifluoroacetylpsidouridine TP, 1-trifluoromethyl-psido-UTP, 1-vinylpsidouridine TP, 2,2'-anhydro-uridine TP, 2'-bromo-deoxyuridine TP, 2'-F-5-methyl-2'-deoxy-UTP, 2'-OMe-5-Me-UTP, 2'-OMe-psido-UTP, 2'-a-ethynyluridine TP, 2'-a-trifluoromethyluridine TP, 2'-b-ethynyluridine TP, 2'-b-trifluoromethyluridine TP, 2'-deoxy-2',2'-difluorouridine TP, 2'-deoxy-2'-a-mercaptouridine TP, 2'-deoxy-2'-a-thiomethoxyuridine TP, 2'-deoxy-2'-b-aminouridine TP, 2'-deoxy-2'-b-azidouridine TP, 2'-deoxy-2'-b-bromouridine TP, 2'-deoxy-2'-b-chlorouridine TP, 2'-deoxy-2'-b-fluorouridine TP, 2'-deoxy-2'-b-iodouridine TP, 2'-deoxy-2'-b-mercaptouridine TP, 2'-deoxy-2'-b-thiomethoxyuridine TP, 2-methoxy-4-thio-uridine, 2-methoxyuridine, 2'-O-methyl-5-(1-propynyl)uridine TP, 3-alkyl-psido-UTP, 4'-azidouridine TP, 4'-carbocyclic uridine TP, 4'-ethynyluridine TP, 5-(1-propynyl)ara-uridine TP5-(2-Furanyl)uridine TP, 5-cyanouridine TP, 5-dimethylaminouridine TP, 5'-homo-uridine TP, 5-iodo-2'-fluoro-deoxyuridine TP, 5-phenylethynyluridine TP, 5-trideuteriomethyl-6-deuterio-uridine TP, 5-trifluoromethyl-uridine TP, 5-vinylarabinouridine TP, 6-(2,2,2-trifluoroethyl)-pseudo-UTP, 6-(4-morpholino)-pseudo-UTP, 6-(4-thiomorpholino)-pseudo-UTP, 6-(substituted phenyl)-pseudo-UTP, 6-amino-pseudo-UTP, 6-azido-pseudo-UTP, 6-bromo-pseudo-UTP, 6-butyl-pseudo-UTP, 6-chloro-pseudo-UTP, 6-cyano-pseudo-UTP, 6-dimethylamino-pseudo-UTP, 6-ethoxy-pseudo-UTP, 6-ethylcarboxylate-pseudo-UTP, 6-ethyl-pseudo-UTP, 6-fluoro-pseudo-UTP, 6-formyl-pseudo-UTP, 6-hydroxyamino-pseudo-UTP, 6-hydroxy-pseudo-UTP, 6-iodo-pseudo-UTP, 6-isopropyl-pseudo-UTP, 6-methoxy-pseudo-UTP, 6-methylamino-pseudo-UTP, 6-methyl-pseudo-UTP, 6-phenyl-pseudo-UTP, 6-phenyl-pseudo-UTP, 6-propyl-pseudo-UTP, 6-tert-butyl-pseudo-UTP, 6-trifluoromethoxy-pseudo-UTP, 6-trifluoromethyl-pseudo-UTP, alpha-thio-pseudo-UTP, pseudouridine 1-(4-methylbenzenesulfonic acid)TP, pseudouridine 1-(4-methylbenzoic acid)TP, pseudouridine TP1-[3-(2-ethoxy)]propionic acid, pseudouridine TP1-[3-{2-(2-[2-(2-ethoxy)-ethoxy]-ethoxy)-ethoxy}]propionic acid, pseudouridine TP1-[3-{2-(2-[2-{2(2-ethoxy)-ethoxy}-ethoxy]-ethoxy)-ethoxy}]propionic acid, pseudouridine TP1-[3-{2-(2-[2-ethoxy]-ethoxy)-ethoxy}]propionic acid, pseudouridine TP1-[3-{2-(2-ethoxy)-ethoxy}]propionic acid,Pseudouridine TP1-methylphosphonic acid, pseudouridine TP1-methylphosphonic acid diethyl ester, pseudourido-UTP-N1-3-propionic acid, pseudourido-UTP-N1-4-butyric acid, pseudourido-UTP-N1-5-pentanoic acid, pseudourido-UTP-N1-6-hexanoic acid, pseudourido-UTP-N1-7-heptanoic acid, pseudourido-UTP-N1-methyl-p-benzoic acid, pseudourido-UTP-N1-p-benzoic acid, wybutosine, hydroxywybutosine, isowyosine, peroxidowybutosine, low-modified hydroxywybutosine, 4-demethylwyosine, 2,6-(diamino)purine, 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl:1,3-(diaz)-2-(oxo)-phenothiazin-l-yl, 1,3-(diaz)-2-(oxo)-phenoxazin-1-yl, 1,3,5-(triaza)-2,6-(dioxo)-naphthalene, 2(amino)purine, 2,4,5-(trimethyl)phenyl, 2’methyl, 2’amino, 2’azide, 2’fluoro-cytidine, 2’methyl, 2’amino, 2’azide, 2’fluoro-adenine, 2’methyl, 2’amino, 2’azide, 2’fluoro-uridine, 2’-amino-2’-deoxyribose, 2-amino-6-chloro-purine, 2-aza-inosinyl, 2’-azido-2’-deoxyribose, 2’fluoro-2’-deoxyribose, 2’-fluoro-modified base, 2’-O-methyl-ribose, 2-oxo-7-aminopyridopyrimidin-3-yl, 2-oxo-pyridopyrimidin-3-yl, 2-pyridinone, 3nitropyrrole, 3-(methyl)-7-(propynyl)isocarbostyrylyl, 3-(methyl)isocarbostyrylyl, 4-(fluoro)-6-(methyl)benzimidazole, 4-(methyl)benzimidazole, 4-(methyl)indolyl, 4,6-(dimethyl)indolyl, 5nitroindole, 5-substituted pyrimidine, 5-(methyl)isocarbostyrylyl, 5-nitroindole, 6-(aza)pyrimidine, 6-(azo)thymine, 6-(methyl)-7-(aza)indolyl, 6-chloro-purine, 6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenothiazin-1-yl,7-(Aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-(aminoalkylhydroxy)-1,3-(diaz)-2-(oxo)-phenoxazin-1-yl, 7-(aminoalkylhydroxy)-1,3-(diaz)-2-(oxo)-phenothiazin-1-yl, 7-(aminoalkylhydroxy)-1,3-(diaz)-2-(oxo)-phenoxazin-1-yl, 7-(aza)indolyl, 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin 1-yl, 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenothiazin-1-yl, 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-(guanidiniumalkylhydroxy)-1,3-(diaz)-2-(oxo)-phenoxazin-1-yl, 7-(guanidiniumalkyl-hydroxy)-1,3-(diaz)-2-(oxo)-phenothiazin-1-yl, 7-(guanidiniumalkylhydroxy)-1,3-(diaz)-2-(oxo)-phenoxazin-1-yl, 7-(propynyl)isocarbostyrylyl, 7-(propynyl)isocarbostyrylyl, propynyl-7-(aza)indolyl, 7-deaza-inosinyl, 7-substituted 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-substituted 1,3-(diaz)-2-(oxo)-phenoxazin-1-yl, 9-(methyl)-imidazopyridinyl, aminoindolyl, anthracenyl, bis-ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, bis-ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, difluorotolyl, hypoxanthine, imidazopyridinyl, inosinyl, isocarbostyrylyl, isoguanicine, N2-substituted purine, N6-methyl-2-amino-purine, N6-substituted purine, N-alkylated derivative, naphthalenyl, nitrobenzimidazolyl, nitroimidazolyl, nitroindazolyl, nitropyrazolyl, nebularine, O6-substituted purine, O-alkylated derivative,Ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, oxoformycin TP, para-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, para-substituted-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, pentacenyl, phenanthracenyl, phenyl, propynyl-7-(aza)ine, drill, pyrenyl, pyridopyrimidin-3-yl, pyridopyrimidin-3-yl, 2-oxo-7-amino-pyridopyrimidin-3-yl, pyrrolo-pyrimidin-2-one-3-yl, pyrrolopyrimidinyl, pyrrolopyridinyl, stilbenyl, substituted 1,2,4-triazole, tetracenyl, tubercidin, xanthine, xanthosine-5’-TP, 2-thio-zeverin, 5-aza-2-thio-zeverin, 7-deaza-2-amino-purine, pyridin-4-one ribonucleoside, 2-amino-riboside-TP, formycin ATP, formycin BTP, pyrosin TP, 2’-OH-ara-adenosine TP, 2’-OH-ara-cytidine TP, 2’-OH-ara-uridine TP, 2’-OH-ara-guanosine TP, 5-(2-carbomethoxyvinyl)uridine TP, and N6-(19-amino-pentaoxanonadecyl)adenosine TP.

[0174] In some embodiments, the polynucleotide (e.g., an RNA polynucleotide such as an mRNA polynucleotide) comprises a combination of at least two (e.g., 2, 3, 4, or more) of the aforementioned modified nucleobases.

[0175] In some embodiments, modified nucleobases in a polynucleotide (e.g., an RNA polynucleotide such as an mRNA polynucleotide) are pseudouridine (ψ), 2-thiouridine (s2U), 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine, 2'-O-methyluridine, 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), α-thio-guanosine, α-thio-adenosine, 5-cyanouridine, 4'-thiouridine 7-deaza-adenine, 1-methyl-adenosine (m1A), 2-methyl-adenosine (m2A), N6-methyl-adenosine (m6A) and 2,6-diaminopurine, (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 7-deaza-guanosine, 7-cyano-7-deaza-guanosine (preQ0), 7-aminomethyl-7-deaza-guanosine (preQ1), 7-methyl-guanosine (m7G), 1-methyl-guanosine (m1G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 2,8-dimethyladenosine, 2-geranylthiouridine, 2-lysidine, 2-selenouridine, 3-(3-amino-3-carboxypropyl)-5,6-Dihydrouridine, 3-(3-amino-3-carboxypropyl)pseudouridine, 3-methylpseudouridine, 5-(carboxyhydroxymethyl)-2'-O-methyluridine methyl ester, 5-aminomethyl-2-geranylthiouidine, 5-aminomethyl-2-selenouridine, 5-aminomethyluridine, 5-carbamoylhydroxymethyluridine, 5-carbamoylmethyl-2-thiouridine, 5-carboxymethyl-2-thiouridine, 5-carboxymethylaminomethyl-2-geranylthiouidine, 5-carboxymethylaminomethyl-2-selenouridine, 5-cyanomethyluridine, 5-hydroxythiocytidine, 5-methylaminomethyl-2-geranylthiouidine, 7-aminocarboxypropyl-demethylwyosine, 7-aminocarboxypropylwyosine, 7-aminocarboxypropylwyosine methyl ester, 8-methyladenosine, N4,N4-dimethylcytidine, N6-formyladenosine, N6-hydroxymethyladenosine, agmatidine, cyclic N6-threonylcarbamoyladenosine, glutamyl-queuosine, methylated hypomodified hydroxywybutosine, N4,N4,2'-O-trimethylcytidine, geranylated 5-methylaminomethyl-2-thiouridine, geranylated 5-carboxymethylaminomethyl-2-thiouridine, Q base, preQ0 base, preQ1 base, and combinations of two or more thereof. In some embodiments, at least one chemically modified nucleoside is selected from the group consisting of pseudouridine, 1-methyl-pseudouridine, 1-ethyl-pseudouridine, 5-methylcytosine, 5-methoxyuridine, and combinations thereof. In some embodiments, a polynucleotide (e.g., an RNA polynucleotide such as an mRNA polynucleotide) comprises a combination of at least two (e.g., 2, 3, 4, or more) of the aforementioned modified nucleobases. In some embodiments, a polynucleotide (e.g., an RNA polynucleotide such as an mRNA polynucleotide) comprises a combination of at least two (e.g., 2, 3, 4, or more) of the aforementioned modified nucleobases.,

[0176] In some embodiments, the modified nucleobases in the polynucleotide (e.g., an RNA polynucleotide such as an mRNA polynucleotide) are selected from the group consisting of 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), pseudouridine (ψ), α-thio-guanosine, and α-thio-adenosine. In some embodiments, the polyribonucleotide comprises a combination of at least two (e.g., 2, 3, 4, or more) of the foregoing modified nucleobases.

[0177] In some embodiments, the polynucleotide (e.g., an RNA polynucleotide such as an mRNA polynucleotide) comprises pseudouridine (ψ) and 5-methyl-cytidine (m5C). In some embodiments, the polyribonucleotide (e.g., an RNA such as an mRNA) comprises 1-methyl-pseudouridine (m1ψ). In some embodiments, the polyribonucleotide (e.g., an RNA such as an mRNA) comprises 1-ethyl-pseudouridine (e1ψ). In some embodiments, the polyribonucleotide (e.g., an RNA such as an mRNA) comprises 1-methyl-pseudouridine (m1ψ) and 5-methyl-cytidine (m5C). In some embodiments, the polyribonucleotide (e.g., an RNA such as an mRNA) comprises 1-ethyl-pseudouridine (e1ψ) and 5-methyl-cytidine (m5C). In some embodiments, the polyribonucleotide (e.g., an RNA such as an mRNA) comprises 2-thiouridine (s2U). In some embodiments, the polyribonucleotide (e.g., an RNA such as an mRNA) comprises 2-thiouridine and 5-methyl-cytidine (m5C). In some embodiments, the polyribonucleotide (e.g., an RNA such as an mRNA) comprises methoxy-uridine (mo5U). In some embodiments, the polyribonucleotide (e.g., an RNA such as an mRNA) comprises 5-methoxy-uridine (mo5U) and 5-methyl-cytidine (m5C). In some embodiments, the polyribonucleotide (e.g., an RNA such as an mRNA) comprises 2'-O-methyluridine. In some embodiments, the polyribonucleotide (e.g., an RNA such as an mRNA) comprises 2'-O-methyluridine and 5-methyl-cytidine (m5C). In some embodiments, the polyribonucleotide (e.g., an RNA such as an mRNA) comprises N6-methyl-adenosine (m6A). In some embodiments, the polyribonucleotide (e.g., an RNA such as an mRNA) comprises N6-methyl-adenosine (m6A) and 5-methyl-cytidine (m5C).

[0178] In some embodiments, the polynucleotide (e.g., an RNA polynucleotide such as an mRNA polynucleotide) is uniformly modified for a particular modification (e.g., fully modified, modified throughout the sequence). For example, the polynucleotide can be uniformly modified with 1-methyl-pseudouridine, i.e., all uridine residues in the mRNA sequence are replaced with 1-methyl-pseudouridine. Similarly, the polynucleotide can be uniformly modified by replacing any type of nucleoside residue present in the sequence with a modified residue such as those described above.

[0179] Exemplary nucleobases and nucleosides having modified cytosine include N4-acetyl-cytidine (ac4C), 5-methyl-cytidine (m5C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm5C), 1-methyl-pseudoisocytidine, 2-thio-cytidine (s2C), and 2-thio-5-methyl-cytidine.

[0180] In some embodiments, the modified nucleobase is a modified uridine. Exemplary nucleobases and nucleosides having modified uridine include 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxyuridine, 2-thiouridine, 5-cyanouridine, 2'-O-methyluridine, and 4'-thiouridine.

[0181] In some embodiments, the modified nucleobase is a modified adenine. Exemplary nucleobases and nucleosides having modified adenine include 7-deaza-adenine, 1-methyl-adenosine (m1A), 2-methyl-adenosine (m2A), and N6-methyl-adenosine (m6A).

[0182] In some embodiments, the modified nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having modified guanine include inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 7-deaza-guanosine, 7-cyano-7-deaza-guanosine (preQ0), 7-aminomethyl-7-deaza-guanosine (preQ1), 7-methyl-guanosine (m7G), 1-methyl-guanosine (m1G), 8-oxo-guanosine, and 7-methyl-8-oxo-guanosine.

[0183] The polynucleotides of the present disclosure can be partially or fully modified throughout the full length of the molecule. For example, one or more or all or a given type of nucleotide (e.g., purine or pyrimidine, or any one or more or all of A, G, U, C) in the polynucleotide of the present invention or a predetermined sequence region thereof (e.g., mRNA with or without a polyA tail) can be uniformly modified. In some embodiments, all nucleotides X in the polynucleotide (or a given sequence region thereof) of the present disclosure are modified nucleotides, where X is any one of the nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C, or A+G+C.

[0184] The polynucleotide may contain from about 1% to about 100% modified nucleotides (relative to the total nucleotide content or relative to one or more types of nucleotides (i.e., any one or more of A, G, U, or C)), or any percentage in between (e.g., 1% - 20%, 1% - 25%, 1% - 50%, 1% - 60%, 1% - 70%, 1% - 80%, 1% - 90%, 1% - 95%, 10% - 20%, 10% - 25%, 10% - 50%, 10% - 60%, 10% - 70%, 10% - 80%, 10% - 90%, 10% - 95%, 10% - 100%, 20% - 25%, 20% - 50%, 20% - 60%, 20% - 70%, 20% - 80%, 20% - 90%, 20% - 95%, 20% - 100%, 50% - 60%, 50% - 70%, 50% - 80%, 50% - 90%, 50% - 95%, 50% - 100%, 70% - 80%, 70% - 90%, 70% - 95%, 70% - 100%, 80% - 90%, 80% - 95%, 80% - 100%, 90% - 95%, 90% - 100%, and 95% - 100%). It will be understood that any remaining percentage is occupied by the presence of unmodified A, G, U, or C.

[0185] The polynucleotide may contain at least 1% and at most 100% modified nucleotides, or any percentage in between, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, the polynucleotide may contain modified pyrimidines such as modified uracil or modified cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the uracil in the polynucleotide is replaced by modified uracil (e.g., 5-substituted uracil). The modified uracil may be replaced by a compound having a single unique structure, or by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the cytosine in the polynucleotide is replaced by modified cytosine (e.g., 5-substituted cytosine). The modified cytosine may be replaced by a compound having a single unique structure, or by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures).

[0186] In some embodiments, the modified nucleobase is modified uracil. Exemplary nucleobases and nucleosides having modified uracil include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s 2 U), 4-thio-uridine (s 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho 5 U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), 3-methyl-uridine (m3 U), 5-methoxy-uridine (mo 5 U), uridine 5-oxyacetic acid (cmo 5 U), methyl uridine 5-oxyacetate (mcmo 5 U), 5-carboxymethyl-uridine (cm 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm 5 U), methyl 5-carboxyhydroxymethyl-uridine (mchm 5 U), 5-methoxycarbonylmethyl-uridine (mcm 5 U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm 5 s 2 U), 5-aminomethyl-2-thio-uridine (nm 5 s 2 U), 5-methylaminomethyl-uridine (mnm 5 U), 5-methylaminomethyl-2-thio-uridine (mnm 5 s 2 U), 5-methylaminomethyl-2-seleno-uridine (mnm 5 se 2 U), 5-carbamoylmethyl-uridine (ncm 5 U), 5-carboxymethylaminomethyl-uridine (cmnm 5 U), 5-carboxymethylaminomethyl-2-thio-uridine (cmnm 5 s 2 U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine (τm 5 U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine (τm 5 s 2 U), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine (m 5 U, i.e., having the nucleobase deoxythymine), 1-methyl-pseudouridine (m 1 ψ), 1-ethyl-pseudouridine (e 1 ψ), 5-methyl-2-thio-uridine (m 5 s2 U), 1-methyl-4-thio-pseudouridine (m 1 s 4 ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m 3 ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m 5 D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp 3 U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp 3 ψ), 5-(isopentenylaminomethyl)uridine (inm 5 U), 5-(isopentenylaminomethyl)-2-thio-uridine (inm 5 s 2 U), α-thio-uridine, 2’-O-methyl-uridine (Um), 5,2’-O-dimethyl-uridine (m 5 Um), 2’-O-methyl-pseudouridine (ψm), 2-thio-2’-O-methyl-uridine (s 2 Um), 5-methoxycarbonylmethyl-2’-O-methyl-uridine (mcm 5 Um), 5-carbamoylmethyl-2’-O-methyl-uridine (ncm 5 Um), 5-carboxymethylaminomethyl-2’-O-methyl-uridine (cmnm 5 Um), 3,2’-O-dimethyl-uridine (m 3 Um), and 5-(isopentenylaminomethyl)-2’-O-methyl-uridine (inm 5Examples include uridine, 1-thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uridine, 2'-OH-ara-uridine, 5-(2-carbomethoxyvinyl)uridine, and 5-[3-(1-E-propenylamino)]uridine.

