Methods for regulating human L1 retrotransposon RNA and compositions for use therewith

Abstract

Compositions and methods are provided for upregulating L1 RNA activity in a subject in need thereof. The compositions comprise a nucleic acid encoding L1 RNA, or L1 RNA alone or contained in an expression vector and / or further contained in osteogenic progenitor cells, such as mesenchymal stem cells, genetically engineered to express L1 RNA. In this embodiment, the compositions are used to increase L1 RNA levels, such as L1 RNA copy number, in a subject in need of increasing bone mass index. In a preferred embodiment, the osteoprogenitor cells are autologous cells. Also provided are compositions and methods for downregulating L1 RNA levels / activity in a subject in need thereof. The compositions comprise one or more agents in an amount effective to knock down L1 RNA in cells. The compositions can be used to treat conditions associated with aging. A preferred agent is an L1 RNA antisense oligonucleotide.

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims priority to U.S. Patent Application No. 62 / 916,096, filed on October 16, 2019, and U.S. Patent Application No. 62 / 945,535, filed on December 9, 2019, the disclosures of which are hereby incorporated by reference in their entirety.

[0002] The present invention generally relates to methods for modulating human L1 retrotransposon RNA activity in subjects in need thereof, and compositions for use therewith.

Background Art

[0003] Long interspersed nuclear elements (LINEs) are a group of non-LTR (long terminal repeat) retrotransposons that are widespread in the genomes of many eukaryotes. LINEs constitute a family of transposons, each about 7,000 base pairs in length. LINEs are transcribed into mRNA and translated into proteins that function as reverse transcriptases. The reverse transcriptase creates a DNA copy of the LINE RNA that can be integrated into the genome at a new site. The only abundant LINE in humans is LINE-1. L1 occupies approximately 21% of the human genome (Lander, et al. Nature (2001), doi:10.1038 / 35057062), but only a few dozen belonging to the L1HS (L1 human-specific) Ta (transcribed, subset a) subfamily still retain the ability to retrotranspose autonomously via an ORF2-dependent RNA-mediated "copy and paste" mechanism (Fent, et al. Cell (1996), doi:10.1016 / S0092-8674(00)81997-2, Luan, et al., Cell (1993), doi:10.1016 / 0092-8674(93)90078-5, Cost, et al. EMBO J. (2002), doi:10.1093 / emboj / cdf592) (Sassaman, et al. Nat. Genet. (1997), doi:10.1038 / ng0597-37, Brouha, et al. Proc. Natl. Acad. Sci. (2003), doi:10.1073 / pnas.0831042100).Cells have evolved several defense mechanisms to prevent harmful, uncontrolled translocations (Kazazian, et al. N. Engl. J. Med. (2017), doi:10.1056 / NEJMra1510092), but evidence indicates that somatic L1 mobilization occurs in the developing brain and contributes to individual somatic mosaicism (Coufal, et al. Nature (2009), doi:10.1038 / nature08248, Muotri, et al. Hippocampus (2009), doi:10.1002 / hipo.20564, Baillie, et al. Nature (2011), doi:10.1038 / nature10531, Evrony, et al. Cell (2012), doi:10.1016 / j.cell.2012.09.035), and its function remains unknown. Interestingly, in mice, L1 reactivation in the brain correlates with exposure to juvenile stress states (Bedrosian, et al. Science 359(6382):1395-1399(2018), doi:10.1126 / science.aah3378). However, whether L1 mobilization is supported by other tissues and whether L1 expansion can contribute to tissue homeostasis is largely unexplored.

Prior Art Documents

Non-Patent Documents

[0004]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

[0005] It is an object of the present invention to provide a composition and a method for regulating L1 in a subject that requires regulation of L1. [Summary of the Invention]