[0187] In some embodiments, the modified nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having a modified cytosine include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m 3 C), N4-acetyl-cytidine (ac 4 C), 5-formyl-cytidine (f 5 C), N4-methyl-cytidine (m 4 C), 5-methyl-cytidine (m 5 C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm 5 C), 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine (s 2 C), 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine (k 2 C), α-thio-cytidine, 2'-O-methyl-cytidine (Cm), 5,2'-O-dimethyl-cytidine (m 5 Cm), N4-acetyl-2'-O-methyl-cytidine (ac 4 Cm), N4,2'-O-dimethyl-cytidine (m 4 Cm), 5-formyl-2'-O-methyl-cytidine (f 5 Cm), N4,N4,2'-O-trimethyl-cytidine (m 4 2Examples include Cm), 1-thio-cytidine, 2'-F-ara-cytidine, 2'-F-cytidine, and 2'-OH-ara-cytidine.

[0188] In some embodiments, the modified nucleobase is a modified adenine. Exemplary nucleobases and nucleosides having a modified adenine include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenosine (m 1 A), 2-methyl-adenosine (m 2 A), N6-methyl-adenosine (m 6 A), 2-methylthio-N6-methyl-adenosine (ms 2 m 6 A), N6-isopentenyl-adenosine (i 6 A), 2-methylthio-N6-isopentenyl-adenosine (ms 2 i 6 A), N6-(cis-hydroxyisopentenyl)adenosine (io 6 A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine (ms 2 io 6 A), N6-glycinylcarbamoyl-adenosine (g 6 A), N6-threonylcarbamoyl-adenosine (t 6 A), N6-methyl-N6-threonylcarbamoyl-adenosine (m 6 t 6 A), 2-methylthio-N6-threonylcarbamoyl-adenosine (ms 2 g 6 A), N6,N6-dimethyl-adenosine (m 6 2 A), N6-hydroxynorvalylcarbamoyl-adenosine (hn 6A), 2-methylthio-N6-hydroxy-norvalylcarbamoyl-adenosine (ms 2 hn 6 A), N6-acetyl-adenosine (ac 6 A), 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, α-thio-adenosine, 2'-O-methyl-adenosine (Am), N6,2'-O-dimethyl-adenosine (m 6 Am), N6,N6,2'-O-trimethyl-adenosine (m 6 2 Am), 1,2'-O-dimethyl-adenosine (m 1 Am), 2'-O-ribosyladenosine (phosphate) (Ar(p)), 2-amino-N6-methyl-purine, 1-thio-adenosine, 8-azido-adenosine, 2'-F-ara-adenosine, 2'-F-adenosine, 2'-OH-ara-adenosine, and N6-(19-amino-pentaoxanonadecil)-adenosine.

[0189] In some embodiments, the modified nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having a modified guanine include inosine (I), 1-methyl-inosine (m 1 I), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxwybutosine (o 2 yW), hydroxywybutosine (OhyW), hypomodified hydroxywybutosine (OhyW * ), 7-deaza-guanosine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanosine (preQ 0 ), 7-aminomethyl-7-deaza-guanosine (preQ 1 ), archaeosine (G + ), 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine (m 7G), 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine (m 1 G), N2-methyl-guanosine (m 2 G), N2,N2-dimethyl-guanosine (m 2 2 G), N2,7-dimethyl-guanosine (m 2,7 G), N2,N2,7-dimethyl-guanosine (m 2,2,7 G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, α-thio-guanosine, 2'-O-methyl-guanosine (Gm), N2-methyl-2'-O-methyl-guanosine (m 2 Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m 2 2 Gm), 1-methyl-2'-O-methyl-guanosine (m 1 Gm), N2,7-dimethyl-2'-O-methyl-guanosine (m 2,7 Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m 1 Im), 2'-O-ribosylguanosine (phosphate) (Gr(p)), 1-thio-guanosine, O6-methyl-guanosine, 2'-F-ara-guanosine, and 2'-F-guanosine.

[0190] In some embodiments, the RNA vaccine comprises a 5'UTR element, optionally a codon-optimized open reading frame and a 3'UTR element, a poly(A) sequence and / or a polyadenylation signal, and the RNA is not chemically modified.

[0191] RSV RNA Vaccine: In vitro transcription of RNA (e.g., mRNA) The RSV vaccine of the present disclosure comprises at least one RNA polynucleotide such as mRNA (e.g., modified mRNA). The mRNA is transcribed in vitro from a template DNA, e.g., called an "in vitro transcription template". In some embodiments, the at least one RNA polynucleotide has at least one chemical modification. The at least one chemical modification can include, but is not explicitly limited to, any modification described herein.

[0192] In vitro transcription of RNA is known in the art and is described in International Publication No. WO / 2014 / 152027, which is hereby incorporated by reference in its entirety. For example, in some embodiments, the RNA transcript is generated using an unamplified linear DNA template in an in vitro transcription reaction to generate the RNA transcript. In some embodiments, the RNA transcript is capped by enzymatic capping. In some embodiments, the RNA transcript is purified by chromatography, e.g., using an oligo dT substrate. Some embodiments exclude the use of DNase. In some embodiments, the RNA transcript is synthesized from an unamplified linear DNA template encoding the gene of interest by an enzymatic in vitro transcription reaction utilizing T7 phage RNA polymerase and nucleotide triphosphates of the desired chemical. Any number of RNA polymerases or variants can be used in the methods of the invention. The polymerase can be selected from, but is not limited to, phage RNA polymerases such as T7 RNA polymerase, T3 RNA polymerase, SP6 RNa polymerase and / or mutant polymerases (e.g., polymerases that can incorporate chemically modified nucleic acids and / or nucleotides including, but not limited to, modified nucleic acids and / or modified nucleotides).

[0193] In some embodiments, unamplified linearized plasmid DNA is used as the template DNA for in vitro transcription. In some embodiments, the template DNA is isolated DNA. In some embodiments, the template DNA is cDNA. In some embodiments, the cDNA is formed by reverse transcription of an RNA polynucleotide, such as, but not limited to, RSV RNA, such as RSV mRNA. In some embodiments, the cell is, for example, a bacterial cell, such as E. coli, and the plasmid DNA template is transfected into, for example, DH-1 cells. In some embodiments, the transfected cells are cultured to replicate the plasmid DNA, and then the plasmid DNA is isolated and purified. In some embodiments, the DNA template contains an RNA polymerase promoter, such as a T7 promoter, located on the 5' side and operably linked to the gene of interest.

[0194] In some embodiments, the in vitro transcription template encodes a 5' untranslated (UTR) region, contains an open reading frame, and encodes a 3' UTR and a polyA tail. The composition and length of the specific nucleic acid sequence of the in vitro transcription template depend on the mRNA encoded by the template.

[0195] The "5' untranslated region" (UTR) refers to the region of mRNA that is directly upstream (i.e., 5' side) from the start codon that does not encode a polypeptide (i.e., the first codon of the mRNA transcript translated by the ribosome).

[0196] The "3' untranslated region" (UTR) refers to the region of mRNA that is directly downstream (i.e., 3' side) from the stop codon that does not encode a polypeptide (i.e., the codon of the mRNA transcript that signals the end of translation).

[0197] An "open reading frame" is a continuous stretch of DNA that begins with a start codon (e.g., methionine (ATG)), ends with a stop codon (e.g., TAA, TAG, or TGA), and encodes a polypeptide.

[0198] A "polyA tail" is a region of an mRNA that is downstream from the 3'UTR, e.g., directly downstream (i.e., 3' side), and contains a number of consecutive adenosine monophosphates. The polyA tail can contain 10 - 300 adenosine monophosphates. For example, the polyA tail can contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 adenosine monophosphates. In some embodiments, the polyA tail contains 50 - 250 adenosine monophosphates. In a relevant biological context (e.g., intracellular, in vivo), the poly(A) tail functions, for example, to protect the mRNA from enzymatic degradation in the cytoplasm and / or to assist in transcription termination, nuclear export of the mRNA, and translation.

[0199] In some embodiments, the polynucleotide comprises 200 - 3,000 nucleotides. For example, the polynucleotide can comprise 200 - 500, 200 - 1000, 200 - 1500, 200 - 3000, 500 - 1000, 500 - 1500, 500 - 2000, 500 - 3000, 1000 - 1500, 1000 - 2000, 1000 - 3000, 1500 - 3000, or 2000 - 3000 nucleotides.

[0200] Treatment method Compositions (e.g., pharmaceutical compositions), methods, kits, and reagents for the prevention and / or treatment of RSV in humans and other animals are provided herein. The RSV RNA (e.g., mRNA) vaccine can be used as a therapeutic or prophylactic agent. This can be used as an agent for the prevention and / or treatment of infectious diseases. In an exemplary embodiment, the RSV RNA vaccine of the present disclosure is used to provide prophylactic protection from RSV. Prophylactic protection from RSV can be achieved after administration of the RSV RNA vaccine of the present disclosure. The vaccine can be administered once, twice, three times, four times, or more, although a single administration of the vaccine may be sufficient (followed optionally by a single booster). Although less desirable, it is possible to administer the vaccine to an infected individual to achieve a therapeutic response. The dosage may need to be adjusted as appropriate.

[0201] In an aspect of the invention, a method of inducing an immune response in a subject against RSV is provided. The method involves administering to the subject an RSV RNA vaccine comprising at least one RNA polynucleotide having an open reading frame encoding at least one RSV antigenic polypeptide or an immunogenic fragment thereof, whereby in the subject, an immune response specific to the RSV antigenic polypeptide or an immunogenic fragment thereof is induced, and the anti-antigenic polypeptide antibody titer in the subject increases compared to the anti-antigenic polypeptide antibody titer in a subject vaccinated with a conventional (e.g., non-nucleic acid) vaccine against RSV at a prophylactically effective dose after vaccination. "Anti-antigenic polypeptide antibody" is a serum antibody that specifically binds to the antigenic polypeptide.

[0202] A prophylactically effective dose is a therapeutically effective dose that prevents viral infection at clinically acceptable levels. In some embodiments, a therapeutically effective dose is the dose listed in the vaccine package insert. A conventional vaccine, as used herein, refers to a vaccine other than the mRNA vaccine of the present invention. For example, conventional vaccines include, but are not limited to, live microorganism vaccines, inactivated microorganism vaccines, subunit vaccines, protein antigen vaccines, DNA vaccines, and the like.

[0203] In some embodiments, the antigenic polypeptide antibody titer of the subject increases by 1 log to 10 log compared to the antigenic polypeptide antibody titer of a subject vaccinated with a conventional vaccine against RSV at a prophylactically effective dose after vaccination.

[0204] In some embodiments, the antigenic polypeptide antibody titer of the subject increases by 1 log compared to the antigenic polypeptide antibody titer of a subject vaccinated with a conventional vaccine against RSV at a prophylactically effective dose after vaccination.

[0205] In some embodiments, the antigenic polypeptide antibody titer of the subject increases by 2 log compared to the antigenic polypeptide antibody titer of a subject vaccinated with a conventional vaccine against RSV at a prophylactically effective dose after vaccination.

[0206] In some embodiments, the antigenic polypeptide antibody titer of the subject increases by 3 log compared to the antigenic polypeptide antibody titer of a subject vaccinated with a conventional vaccine against RSV at a prophylactically effective dose after vaccination.

[0207] In some embodiments, the antigenic polypeptide antibody titer of the subject increases by 5 log compared to the antigenic polypeptide antibody titer of a subject vaccinated with a conventional vaccine against RSV at a prophylactically effective dose after vaccination.

[0208] In some embodiments, the anti-antigenic polypeptide antibody titer of the subject increases by 10 log compared to the anti-antigenic polypeptide antibody titer of a subject vaccinated with a conventional vaccine against RSV at a prophylactically effective dose after vaccination.

[0209] In another aspect of the present invention, a method of inducing an immune response in a subject against RSV is provided. The method involves administering to the subject an RSV RNA vaccine comprising at least one RNA polynucleotide having an open reading frame encoding at least one RSV antigenic polypeptide or an immunogenic fragment thereof, whereby an immune response specific for the RSV antigenic polypeptide or an immunogenic fragment thereof is induced in the subject, and the immune response in the subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine against RSV at a dose level 2-fold to 100-fold that of the RNA vaccine.

[0210] In some embodiments, the immune response of the subject is equivalent to the immune response of a subject vaccinated with a conventional vaccine at a dose level 2-fold that of the RSV RNA vaccine.

[0211] In some embodiments, the immune response of the subject is equivalent to the immune response of a subject vaccinated with a conventional vaccine at a dose level 3-fold that of the RSV RNA vaccine.

[0212] In some embodiments, the immune response of the subject is equivalent to the immune response of a subject vaccinated with a conventional vaccine at a dose level 4-fold that of the RSV RNA vaccine.

[0213] In some embodiments, the immune response of the subject is equivalent to the immune response of a subject vaccinated with a conventional vaccine at a dose level 5-fold that of the RSV RNA vaccine.

[0214] In some embodiments, the immune response of the subject is equivalent to the immune response of a subject vaccinated with a conventional vaccine at a dose level 10-fold that of the RSV RNA vaccine.

[0215] In some embodiments, the immune response in the subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at a dose level 50-fold that of the RSV RNA vaccine.

[0216] In some embodiments, the immune response in the subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at a dose level 100-fold that of the RSV RNA vaccine.

[0217] In some embodiments, the immune response in the subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at a dose level 10 - 1000-fold that of the RSV RNA vaccine.

[0218] In some embodiments, the immune response in the subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at a dose level 100 - 1000-fold that of the RSV RNA vaccine.

[0219] In other embodiments, the immune response is evaluated by determining the [protein] antibody titer in the subject.

[0220] In another aspect, the present invention provides a method of inducing an immune response against RSV in a subject by administering to the subject an RSV RNA vaccine comprising at least one RNA polynucleotide having an open reading frame encoding at least one RSV antigenic polypeptide or an immunogenic fragment thereof, thereby inducing in the subject a specific immune response against the RSV antigenic polypeptide or an immunogenic fragment thereof, wherein the immune response in the subject is induced 2 days to 10 weeks earlier compared to the immune response induced in a subject vaccinated with a prophylactically effective dose of a conventional vaccine against RSV. In some embodiments, the immune response in the subject is induced in a subject vaccinated with a prophylactically effective dose of a conventional vaccine that is 2 - 100-fold the dose of the RNA vaccine.

[0221] In some embodiments, the immune response in the subject is induced 2 days earlier compared to the immune response induced in a subject inoculated with a prophylactically effective dose of a conventional vaccine.

[0222] In some embodiments, the immune response in the subject is induced 3 days earlier compared to the immune response induced in a subject inoculated with a prophylactically effective dose of a conventional vaccine.

[0223] In some embodiments, the immune response in the subject is induced 1 week earlier compared to the immune response induced in a subject inoculated with a prophylactically effective dose of a conventional vaccine.

[0224] In some embodiments, the immune response in the subject is induced 2 weeks earlier compared to the immune response induced in a subject inoculated with a prophylactically effective dose of a conventional vaccine.

[0225] In some embodiments, the immune response in the subject is induced 3 weeks earlier compared to the immune response induced in a subject inoculated with a prophylactically effective dose of a conventional vaccine.

[0226] In some embodiments, the immune response in the subject is induced 5 weeks earlier compared to the immune response induced in a subject inoculated with a prophylactically effective dose of a conventional vaccine.

[0227] In some embodiments, the immune response in the subject is induced 10 weeks earlier compared to the immune response induced in a subject inoculated with a prophylactically effective dose of a conventional vaccine.

[0228] Broad-spectrum RSV vaccine Situations where there is a risk of infection with two or more RSV strains are envisaged. RNA (e.g., mRNA) - based therapeutic vaccines are particularly suitable for the prime - boost vaccination approach due to several factors including, but not limited to, manufacturing speed and the ability to rapidly adapt the vaccine to match recognized geographical threats. Further, since the vaccine uses the human body to produce antigenic proteins, it is suitable for the production of larger and more complex antigenic proteins, thereby enabling proper folding, surface expression, antigen presentation, etc. in human subjects. To protect against two or more RSV strains, a prime - boost vaccine can be administered that includes RNA encoding at least one antigenic polypeptide protein (or an antigenic portion thereof) of a first RSV and further includes RNA encoding at least one antigenic polypeptide protein (or an antigenic portion thereof) of a second RSV. The RNA (mRNA) may be formulated together, for example, in a single lipid nanoparticle (LNP), or may be formulated in separate LNPs that are intended for co - administration.

[0229] Flagellin adjuvant Flagellin is a monomeric protein of approximately 500 amino acids that forms flagella involved in bacterial motility upon polymerization. Flagellin is expressed by various flagellated bacteria (e.g., Salmonella typhimurium) and non - flagellated bacteria (such as Escherichia coli). The sensing of flagellin by innate immune system cells (such as dendritic cells, macrophages) is mediated by Toll - like receptor 5 (TLR5) as well as Nod - like receptors (NLR) Ipaf and Naip5. TLRs and NLRs have been identified to play roles in activating innate and adaptive immune responses. Thus, flagellin provides an adjuvant effect in vaccines.

[0230] The nucleotide and amino acid sequences encoding known flagellin polypeptides are publicly available in the NCBI GenBank database. Among them, flagellin sequences derived from S. Typhimurium, H. Pylori, V. Cholera, S. marcesens, S. flexneri, T. Pallidum, L. pneumophila, B. burgdorferei, C. difficile, R. meliloti, A. tumefaciens, R. lupini, B. clarridgeiae, P. Mirabilis, B. subtilus, L. monocytogenes, P. aeruginosa and E. coli are known.

[0231] As used herein, a flagellin polypeptide refers to a full-length flagellin protein, an immunogenic fragment thereof, and a peptide having at least 50% sequence identity to the flagellin protein or an immunogenic fragment thereof. Exemplary flagellin proteins include Salmonella typhi (UniPro entry number Q56086), Salmonella typhimurium (A0A0C9DG09), Salmonella enteritidis (A0A0C9BAB7), and Salmonella choleraesuis (Q6V2X8) as well as flagellins derived from SEQ ID NOs: 173-175. In some embodiments, the flagellin polypeptide has at least 60%, 70%, 75%, 80%, 90%, 95%, 97%, 98% or 99% sequence identity to the flagellin protein or an immunogenic fragment thereof.