[0006] One embodiment provides compositions and methods for upregulating L1 RNA activity in a subject in need thereof. The L1 is preferably of the L1HS-Ta1 family. The composition comprises a nucleic acid encoding L1 RNA or L1 RNA, alone or contained in an expression vector. The NA is preferably in a pharmaceutically acceptable carrier for the subject, or it can be incorporated by genetically engineering progenitor cells, such as mesenchymal stem cells, derived from bone marrow to express L1 RNA, and suspending the L1 RNA-expressing cells in a pharmaceutically acceptable carrier. In this aspect, the composition is used to increase the level of L1 RNA, such as the L1 RNA copy number, in a subject in need of increasing the bone mass index. Exemplary subjects include postmenopausal women, subjects diagnosed with or at risk of developing osteoporosis, and subjects undergoing retroviral therapy, such as NRT1. The method comprises administering a nucleic acid (NA) encoding L1 RNA or L1 RNA to a subject in need thereof. The NA can be administered to the subject in a pharmaceutically acceptable carrier, or it can be administered in the form of bone marrow-derived bone-forming progenitor cells, such as mesenchymal stem cells, genetically engineered to express L1 RNA, in a pharmaceutically acceptable carrier. In a preferred embodiment, the bone progenitor cells are autologous cells.

[0007] Another embodiment provides compositions and methods for downregulating L1 RNA level / activity in a subject in need thereof. Preferred agents are L1 RNA antisense oligonucleotides, and particularly preferred are fluoroarabino nucleic acid (FANA) modified antisense oligonucleotides. The composition includes a formulation containing one or more agents for depleting L1 RNA. In a preferred embodiment, the method includes downregulating L1 RNA level / activity in cells in a subject, such as fibroblasts, preferably dermal fibroblasts. The method in a preferred embodiment includes administering one or more agents in an effective amount to knockdown L1 RNA in cells in a subject, such as dermal fibroblasts. The compositions can be used to treat aging and conditions associated with accelerated aging, including, but not limited to, progeria syndrome and wrinkles. Brief Description of the Drawings

[0008]

Figure 1A

Figure 1B

Figure 1C

Figure 1D

Figure 1E

Figure 1F

Figure 1G

Figure 1H

Figure 2A

Figure 2B

Figure 2C

Figure 2D

Figure 2E

Figure 2F

Figure 2G

Figure 2H

Figure 3A

Figure 3B

Figure 3C

Figure 3D

Figure 3E

Figure 4A

Figure 4B

Figure 4C

Figure 4D

Figure 4E

Figure 4F

Figure 5A

Figure 5B

Figure 5C

Figure 5D

Figure 6A

Figure 6B

Figure 6C

Figure 6D

Figure 6E

Figure 6F

Figure 6G

Figure 7A

Figure 7B

Figure 7C

Figure 8A

Figure 8B

Figure 8C

Figure 8D

Figure 8E

Figure 8F

Figure 8G

Figure 9A

Figure 9B

Figure 10

Figure 11A

Figure 11B

Figure 11C

Figure 11D

Figure 11E

Figure 11F

Figure 12A

Figure 12B

Figure 12C

Figure 12D

Figure 13A-1

Figure 13A-2

Figure 13A-3

Figure 13B

Figure 13C

Figure 13D

Figure 13E

Figure 14A

Figure 14B

Figure 14C

Figure 14D

Figure 14E

Figure 14F

Mode for Carrying Out the Invention

[0009] The disclosed compositions and methods are based on the discovery that L1 mobilization is supported by other tissues, and little is known about whether L1 expansion can contribute to tissue homeostasis. A typical L1 element is about 6,000 base pairs long and consists of two non-overlapping open reading frames (ORFs) adjacent to the untranslated region (UTR) and target site duplications. L1 has a 5' untranslated region (UTR), followed by open reading frame 1 (ORF1), an inter-ORF region, open reading frame 2 (ORF2), and a 3' UTR with a polyA site and associated polyA tail. In humans, ORF2 is thought to be translated by an atypical termination / restart mechanism. The 5' untranslated region (UTR) of the L1 element contains, in a sense, a strong internal RNA polymerase II transcription promoter. L1 transcription produces a full-length mRNA that produces two proteins, ORF1p and ORF2p. The first ORF encodes a 500 amino acid - 40 kDa protein that lacks homology to any protein of known function. The second ORF of L1 encodes a protein with endonuclease and reverse transcriptase activities.

[0010] The disclosed compositions and methods modulate the cellular levels of L1 that, in certain embodiments, belong to the L1HS (L1 human-specific) Ta (transcribed, subset a) subfamily. The Ta (transcribed, subset a) subfamily of L1 LINE (long interspersed element) is characterized by a 3bp ACA sequence in the 3' untranslated region and contains approximately 520 members in the human genome.

[0011] I. Definitions As used herein, "cosmetic composition" refers to a composition for topical application to the skin or hair of a mammal, particularly a human. Such compositions can generally be classified as leave-on or rinse-off and include any product applied to the human body to improve appearance or general aesthetics.

[0012] As used herein, "vector" refers to a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment can be inserted to effect replication of the inserted segment. The vectors described herein can be expression vectors.

[0013] As used herein, "expression vector" refers to a vector that contains one or more expression control sequences.

[0014] As used herein, "expression control sequence" refers to a DNA sequence that controls and regulates the transcription and / or translation of another DNA sequence.

[0015] As used herein, the term "pharmaceutically acceptable carrier" includes any of the standard pharmaceutical carriers, such as phosphate buffered saline, water, and emulsions, such as oil / water or water / oil emulsions, and various types of wetting agents.

[0016] As used herein, the term "treating" includes alleviating symptoms associated with a particular disorder or condition and / or preventing or eliminating the symptoms.

[0017] "Operably linked" refers to an arrangement of components configured so that they perform their normal functions. For example, a control sequence or promoter operably linked to a coding sequence can affect the expression of the coding sequence, and an organelle localization sequence operably linked to a protein can localize the linked protein to a particular organelle.

[0018] As used herein, the term "host cell" refers to a cell into which a recombinant vector can be introduced.

[0019] As used herein, "transformed" and "transfected" include the introduction of nucleic acid (e.g., a vector) into a cell by several techniques known in the art.

[0020] When applied to the nanoparticles, therapeutic agents, and pharmaceutical compositions described herein, the terms "effective amount" and "therapeutically effective amount" are used interchangeably and mean the amount necessary to produce the desired therapeutic result. For example, an effective amount is a level effective to treat, cure, or alleviate the symptoms of a disease to which the composition and / or therapeutic agent, or pharmaceutical composition, is administered.

[0021] The terms "inhibit" and "reduce" mean to decrease or lower activity or expression. This can be a complete or partial inhibition or reduction of activity or expression. Inhibition or reduction can be compared to a control or standard level. Inhibition can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%.

[0022] II. Compositions and Methods for Increasing L1 RNA in a Subject The disclosed compositions and methods are based on the discovery that reduced L1 RNA expression in human bone marrow mesenchymal stem cells (hBMSCs) that differentiate into bone cells results in reduced translocation and strongly impairs the ability of cells to generate mineralized bone matrix. Increasing the amount of L1 RNA (preferably L1HS-Ta1 in humans) in mesenchymal cells of subjects such as postmenopausal women counteracts bone loss and thus reduces symptoms associated with osteoporosis. L1-driven structural variations are strongly correlated with bone mass and specifically distinguish the bone genome and bone mass of healthy versus osteoporotic postmenopausal women. In vitro cell culture experiments have shown that 1) L1 genomic expansion positively contributes to bone formation in developmental osteoblasts developed from MSCs, 2) disrupted L1 retrotranslocation in developmental osteoblasts results in lack of activation of the bone formation program and reduced mineralization, and 3) mobilization of L1 does not occur during adipocyte differentiation from MSCs, which are the accumulating cell type in osteoporosis patients, and is therefore specific to bone formation. This study also shows that even moderate depletion of L1 RNA in differentiating osteoblasts is sufficient to induce a significant decrease in the expression of osteoblast-related transcription factors.

[0023] Furthermore, ORF2, which is encoded by active L1 and is an enzyme required for L1 translocation, is an off-target of nucleoside reverse transcriptase inhibitors (NRTIs) used in antiretroviral therapy. A significant decrease in bone mineral density leading to osteoporosis is a major complication in patients treated with NRTIs. The compositions and methods disclosed in some embodiments are based on the discovery that NRTI treatment of HBMSCs that differentiate into bone cells prevents L1 retrotranslocation and results in reduced mineralization of bone.

[0024] Accordingly, one embodiment discloses a method for increasing L1 RNA in bone progenitor cells in a subject in need thereof. Exemplary subjects include patients having osteoporosis or a condition in need of an increase in bone remodeling / bone mass index. A second embodiment discloses a composition for increasing L1 RNA in bone progenitor cells in a subject in need thereof. The composition includes a nucleic acid surrounding the L1 RNA, the L1 RNA, and optionally, a small molecule known to upregulate L1 retrotransposition.