[0232] In some embodiments, the flagellin polypeptide is an immunogenic fragment. The immunogenic fragment is a part of the flagellin protein that elicits an immune response. In some embodiments, the immune response is a TLR5 immune response. An example of the immunogenic fragment is a flagellin protein in which all or part of the hinge region is deleted or replaced with other amino acids. For example, an antigenic polypeptide can be inserted into the hinge region. The hinge region is the hypervariable region of flagellin. The hinge region of flagellin is also referred to as the "D3 domain or D3 region", "propeller domain or propeller region", "hypervariable domain or hypervariable region", and "variable domain or variable region". "At least a part of the hinge region", as used herein, refers to any part of the hinge region of flagellin or the entire hinge region. In other embodiments, the immunogenic fragment of flagellin is a 20-, 25-, 30-, 35- or 40-amino acid C-terminal fragment of flagellin.

[0233] The flagellin monomer is formed by domains D0 to D3. 0 and D1 that form the stem are composed of long vertically aligned alpha helices and are highly conserved among various bacteria. The D1 domain contains several amino acid stretches useful for TLR5 activation. The entire D1 domain or one or more of the active regions within the domain is the immunogenic fragment of flagellin. Examples of the immunogenic regions within the D1 domain include residues 88-114 and residues 411-431 of Salmonella typhimurium FliC flagellin. Among the 13 amino acids in the 88-100 region, at least 6 substitutions are possible between Salmonella flagellin and other flagellins that retain TLR5 activation. Therefore, the immunogenic fragment of flagellin contains a flagellin-like sequence that activates TLR5 and contains a 13-amino acid motif that is 53% or more identical to the sequence of 88-100 of Salmonella FliC (LQRVRELAVQSAN, SEQ ID NO: 286).

[0234] In some embodiments, an RNA (e.g., mRNA) vaccine comprises RNA encoding a fusion protein of flagellin and one or more antigenic polypeptides. As used herein, "fusion protein" refers to the linkage of two components of a construct. In some embodiments, the carboxy terminus of the antigenic polypeptide is fused or linked to the amino terminus of the flagellin polypeptide. In other embodiments, the amino terminus of the antigenic polypeptide is fused or linked to the carboxy terminus of the flagellin polypeptide. The fusion protein can comprise, for example, 1, 2, 3, 4, 5, 6 or more flagellin polypeptides linked to 1, 2, 3, 4, 5, 6 or more antigenic polypeptides. When two or more flagellin polypeptides and / or two or more antigenic polypeptides are linked, such constructs may be referred to as "multimers".

[0235] Each component of the fusion protein may be directly linked to each other or connected via a linker. For example, the linker may be an amino acid linker. The amino acid linker for linking the components of the fusion protein encoded by an RNA (e.g., mRNA) vaccine may comprise at least one element selected from the group consisting of lysine residue, glutamic acid residue, serine residue and arginine residue. In some embodiments, the linker is 1-30, 1-25, 1-25, 5-10, 5, 15 or 5-20 amino acids in length.

[0236] In other embodiments, an RNA (e.g., mRNA) vaccine comprises at least two separate RNA polynucleotides, one encoding one or more antigenic polypeptides and the other encoding a flagellin polypeptide. The at least two RNA polynucleotides can be formulated together in a carrier such as a lipid nanoparticle.

[0237] Therapeutic and prophylactic compositions For example, compositions (e.g., pharmaceutical compositions), methods, kits, and reagents for the prevention, treatment, and / or diagnosis of RSV in humans and other animals are provided herein. RSV RNA (e.g., mRNA) vaccines can be used as therapeutic or prophylactic agents. This can be used as an agent for the prevention and / or treatment of infectious diseases. In some embodiments, the RSV vaccine of the present invention can be envisioned for use in priming immune effector cells, for example, after activating peripheral blood mononuclear cells (PBMCs) ex vivo, injecting (re-injecting) them into a subject.

[0238] In an exemplary embodiment, an RSV vaccine containing the RNA polynucleotide described herein can be administered to a subject (e.g., a mammalian subject such as a human subject), and the RNA polynucleotide is translated in vivo to produce an antigenic polypeptide.

[0239] An RSV RNA vaccine can induce the translation of a polypeptide (e.g., an antigen or immunogen) in a cell, tissue, or organism. In an exemplary embodiment, such translation occurs in vivo, although embodiments where such translation occurs ex vivo, in a medium, or in vitro are also envisioned. In an exemplary embodiment, a cell, tissue, or organism is contacted with an effective amount of a composition containing an RSV RNA vaccine containing a polynucleotide having at least one translatable region encoding an antigenic polypeptide.

[0240] The "effective amount" of an RSV RNA vaccine is provided, at least in part, based on the target tissue, target cell type, means of administration, physical characteristics of the polynucleotide (e.g., size and degree of modified nucleosides), and other components of the RSV RNA vaccine, as well as other determinants. Generally, an effective amount of an RSV RNA vaccine composition results in an immune response that is induced or boosted in correlation with antigen production in cells. Generally, an effective amount of an RSV RNA vaccine containing an RNA polynucleotide having at least one chemical modification is preferably more effective than a composition containing a similar unmodified polynucleotide encoding the same antigen or peptide antigen. The increase in antigen production can be indicated by an increase in cell transfection (percentage of cells transfected with the RNA vaccine), an increase in protein translation from the polynucleotide, a decrease in nuclease degradation (e.g., as indicated by an extended protein translation period from the modified polynucleotide), or a change in the antigen-specific immune response of the host cell.

[0241] The term "pharmaceutical composition" refers to a combination of an active substance and an inert or active carrier, whereby the composition is particularly suitable for diagnostic or therapeutic use in vivo or ex vivo. A "pharmaceutically acceptable carrier" does not cause undesirable physiological effects after or upon administration to a subject. The carrier in a pharmaceutical composition must also be "acceptable" in the sense that it is compatible with the active ingredient and capable of stabilizing the active ingredient. One or more solubilizing agents can be utilized as pharmaceutical carriers for the delivery of the active substance. Examples of pharmaceutically acceptable carriers include, but are not limited to, biocompatible vehicles, adjuvants, additives, and diluents that achieve a composition usable as a dosage form. Examples of other carriers include colloidal silicon dioxide, magnesium stearate, cellulose, and sodium lauryl sulfate. Further suitable pharmaceutical carriers and diluents and the pharmaceutical necessities for their use are described in Remington’s Pharmaceutical Sciences.

[0242] In some embodiments, the RNA vaccines (including polynucleotides and their encoded polypeptides) according to the present disclosure can be used for the treatment or prevention of RSV.

[0243] The RSV RNA vaccine can be administered prophylactically or therapeutically to healthy individuals as part of an active immunization scheme, or during the incubation period or early in the course of active infection after onset. In some embodiments, the amount of the RNA vaccine of the present disclosure provided to a cell, tissue or subject can be an amount effective for immunoprophylaxis.

[0244] RSV RNA (e.g., mRNA) vaccines can be administered together with other prophylactic or therapeutic compounds. As non-limiting examples, the prophylactic or therapeutic compound can be an adjuvant or a booster. As used herein with respect to prophylactic compositions such as vaccines, the term "booster" refers to an additional administration of a prophylactic (vaccine) composition. A booster (or booster vaccine) can be administered after a prior administration of a prophylactic composition. The time from the first administration of the prophylactic composition to the booster administration is not limiting, but can be 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes, 20 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 36 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 10 days, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 18 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12 years, 13 years, 14 years, 15 years, 16 years, 17 years, 18 years, 19 years, 20 years, 25 years, 30 years, 35 years, 40 years, 45 years, 50 years, 55 years, 60 years, 65 years, 70 years, 75 years, 80 years, 85 years, 90 years, 95 years or more than 99 years. In an exemplary embodiment, the time from the first administration of the prophylactic composition to the booster administration is not limiting, but can be 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 6 months or 1 year.

[0245] In some embodiments, the RSV RNA vaccine can be administered intramuscularly, intranasally, or intradermally, similar to the administration of inactivated vaccines known in the art.

[0246] RSV RNA vaccines can be used in a variety of settings depending on the incidence of infectious diseases or the degree or level of unmet medical needs. As a non-limiting example, RNA vaccines can be used to treat and / or prevent various infectious diseases. RNA vaccines generally have excellent properties in that they often have a greater antibody titer and provide a faster response compared to commonly available antiviral agents.

[0247] Provided herein are pharmaceutical compositions comprising RSV RNA vaccines and RNA vaccine compositions and / or complexes, optionally in combination with one or more pharmaceutically acceptable excipients.

[0248] RSV RNA (e.g., mRNA) vaccines can be formulated or administered alone or together with one or more other components. For example, the RSV RNA vaccine (vaccine composition) can include other components including, but not limited to, adjuvants.

[0249] In some embodiments, the RSV RNA vaccine is adjuvant-free.

[0250] RSV RNA (e.g., mRNA) vaccines can be formulated or administered in combination with one or more pharmaceutically acceptable excipients. In some embodiments, the vaccine composition includes at least one additional active substance, such as a therapeutically active substance, a prophylactically active substance, or a combination of both. The vaccine composition can be sterile, pyrogen-free, or both sterile and pyrogen-free. Items generally considered in the formulation and / or manufacture of pharmaceuticals such as vaccine compositions can be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference in its entirety).

[0251] In some embodiments, the RSV RNA vaccine is administered to a human, a human patient or a subject. For the purposes of the present disclosure, the term "active ingredient" generally refers to the RNA vaccine or polynucleotide contained therein, for example, an RNA polynucleotide encoding an antigenic polypeptide (e.g., an mRNA polynucleotide).

[0252] The formulations of the vaccine compositions described herein can be prepared by any method known in the pharmacological arts or developed hereafter. Generally, such preparation methods include the step of combining the active ingredient (e.g., an mRNA polynucleotide) with an excipient and / or one or more other accessory components, and then, if necessary and / or desirable, dividing, shaping and / or packaging the product into the desired single or multiple dose units.

[0253] The relative amounts of the active ingredient, pharmaceutically acceptable excipient and / or any additional components in the pharmaceutical compositions according to the present disclosure can vary depending on the characteristics, physical build and / or condition of the subject being treated, and further depending on the route by which the composition is administered. By way of example, the composition can contain from 0.1% to 100%, for example, from 0.5 to 50%, from 1 to 30%, from 5 to 80%, at least 80% (w / w) of the active ingredient.

[0254] RSV RNA vaccines can be formulated using one or more excipients that (1) enhance stability, (2) increase cell transfection, (3) enable sustained or delayed release (e.g., from depot formulations), (4) alter biodistribution (e.g., targeting to specific tissues or cell types), (5) increase in vivo translation of the encoded protein, and / or (6) alter the in vivo release profile of the encoded protein (antigen). Excipients can include conventional excipients such as solvents, dispersion media, diluents or other liquid vehicles, dispersion or suspension aids, surfactants, isotonic agents, thickening or emulsifying agents, preservatives, and in addition to any and all of these, but not limited to, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell type nanoparticles, peptides, proteins, cells transfected with the RSV RNA vaccine (e.g., for transplantation into a subject), hyaluronidase, nanoparticle mimics, and combinations thereof.

[0255] Stabilizing element Natural eukaryotic mRNA molecules are known to contain stabilizing elements, such as, but not limited to, the untranslated region (UTR) at its 5' end (5'UTR) and / or the UTR at its 3' end (3'UTR), in addition to other structural features such as the 5' cap structure or the 3' poly(A) tail. Both the 5'UTR and the 3'UTR are typically transcribed from genomic DNA and are elements of the immature mRNA. Characteristic structural features of mature mRNA, such as the 5' cap and the 3' poly(A) tail, are usually added to the transcribed (immature) mRNA during mRNA processing. The 3' poly(A) tail is typically a stretch of adenine nucleotides added to the 3' end of the transcribed mRNA and can contain up to about 400 adenine nucleotides. In some embodiments, the length of the 3' poly(A) tail can be an essential element with respect to the stability of individual mRNAs.

[0256] In some embodiments, the RNA vaccine can include one or more stabilizing elements. The stabilizing elements can include, for example, histone stem loops. A stem-loop binding protein (SLBP), which is a 32 kDa protein, has been identified. SLBP associates with the histone stem loop at the 3’ end of the histone message in both the nucleus and the cytoplasm. Its expression level is regulated by the cell cycle, peaking during the S phase when histone mRNA levels also increase. This protein has been found to be required for efficient 3’ end processing of histone pre-mRNA by U7 snRNP. SLBP continues to associate with the stem loop after processing and then stimulates the translation of mature histone mRNA into histone protein in the cytoplasm. The RNA-binding domain of SLBP is conserved across metazoans and protozoans, and its binding to the histone stem loop is loop-structure dependent. The minimal binding site is at least 3 nucleotides on the 5’ side and 2 nucleotides on the 3’ side relative to the stem loop.

[0257] In some embodiments, the RNA vaccine includes a coding region, at least one histone stem loop, and optionally a poly(A) sequence or polyadenylation signal. The poly(A) sequence or polyadenylation signal is generally thought to improve the expression level of the encoded protein. The encoded protein is, in some embodiments, not a histone protein, a reporter protein (e.g., luciferase, GFP, EGFP, β-galactosidase, EGFP), or a marker or selectable protein (e.g., α-globin, galactokinase, and xanthine:guanine phosphoribosyltransferase (GPT)).

[0258] In some embodiments, the combination of a poly(A) sequence or polyadenylation signal and at least one histone stem loop, both of which naturally exhibit alternative mechanisms, act synergistically to increase protein expression beyond the levels observed with either element alone. The synergistic effect of the combination of poly(A) and at least one histone stem loop has been found to be independent of the order of the elements or the length of the poly(A) sequence.

[0259] In some embodiments, the RNA vaccine does not contain a histone downstream element (HDE). A "histone downstream element" (HDE) contains a purine-rich polynucleotide stretch of about 15-20 nucleotides on the 3' side of the native stem loop, which represents the binding site for U7 snRNA involved in the processing of histone pre-mRNA to mature histone mRNA. In some embodiments, the nucleic acid does not contain an intron.

[0260] In some embodiments, the RNA vaccine may or may not contain an enhancer sequence and / or a promoter sequence, which may be modified or unmodified, activated or inactivated. In some embodiments, the histone stem loop typically derives from a histone gene and includes intramolecular base pairing of two adjacent partial or fully reverse-complementary sequences separated by a spacer consisting of a short sequence that forms the loop of the structure. The unpaired loop region typically cannot base pair with any of the stem loop elements. This is an important component of many RNA secondary structures and thus occurs more frequently in RNA, but can also be present in single-stranded DNA. The stability of the stem loop structure typically depends on the length of the paired region, the number of mismatches or bulges, and the base composition. In some embodiments, wobble base pairing (non-Watson-Crick base pairing) can occur. In some embodiments, at least one histone stem loop sequence contains 15-45 nucleotides in length.

[0261] In other embodiments, one or more AU-rich sequences can be removed from the RNA vaccine. These sequences, sometimes referred to as AURES, are destabilizing sequences found in the 3’UTR. AURES can be removed from the RNA vaccine. Alternatively, AURES may be left in the RNA vaccine.

[0262] In some embodiments, the RNA polynucleotide does not contain a stabilizing element.

[0263] Nanoparticle formation In some embodiments, the RSV RNA (e.g., mRNA) vaccine is formulated in nanoparticles. In some embodiments, the RSV RNA vaccine is formulated in lipid nanoparticles. In some embodiments, the RSV RNA vaccine is formulated in a lipid-polycation complex called cationic lipid nanoparticles. The formation of lipid nanoparticles can be achieved by methods known in the art and / or methods described in US Patent Application Publication No. 20120178702, which is incorporated herein by reference in its entirety. By way of non-limiting example, polycations can include cationic peptides or polypeptides, including but not limited to polylysine, polyornithine, and / or polyarginine, as well as cationic peptides described in International Publication No. WO2012013326 or US Patent Application Publication No. US20130142818, each of which is incorporated herein by reference in its entirety. In some embodiments, the RSV RNA vaccine is formulated in lipid nanoparticles that include non-cationic lipids such as, but not limited to, cholesterol or dioleoylphosphatidylethanolamine (DOPE).

[0264] Lipid nanoparticle formulations can be affected by biophysical parameters such as, but not limited to, the choice of cationic lipid components, the degree of saturation of the cationic lipid, the nature of PEGylation, the ratio of all components, and size. In one example by Semple et al. (Nature Biotech. 2010 28:172-176, incorporated herein by reference in its entirety), the lipid nanoparticle formulation consists of 57.1% cationic lipid, 7.1% dipalmitoyl phosphatidylcholine, 34.3% cholesterol and 1.4% PEG-c-DMA. As another example, changing the composition of the cationic lipid has been shown to result in efficient delivery of siRNA by various antigen-presenting cells (Basha et al. Mol Ther. 2011 19:2186-2200, incorporated herein by reference in its entirety).

[0265] In some embodiments, the lipid nanoparticle formulation may comprise 35-45% cationic lipid, 40%-50% cationic lipid, 50%-60% cationic lipid and / or 55%-65% cationic lipid. In some embodiments, the ratio of lipid to RNA (e.g., mRNA) in the lipid nanoparticles may be 5:1 to 20:1, 10:1 to 25:1, 15:1 to 30:1 and / or at least 30:1.

[0266] In some embodiments, the PEG ratio in the lipid nanoparticle formulation may be increased or decreased, and / or the carbon chain length of the PEG lipid may be changed from C14 to C18 to alter the pharmacokinetics and / or biodistribution of the lipid nanoparticle formulation. As a non-limiting example, the lipid nanoparticle formulation may contain PEG-c-DOMG (R-3-[(ω-methoxy-poly(ethylene glycol)2000)carbamoyl)]-1,2-dimyristyloxypropyl-3-amine) (also referred to herein as PEG-DOMG) at a lipid molar ratio of 0.5% to 3.0%, 1.0% to 3.5%, 1.5% to 4.0%, 2.0% to 4.5%, 2.5% to 5.0% and / or 3.0% to 6.0% compared to the cationic lipid, DSPC and cholesterol. In some embodiments, PEG-c-DOMG may be replaced with a PEG lipid such as, but not limited to, PEG-DSG (1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol), PEG-DMG (1,2-dimyristoyl-sn-glycerol) and / or PEG-DPG (1,2-dipalmitoyl-sn-glycerol, methoxypolyethylene glycol). The cationic lipid can be selected from any lipid known in the art such as, but not limited to, DLin-MC3-DMA, DLin-DMA, C12-200 and DLin-KC2-DMA (see, for example, US Patent Application Publication No. 20130245107A1).

[0267] In some embodiments, the RSV RNA (e.g., mRNA) vaccine formulation is a nanoparticle comprising at least one lipid. The lipid can be selected from, but is not limited to, DLin-DMA, DLin-K-DMA, 98N12-5, C12-200, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, PLGA, PEG, PEG-DMG, a PEGylated lipid, and an amino alcohol lipid. In some embodiments, the lipid can be a cationic lipid, such as, but not limited to, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, and an amino alcohol lipid. The amino alcohol cationic lipid can be the lipid described in U.S. Patent Application Publication No. US20130150625, which is hereby incorporated by reference in its entirety, and / or can be made by the methods described in the patent application publication. By way of non-limiting example, the cationic lipid can be 2-amino-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-2-{[(9Z,2Z)-octadeca-9,12-dien-1-yloxy]methyl}propan-1-ol (Compound 1 of US20130150625), 2-amino-3-[(9Z)-octadeca-9-en-1-yloxy]-2-{[(9Z)-octadeca-9-en-1-yloxy]methyl}propan-1-ol (Compound 2 of US20130150625), 2-amino-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-2-[(octyloxy)methyl]propan-1-ol (Compound 3 of US20130150625), and 2-(dimethylamino)-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-2-{[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]methyl}propan-1-ol (Compound 4 of US20130150625), or any pharmaceutically acceptable salt or stereoisomer thereof.