[0025] A. Osteoporosis and Conditions Requiring an Increase in Bone Mass Index Primary osteoporosis is a skeletal disorder that reduces bone density and disrupts its microstructure, making bones prone to low-impact fractures. The skeleton has a strong genetic predisposition since 70 - 80% of BMD is hereditary (1)(2). Primary osteoporosis has a multifactorial origin involving both genes and environment (3). In osteoporosis, the MSC pool in the bone marrow niche promotes the development of adipocytes at the expense of osteoblasts that build bone. This mechanism, alone or together with an increased bone resorption rate, results in net bone loss (4)(5). Osteoporosis is a major cause of morbidity, mortality, and reduced quality of life worldwide (6) and contributes to over 8.9 million fractures annually (7). A significant reduction in BMD, increased skeletal fragility, and fracture risk are also important clinical problems for individuals of all ages infected with the human immunodeficiency virus (HIV) under NRTI-based ART.

[0026] Bone is constantly changing - that is, old bone is removed and replaced with new bone. During childhood, more bone is produced than removed, so the skeleton grows in both size and strength. For most people, bone mass peaks in their 20s. By this age, men usually have accumulated more bone mass than women. After this point, the amount of bone within the skeleton typically begins to slowly decrease as the removal of old bone exceeds the formation of new bone.

[0027] Men in their 50s do not experience the rapid bone mass loss that women experience in the years following menopause. However, by age 65 or 70, men and women lose bone mass at the same rate, and calcium absorption, an essential nutrient for bone health throughout life, decreases in both men and women. Excessive bone loss makes bones more brittle and increases the likelihood of fractures. Osteoporosis mainly has two types: primary and secondary. In cases of primary osteoporosis, the condition is either caused by age-related bone loss (sometimes called senile osteoporosis) or the cause is unknown (idiopathic osteoporosis). The term idiopathic osteoporosis is typically used only for men under 70 years old, and in older men, age-related bone loss is assumed to be the cause. Most men with osteoporosis have at least one (and sometimes more than one) secondary cause. In cases of secondary osteoporosis, bone mass loss is caused by specific lifestyle behaviors, diseases, or medications. Some of the most common causes of secondary osteoporosis in men include exposure to glucocorticoid drugs, hypogonadism (low levels of testosterone), alcohol abuse, smoking, gastrointestinal diseases, hypercalciuria, and immobilization.

[0028] Other conditions in which an intervention method for increasing bone mass index may be useful include spinal fusion therapy, in which an autograft or bone graft is delivered, alone or in combination with cells, to a spinal fusion site (typically the site between two vertebrae) to treat conditions such as degenerative disc disease, spondylolisthesis, spinal stenosis, scoliosis, fractured vertebrae, infections, intervertebral disc herniation, and tumors. The intervention is aimed at promoting bone growth and the ultimate fixation between the vertebrae where the spinal fusion therapy is inserted. The compositions disclosed in this application can improve bone growth at the site in combination with standard spinal fusion therapy. The disclosed compositions can also be used as an adjuvant therapy for fracture healing, especially in the elderly.

[0029] A method for increasing L1 RNA in a subject that requires an increase in B.L1 RNA In one embodiment, the method disclosed comprises providing to a subject in need thereof osteoprogenitor cells, such as bone-forming bone marrow-derived cells that have been genetically engineered ex vivo to upregulate L1 RNA, or gene therapy that increases the amount of L1 in cells. In other embodiments, the method comprises providing L1 RNA or a gene encoding L1 RNA to a subject in need thereof, either alone or in combination with providing the genetically engineered bone-forming bone marrow-derived cells disclosed herein.

[0030] L1 RNA can be synthesized in vitro and then introduced into cells of interest either in vitro or in vivo, or host cells can be engineered to induce expression of L1 RNA from the L1 gene under specific conditions. One approach involves nucleic acid transfer into primary cells in culture, followed by transplantation (preferably autologous) of the transformed cells ex vivo into the host, either systemically or to a specific organ or tissue. Exemplary subjects include postmenopausal women, subjects diagnosed with osteoporosis, and subjects receiving antiretroviral therapy, such as NRT1.

[0031] In one embodiment, the disclosed composition contains the sequence of human L1 RNA (L1-Ta subfamily), either alone or in a vector, which has been transferred into primary cells.

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

[0032] However, the composition can contain a fragment of L1 RNA, e.g., L1 open reading frame 1 (ORF1), alone or preceded by a 5' untranslated region (UTR), or can include open reading frame 2 (ORF2). The ORF2 expression construct is disclosed, for example, in Gasior, et al., J. Mol. Biol., 357(5):1383-1393(2006).

[0033] i. Ex vivo method The ex vivo method can include, for example, the steps of collecting cells from a subject, culturing the cells, transducing them with a DNA encoding L1 RNA or an expression vector containing L1 RNA, and maintaining the cells under conditions suitable for the expression of the encoded RNA. These methods are known in the field of molecular biology. In a preferred embodiment, the cells are autologous to the subject being treated. A preferred host cell is hBMSC. Methods for isolating hBMSC are known in the art (Baghaevi, et al. Gastroenterol, Hepatol Bed Bench, 10(3):208-2013(2017).

[0034] 1. Vector Vectors encoding L1 RNA are also provided. Nucleic acids such as those described above can be inserted into a vector for expression in cells. As used herein, a "vector" is a replicon, such as a plasmid, phage, virus, or cosmid, into which another DNA segment can be inserted to effect replication of the inserted segment. The vector can be an expression vector. An "expression vector" is a vector that contains one or more expression control sequences, and an "expression control sequence" is a DNA sequence that controls and regulates the transcription and / or translation of another DNA sequence.

[0035] The nucleic acid in the vector can be operably linked to one or more expression control sequences. For example, the control sequences can be incorporated into a gene construct such that the expression control sequences effectively control the expression of the coding sequence of interest. Examples of expression control sequences include promoters, enhancers, and transcription termination regions. A promoter is an expression control sequence consisting of a region of a DNA molecule and is typically located within 100 nucleotides upstream of the point where transcription begins (generally near the start site of RNA polymerase II). To place a coding sequence under the control of a promoter, it is necessary to position the translation start site of the polypeptide's translation reading frame between 1 nucleotide and about 50 nucleotides downstream of the promoter. Hamann, et al., J. Biol. Eng., 13:7 (2019) demonstrated that gene expression in hBMSCs driven by the cytomegalovirus (CMV) promoter resulted in a 10-fold higher transgene expression than transfection with plasmids containing the elongation factor 1α (EF1α) or Rous sarcoma virus (RSV) promoter.

[0036] Enhancers provide expression specificity with respect to time, position, and level. Unlike promoters, enhancers can function when located at various distances from the transcription site. Enhancers can also be located downstream of the transcription start site. A coding sequence is "operably linked" to and under the "control" of an expression control sequence within a cell if RNA polymerase can transcribe the coding sequence into mRNA and then translate it into the protein encoded by the coding sequence.

[0037] Suitable expression vectors include plasmids and viral vectors derived from, for example, bacteriophages, baculoviruses, tobacco mosaic viruses, herpesviruses, cytomegaloviruses, retroviruses, vaccinia viruses, adenoviruses, and adeno-associated viruses, but are not limited thereto. A number of vectors and expression systems are commercially available from companies such as Novagen (Madison, WI), Clontech (Palo Alto, CA), Stratagene (La Jolla, CA), and Invitrogen Life Technologies (Carlsbad, CA). In recent transfection studies, minicircle DNA (mcDNA), a nucleic acid derived from pDNA by recombination to remove bacterial sequences, has been investigated. L1 RNA can be introduced into host cells using mcDNA by methods known in the art (Mun et al. Biomaterials, 2016, 101: 310-320).

[0038] 2. Host cell transformation A vector containing the nucleic acid to be expressed can be transferred into a host cell. The term "host cell" is intended to include osteoprogenitor cells into which a recombinant expression vector can be introduced. As used herein, "transformed" and "transfected" include the introduction of a nucleic acid molecule (e.g., a vector) into a cell by one of several techniques. Without being limited to a particular technique, some of these techniques are well established in the art. Nucleic acids can be transfected into mammalian cells by techniques including, for example, calcium phosphate coprecipitation, DEAE-dextran-mediated transfection, lipofection, electroporation, or microinjection. Preferred host cells include osteoprogenitor cells such as HBMSCs or osteoblasts.