[0268] Lipid nanoparticle formulations typically contain lipids, particularly ionic cationic lipids such as 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-nona-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)-N,N-dimethyl-2-nonylheneicos-12,15-dien-1-amine (L608), or N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecane-8-amine (L530), and further contain a neutral lipid sterol and a molecule capable of reducing particle aggregation, such as a PEG lipid or a PEG-modified lipid.

[0269] In some embodiments, the lipid nanoparticle formulation consists essentially of (i) at least one lipid selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-nona-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)-N,N-dimethyl-2-nonylheneicos-12,15-dien-1-amine (L608), and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecane-8-amine (L530); (ii) a neutral lipid selected from DSPC, DPPC, POPC, DOPE, and SM; (iii) a sterol such as cholesterol; and (iv) a PEG lipid such as PEG-DMG or PEG-cDMA, in a molar ratio of cationic lipid 20-60%:neutral lipid 5-25%:sterol 25-55%:PEG lipid 0.5-15%.

[0270] In some embodiments, the lipid nanoparticle formulation comprises a cationic lipid selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-nona-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)-N,N-dimethyl-2-nonylheneicos-12,15-dien-1-amine (L608), and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecane-8-amine (L530) in an amount of 25% to 75% on a molar basis, for example, 35 to 65%, 45 to 65%, 60%, 57.5%, 50% or 40% on a molar basis.

[0271] In some embodiments, the lipid nanoparticle formulation comprises 0.5% to 15% by mole, such as 3 to 12%, 5 to 10% or 15%, 10% or 7.5% by mole of neutral lipid. Examples of neutral lipids include, but are not limited to, DSPC, POPC, DPPC, DOPE and SM. In some embodiments, the formulation comprises 5% to 50% by mole (such as 15 to 45%, 20 to 40%, 40%, 38.5%, 35% or 31% by mole) of sterol. A non-limiting example of sterol is cholesterol. In some embodiments, the lipid nanoparticle formulation comprises 0.5% to 20% by mole (such as 0.5 to 10%, 0.5 to 5%, 1.5%, 0.5%, 1.5%, 3.5% or 5% by mole) of PEG lipid or PEG-modified lipid. In some embodiments, the PEG lipid or PEG-modified lipid comprises a PEG molecule with an average molecular weight of 2,000 Da. In some embodiments, the PEG lipid or PEG-modified lipid comprises a PEG molecule with an average molecular weight of less than 2,000, such as about 1,500 Da, about 1,000 Da or about 500 Da. Non-limiting examples of PEG-modified lipids include PEG-distearoyl glycerol (PEG-DMG) (also referred to herein as PEG-C14 or C14-PEG), PEG-cDMA (further discussed in Reyes et al. J. Controlled Release, 107, 276-287 (2005), the entire content of which is incorporated herein by reference).

[0272] In some embodiments, the lipid nanoparticle formulation comprises, on a molar basis, 25-75% cationic lipid selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-nona-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)-N,N-dimethyl-2-nonylheneicos-12,15-dien-1-amine (L608), and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecane-8-amine (L530), 0.5-15% neutral lipid, 5-50% sterol, and 0.5-20% PEG lipid or PEGylated lipid.

[0273] In some embodiments, the lipid nanoparticle formulation comprises, on a molar basis, 35-65% cationic lipid selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-nona-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)-N,N-dimethyl-2-nonylheneicos-12,15-dien-1-amine (L608), and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecane-8-amine (L530), 3-12% neutral lipid, 15-45% sterol, and 0.5-10% PEG lipid or PEGylated lipid.

[0274] In some embodiments, the lipid nanoparticle formulation comprises, on a molar basis, 45-65% cationic lipid selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-nona-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)-N,N-dimethyl-2-nonylheneicos-12,15-dien-1-amine (L608), and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecane-8-amine (L530), 5-10% neutral lipid, 25-40% sterol, and 0.5-10% PEG lipid or PEGylated lipid.

[0275] In some embodiments, the lipid nanoparticle formulation comprises, on a molar basis, 60% cationic lipid selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-nona-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)-N,N-dimethyl-2-nonylheneicos-12,15-dien-1-amine (L608), and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecane-8-amine (L530), 7.5% neutral lipid, 31% sterol, and 1.5% PEG lipid or PEGylated lipid.

[0276] In some embodiments, the lipid nanoparticle formulation comprises, on a molar basis, 50% cationic lipid selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-nona-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)-N,N-dimethyl-2-nonylheneicos-12,15-dien-1-amine (L608) and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecane-8-amine (L530), 10% neutral lipid, 38.5% sterol, and 1.5% PEG lipid or PEGylated lipid.

[0277] In some embodiments, the lipid nanoparticle formulation comprises, on a molar basis, 50% cationic lipid selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-nona-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)-N,N-dimethyl-2-nonylheneicos-12,15-dien-1-amine (L608) and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecane-8-amine (L530), 10% neutral lipid, 35% sterol, 4.5% or 5% PEG lipid or PEGylated lipid, and 0.5% targeting lipid.

[0278] In some embodiments, the lipid nanoparticle formulation comprises, on a molar basis, 40% cationic lipid selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-nona-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)-N,N-dimethyl-2-nonylheneicos-12,15-dien-1-amine (L608), and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecane-8-amine (L530), 15% neutral lipid, 40% sterol, and 5% PEG lipid or PEG-modified lipid.

[0279] In some embodiments, the lipid nanoparticle formulation comprises, on a molar basis, 57.2% cationic lipid selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-nona-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)-N,N-dimethyl-2-nonylheneicos-12,15-dien-1-amine (L608), and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecane-8-amine (L530), 7.1% neutral lipid, 34.3% sterol, and 1.4% PEG lipid or PEG-modified lipid.

[0280] In some embodiments, the lipid nanoparticle formulation comprises, on a molar basis, 57.5% of a cationic lipid selected from PEG lipid, PEG-cDMA (PEG-cDMA is further discussed in Reyes et al. (J. Controlled Release, 107, 276-287 (2005), the entire content of which is incorporated herein by reference), 7.5% of a neutral lipid, 31.5% of a sterol, and 3.5% of a PEG lipid or PEG-modified lipid.

[0281] In some embodiments, the lipid nanoparticle formulation consists essentially of a lipid mixture in a molar ratio of cationic lipid 20-70%: neutral lipid 5-45%: cholesterol 20-55%: PEG-modified lipid 0.5-15%. In some embodiments, the lipid nanoparticle formulation consists essentially of a lipid mixture in a molar ratio of cationic lipid 20-60%: neutral lipid 5-25%: cholesterol 25-55%: PEG-modified lipid 0.5-15%.

[0282] In some embodiments, the lipid molar ratio is 50 / 10 / 38.5 / 1.5 (mol% cationic lipid / neutral lipid (e.g., DSPC) / Chol / PEG-modified lipid (e.g., PEG-DMG, PEG-DSG or PEG-DPG)), 57.2 / 7.1 / 34.3 / 1.4 (mol% cationic lipid / neutral lipid (e.g., DPPC) / Chol / PEG-modified lipid (e.g., PEG-cDMA)), 40 / 15 / 40 / 5 (mol% cationic lipid / neutral lipid (e.g., DSPC) / Chol / PEG-modified lipid (e.g., PEG-DMG)), 50 / 10 / 35 / 4.5 / 0.5 (mol% cationic lipid / neutral lipid (e.g., DSPC) / Chol / PEG-modified lipid (e.g., PEG-DSG)), 50 / 10 / 35 / 5 (cationic lipid / neutral lipid (e.g., DSPC) / Chol / PEG-modified lipid (e.g., PEG-DMG)), 40 / 10 / 40 / 10 (mol% cationic lipid / neutral lipid (e.g., DSPC) / Chol / PEG-modified lipid (e.g., PEG-DMG or PEG-cDMA)), 35 / 15 / 40 / 10 (mol% cationic lipid / neutral lipid (e.g., DSPC) / Chol / PEG-modified lipid (e.g., PEG-DMG or PEG-cDMA)), or 52 / 13 / 30 / 5 (mol% cationic lipid / neutral lipid (e.g., DSPC) / Chol / PEG-modified lipid (e.g., PEG-DMG or PEG-cDMA)).

[0283] Non-limiting examples of lipid nanoparticle compositions and methods for making the same are described, for example, in Semple et al. (2010) Nat. Biotechnol. 28:172-176; Jayarama et al. (2012), Angew. Chem. Int. Ed., 51:8529-8533, and Maier et al. (2013) Molecular Therapy 21, 1570-1578 (each of which is incorporated herein by reference in its entirety).

[0284] In some embodiments, the lipid nanoparticle formulation may include a cationic lipid, a PEG lipid, and a structural lipid, and optionally may include a non-cationic lipid. As a non-limiting example, the lipid nanoparticles may include 40-60% cationic lipid, 5-15% non-cationic lipid, 1-2% PEG lipid, and 30-50% structural lipid. As another non-limiting example, the lipid nanoparticles may include 50% cationic lipid, 10% non-cationic lipid, 1.5% PEG lipid, and 38.5% structural lipid. As yet another non-limiting example, the lipid nanoparticles may include 55% cationic lipid, 10% non-cationic lipid, 2.5% PEG lipid, and 32.5% structural lipid. In some embodiments, the cationic lipid may be any of the cationic lipids described herein, including but not limited to DLin-KC2-DMA, DLin-MC3-DMA, L319, L608, and L520.

[0285] In some embodiments, the lipid nanoparticle formulation described herein may be a four-component lipid nanoparticle. The lipid nanoparticles may include a cationic lipid, a non-cationic lipid, a PEG lipid, and a structural lipid. As a non-limiting example, the lipid nanoparticles may include 40-60% cationic lipid, 5-15% non-cationic lipid, 1-2% PEG lipid, and 30-50% structural lipid. As another non-limiting example, the lipid nanoparticles may include 50% cationic lipid, 10% non-cationic lipid, 1.5% PEG lipid, and 38.5% structural lipid. As yet another non-limiting example, the lipid nanoparticles may include 55% cationic lipid, 10% non-cationic lipid, 2.5% PEG lipid, and 32.5% structural lipid. In some embodiments, the cationic lipid may be any of the cationic lipids described herein, including but not limited to DLin-KC2-DMA, DLin-MC3-DMA, L319, L608, and L520.

[0286] In some embodiments, the lipid nanoparticle formulations described herein may include a cationic lipid, a non-cationic lipid, a PEG lipid, and a structural lipid. As a non-limiting example, the lipid nanoparticles include 50% cationic lipid DLin-KC2-DMA, 10% non-cationic lipid DSPC, 1.5% PEG lipid PEG-DOMG, and 38.5% structural lipid cholesterol. As a non-limiting example, the lipid nanoparticles include 50% cationic lipid DLin-MC3-DMA, 10% non-cationic lipid DSPC, 1.5% PEG lipid PEG-DOMG, and 38.5% structural lipid cholesterol. As a non-limiting example, the lipid nanoparticles include 50% cationic lipid DLin-MC3-DMA, 10% non-cationic lipid DSPC, 1.5% PEG lipid PEG-DMG, and 38.5% structural lipid cholesterol. As yet another non-limiting example, the lipid nanoparticles may include 55% cationic lipid L319, L608 or L520, 10% non-cationic lipid DSPC, 2.5% PEG lipid PEG-DMG, and 32.5% structural lipid cholesterol.

[0287] The relative amounts of the active ingredient, pharmaceutically acceptable excipients and / or any additional ingredients in the vaccine composition can vary depending on what the subject being treated is, their physique and / or condition, and further depending on the route by which the composition is administered. For example, the composition may contain 0.1% to 99% (w / w) of the active ingredient. By way of example, the composition may contain 0.1% to 100%, for example, 0.5 to 50%, 1 to 30%, 5 to 80%, at least 80% (w / w) of the active ingredient.

[0288] In some embodiments, the RNA vaccine composition may comprise the polynucleotides described herein and be formulated in lipid nanoparticles comprising DLin-MC3-DMA, cholesterol, DSPC, and PEG2000-DMG, trisodium citrate buffer, sucrose, and water for injection. As a non-limiting example, the composition may comprise 2.0 mg / mL of drug substance (e.g., polynucleotide encoding RSV), 21.8 mg / mL of MC3, 10.1 mg / mL of cholesterol, 5.4 mg / mL of DSPC, 2.7 mg / mL of PEG2000-DMG, 5.16 mg / mL of trisodium citrate, 71 mg / mL of sucrose, and 1.0 mL of water for injection.

[0289] In some embodiments, the nanoparticles (e.g., lipid nanoparticles) have an average diameter of 10-500 nm, 20-400 nm, 30-300 nm, or 40-200 nm. In some embodiments, the nanoparticles (e.g., lipid nanoparticles) have an average diameter of 50-150 nm, 50-200 nm, 80-100 nm, or 80-200 nm.

[0290] Liposomes, Lipoplexes, and Lipid Nanoparticles In some embodiments, the RNA vaccine pharmaceutical composition may be formulated in liposomes such as, but not limited to, DiLa2 liposomes (Marina Biotech (Bothell, WA)), SMARTICLES® (Marina Biotech (Bothell, WA)), neutral DOPC (1,2-dioleoyl-sn-glycero-3-phosphocholine)-based liposomes (e.g., siRNA delivery for ovarian cancer (Landen et al. Cancer Biology & Therapy 2006 5(12) 1708-1713), which is hereby incorporated by reference in its entirety), and hyaluronan-coated liposomes (Quiet Therapeutics (Israel)).

[0291] In some embodiments, the RNA vaccine can be formulated in a lyophilized gel-phase liposome composition as described in U.S. Patent Application Publication No. US2012060293, which is incorporated herein by reference in its entirety.

[0292] The nanoparticle formulation can include a phosphate conjugate. The phosphate conjugate can extend the in vivo circulation time and / or increase the targeted delivery of the nanoparticles. The phosphate conjugate used in the present invention can be prepared by the methods described in WO2013033438 or U.S. Patent Application Publication No. US20130196948, each of which is incorporated herein by reference in its entirety. As a non-limiting example, the phosphate conjugate can include any one of the compounds of the formula described in International Publication No. WO2013033438, which is incorporated herein by reference in its entirety.

[0293] The nanoparticle formulation can include a polymer conjugate. The polymer conjugate can be a water-soluble conjugate. The polymer conjugate can have the structure described in U.S. Patent Application Publication No. 20130059360, which is incorporated herein by reference in its entirety. In some embodiments, the polymer conjugate with the polynucleotide of the present invention can be prepared using the methods and / or segmented polymer reagents described in U.S. Patent Application Publication No. 20130072709, which is incorporated herein by reference in its entirety. In other embodiments, the polymer conjugate can have a pendant side chain group including a ring moiety, such as, but not limited to, the polymer conjugate described in U.S. Patent Application Publication No. US20130196948, which is incorporated herein by reference in its entirety.

[0294] The nanoparticle formulation may include a conjugate that improves the delivery of the nanoparticles of the present invention in a subject. Further, the conjugate may suppress the phagocytic clearance of the nanoparticles in the subject. In some embodiments, the conjugate may be a "self" peptide designed from the human membrane protein CD47 (e.g., the "self" particles described by Rodriguez et al. (Science 2013, 339, 971-975, incorporated herein by reference in its entirety)). As shown by Rodriguez et al., the self peptide delayed the macrophage-mediated clearance of the nanoparticles and improved the delivery of the nanoparticles. In other embodiments, the conjugate may be the membrane protein CD47 (see, e.g., Rodriguez et al. Science 2013, 339, 971-975, incorporated herein by reference in its entirety). Rodriguez et al. showed that CD47, like the "self" peptide, can increase the ratio of circulating particles in a subject compared to scrambled peptides and PEG-coated nanoparticles.

[0295] In some embodiments, the RNA vaccine of the present invention is formulated in nanoparticles that include a conjugate that improves the delivery of the nanoparticles of the present invention in a subject. The conjugate may be the CD47 membrane, or the conjugate may be derived from the CD47 membrane protein, such as the "self" peptide described above. In other embodiments, the nanoparticles may include PEG and a conjugate or derivative of CD47. In still other embodiments, the nanoparticles may include both the "self" peptide described above and the membrane protein CD47.

[0296] In some embodiments, the "self" peptide and / or the CD47 protein may be conjugated to virus-like particles or pseudovirions as described herein for the delivery of the RNA vaccine of the present invention.

[0297] In other embodiments, the RNA vaccine pharmaceutical composition comprises the polynucleotide of the present invention and a conjugate that may have a cleavable bond. Non-limiting examples of conjugates include aromatic moieties containing an ionic hydrogen atom, spacer moieties, and water-soluble polymers. As a non-limiting example, a pharmaceutical composition comprising a conjugate having a cleavable bond and a method for delivering the pharmaceutical composition are described in U.S. Patent Application Publication No. US20130184443, the entire content of which is incorporated herein by reference.

[0298] The nanoparticle formulation can be a carbohydrate nanoparticle comprising a carbohydrate carrier and an RNA vaccine. As non-limiting examples, carbohydrate carriers can include, but are not limited to, succinic anhydride-modified phytoglycogen or glycogen-like substances, phytoglycogen octenyl succinate, phytoglycogen β-dextrin, succinic anhydride-modified phytoglycogen β-dextrin (see, for example, International Publication No. WO2012109121, the entire content of which is incorporated herein by reference).

[0299] The nanoparticle formulations of the present invention may be coated with a surfactant or a polymer to improve particle delivery. In some embodiments, the nanoparticles can be coated with a hydrophilic coating such as, but not limited to, a PEG coating and / or a coating having a neutral surface charge. The hydrophilic coating can be useful for delivering nanoparticles containing a large payload such as an RNA vaccine into the central nervous system. As a non-limiting example, nanoparticles comprising a hydrophilic coating and a method for making the nanoparticles are described in U.S. Patent Application Publication No. US20130183244, the entire content of which is incorporated herein by reference.

[0300] In some embodiments, the lipid nanoparticles of the present invention can be hydrophilic polymer particles. Non-limiting examples of hydrophilic polymer particles and methods for making hydrophilic polymer particles are described in U.S. Patent Application Publication No. US20130210991, the entire content of which is incorporated herein by reference.

[0301] In other embodiments, the lipid nanoparticles of the present invention can be hydrophobic polymer particles.

[0302] Lipid nanoparticle formulations can be improved by replacing cationic lipids with biodegradable cationic lipids known as rapidly eliminated lipid nanoparticles (reLNPs). Without limitation, ionic cationic lipids such as DLinDMA, DLin-KC2-DMA, and DLin-MC3-DMA have been found to accumulate in plasma and tissues over time and can be potential toxicants. The rapid metabolism of rapidly eliminated lipids can improve the tolerance and therapeutic index of lipid nanoparticles in rats by an order of magnitude from a dose of 1 mg / kg to a dose of 10 mg / kg. Incorporating enzymatically degradable ester bonds can improve the degradation and metabolic profile of the cationic components while maintaining the activity of the reLNP formulation. The ester bond may be inherent in the lipid chain or located terminally at the end of the lipid chain. The internal ester bond may replace any carbon in the lipid chain.

[0303] In some embodiments, the internal ester bond may be located on either side of the saturated carbon.

[0304] In some embodiments, an immune response can be induced by delivering lipid nanoparticles that can include nanochemical species, polymers, and immunogens (U.S. Patent Application Publication No. 20120189700 and International Publication No. WO2012099805, each incorporated herein by reference in its entirety).