[0039] The transduction step can be achieved by any standard means used in ex vivo gene therapy, including, for example, calcium phosphate, lipofection, electroporation, viral infection, and gene gun introduction. Alternatively, liposomes or polymeric microparticles can be used. Cells that have been successfully transduced can then be selected, for example, for the expression of a coding sequence or a drug resistance gene. The cells can then be lethally irradiated (if desired) and injected or implanted into a subject.

[0040] Effective strategies in non-viral transfection of MSCs ex vivo typically involve using cell membrane disruption to transfer nucleic acids into cells (e.g., microinjection, electroporation, and microporation) or packaging nucleic acids with nanocarrier materials that promote intracellular trafficking via endocytosis.

[0041] The main alternative to electroporation for nucleic acid transfer into MSCs ex vivo is transfection with nanocarriers, which are materials that electrostatically condense or encapsulate nucleic acids into nanoparticles or aggregated complexes that favorably associate with the cell membrane through charge interactions or surface receptor binding, followed by internalization mainly via macropinocytosis, clathrin-mediated endocytosis, or caveolae-mediated endocytosis, depending mainly on the nanoparticle size and charge. Carriers include, but are not limited to, polymers, lipids, polysaccharides, peptides, and inorganic materials, and have been demonstrated to facilitate the transfection of MSCs. Examples include, but are not limited to, nano-hydroxyapatite (nHA), the ubiquitous cationic polymer transfection reagent 25 kDa branched polyethyleneimine (bPEI) functionalized preferably with hyaluronic acid, and the repetitive arginine-alanine-leucine-alanine (RALA) amphiphilic peptide, poly(amidoamine) (PAMAM), poly(β-amino-ester) (PBAE), PEI-coated PLGA nanoparticles, etc., as reviewed in Hamann, et al., J. Biol. Eng., 13:7 (2019).

[0042] Using cell culture conditions that improve transfection efficiency can ensure efficient uptake of nucleic acids introduced into cells. For example, glucocorticoid (Gc) can dramatically enhance ex vivo transfection in MSCs. 100 nM Gc dexamethasone (DEX) delivered 0 - 30 minutes prior to transfection has been shown to increase transgene expression in hBMSCs.

[0043] The transformed bone progenitor cells are preferably isolated, cultured under GMP conditions, and obtained by purifying within an established dosage range.

[0044] ii. In vivo method The in vivo method includes introducing the engineered bone progenitor cells disclosed herein into a subject in need thereof, or directly transferring L1 RNA or DNA encoding L1 RNA into a subject in need thereof. The disclosed method can also include administering to the subject small molecules and compounds known to upregulate L1 RNA transcription and retrotransposition. For example, agents such as benzo[a]pyrene, camptothecin, cytochalasin D, mevalonate, and vinblastine, PPARα agonists (bezafibrate and fenofibrate), and non-steroidal anti-inflammatory drugs (diflunisal, flufenamic acid, salicylamide, and sulindac) have been shown to induce L1 promoter activity (Terasaki, et al., PLoS One. 2013;8(9):e74629).

[0045] Cells (genetically engineered to contain a vector containing L1 RNA or DNA encoding L1 RNA) can be introduced into a subject using methods known in the art, for example, by intravenous injection. Autologous transformed BMSCs can be injected intravenously at a dosage range of 2 million to 5 million cells / kg. In embodiments where the cells are delivered intravenously, on the day of injection, the transformed cells are resuspended in saline at a concentration of 5 million cells / mL and preferably fucosylated. The final product can then be packaged in a syringe for intravenous administration to the patient via a peripheral venous access. Methods for improving the homing of hBMSCs to the bone marrow using fucosyltransferase are known in the art. Basically, an exogenously introduced fucosyltransferase is used to convert CD44 expressed by MSCs into HCELL (hematopoietic cell E- / L-selectin ligand), a potent E-selectin ligand essential for HSC homing to the bone marrow. Basically, an exogenously introduced fucosyltransferase is used to convert CD44 expressed by MSCs into HCELL (hematopoietic cell E- / L-selectin ligand), a potent E-selectin ligand essential for HSC homing to the bone marrow (Krueger, et al., Stem Cells Translational Med., 7:651-663 (reviewed in 2018)).