[0305] The polymer can encapsulate or partially encapsulate the nanochemical species. The immunogen can be a recombinant protein, modified RNA, and / or a polynucleotide as described herein. In some embodiments, the lipid nanoparticles can be formulated for use in a vaccine, such as but not limited to a vaccine against a pathogen.

[0306] Lipid nanoparticles may have their surface properties manipulated and changed so that the lipid nanoparticles can pass through the mucosal barrier. Mucus is located in mucosal tissues such as, but not limited to, the oral cavity (e.g., the membranes of the cheek and esophagus and tonsil tissue), the eyes, the gastrointestinal tract (e.g., the stomach, small intestine, large intestine, colon, rectum), the nose, the respiratory tract (e.g., the membranes of the nose, pharynx, trachea, and bronchi), the genitalia (e.g., the membranes of the vagina, cervix, and urethra). Nanoparticles larger than 10 - 200 nm are preferred in terms of high drug encapsulation efficiency and the ability to provide sustained delivery of a wide range of drugs, but are thought to be too large to diffuse rapidly through the mucosal barrier. Since mucus is continuously secreted, excreted, discarded or digested, and recycled, most of the trapped particles can be removed from the mucosal tissue within seconds or hours. Large polymer nanoparticles (200 nm - 500 nm in diameter) densely coated with low molecular weight polyethylene glycol (PEG) diffuse through mucus slightly 4 - 6 times slower than the same particles diffusing in water (Lai et al. PNAS 2007 104(5):1482 - 487; Lai et al. Adv Drug Deliv Rev. 2009 61(2):158 - 171, each of which is incorporated herein by reference in its entirety). Nanoparticle transport can be determined using the rate of passage and / or fluorescence microscopy methods such as, but not limited to, fluorescence recovery after photobleaching (FRAP) and high - resolution multiparticle tracking (MPT). As a non - limiting example, compositions capable of passing through the mucosal barrier can be prepared as described in U.S. Patent No. 8,241,670 or International Publication No. WO2013110028 (each of which is incorporated herein by reference in its entirety).

[0307] Lipid nanoparticles engineered to pass through mucus may contain a polymeric material (e.g., a polymer core) and / or a polymer-vitamin conjugate and / or a triblock copolymer. The polymeric material can include, but is not limited to, polyamines, polyethers, polyamides, polyesters, polyurethanes, polyureas, polycarbonates, poly(styrene), polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylene, polyethyleneimine, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates. The polymeric material can be biodegradable and / or biocompatible. Non-limiting examples of biocompatible polymers are described in International Publication No. WO2013116804, the entire content of which is incorporated herein by reference. The polymeric material can further be irradiated. As a non-limiting example, the polymeric material can be gamma irradiated (see, e.g., International Publication No. WO201282165, the entire content of which is incorporated herein by reference). Non-limiting examples of specific polymers include poly(caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly(lactic acid) (PLA), poly(L-lactic acid) (PLLA), poly(glycolic acid) (PGA), poly(lactic acid-co-glycolic acid) (PLGA), poly(L-lactic acid-co-glycolic acid) (PLLGA), poly(D,L-lactide) (PDLA), poly(L-lactide) (PLLA), poly(D,L-lactide-co-caprolactone), poly(D,L-lactide-co-caprolactone-co-glycolide), poly(D,L-lactide-co-PEO-co-D,L-lactide), poly(D,L-lactide-co-PPO-co-D,L-lactide), polyalkyl cyanoacrylate, polyurethane, poly-L-lysine (PLL), hydroxypropyl methacrylate (HPMA), polyethylene glycol, poly-L-glutamic acid, poly(hydroxy acid), polyanhydride, polyorthoester, poly(ester amide), polyamide, poly(ester ether), polycarbonate, polyalkylene, e.g., polyethylene and polypropylene, polyalkylene glycol, e.g., poly(ethylene glycol) (PEG), polyalkylene oxide (PEO),Polyalkylene terephthalates, such as poly(ethylene terephthalate), polyvinyl alcohol (PVA), polyvinyl ethers, polyvinyl esters, such as poly(vinyl acetate), polyvinyl halides, such as poly(vinyl chloride) (PVC), polyvinyl pyrrolidone, polysiloxanes, polystyrene (PS), polyurethanes, derivatized celluloses, such as alkyl celluloses, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, nitrocellulose, hydroxypropyl cellulose, carboxymethyl cellulose, polymers of acrylic acid, such as poly(methyl (meth)acrylate) (PMMA), poly(ethyl (meth)acrylate), poly(butyl (meth)acrylate), poly(isobutyl (meth)acrylate), poly(hexyl (meth)acrylate), poly(isodecyl (meth)acrylate), poly(lauryl (meth)acrylate), poly(phenyl (meth)acrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate) and copolymers and mixtures thereof, polydioxanone and its copolymers, polyhydroxyalkanoates, polypropylene fumarate, polyoxymethylene, poloxamers, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), PEG-PLGA-PEG, and trimethylene carbonate, polyvinyl pyrrolidone. Lipid nanoparticles can be coated with or associated with copolymers such as, but not limited to, block copolymers (such as the branched polyether-polyamide block copolymers described in International Publication No. WO2013012476, which is incorporated herein by reference in its entirety) and (poly(ethylene glycol))-(poly(propylene oxide))-(poly(ethylene glycol)) triblock copolymers (see, for example, U.S. Patent Application Publication No. 20120121718, U.S. Patent Application Publication No. 20100003337, and U.S. Patent No. 8,263,665, each of which is incorporated herein by reference in its entirety). The copolymers can be GRAS (Generally Recognized as Safe) polymers, and the formation of lipid nanoparticlesIt can be produced in such a way that no new chemical entity is generated. For example, lipid nanoparticles can include poloxamer-coated PLGA nanoparticles that can still rapidly pass through human mucus without forming new chemical entities (Yang et al. Angew. Chem. Int. Ed. 2011 50:2597 - 2600, the entire content of which is incorporated herein by reference). A non-limiting expandable method for generating nanoparticles that can pass through human mucus has been described by Xu et al. (see, for example, J Control Release 2013, 170(2):279 - 86, the entire content of which is incorporated herein by reference).

[0308] The vitamin of the polymer-vitamin conjugate may be vitamin E. The vitamin portion of the conjugate may be substituted with other suitable components such as, but not limited to, vitamin A, vitamin E, other vitamins, cholesterol, hydrophobic moieties, or hydrophobic constituents of other surfactants (e.g., sterol chains, fatty acids, hydrocarbon chains, and alkylene oxide chains).

[0309] In some embodiments, the RNA (e.g., mRNA) vaccine pharmaceutical composition may be formulated in liposomes such as, but not limited to, DiLa2 liposomes (Marina Biotech (Bothell, WA)), SMARTICLES® (Marina Biotech (Bothell, WA)), neutral DOPC (1,2-dioleoyl-sn-glycero-3-phosphocholine)-based liposomes (e.g., siRNA delivery for ovarian cancer (Landen et al. Cancer Biology & Therapy 2006 5(12)1708 - 1713, the entire content of which is incorporated herein by reference)), and hyaluronan-coated liposomes (Quiet Therapeutics (Israel)).

[0310] In some embodiments, the RNA vaccine can be formulated in a lyophilized gel-phase liposome composition as described in U.S. Patent Application Publication No. US2012060293, which is incorporated herein by reference in its entirety.

[0311] The nanoparticle formulation can include a phosphate conjugate. The phosphate conjugate can extend the in vivo circulation time and / or increase the targeted delivery of the nanoparticles. The phosphate conjugate used in the present invention can be prepared by the methods described in WO2013033438 or U.S. Patent Application Publication No. 20130196948, each of which is incorporated herein by reference in its entirety. By way of non-limiting example, the phosphate conjugate can include any one of the compounds of the formula described in International Publication No. WO2013033438, which is incorporated herein by reference in its entirety.

[0312] The nanoparticle formulation can include a polymer conjugate. The polymer conjugate can be a water-soluble conjugate. The polymer conjugate can have the structure described in U.S. Patent Application Publication No. 20130059360, which is incorporated herein by reference in its entirety. In some embodiments, the polymer conjugate with the polynucleotide of the present invention can be prepared using the methods and / or segmented polymer reagents described in U.S. Patent Application Publication No. 20130072709, which is incorporated herein by reference in its entirety. In other embodiments, the polymer conjugate can have a pendant side chain group containing a ring moiety, such as, but not limited to, the polymer conjugate described in U.S. Patent Application Publication No. US20130196948, which is incorporated herein by reference in its entirety.

[0313] The nanoparticle formulation may include a conjugate that improves delivery of the nanoparticles of the present invention in a subject. Further, the conjugate may suppress phagocytic clearance of the nanoparticles in a subject. In some embodiments, the conjugate may be a "self" peptide designed from the human membrane protein CD47 (e.g., the "self" particles described by Rodriguez et al. (Science 2013, 339, 971-975, incorporated herein by reference in its entirety)). As shown by Rodriguez et al., the self peptide delayed macrophage-mediated clearance of the nanoparticles and improved delivery of the nanoparticles. In other embodiments, the conjugate may be the membrane protein CD47 (see, e.g., Rodriguez et al. Science 2013, 339, 971-975, incorporated herein by reference in its entirety). Rodriguez et al. showed that CD47, like the "self" peptide, can increase the ratio of circulating particles in a subject compared to scrambled peptides and PEG-coated nanoparticles.

[0314] In some embodiments, the RNA vaccine of the present invention is formulated in nanoparticles that include a conjugate that improves delivery of the nanoparticles of the present disclosure in a subject. The conjugate may be the CD47 membrane, or the conjugate may be derived from the CD47 membrane protein, such as the "self" peptide described above. In other embodiments, the nanoparticles may include PEG and a conjugate or derivative of CD47. In yet other embodiments, the nanoparticles may include both the "self" peptide described above and the membrane protein CD47.

[0315] In other embodiments, the "self" peptide and / or CD47 protein may be conjugated to virus-like particles or pseudovirions as described herein for delivery of the RNA vaccine of the present invention.

[0316] In other embodiments, the RNA vaccine pharmaceutical composition comprises the polynucleotide of the present invention and a conjugate that may have a cleavable bond. Non-limiting examples of conjugates include aromatic moieties containing an ionic hydrogen atom, spacer moieties, and water-soluble polymers. As a non-limiting example, a pharmaceutical composition comprising a conjugate having a cleavable bond and a method for delivering the pharmaceutical composition are described in U.S. Patent Application Publication No. US20130184443, the entire contents of which are incorporated herein by reference.

[0317] The nanoparticle formulation can be a carbohydrate nanoparticle comprising a carbohydrate carrier and an RNA (e.g., mRNA) vaccine. As non-limiting examples, carbohydrate carriers can include, but are not limited to, anhydro-modified phytoglycogen or glycogen-like substances, phytoglycogen octenyl succinate, phytoglycogen β-dextrin, anhydro-modified phytoglycogen β-dextrin (see, e.g., International Publication No. WO2012109121, the entire contents of which are incorporated herein by reference).

[0318] The nanoparticle formulations of the present invention may be coated with a surfactant or a polymer to improve particle delivery. In some embodiments, the nanoparticles can be coated with a hydrophilic coating such as, but not limited to, a PEG coating and / or a coating having a neutral surface charge. The hydrophilic coating can be useful for delivering nanoparticles containing a large payload such as an RNA vaccine into the central nervous system. As a non-limiting example, nanoparticles comprising a hydrophilic coating and a method for making the nanoparticles are described in U.S. Patent Application Publication No. US20130183244, the entire contents of which are incorporated herein by reference.

[0319] In some embodiments, the lipid nanoparticles of the present invention can be hydrophilic polymer particles. Non-limiting examples of hydrophilic polymer particles and methods for making hydrophilic polymer particles are described in U.S. Patent Application Publication No. US20130210991, the entire content of which is incorporated herein by reference.

[0320] In other embodiments, the lipid nanoparticles of the present invention can be hydrophobic polymer particles.

[0321] Lipid nanoparticle formulations can be improved by replacing cationic lipids with biodegradable cationic lipids known as rapidly eliminated lipid nanoparticles (reLNPs). Without limitation, ionic cationic lipids such as DLinDMA, DLin-KC2-DMA, and DLin-MC3-DMA have been found to accumulate in plasma and tissues over time and can be potential toxicants. The rapid metabolism of rapidly eliminated lipids can improve the tolerance and therapeutic index of lipid nanoparticles in rats by an order of magnitude from a dose of 1 mg / kg to a dose of 10 mg / kg. Incorporating enzymatically degradable ester bonds can improve the degradation and metabolic profile of the cationic components while maintaining the activity of the reLNP formulation. The ester bond may be intrinsic in the lipid chain or located terminally at the end of the lipid chain. The internal ester bond may replace any carbon in the lipid chain.

[0322] In some embodiments, the internal ester bond may be located on either side of the saturated carbon.

[0323] In some embodiments, an immune response can be induced by delivering lipid nanoparticles that can include nanochemical species, polymers, and immunogens (U.S. Patent Application Publication No. 20120189700 and International Publication No. WO2012099805, each incorporated herein by reference in its entirety).

[0324] Lipid nanoparticles may have their surface properties manipulated and altered so that the lipid nanoparticles pass through the mucosal barrier. Mucus is located in mucosal tissues such as, but not limited to, the oral cavity (e.g., the membranes of the cheek and esophagus and tonsil tissue), the eyes, the gastrointestinal tract (e.g., the stomach, small intestine, large intestine, colon, rectum), the nose, the respiratory tract (e.g., the membranes of the nose, pharynx, trachea, and bronchi), the genitalia (e.g., the membranes of the vagina, cervix, and urethra). Nanoparticles larger than 10 - 200 nm are preferred in terms of high drug encapsulation efficiency and the ability to provide sustained delivery of a wide range of drugs, but are thought to be too large to diffuse rapidly through the mucosal barrier. Since mucus is continuously secreted, excreted, discarded or digested, and recycled, most of the captured particles can be removed from the mucosal tissue within seconds or hours. Large polymer nanoparticles (200 nm - 500 nm in diameter) densely coated with low molecular weight polyethylene glycol (PEG) diffuse through mucus slightly 4 - 6 times slower than the same particles diffusing in water (Lai et al. PNAS 2007 104(5):1482 - 487; Lai et al. Adv Drug Deliv Rev. 2009 61(2):158 - 171, each of which is incorporated herein by reference in its entirety). Nanoparticle transport can be determined using the rate of passage and / or fluorescence microscopy methods such as, but not limited to, fluorescence recovery after photobleaching (FRAP) and high - resolution multiparticle tracking (MPT). As a non - limiting example, compositions capable of passing through the mucosal barrier can be prepared as described in U.S. Patent No. 8,241,670 or International Publication No. WO2013110028 (each of which is incorporated herein by reference in its entirety).

[0325] Lipid nanoparticles engineered to pass through mucus may contain a polymeric material (i.e., a polymer core) and / or a polymer-vitamin conjugate and / or a triblock copolymer. The polymeric material can include, but is not limited to, polyamines, polyethers, polyamides, polyesters, polyurethanes, polyureas, polycarbonates, poly(styrene), polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylene, polyethyleneimine, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates. The polymeric material can be biodegradable and / or biocompatible. Non-limiting examples of biocompatible polymers are described in International Publication No. WO2013116804, the entire content of which is incorporated herein by reference. The polymeric material can further be irradiated. As a non-limiting example, the polymeric material can be gamma irradiated (see, e.g., International Publication No. WO201282165, the entire content of which is incorporated herein by reference). Non-limiting examples of specific polymers include poly(caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly(lactic acid) (PLA), poly(L-lactic acid) (PLLA), poly(glycolic acid) (PGA), poly(lactic acid-co-glycolic acid) (PLGA), poly(L-lactic acid-co-glycolic acid) (PLLGA), poly(D,L-lactide) (PDLA), poly(L-lactide) (PLLA), poly(D,L-lactide-co-caprolactone), poly(D,L-lactide-co-caprolactone-co-glycolide), poly(D,L-lactide-co-PEO-co-D,L-lactide), poly(D,L-lactide-co-PPO-co-D,L-lactide), polyalkyl cyanoacrylate, polyurethane, poly-L-lysine (PLL), hydroxypropyl methacrylate (HPMA), polyethylene glycol, poly-L-glutamic acid, poly(hydroxy acid), polyanhydride, polyorthoester, poly(ester amide), polyamide, poly(ester ether), polycarbonate, polyalkylene, e.g., polyethylene and polypropylene, polyalkylene glycol, e.g., poly(ethylene glycol) (PEG), polyalkylene oxide (PEO),Polyalkylene terephthalates, such as poly(ethylene terephthalate), polyvinyl alcohol (PVA), polyvinyl ethers, polyvinyl esters, such as poly(vinyl acetate), polyvinyl halides, such as poly(vinyl chloride) (PVC), polyvinyl pyrrolidone, polysiloxanes, polystyrene (PS), polyurethanes, derivatized celluloses, such as alkyl celluloses, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, nitrocellulose, hydroxypropyl cellulose, carboxymethyl cellulose, polymers of acrylic acid, such as poly(methyl (meth)acrylate) (PMMA), poly(ethyl (meth)acrylate), poly(butyl (meth)acrylate), poly(isobutyl (meth)acrylate), poly(hexyl (meth)acrylate), poly(isodecyl (meth)acrylate), poly(lauryl (meth)acrylate), poly(phenyl (meth)acrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate) and copolymers and mixtures thereof, polydioxanone and its copolymers, polyhydroxyalkanoates, polypropylene fumarate, polyoxymethylene, poloxamers, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), PEG-PLGA-PEG, and trimethylene carbonate, polyvinyl pyrrolidone. Lipid nanoparticles can be coated with or associated with copolymers such as, but not limited to, block copolymers (such as the branched polyether-polyamide block copolymers described in International Publication No. WO2013012476, which is incorporated herein by reference in its entirety) and (poly(ethylene glycol))-(poly(propylene oxide))-(poly(ethylene glycol)) triblock copolymers (see, for example, U.S. Patent Application Publication Nos. 20120121718 and 20100003337 and U.S. Patent No. 8,263,665, each of which is incorporated herein by reference in its entirety). The copolymers can be GRAS (Generally Recognized as Safe) polymers, and the formation of lipid nanoparticles isIt can be made in such a way that no new chemical entity is generated. For example, lipid nanoparticles can include poloxamer-coated PLGA nanoparticles that can still rapidly pass through human mucus without forming a new chemical entity (Yang et al. Angew. Chem. Int. Ed. 2011 50:2597 - 2600, the entire content of which is incorporated herein by reference). A non-limiting scalable method for generating nanoparticles that can pass through human mucus has been described by Xu et al. (see, for example, J Control Release 2013, 170(2):279 - 86, the entire content of which is incorporated herein by reference).

[0326] The vitamin of the polymer-vitamin conjugate may be vitamin E. The vitamin portion of the conjugate may be replaced with other suitable components such as, but not limited to, vitamin A, vitamin E, other vitamins, cholesterol, hydrophobic moieties or hydrophobic constituents of other surfactants (e.g., sterol chains, fatty acids, hydrocarbon chains and alkylene oxide chains).

[0327] Lipid nanoparticles engineered to pass through mucus can include, but are not limited to, polynucleotides, anionic proteins (e.g., bovine serum albumin), surfactants (e.g., cationic surfactants such as dimethyldioctadecyl-ammonium bromide), sugars or sugar derivatives (e.g., cyclodextrin), nucleic acids, polymers (e.g., heparin, polyethylene glycol, and poloxamer), mucolytics (e.g., N-acetylcysteine, mulberry, bromelain, papain, clerodendrum, acetylcysteine, bromhexine, carbocysteine, eplazone, mesna, ambroxol, sobrerol, domiodol, retosteine, streptonin, tiopronin, gelsolin, thymosin β4, donnase alpha, neruthenexin, erdosteine), and surface modifiers such as various DNases including rhDNase. The surface modifiers can be embedded in the particle surface, wrapped around the particle surface, or disposed on the surface of the lipid nanoparticles (e.g., by coating, adsorption, covalent bonding, or other processes) (see, e.g., U.S. Patent Application Publication Nos. 20100215580, 20080166414, and US20130164343, the entire contents of each of which are incorporated herein by reference).

[0328] In some embodiments, lipid nanoparticles that pass through mucus can include at least one polynucleotide described herein. The polynucleotide can be encapsulated within the lipid nanoparticles and / or disposed on the surface of the particles. The polynucleotide can be covalently bound to the lipid nanoparticles. Lipid nanoparticle formulations that pass through mucus can include a plurality of nanoparticles. Further, the formulation can contain particles that interact with mucus and can alter the structural properties and / or adhesiveness of the peripheral mucus to reduce mucoadhesion that can enhance delivery of the lipid nanoparticles that pass through mucus to mucosal tissue.

[0329] In other embodiments, lipid nanoparticles that pass through mucus can be hypotonic formulations that include a coating that improves mucosal passage. The formulation can be hypotonic with respect to the epithelium to which it is delivered.

[0330] Non-limiting examples of hypotonic formulations can be found in International Publication No. WO2013110028, the entire content of which is incorporated herein by reference.

[0331] In some embodiments, to improve delivery across the mucosal barrier, the RNA vaccine formulation may contain a hypotonic solution or be a hypotonic solution. Hypotonic solutions have been found to be able to increase the rate at which muco-inert particles, such as particles that pass through mucus, can reach the vaginal epithelial surface (see, e.g., Ensign et al. Biomaterials 2013, 34(28):6922-9, the entire content of which is incorporated herein by reference).

[0332] In some embodiments, the RNA vaccine is formulated as a lipoplex, including but not limited to, the ATUPLEX™, DACC, DBTC systems and other siRNA lipoplex technologies of Silence Therapeutics (London, United Kingdom), STEMFECT™ of STEMGENT® (Cambridge, MA), and targeted and untargeted nucleic acid delivery based on polyethyleneimine (PEI) or protamine (Aleku et al. Cancer Res. 2008 68:9788-9798; Strumberg et al. Int J Clin Pharmacol Ther 2012 50:76-78; Santel et al., Gene Ther 2006 13:1222-1234; Santel et al., Gene Ther 2006 13:1360-1370; Gutbier et al., Pulm Pharmacol.Ther. 2010 23:334-344; Kaufmann et al. Microvasc Res 2010 80:286-293; Weide et al. J Immunother. 2009 32:498-507; Weide et al. J Immunother. 2008 31:180-188; Pascolo, Expert Opin.Biol.Ther. 4:1285-1294; Fotin-Mleczek et al., 2011 J.Immunother. 34:1-15; Song et al., Nature Biotechnol. 2005, 23:709-717; Peer et al., Proc Natl Acad Sci U S A. 2007 6;104:4095-4100; deFougerolles Hum Gene Ther. 2008 19:125-132, each of which is incorporated herein by reference in its entirety).

[0333] In some embodiments, such formulations can also be engineered or otherwise modified to passively or actively target various cell types in vivo, including but not limited to hepatocytes, immune cells, tumor cells, endothelial cells, antigen presenting cells, and leukocytes (Akinc et al. Mol Ther. 2010 18:1357-1364; Song et al., Nat Biotechnol. 2005 23:709-717; Judge et al., J Clin Invest. 2009 119:661-673; Kaufmann et al., Microvasc Res 2010 80:286-293; Santel et al., Gene Ther 2006 13:1222-1234; Santel et al., Gene Ther 2006 13:1360-1370; Gutbier et al., Pulm Pharmacol. Ther. 2010 23:334-344; Basha et al., Mol. Ther. 2011 19:2186-2200; Fenske and Cullis, Expert Opin Drug Deliv. 2008 5:25-44; Peer et al., Science. 2008 319:627-630; Peer and Lieberman, Gene Ther. 2011 18:1127-1133, each incorporated herein by reference in its entirety). An example of passive targeting of a formulation to hepatocytes includes DLin-DMA, DLin-KC2-DMA, and DLin-MC3-DMA-based lipid nanoparticle formulations that have been shown to bind to apolipoprotein E and promote binding and uptake of the formulation to hepatocytes in vivo (Akinc et al. Mol Ther. 2010 18:1357-1364, incorporated herein by reference in its entirety).The formulation can also be selectively targeted by expressing different ligands on its surface, such as, but not limited to, folic acid, transferrin, N-acetylgalactosamine (GalNAc), and antibody targeting approaches (Kolhatkar et al., Curr Drug Discov Technol. 2011 8:197-206; Musacchio and Torchilin, Front Biosci. 2011 16:1388-1412; Yu et al., Mol Membr Biol. 2010 27:286-298; Patil et al., Crit Rev Ther Drug Carrier Syst. 2008 25:1-61; Benoit et al., Biomacromolecules. 2011 12:2708-2714; Zhao et al., Expert Opin Drug Deliv. 2008 5:309-319; Akinc et al., Mol Ther. 2010 18:1357-1364; Srinivasan et al., Methods Mol Biol. 2012 820:105-116; Ben-Arie et al., Methods Mol Biol. 2012 757:497-507; Peer 2010 J Control Release. 20:63-68; Peer et al., Proc Natl Acad Sci U S A. 2007 104:4095-4100; Kim et al., Methods Mol Biol. 2011 721:339-353; Subramanya et al., Mol Ther. 2010 18:2028-2037; Song et al., Nat Biotechnol. 2005 23:709-717; Peer et al., Science. 2008 319:627-630; Peer and Lieberman, Gene Ther. 2011 18:1127-1133, each of which is incorporated herein by reference in its entirety).

[0334] In some embodiments, the RNA (e.g., mRNA) vaccine is formulated as solid lipid nanoparticles. The solid lipid nanoparticles (SLN) can be spherical with an average diameter up to 1000 nm. The SLN has a solid lipid core matrix that can solubilize lipophilic molecules and can be stabilized with surfactants and / or emulsifiers. In other embodiments, the lipid nanoparticles can be self-assembling lipid polymer nanoparticles (see Zhang et al., ACS Nano, 2008, 2(8), pp 1696-1702, the entire content of which is incorporated herein by reference). As a non-limiting example, the SLN may be the SLN described in International Publication No. WO2013105101 (the entire content of which is incorporated herein by reference). As another non-limiting example, the SLN can be made by the method or process described in International Publication No. WO2013105101 (the entire content of which is incorporated herein by reference).

[0335] The formulation can increase the transfection of cells by the RNA vaccine and / or increase the translation of the encoded protein, and liposomes, lipoplexes or lipid nanoparticles can be utilized to improve the efficiency of protein production of the polynucleotide of interest. One such example may be the use of lipid encapsulation to enable effective systemic delivery of polyplex plasmid DNA (Heyes et al., Mol Ther. 2007 15:713-720, the entire content of which is incorporated herein by reference). Liposomes, lipoplexes or lipid nanoparticles can also be used to increase the stability of the polynucleotide.

[0336] In some embodiments, the RNA (e.g., mRNA) vaccines of the present invention can be formulated for controlled release and / or targeted delivery. As used herein, "controlled release" refers to the release profile of a pharmaceutical composition or compound that conforms to a specific release pattern to achieve a therapeutic outcome. In some embodiments, the RNA vaccine can be encapsulated within a delivery agent described herein and / or known in the art for controlled release and / or targeted delivery. As used herein, the term "encapsulate" means to enclose, surround, or envelop. When referring to the formulation of a compound of the present invention, the encapsulation can be substantial, complete, or partial. The term "substantially encapsulated" means that at least 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, greater than 99.9, or greater than 99.999% of the pharmaceutical composition or compound of the present invention is enclosed, surrounded, or enveloped within the delivery agent. "Partial encapsulation" means that less than 10%, 10, 20, 30, 40, 50 or less of the pharmaceutical composition or compound of the present invention is enclosed, surrounded, or enveloped within the delivery agent. Advantageously, the encapsulation can be determined by measuring the leakage or activity of the pharmaceutical composition or compound of the present invention using fluorescence and / or electron micrographs. For example, at least 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, 99.99 or greater than 99.99% of the pharmaceutical composition or compound of the present invention is encapsulated within the delivery agent.

[0337] In some embodiments, the controlled release formulation can include, without limitation, triblock copolymers. By way of non-limiting example, the formulation can include two different types of triblock copolymers (see International Publication Nos. WO2012131104 and WO2012131106, the entire contents of each of which are incorporated herein by reference).

[0338] In other embodiments, the RNA vaccine can be encapsulated in lipid nanoparticles or in lipid nanoparticles that are rapidly cleared, and then the lipid nanoparticles or the rapidly cleared lipid nanoparticles can be encapsulated within polymers, hydrogels, and / or surgical sealants described herein and / or known in the art. By way of non-limiting example, the polymer, hydrogel, or surgical sealant can be PLGA, ethylene vinyl acetate (EVAc), poloxamer, GELSITE® (Nanotherapeutics, Inc. (Alachua, FL)), HYLENEX® (Halozyme Therapeutics (San Diego CA)), fibrinogen polymer (Ethicon Inc. (Cornelia, GA)), TISSELL® (Baxter International, Inc (Deerfield, IL)), PEG-based sealants, and surgical sealants such as COSEAL® (Baxter International, Inc (Deerfield, IL)).

[0339] In other embodiments, the lipid nanoparticles may be encapsulated within any polymer known in the art that can form a gel when injected into a subject. As another non-limiting example, the lipid nanoparticles may be encapsulated within a biodegradable polymer matrix.

[0340] In some embodiments, the RNA vaccine formulation for controlled release and / or targeted delivery may also include at least one controlled release coating. Controlled release coatings include, but are not limited to, cellulose derivatives such as OPADRY®, polyvinylpyrrolidone / vinyl acetate copolymer, polyvinylpyrrolidone, hydroxypropylmethylcellulose, hydroxypropylcellulose, hydroxyethylcellulose, EUDRAGIT RL®, EUDRAGIT RS®, and aqueous ethylcellulose dispersions (AQUACOAT® and SURELEASE®).

[0341] In some embodiments, the RNA (e.g., mRNA) vaccine controlled release and / or targeted delivery formulation may include at least one degradable polyester that may contain a polycationic side chain. Degradable polyesters include, but are not limited to, poly(serine ester), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline ester), and combinations thereof. In other embodiments, the degradable polyester may include a PEG conjugate for forming a PEGylated polymer.

[0342] In some embodiments, an RNA vaccine controlled release and / or targeted delivery formulation comprising at least one polynucleotide may include at least one PEG and / or PEG-related polymer derivative as described in U.S. Patent No. 8,404,222, which is incorporated herein by reference in its entirety.

[0343] In other embodiments, an RNA vaccine controlled release delivery formulation comprising at least one polynucleotide may be a controlled release polymer system as described in U.S. Patent Application Publication No. 20130130348, which is incorporated herein by reference in its entirety.

[0344] In some embodiments, the RNA (e.g., mRNA) vaccine of the present invention can be encapsulated in therapeutic nanoparticles, which are referred to herein as "therapeutic nanoparticle RNA vaccines". The therapeutic nanoparticles can be formulated by the methods described herein and methods known in the art, such as, but not limited to, International Publication Nos. WO2010005740, WO2010030763, WO2010005721, WO2010005723, WO2012054923, U.S. Patent Application Publication Nos. US20110262491, US20100104645, US20100087337, US20100068285, US20110274759, US20100068286, US20120288541, US20130123351 and US20130230567, and U.S. Pat. Nos. 8,206,747, 8,293,276, 8,318,208 and 8,318,211 (the entire contents of each of which are incorporated herein by reference). In other embodiments, the therapeutic polymer nanoparticles can be identified by the method described in U.S. Patent Application Publication No. US20120140790 (the entire contents of which are incorporated herein by reference).

[0345] In some embodiments, the therapeutic nanoparticle RNA vaccine can be formulated for sustained release. As used herein, "sustained release" refers to a pharmaceutical composition or compound that follows a certain release rate over a specific period of time. The specific period includes, but is not limited to, time, days, weeks, months, and years. As a non-limiting example, a sustained-release nanoparticle can include a polymer and a therapeutic agent such as, but not limited to, the polynucleotide of the present invention (see International Publication No. WO 2010 / 075072 and U.S. Patent Application Publication Nos. US 2010 / 0216804, US 2011 / 0217377, and US 2012 / 0201859, each of which is incorporated herein by reference in its entirety). In another non-limiting example, a sustained-release formulation can include an agent that enables sustained bioavailability, such as, but not limited to, a crystal, a macromolecular gel, and / or a microparticle suspension (see U.S. Patent Application Publication No. US 2013 / 0150295, the entire content of which is incorporated herein by reference).

[0346] In some embodiments, the therapeutic nanoparticle RNA vaccine can be formulated to be target-specific. As a non-limiting example, the therapeutic nanoparticle can include a corticosteroid (see International Publication No. WO 2011 / 084518, which is incorporated herein by reference in its entirety). As a non-limiting example, the therapeutic nanoparticle can be formulated in the nanoparticles described in International Publication Nos. WO 2008 / 121949, WO 2010 / 005726, WO 2010 / 005725, WO 2011 / 084521, and U.S. Patent Application Publication Nos. US 2010 / 0069426, US 2012 / 0004293, and US 2010 / 0104655 (each of which is incorporated herein by reference in its entirety).

[0347] In some embodiments, the nanoparticles of the present invention may include a polymer matrix. By way of non-limiting example, the nanoparticles may include, but are not limited to, two or more polymers such as polyethylene, polycarbonate, polyanhydride, polyhydroxy acid, polypropyl fumarate, polycaprolactone, polyamide, polyacetal, polyether, polyester, poly(orthoester), polycyanoacrylate, polyvinyl alcohol, polyurethane, polyphosphazene, polyacrylate, polymethacrylate, polycyanoacrylate, polyurea, polystyrene, polyamine, polylysine, poly(ethyleneimine), poly(serine ester), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline ester) or combinations thereof.

[0348] In some embodiments, the therapeutic nanoparticles may include a diblock copolymer. In some embodiments, the diblock copolymer may include PEG in combination with a polymer such as, but not limited to, polyethylene, polycarbonate, polyanhydride, polyhydroxy acid, polypropyl fumarate, polycaprolactone, polyamide, polyacetal, polyether, polyester, poly(orthoester), polycyanoacrylate, polyvinyl alcohol, polyurethane, polyphosphazene, polyacrylate, polymethacrylate, polycyanoacrylate, polyurea, polystyrene, polyamine, polylysine, poly(ethyleneimine), poly(serine ester), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline ester) or combinations thereof. In still other embodiments, the diblock copolymer may be a high-X diblock copolymer such as those described in International Publication No. WO2013120052, the entire contents of which are incorporated herein by reference.

[0349] As a non-limiting example, the therapeutic nanoparticles include a PLGA-PEG block copolymer (see U.S. Patent Application Publication No. US20120004293 and U.S. Patent No. 8,236,330, each incorporated herein by reference in its entirety). In another non-limiting example, the therapeutic nanoparticles are stealth nanoparticles comprising diblock copolymers of PEG and PLA or PEG and PLGA (see U.S. Patent No. 8,246,968 and International Publication No. WO2012166923, each incorporated herein by reference in its entirety). In yet another non-limiting example, the therapeutic nanoparticles are the stealth nanoparticles or target-specific stealth nanoparticles described in U.S. Patent Application Publication No. 20130172406 (incorporated herein by reference in its entirety).

[0350] In some embodiments, the therapeutic nanoparticles can include a multi-block copolymer (e.g., see U.S. Patent Nos. 8,263,665 and 8,287,910 and U.S. Patent Application Publication No. 20130195987, each incorporated herein by reference in its entirety).

[0351] In yet another non-limiting example, the lipid nanoparticles comprise the block copolymer PEG-PLGA-PEG (e.g., used as a delivery vehicle for the TGF-β1 gene in Lee et al. “Thermosensitive Hydrogel as a Tgf-β1 Gene Delivery Vehicle Enhances Diabetic Wound Healing.” Pharmaceutical Research, 2003 20(12):1995-2000, Li et al. “Controlled Gene Delivery System Based on Thermosensitive Biodegradable Hydrogel” Pharmaceutical Research 2003 20(6):884-888; and Chang et al., “Non-ionic amphiphilic biodegradable PEG-PLGA-PEG copolymer enhances gene delivery efficiency in rat skeletal muscle.” J Controlled Release. 2007 118:245-253, see thermosensitive hydrogel (PEG-PLGA-PEG) references, each incorporated herein by reference in its entirety). The RNA (e.g., mRNA) vaccines of the present disclosure can be formulated in lipid nanoparticles comprising the PEG-PLGA-PEG block copolymer.

[0352] In some embodiments, the block copolymers described herein may be included in a polyion complex comprising non-polymer micelles and the block copolymer (see, e.g., U.S. Patent Application Publication No. 20120076836, incorporated herein by reference in its entirety).

[0353] In some embodiments, the therapeutic nanoparticles can include at least one acrylic polymer. Acrylic polymers include, but are not limited to, acrylic acid, methacrylic acid, copolymers of acrylic acid and methacrylic acid, methyl methacrylate copolymers, ethoxyethyl methacrylate, cyanoethyl methacrylate, aminoalkyl methacrylate copolymers, poly(acrylic acid), poly(methacrylic acid), polycyanoacrylate, and combinations thereof.

[0354] In some embodiments, the therapeutic nanoparticles can include at least one poly(vinyl ester) polymer. The poly(vinyl ester) polymer can be a copolymer such as a random copolymer. By way of non-limiting example, the random copolymer can have a structure such as that described in International Publication No. WO2013032829 or U.S. Patent Application Publication No. 20130121954, the entire contents of which are incorporated herein by reference. In some aspects, the poly(vinyl ester) polymer can be conjugated to the polynucleotides described herein. In other aspects, the poly(vinyl ester) polymers that can be used in the present invention can be those described herein.

[0355] In some embodiments, the therapeutic nanoparticles can include at least one diblock copolymer. The diblock copolymer can be, but is not limited to, a poly(lactic acid)-poly(ethylene glycol) copolymer (see, e.g., International Publication No. WO2013044219, the entire contents of which are incorporated herein by reference). By way of non-limiting example, the therapeutic nanoparticles can be used to treat cancer (see International Publication No. WO2013044219, the entire contents of which are incorporated herein by reference).

[0356] In some embodiments, the therapeutic nanoparticles can include at least one cationic polymer described herein and / or known in the art.

[0357] In some embodiments, the therapeutic nanoparticles can include at least one amine-containing polymer, including but not limited to polylysine, polyethyleneimine, poly(amidoamine) dendrimer, poly(β-amino ester) (see, e.g., U.S. Patent No. 8,287,849, which is incorporated herein by reference in its entirety), and combinations thereof. In other embodiments, the nanoparticles described herein can include amine cationic lipids such as those described in International Publication No. WO2013059496 (which is incorporated herein by reference in its entirety). In some aspects, the cationic lipid can have an amino-amine or amino-amide moiety.