[0046] In vivo gene therapy can be used, by which the gene material is directly transferred to the patient. In these embodiments, the gene material is introduced into the patient by a virus-derived vector or non-viral technology. In vivo nucleic acid therapy can be achieved by functionally active DNA being directly transferred in vivo to mammalian somatic tissue or organs. The nucleic acid can be administered in vivo by viral means. The therapeutic gene expression cassette typically consists of a promoter that drives gene transcription, a transgene of interest, and a termination signal that terminates gene transcription. Such an expression cassette can be embedded in a plasmid (circular double-stranded DNA molecule) as a delivery vehicle. Plasmid DNA (pDNA) can be directly injected in vivo by various injection techniques, among which hydrodynamic injection achieves the maximum gene transfer efficiency in major organs by rapidly injecting a large amount of pDNA solution and temporarily inducing pores in the cell membrane. To assist the negatively charged pDNA molecules in penetrating the hydrophobic cell membrane, chemical materials containing cationic lipids and cationic polymers are used to condense pDNA into lipoplexes and polyplexes, respectively.

[0047] As is well known in the art, L1 RNA or a nucleic acid molecule encoding L1 RNA can be packaged into a retroviral vector using a packaging cell line that generates replication-defective retroviruses. Other viral vectors, including recombinant adenoviruses and vaccinia viruses, can also be used and can be made non-replicating. Nucleic acids can also be delivered by other carriers, including liposomes, polymeric microparticles and nanoparticles, and polycations such as asialoorosomucoid / polylysine. Various techniques and methods for in vivo gene delivery using the disclosed vectors and carriers are known in the art (reviewed in Wang, et al., Discov. Med., 18(97):67-77(2014)). A major advance in DNA vector design is minicircle DNA (mcDNA), which differs from pDNA in the absence of a CpG-rich backbone sequence of bacterial origin. When administered in vivo, mcDNA mediates safer, higher, and sustainable transgene expression than conventional pDNA.

[0048] III. Compositions and Methods for Reducing L1 RNA in a Subject The disclosed methods and applications rely on performing them in a subject in need of reducing the level of L1 RNA, a nucleic acid encoding LINE1 RNA, or an L1 RNA-encoded protein. The methods and applications are based on the discovery that a reduction in L1 RNA levels reduces markers of cellular senescence in fibroblasts and markers of skin health, such as the thickness of the epidermal layer.

[0049] Downregulation of L1 RNA expression can be used to treat age-related conditions such as Hutchinson-Gilford progeria syndrome. Hutchinson-Gilford progeria syndrome ("progeria" or "HGPS") is a rare and fatal genetic disorder characterized by an appearance of accelerated aging in children. Although appearing healthy at birth, children with progeria begin to exhibit many features of accelerated aging within the first two years of life. Symptoms of progeria include growth failure, loss of body fat and hair, aged-looking skin, joint stiffness, hip dislocation, systemic atherosclerotic cardiovascular (heart) disease, and stroke. Other progeroid syndromes include Werner syndrome, also known as "adult progeria" which does not manifest until the late teens. There is no cure for progeria, but occupational and physical therapy can help children continue to move if their joints become stiff. The disclosed compositions and methods can improve the symptoms of accelerated aging associated with progeria syndrome. The following examples show that depletion of L1 RNA in cells obtained from an HGPS mouse model (LAKI) using antisense oligonucleotides (AONs) restored the levels of epigenetic marks, decreased the expression of aging-related genes, and increased lifespan.

[0050] Downregulation of L1 RNA expression can also be found in applications in cosmetic compositions. In some embodiments, the cosmetic composition can be used topically or subcutaneously to treat signs of aging. These signs include the formation of fine lines and wrinkles, insufficient skin firmness, decreased skin luster, lack of skin smoothness, loss of skin elasticity, formation of age spots, blemishes, poor complexion, uneven pigmentation, and combinations thereof. The composition is, in some embodiments, effective to improve the thickness of the epidermal layer.

[0051] A. Downregulation / Inhibition of L1 RNA L1 RNA can be downregulated by treating cells to downregulate the L1 RNA level. This step includes contacting the cells with one or more agents that inhibit L1 RNA. Agents that inhibit L1 RNA as used herein include, but are not limited to, agents that reduce the retrotransposition of L1 RNA in cells and agents that inhibit any of the activities of proteins expressed by L1 RNA. The L1 RNA inhibitor can be a nucleic acid, a peptide (e.g., a peptide aptamer), or a small molecule.