[0358] In some embodiments, the therapeutic nanoparticles can include at least one degradable polyester that can contain polycationic side chains. Degradable polyesters include, but are not limited to, poly(serine ester), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline ester), and combinations thereof. In other embodiments, the degradable polyester can include a PEG conjugate for forming a PEGylated polymer.

[0359] In other embodiments, the therapeutic nanoparticles can include a conjugate of at least one targeting ligand. The targeting ligand can be any ligand known in the art, including but not limited to a monoclonal antibody (see Kirpotin et al, Cancer Res. 2006 66:6732-6740, which is incorporated herein by reference in its entirety).

[0360] In some embodiments, the therapeutic nanoparticles can be formulated in an aqueous solution and used to target cancer (see International Publication No. WO2011084513 and U.S. Patent Application Publication No. 20110294717, each of which is incorporated herein by reference in its entirety).

[0361] In some embodiments, a therapeutic nanoparticle RNA vaccine (e.g., a therapeutic nanoparticle comprising at least one RNA vaccine) can be formulated using the method described by Podobinski et al. in U.S. Patent No. 8,404,799, the entire content of which is incorporated herein by reference.

[0362] In some embodiments, an RNA (e.g., mRNA) vaccine can be encapsulated within, bound to, and / or associated with a synthetic nanocarrier. Synthetic nanocarriers include, but are not limited to, those described in International Publication Nos. WO2010005740, WO2012149454, and WO2013019669, and U.S. Patent Application Publication Nos. US20110262491, US20100104645, US20100087337, and US20120244222, the entireties of each of which are incorporated herein by reference. The synthetic nanocarriers can be formulated using methods known in the art and / or methods described herein. By way of non-limiting example, the synthetic nanocarriers can be formulated by the methods described in International Publication Nos. WO2010005740, WO2010030763, and WO201213501, and U.S. Patent Application Publication Nos. US20110262491, US20100104645, US20100087337, and US2012024422, the entireties of each of which are incorporated herein by reference. In other embodiments, formulations of the synthetic nanocarriers can be lyophilized using the methods described in International Publication No. WO2011072218 and U.S. Patent No. 8,211,473, the entire contents of each of which are incorporated herein by reference. In yet other embodiments, without limitation, formulations of the present invention comprising synthetic nanocarriers can be lyophilized or reconstituted by the methods described in U.S. Patent Application Publication No. 20130230568, the entire content of which is incorporated herein by reference.

[0363] In some embodiments, the synthetic nanocarrier may contain a reactive group that releases the polynucleotides described herein (see International Publication No. WO20120952552 and U.S. Patent Application Publication No. US20120171229, each incorporated herein by reference in its entirety).

[0364] In some embodiments, the synthetic nanocarrier may contain an immunostimulant that enhances the immune response from delivery of the synthetic nanocarrier. As a non-limiting example, the synthetic nanocarrier may include a Th1 immunostimulant that can enhance the Th1-based response of the immune system (see International Publication No. WO2010123569 and U.S. Patent Application Publication No. 20110223201, each incorporated herein by reference in its entirety).

[0365] In some embodiments, the synthetic nanocarrier may be formulated for targeted release. In some embodiments, the synthetic nanocarrier is formulated to release the polynucleotide at a specified pH and / or after a desired time interval. As a non-limiting example, the synthetic nanoparticles may be formulated to release an RNA vaccine after 24 hours and / or at pH 4.5 (see International Publication Nos. WO2010138193 and WO2010138194 and U.S. Patent Application Publication Nos. US20110020388 and US20110027217, each incorporated herein by reference in its entirety).

[0366] In some embodiments, the synthetic nanocarrier may be formulated for controlled and / or sustained release of the polynucleotides described herein. As a non-limiting example, synthetic nanocarriers for sustained release can be formulated by methods known in the art, methods described herein, and / or methods described in International Publication No. WO2010138192 and U.S. Patent Application Publication No. 20100303850 (each incorporated herein by reference in its entirety).

[0367] In some embodiments, the RNA vaccine can be formulated for controlled and / or sustained release, and the formulation comprises at least one polymer that is a crystalline side chain (CYSC) polymer. The CYSC polymer is described in U.S. Patent No. 8,399,007, which is hereby incorporated by reference in its entirety.

[0368] In some embodiments, the synthetic nanocarrier can be formulated for use as a vaccine. In some embodiments, the synthetic nanocarrier can encapsulate at least one polynucleotide encoding at least one antigen. As a non-limiting example, the synthetic nanocarrier can comprise at least one antigen and an excipient for a vaccine dosage form (see International Publication No. WO2011150264 and U.S. Patent Application Publication No. 20110293723, each of which is hereby incorporated by reference in its entirety). As another non-limiting example, the vaccine dosage form can comprise at least two synthetic nanocarriers comprising the same or different antigens and an excipient (see International Publication No. WO2011150249 and U.S. Patent Application Publication No. 20110293701, each of which is hereby incorporated by reference in its entirety). The vaccine dosage form can be selected by the methods described herein, methods known in the art, and / or the methods described in International Publication No. WO2011150258 and U.S. Patent Application Publication No. US20120027806 (each of which is hereby incorporated by reference in its entirety).

[0369] In some embodiments, the synthetic nanocarrier can comprise at least one polynucleotide encoding at least one adjuvant (e.g., flagellin protein). In some embodiments, the synthetic nanocarrier can comprise at least one adjuvant. By way of non-limiting example, the adjuvant can include dimethyldioctadecylammonium bromide, dimethyldioctadecylammonium chloride, dimethyldioctadecylammonium phosphate or dimethyldioctadecylammonium acetate (DDA), and a nonpolar fraction of mycobacterial total lipid extract or a portion of said nonpolar fraction (see, e.g., U.S. Patent No. 8,241,610, which is incorporated herein by reference in its entirety). In other embodiments, the synthetic nanocarrier can comprise at least one polynucleotide and an adjuvant. By way of non-limiting example, synthetic nanocarriers that optionally include an adjuvant can be formulated by the methods described in International Publication No. WO2011150240 and U.S. Patent Application Publication No. US20110293700 (each of which is incorporated herein by reference in its entirety).

[0370] In some embodiments, the synthetic nanocarrier can encapsulate at least one polynucleotide encoding a virus-derived peptide, fragment or region. By way of non-limiting example, synthetic nanocarriers include those described in International Publication Nos. WO2012024621, WO201202629 and WO2012024632 and U.S. Patent Application Publication Nos. US20120064110, US20120058153 and US20120058154 (each of which is incorporated herein by reference in its entirety).

[0371] In some embodiments, the synthetic nanocarrier can be bound to a polynucleotide capable of inducing a humoral response and / or a cytotoxic T lymphocyte (CTL) response (see, e.g., International Publication No. WO2013019669, which is incorporated herein by reference in its entirety).

[0372] In some embodiments, the RNA vaccine can be encapsulated in, bound to, and / or associated with zwitterionic lipids. Non-limiting examples of zwitterionic lipids and methods of using zwitterionic lipids are described in U.S. Patent Application Publication No. 20130216607, the entire content of which is incorporated herein by reference. In some aspects, the zwitterionic lipids can be used in the liposomes and lipid nanoparticles described herein.

[0373] In some embodiments, the RNA vaccine can be formulated in the colloidal nanocarriers described in U.S. Patent Application Publication No. 20130197100 (the entire content of which is incorporated herein by reference).

[0374] In some embodiments, the nanoparticles can be optimized for oral administration. The nanoparticles can include at least one cationic biopolymer such as, but not limited to, chitosan or a derivative thereof. As a non-limiting example, the nanoparticles can be formulated by the methods described in U.S. Patent Application Publication No. 20120282343, the entire content of which is incorporated herein by reference.

[0375] In some embodiments, the LNP includes lipid KL52 (the amino lipid disclosed in U.S. Patent Application Publication No. 2012 / 0295832, the entire content of which is expressly incorporated herein by reference). The activity and / or safety of LNP administration (determined by examining one or more of ALT / AST, white blood cell count, and cytokine induction) can be improved by incorporating such lipids. LNPs containing KL52 can be administered intravenously and / or at one or more doses. In some embodiments, administration of KL52-containing LNPs results in the same or improved mRNA and / or protein expression compared to LNPs containing MC3.

[0376] In some embodiments, the RNA vaccine may be delivered using even smaller LNPs. Such particles may have a diameter of less than 0.1 μm up to a maximum of 100 nm, for example, but not limited to, less than 0.1 μm, less than 1.0 μm, less than 5 μm, less than 10 μm, less than 15 μm, less than 20 μm, less than 25 μm, less than 30 μm, less than 35 μm, less than 40 μm, less than 50 μm, less than 55 μm, less than 60 μm, less than 65 μm, less than 70 μm, less than 75 μm, less than 80 μm, less than 85 μm, less than 90 μm, less than 95 μm, less than 100 μm, less than 125 μm, less than 150 μm, less than 175 μm, less than 200 μm, less than 225 μm, less than 250 μm, less than 275 μm, less than 300 μm, less than 325 μm, less than 350 μm, less than 375 μm, less than 400 μm, less than 425 μm, less than 450 μm, less than 475 μm, less than 500 μm, less than 525 μm, less than 550 μm, less than 575 μm, less than 600 μm, less than 625 μm, less than 650 μm, less than 675 μm, less than 700 μm, less than 725 μm, less than 750 μm, less than 775 μm, less than 800 μm, less than 825 μm, less than 850 μm, less than 875 μm, less than 900 μm, less than 925 μm, less than 950 μm or less than 975 μm.

[0377] In other embodiments, the RNA (e.g., mRNA) vaccine may be delivered using smaller LNPs that can have a diameter of about 1 nm to about 100 nm, about 1 nm to about 10 nm, about 1 nm to about 20 nm, about 1 nm to about 30 nm, about 1 nm to about 40 nm, about 1 nm to about 50 nm, about 1 nm to about 60 nm, about 1 nm to about 70 nm, about 1 nm to about 80 nm, about 1 nm to about 90 nm, about 5 nm to about 100 nm, about 5 nm to about 10 nm, about 5 nm to about 20 nm, about 5 nm to about 30 nm, about 5 nm to about 40 nm, about 5 nm to about 50 nm, about 5 nm to about 60 nm, about 5 nm to about 70 nm, about 5 nm to about 80 nm, about 5 nm to about 90 nm, about 10 to about 50 nm, about 20 to about 50 nm, about 30 to about 50 nm, about 40 to about 50 nm, about 20 to about 60 nm, about 30 to about 60 nm, about 40 to about 60 nm, about 20 to about 70 nm, about 30 to about 70 nm, about 40 to about 70 nm, about 50 to about 70 nm, about 60 to about 70 nm, about 20 to about 80 nm, about 30 to about 80 nm, about 40 to about 80 nm, about 50 to about 80 nm, about 60 to about 80 nm, about 20 to about 90 nm, about 30 to about 90 nm, about 40 to about 90 nm, about 50 to about 90 nm, about 60 to about 90 nm, and / or about 70 to about 90 nm.

[0378] In some embodiments, such LNPs are synthesized using a method that comprises a microfluidic mixer. Exemplary microfluidic mixers include, but are not limited to, slit-type interdigital micromixers, for example, but not limited to, those by Microinnova (Allerheiligen bei Wildon, Austria)) and / or zigzag herringbone micromixers (SHM) (Zhigaltsev, I.V. et al., Bottom-up design and synthesis of limit size lipid nanoparticle systems with aqueous and triglyceride cores using millisecond microfluidic mixing is published (Langmuir. 2012. 28:3633-40; Belliveau, N.M. et al., Microfluidic synthesis of highly potent limit-size lipid nanoparticles for in vivo delivery of siRNA. Molecular Therapy-Nucleic Acids. 2012. 1:e37; Chen, D. et al., Rapid discovery of potent siRNA-containing lipid nanoparticles enabled by controlled microfluidic formulation. J Am Chem Soc. 2012. 134(16):6948-51, each of which is incorporated herein by reference in its entirety).

[0379] In some embodiments, the method of generating LNPs with SHM further includes the mixing of at least two inflow streams, which mixing is caused by micro-structured induced chaotic advection (MICA). According to this method, the fluid flow passes through channels present in a herringbone pattern, causing a swirling flow and the fluids to overlap each other. This method may also include a surface for fluid mixing where the surface changes direction while the fluid is circulating. Methods of using SHM to generate LNPs include those disclosed in U.S. Patent Application Publication Nos. 2004 / 0262223 and 2012 / 0276209 (each of which is hereby expressly incorporated by reference in its entirety).

[0380] In some embodiments, the RNA vaccine of the present invention can be formulated into lipid nanoparticles generated using a micromixer such as, but not limited to, a slit-type interdigital microstructured mixer (SIMM-V2) or a standard slit-type interdigital micromixer (SSIMM) or a caterpillar (CPMM) or a jet impingement (IJMM) (manufactured by Institut fur Mikrotechnik Mainz GmbH (Mainz Germany)).

[0381] In some embodiments, the RNA (e.g., mRNA) vaccines of the present disclosure can be formulated in lipid nanoparticles generated using microfluidics technology (see Whitesides, George M. The Origins and the Future of Microfluidics. Nature, 2006 442:368-373; and Abraham et al. Chaotic Mixer for Microchannels. Science, 2002 295:647-651, each incorporated herein by reference in its entirety). As a non-limiting example, a controlled microfluidic formulation involves a passive method of mixing the flow of a driven flow at a low Reynolds number steady pressure within a microchannel (see, e.g., Abraham et al. Chaotic Mixer for Microchannels. Science, 2002 295:647651, incorporated herein by reference in its entirety).

[0382] In some embodiments, the RNA (e.g., mRNA) vaccines of the invention can be formulated in lipid nanoparticles generated using, but not limited to, micromixer chips such as those made by Harvard Apparatus (Holliston, MA) or Dolomite Microfluidics (Royston, UK). The micromixer chip can be used to rapidly mix two or more fluid flows by means of a slit and recombination mechanism.

[0383] In some embodiments, the RNA (e.g., mRNA) vaccines of the present invention can be formulated for delivery using drug-encapsulating microspheres described in International Publication No. WO2013063468 or U.S. Patent No. 8,440,614, each of which is incorporated herein by reference in its entirety. The microspheres can contain compounds of formula (I), (II), (III), (IV), (V) or (VI) described in International Publication No. WO2013063468, the entire content of which is incorporated herein by reference. In other embodiments, amino acids, peptides, polypeptides, lipids (APPL) are useful for delivering the RNA vaccines of the present invention to cells (see International Publication No. WO2013063468, the entire content of which is incorporated herein by reference).

[0384] In some embodiments, the RNA (e.g., mRNA) vaccines of the present disclosure can be formulated in lipid nanoparticles having a diameter of about 10 to about 100 nm, such as, but not limited to, about 10 to about 20 nm, about 10 to about 30 nm, about 10 to about 40 nm, about 10 to about 50 nm, about 10 to about 60 nm, about 10 to about 70 nm, about 10 to about 80 nm, about 10 to about 90 nm, about 20 to about 30 nm, about 20 to about 40 nm, about 20 to about 50 nm, about 20 to about 60 nm, about 20 to about 70 nm, about 20 to about 80 nm, about 20 to about 90 nm, about 20 to about 100 nm, about 30 to about 40 nm, about 30 to about 50 nm, about 30 to about 60 nm, about 30 to about 70 nm, about 30 to about 80 nm, about 30 to about 90 nm, about 30 to about 100 nm, about 40 to about 50 nm, about 40 to about 60 nm, about 40 to about 70 nm, about 40 to about 80 nm, about 40 to about 90 nm, about 40 to about 100 nm, about 50 to about 60 nm, about 50 to about 70 nm, about 50 to about 80 nm, about 50 to about 90 nm, about 50 to about 100 nm, about 60 to about 70 nm, about 60 to about 80 nm, about 60 to about 90 nm, about 60 to about 100 nm, about 70 to about 80 nm, about 70 to about 90 nm, about 70 to about 100 nm, about 80 to about 90 nm, about 80 to about 100 nm, and / or about 90 to about 100 nm.

[0385] In some embodiments, the lipid nanoparticles can have a diameter of about 10 to 500 nm.

[0386] In some embodiments, the lipid nanoparticles can have a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm, greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm, greater than 950 nm or greater than 1000 nm.

[0387] In some aspects, the lipid nanoparticles can be lipid nanoparticles of limiting dimensions as described in International Publication No. WO2013059922, the entire content of which is incorporated herein by reference. The lipid nanoparticles of limiting dimensions can include a lipid bilayer surrounding an aqueous core or a hydrophobic core, where the lipid bilayer can include phospholipids such as, but not limited to, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, dihydrosphingomyelin, cephalin, cerebroside, C8-C20 fatty acid diacylphosphatidylcholine, and 1-palmitoyl-2-oleoylphosphatidylcholine (POPC). In other aspects, the lipid nanoparticles of limiting dimensions can include polyethylene glycol lipids such as, but not limited to, DLPE-PEG, DMPE-PEG, DPPC-PEG, and DSPE-PEG.

[0388] In some embodiments, the RNA vaccine can be delivered, localized, and / or concentrated at a specific location using the delivery methods described in International Publication No. WO2013063530, the entire content of which is incorporated herein by reference. As a non-limiting example, empty polymer particles can be administered to the subject before, simultaneously with, or after delivering the RNA vaccine to the subject. The empty polymer particles change in volume upon contact with the subject and remain, embed, immobilize, or capture at a specific location within the subject.

[0389] In some embodiments, the RNA vaccine can be formulated in an active agent release system (see, e.g., U.S. Patent Application Publication No. US20130102545, the entire content of which is incorporated herein by reference). The active agent release system can include 1) at least one nanoparticle bound to an oligonucleotide inhibitor strand that hybridizes to a nucleic acid having catalytic activity, and 2) a compound bound to at least one substrate molecule bound to a therapeutically effective substance (e.g., a polynucleotide described herein), wherein the therapeutically effective substance is released by cleavage of the substrate molecule by the nucleic acid having catalytic activity.

[0390] In some embodiments, an RNA (e.g., mRNA) vaccine can be formulated in a nanoparticle that includes an inner core containing a non-cellular material and an outer surface containing a cell membrane. The cell membrane can be of cellular origin or a virus-derived membrane. As a non-limiting example, the nanoparticles can be made by the method described in International Publication No. WO2013052167 (the entire content of which is incorporated herein by reference). As another non-limiting example, the nanoparticles described in International Publication No. WO2013052167 (the entire content of which is incorporated herein by reference) can be used to deliver the RNA vaccines described herein.

[0391] In some embodiments, the RNA vaccine can be formulated in a lipid bilayer (protocell) supported by a porous nanoparticle. Protocells are described in International Publication No. WO2013056132, the entire content of which is incorporated herein by reference.

[0392] In some embodiments, the RNA vaccines described herein can be formulated in the polymeric nanoparticles described in U.S. Patent Nos. 8,420,123 and 8,518,963 and European Patent No. EP2073848B1 (each incorporated herein by reference in its entirety), or in polymeric nanoparticles made by the methods described therein. As a non-limiting example, polymeric nanoparticles such as the nanoparticles described in U.S. Patent No. 8,518,963 (incorporated herein by reference in its entirety) or nanoparticles made by the methods described in that patent can have a high glass transition temperature. As another non-limiting example, polymeric nanoparticles for oral and parenteral formulations can be made by the methods described in European Patent No. EP2073848B1 (incorporated herein by reference in its entirety).

[0393] In other embodiments, the RNA (e.g., mRNA) vaccines described herein can be formulated in nanoparticles used in imaging. The nanoparticles can be liposomal nanoparticles such as those described in U.S. Patent Application Publication No. 20130129636 (incorporated herein by reference in its entirety). As a non-limiting example, the liposomes can contain gadolinium(III) 2-{4,7-bis-carboxymethyl-10-[(N,N-distearylamidomethyl-N'-amide-methyl]-1,4,7,10-tetra-azacyclododec-1-yl}-acetate and a neutral fully saturated phospholipid component (see, e.g., U.S. Patent Application Publication No. US20130129636, incorporated herein by reference in its entirety).

[0394] In some embodiments, the nanoparticles that can be used in the present invention are formed by the methods described in U.S. Patent Application Publication No. 20130130348 (incorporated herein by reference in its entirety).

[0395] The nanoparticles of the present invention may further contain nutrients, such as, but not limited to, those that can cause health damage ranging from anemia to neural tube defects if lacking (see, for example, the nanoparticles described in International Publication No. WO2013072929, the entire content of which is incorporated herein by reference). As non-limiting examples, the nutrients may be ferrous salts, ferric salts or elemental iron, iodine, folic acid, vitamins or micronutrients.

[0396] In some embodiments, the RNA (e.g., mRNA) vaccine of the present invention can be formulated in swellable nanoparticles. The swellable nanoparticles may be those described in U.S. Patent No. 8,440,231 (the entire content of which is incorporated herein by reference). As a non-limiting embodiment, swellable nanoparticles can be used to deliver the RNA (e.g., mRNA) vaccine of the present invention to the pulmonary system (see, for example, U.S. Patent No. 8,440,231, the entire content of which is incorporated herein by reference).

[0397] The RNA (e.g., mRNA) vaccine of the present invention can be formulated in polyanhydride nanoparticles, such as those described in U.S. Patent No. 8,449,916 (the entire content of which is incorporated herein by reference). The nanoparticles and microparticles of the present invention can be geometrically engineered to control macrophage response and / or immune response. In some aspects, the geometrically engineered particles can have various shapes, sizes and / or surface charges, such as, but not limited to, for incorporating the polynucleotide of the present invention for targeted delivery, such as pulmonary delivery (see, for example, International Publication No. WO2013082111, the entire content of which is incorporated herein by reference). Other physical characteristics of the geometrically engineered particles can include, but are not limited to, window formation, angled arms, asymmetry and surface roughness, charge, which can alter cell and tissue interactions. As a non-limiting example, the nanoparticles of the present invention can be made by the methods described in International Publication No. WO2013082111 (the entire content of which is incorporated herein by reference).

[0398] In some embodiments, the nanoparticles of the present invention may be water-soluble nanoparticles, such as, but not limited to, those described in International Publication No. WO2013090601, which is incorporated herein by reference in its entirety. The nanoparticles may be inorganic nanoparticles having small, zwitterionic ligands in order to exhibit good water solubility. The nanoparticles may also have a small hydrodynamic diameter (HD), stability against time, pH, and salt concentration, and a low level of non-specific protein binding.

[0399] In some embodiments, the nanoparticles of the present invention can be developed by the method described in U.S. Patent Application Publication No. US20130172406, which is incorporated herein by reference in its entirety.

[0400] In some embodiments, the nanoparticles of the present invention are stealth nanoparticles or target-specific stealth nanoparticles such as, but not limited to, those described in U.S. Patent Application Publication No. 20130172406, which is incorporated herein by reference in its entirety. The nanoparticles of the present invention can be produced by the method described in U.S. Patent Application Publication No. 20130172406, which is incorporated herein by reference in its entirety.

[0401] In other embodiments, the stealth or target-specific stealth nanoparticles may include a polymer matrix. The polymer matrix may include two or more polymers such as, but not limited to, polyethylene, polycarbonate, polyanhydride, polyhydroxy acid, polypropyl fumerate, polycaprolactone, polyamide, polyacetal, polyether, polyester, poly(orthoester), polycyanoacrylate, polyvinyl alcohol, polyurethane, polyphosphazene, polyacrylate, polymethacrylate, polycyanoacrylate, polyurea, polystyrene, polyamine, polyester, polyanhydride, polyether, polyurethane, polymethacrylate, polyacrylate, polycyanoacrylate, or combinations thereof.

[0402] In some embodiments, the nanoparticles may be nanoparticle-nucleic acid hybrid structures having a high density nucleic acid layer. As a non-limiting example, the nanoparticle-nucleic acid hybrid structures can be made by the methods described in U.S. Patent Application Publication No. 20130171646, the entire content of which is incorporated herein by reference. The nanoparticles can include nucleic acids such as, but not limited to, the polynucleotides described herein and / or polynucleotides known in the art.

[0403] At least one of the nanoparticles of the present invention can be embedded in a core nanostructure or can be coated with a low density porous 3D structure or coating capable of carrying or associating at least one payload within or on the nanostructure. Non-limiting examples of nanostructures containing at least one nanoparticle are described in International Publication No. WO2013123523, the entire content of which is incorporated herein by reference.

[0404] Vaccine administration method RSV RNA (e.g., mRNA) vaccines can be administered by any route that results in a therapeutically effective outcome. These include, but are not limited to, intradermal, intramuscular, intranasal, and / or subcutaneous administration. The present disclosure provides methods that include administering an RNA vaccine to a subject in need thereof. The exact required amount can vary for each subject depending on the species, age, and general condition of the subject, the severity of the disease, the particular composition, its mode of administration, its mode of activity, etc. RSV RNA (e.g., mRNA) vaccine compositions are typically formulated in unit dosage forms for ease of administration and uniformity of dosage. However, it will be understood that the total daily dose of an RSV RNA (e.g., mRNA) vaccine composition can be determined by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dosage level, prophylactically effective dosage level, appropriate imaging dosage level for any particular patient can depend on various factors including the disease and severity of the disease being treated, the activity of the particular compound employed, the particular composition employed, the age, weight, general condition, sex, and diet of the patient, the time of administration, route of administration, and rate of excretion of the particular compound employed, the duration of the treatment, drugs used in combination with or concurrently with the particular compound employed, as well as similar factors well known in the medical arts.

[0405] In some embodiments, the RSV RNA (e.g., mRNA) vaccine composition is administered at a dosage level sufficient to deliver from 0.0001 mg / kg to 100 mg / kg, 0.001 mg / kg to 0.05 mg / kg, 0.005 mg / kg to 0.05 mg / kg, 0.001 mg / kg to 0.005 mg / kg, 0.05 mg / kg to 0.5 mg / kg, 0.01 mg / kg to 50 mg / kg, 0.1 mg / kg to 40 mg / kg, 0.5 mg / kg to 30 mg / kg, 0.01 mg / kg to 10 mg / kg, 0.1 mg / kg to 10 mg / kg, or 1 mg / kg to 25 mg / kg per kg of the subject's body weight per day, one or more times per day, one or more times per week, one or more times per month, etc., to obtain a desired therapeutic, diagnostic, prophylactic, or imaging effect (e.g., see the unit dosage ranges described in International Publication No. WO2013078199, which is hereby incorporated by reference in its entirety). The desired dosage can be delivered 3 times per day, 2 times per day, 1 time per day, once every 2 days, once every 3 days, weekly, every 2 weeks, every 3 weeks, every 4 weeks, every 2 months, every 3 months, every 6 months, etc. In certain embodiments, the desired dosage can be delivered using multiple administrations (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more administrations). When multiple administrations are employed, a divided dosing schedule such as those described herein may be used. In an exemplary embodiment, the RSV RNA (e.g., mRNA) vaccine composition can be administered at a dosage level sufficient to deliver from 0.0005 mg / kg to 0.01 mg / kg, e.g., from about 0.0005 mg / kg to about 0.0075 mg / kg, e.g., about 0.0005 mg / kg, about 0.001 mg / kg, about 0.002 mg / kg, about 0.003 mg / kg, about 0.004 mg / kg, or about 0.005 mg / kg.

[0406] In some embodiments, the RSV RNA (e.g., mRNA) vaccine composition can be administered one or two (or more) times at a dosage level sufficient to deliver from 0.025 mg / kg to 0.250 mg / kg, from 0.025 mg / kg to 0.500 mg / kg, from 0.025 mg / kg to 0.750 mg / kg, or from 0.025 mg / kg to 1.0 mg / kg.

[0407] In some embodiments, the RSV RNA (e.g., mRNA) vaccine composition can be administered two times (e.g., on day 0 and day 7, day 0 and day 14, day 0 and day 21, day 0 and day 28, day 0 and day 60, day 0 and day 90, day 0 and day 120, day 0 and day 150, day 0 and day 180, day 0 and 3 months later, day 0 and 6 months later, day 0 and 9 months later, day 0 and 12 months later, day 0 and 18 months later, day 0 and 2 years later, day 0 and 5 years later, or day 0 and 10 years later) at a total dosage of 0.0100 mg, 0.025 mg, 0.050 mg, 0.075 mg, 0.100 mg, 0.125 mg, 0.150 mg, 0.175 mg, 0.200 mg, 0.225 mg, 0.250 mg, 0.275 mg, 0.300 mg, 0.325 mg, 0.350 mg, 0.375 mg, 0.400 mg, 0.425 mg, 0.450 mg, 0.475 mg, 0.500 mg, 0.525 mg, 0.550 mg, 0.575 mg, 0.600 mg, 0.625 mg, 0.650 mg, 0.675 mg, 0.700 mg, 0.725 mg, 0.750 mg, 0.775 mg, 0.800 mg, 0.825 mg, 0.850 mg, 0.875 mg, 0.900 mg, 0.925 mg, 0.950 mg, 0.975 mg, or 1.0 mg or at a dosage level sufficient to deliver these total dosages. Higher and lower dosages as well as dosing frequencies are encompassed by the present disclosure. For example, the RSV RNA (e.g., mRNA) vaccine composition can be administered three or four times.

[0408] In some embodiments, the RSV RNA (e.g., mRNA) vaccine composition may be administered two times (e.g., on day 0 and day 7, day 0 and day 14, day 0 and day 21, day 0 and day 28, day 0 and day 60, day 0 and day 90, day 0 and day 120, day 0 and day 150, day 0 and day 180, day 0 and 3 months later, day 0 and 6 months later, day 0 and 9 months later, day 0 and 12 months later, day 0 and 18 months later, day 0 and 2 years later, day 0 and 5 years later, or day 0 and 10 years later) at a total dose of 0.010 mg, 0.025 mg, 0.100 mg or 0.400 mg or at a dose level sufficient to deliver these total doses.

[0409] In some embodiments, the RSV RNA (e.g., mRNA) vaccine used in a method of vaccinating a subject is administered to the subject in a single dose of nucleic acid vaccine in an amount effective for vaccination of the subject, wherein the single dose is from 10 μg / kg to 400 μg / kg. In some embodiments, the RNA vaccine used in a method of vaccinating a subject is administered to the subject in a single dose of nucleic acid vaccine in an amount effective for vaccination of the subject, wherein the single dose is from 10 μg to 400 μg. In some embodiments, the RSV RNA (e.g., mRNA) vaccine used in a method of vaccinating a subject is administered to the subject as a single dose of from 25 to 1000 μg (e.g., a single dose of mRNA encoding an RSV antigen). In some embodiments, the RSV RNA vaccine is administered to the subject as a single dose of 25, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or 1000 μg. For example, the RSV RNA vaccine can be administered to the subject as a single dose of from 25 to 100, from 25 to 500, from 50 to 100, from 50 to 500, from 50 to 1000, from 100 to 500, from 100 to 1000, from 250 to 500, from 250 to 1000 or from 500 to 1000 μg. In some embodiments, the RSV RNA (e.g., mRNA) vaccine used in a method of vaccinating a subject is administered to the subject as two doses, and the combination of those doses is equivalent to from 25 to 1000 μg of RSV RNA (e.g., mRNA) vaccine.

[0410] The RSV RNA (e.g., mRNA) vaccine pharmaceutical compositions described herein can be formulated into dosage forms described herein such as intranasal, intratracheal or injectable (e.g., intravenous, intraocular, intravitreal, intramuscular, intradermal, intracardiac, intraperitoneal and subcutaneous).

[0411] RSV RNA Vaccine Formulations and Methods of Use Some aspects of the present disclosure provide formulations of RSV RNA (e.g., mRNA) vaccines, wherein the RSV RNA vaccine is formulated in an amount effective to elicit an antigen-specific immune response (e.g., production of antibodies specific for an anti-RSV antigenic polypeptide) in a subject. An "effective amount" is an amount of RSV RNA (e.g., mRNA) vaccine effective to elicit an antigen-specific immune response. Also provided herein is a method of inducing an antigen-specific immune response in a subject.

[0412] In some embodiments, the antigen-specific immune response is characterized by measuring the titer of anti-RSV antigenic polypeptide antibodies produced in a subject administered the RSV RNA (e.g., mRNA) vaccine provided herein. Antibody titer is a measure of the amount of antibody in a subject, e.g., the amount of antibody specific for a particular antigen (e.g., an anti-RSV antigenic polypeptide) or an epitope of an antigen. Antibody titer is typically expressed as the reciprocal of the greatest dilution that gives a positive result. For example, enzyme-linked immunosorbent assay (ELISA) is a common assay for determining antibody titer.

[0413] In some embodiments, antibody titer is used to assess whether a subject is infected or to determine whether immunization is needed. In some embodiments, antibody titer is used to determine the strength of an autoimmune response, to determine whether a booster immunization is needed, to determine whether a previous vaccine was effective, and to identify any recent or previous infections. According to the present disclosure, antibody titer is used to determine the strength of the immune response induced in a subject by an RSV RNA (e.g., mRNA) vaccine.

[0414] In some embodiments, the titer of the anti-RSV antigenic polypeptide antibody produced in the subject increases by at least 1 log compared to a control (e.g., a control vaccine). For example, the titer of the anti-RSV antigenic polypeptide antibody produced in the subject may increase by at least 1.5, at least 2, at least 2.5, or at least 3 logs compared to a control (e.g., a control vaccine). In some embodiments, the titer of the anti-RSV antigenic polypeptide antibody produced in the subject increases by 1, 1.5, 2, 2.5, or 3 logs compared to a control (e.g., a control vaccine). In some embodiments, the titer of the anti-RSV antigenic polypeptide antibody produced in the subject increases by 1 to 3 logs compared to a control (e.g., a control vaccine). For example, the titer of the anti-RSV antigenic polypeptide antibody produced in the subject may increase by 1 to 1.5, 1 to 2, 1 to 2.5, 1 to 3, 1.5 to 2, 1.5 to 2.5, 1.5 to 3, 2 to 2.5, 2 to 3, or 2.5 to 3 logs compared to a control (e.g., a control vaccine).

[0415] In some embodiments, the titer of the anti-RSV antigenic polypeptide antibody produced in the subject increases by at least 2-fold compared to a control (e.g., a control vaccine). For example, the titer of the anti-RSV antigenic polypeptide antibody produced in the subject can increase by at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold or at least 10-fold compared to a control (e.g., a control vaccine). In some embodiments, the titer of the anti-RSV antigenic polypeptide antibody produced in the subject increases by 2, 3, 4, 5, 6, 7, 8, 9 or 10-fold compared to a control (e.g., a control vaccine). In some embodiments, the titer of the anti-RSV antigenic polypeptide antibody produced in the subject increases by 2- to 10-fold compared to a control (e.g., a control vaccine). For example, the titer of the anti-RSV antigenic polypeptide antibody produced in the subject can increase by 2- to 10, 2- to 9, 2- to 8, 2- to 7, 2- to 6, 2- to 5, 2- to 4, 2- to 3, 3- to 10, 3- to 9, 3- to 8, 3- to 7, 3- to 6, 3- to 5, 3- to 4, 4- to 10, 4- to 9, 4- to 8, 4- to 7, 4- to 6, 4- to 5, 5- to 10, 5- to 9, 5- to 8, 5- to 7, 5- to 6, 6- to 10, 6- to 9, 6- to 8, 6- to 7, 7- to 10, 7- to 9, 7- to 8, 8- to 10, 8- to 9 or 9- to 10-fold compared to a control (e.g., a control vaccine).

[0416] The control is, in some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has not received an RSV RNA (e.g., mRNA) vaccine. In some embodiments, the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has received an attenuated live RSV vaccine. An attenuated vaccine is a viable (living) vaccine produced by reducing its toxicity. The attenuated virus is modified to be harmless or less toxic compared to the unmodified live virus. In some embodiments, the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has received an inactivated RSV vaccine. In some embodiments, the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has received a recombinant or purified RSV protein vaccine. A recombinant protein vaccine typically contains either a protein antigen produced in a heterologous expression system (e.g., bacteria or yeast) or a protein antigen purified from a large amount of pathogenic organisms. In some embodiments, the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has received an RSV virus-like particle (VLP) vaccine (e.g., particles that contain viral capsid proteins but do not contain the viral genome and thus cannot replicate / produce progeny virus). In some embodiments, the control is a VLP RSV vaccine that contains the pre-fusion or post-fusion F protein or a combination of the two.

[0417] In some embodiments, the effective amount of the RSV RNA (e.g., mRNA) vaccine is a lower dose compared to the standard therapeutic dose of a recombinant RSV protein vaccine. As used herein, "standard of care" refers to medical or psychological treatment guidelines, which may be general or specific. "Standard of care" defines appropriate treatment based on scientific evidence and collaboration among medical experts involved in the treatment of a given condition. It is the diagnostic and treatment process that a physician / clinician should follow for a particular type of patient, disease, or clinical setting. When described herein, "standard therapeutic dose" is the dose of a recombinant or purified RSV protein vaccine, or a live attenuated RSV vaccine or an inactivated RSV vaccine, or an RSV VLP vaccine that a physician / clinician or other medical expert would administer to a subject to treat or prevent RSV or an RSV-related condition while following the standard of care guidelines for treating or preventing RSV or an RSV-related condition.

[0418] In some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject administered an effective amount of the RSV RNA vaccine is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered the standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live attenuated RSV vaccin...

Claims

1. A respiratory syncytial virus (RSV) vaccine formulated in lipid nanoparticles comprising 20-60 mol% cationic lipid, 5-25 mol% non-cationic lipid, 25-55 mol% sterol, and 0.5-15 mol% PEG-modified lipid, and containing a messenger ribonucleic acid (mRNA) polynucleotide having an open reading frame encoding the pre-fusion glycoprotein F of RSV, wherein the pre-fusion glycoprotein F of RSV comprises an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 291, and compared to the wild-type human RSV glycoprotein F having the amino acid sequence of SEQ ID NO: 3, comprises the S155C, S290C, S190F, and V207L substitutions, and the open reading frame comprises nucleosides consisting of N1-methyl-pseudouridine, adenosine, guanosine, and cytidine.

2. The RSV vaccine according to claim 1, wherein the cationic lipid is an ionic cationic lipid, the non-cationic lipid is a neutral lipid, and the sterol is cholesterol.

3. The RSV vaccine according to claim 1 or 2 for use in a method of inducing an antigen-specific immune response in a subject, the method comprising administering the RSV vaccine in an amount effective to elicit an antigen-specific immune response.

4. The RSV vaccine according to claim 3, wherein the antigen-specific immune response comprises a T cell response or a B cell response.

5. The RSV vaccine according to claim 3 or 4, wherein the method comprises a single administration of the RSV vaccine or administration of a booster dose of the vaccine.

6. The RSV vaccine according to any one of claims 3 to 5, wherein the vaccine is administered by intradermal injection or intramuscular injection.

7. The RSV vaccine according to any one of claims 3 to 6, wherein the effective amount is a total dose of 25-100 μg.

8. The RSV vaccine according to claim 1 or 2, wherein the pre-fusion glycoprotein F of RSV comprises an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 8.

Images