[0052] Compounds that have been shown to inhibit LINE1 retrotransposition include, but are not limited to, capsaicin (Nishikawa, et al. Int J Mol Sci. 2018 Oct;19(10):3243), as well as three selective LINE1 reverse transcriptase inhibitors, GBS-149, emtricitabine, and lamivudine, as published in Banuelos-Sanchez, et al., Cell Chem. Biol. 26(8):P1095-1109(2019).

[0053] L1 RNA can be inhibited using a functional nucleic acid (herein referred to as L1 RNA-inhibiting NA) that downregulates the expression of L1ORF1, L1-ORF2, or a combination thereof, or a vector encoding the same. Examples include, but are not limited to, antisense oligonucleotides, siRNA, shRNA, miRNA, EGS, ribozymes, and aptamers (nucleic acid and peptide aptamers). In a particularly preferred embodiment, L1 RNA is downregulated in a subject in need thereof using an antisense oligonucleotide, e.g., a fluoroarabino nucleic acid (FANA)-modified antisense oligonucleotide (ASO) specific for the L1-ORF1 RNA sequence, and the L1 RNA-inhibiting ASO (or a vector expressing the same) can be formulated and administered to a subject in need thereof as described herein.

[0054] i.RNA interference In some embodiments, L1 RNA expression is inhibited through RNA interference (RNAi). This silencing was first observed upon addition of double-stranded RNA (dsRNA) (Fire, et al. (1998) Nature, 391:806-11, Napoli, et al. (1990) Plant Cell 2:279-89, Hannon, (2002) Nature, 418:244-51). When dsRNA enters the cell, it is cleaved by Dicer, an RNase III-like enzyme, into short interfering double-stranded RNAs (siRNAs) that are 21-23 nucleotides in length and contain two nucleotide overhangs at the 3' end (Elbashir, et al. (2001) Genes Dev., 15:188-200, Bernstein, et al. (2001) Nature, 409:363-6, Hammond, et al. (2000) Nature, 404:293-6). In an ATP-dependent step, the siRNAs generally become incorporated into a multi-subunit protein complex known as the RNAi-induced silencing complex (RISC), which guides the siRNAs to the target RNA sequence (Nykanen, et al. (2001) Cell, 107:309-21). At some point, the siRNA duplex is unwound and the antisense strand remains bound to RISC and appears to direct the degradation of the complementary mRNA sequence by a combination of endonucleases and exonucleases (Martinez, et al. (2002) Cell, 110:563-74). However, the effects of RNAi or siRNAs or their use are not limited to any type of mechanism.

[0055] Short interfering RNA (siRNA) is a double-stranded RNA that can induce sequence-specific post-transcriptional gene silencing, thereby reducing or even inhibiting gene expression. In one example, siRNA causes specific degradation of homologous RNA molecules such as mRNA within the region of sequence identity between both the siRNA and the target RNA. For example, WO02 / 44321 discloses siRNAs that are capable of sequence-specific degradation of target mRNA when base paired with 3' overhang ends, and methods for making these siRNAs are incorporated herein by reference.

[0056] Sequence-specific gene silencing can be achieved in mammalian cells using synthetic short double-stranded RNAs that mimic siRNAs generated by the enzyme Dicer (Elbashir, et al. (2001) Nature, 411:494-498) (Ui-Tei, et al. (2000) FEBS Lett 479:79-82). siRNAs can be chemically or in vitro synthesized or can be the result of short double-stranded hairpin-like RNAs (shRNAs) that are processed intracellularly into siRNAs. Synthetic siRNAs are generally designed using algorithms and conventional DNA / RNA synthesizers. Suppliers include Ambion (Austin, Texas), ChemGenes (Ashland, Massachusetts), Dharmacon (Lafayette, Colorado), Glen Research (Sterling, Virginia), MWB Biotech (Esbersberg, Germany), Proligo (Boulder, Colorado), and Qiagen (Vento, The Netherlands). siRNAs can also be synthesized in vitro using kits such as Ambion's SILENCER® siRNA Construction Kit.

[0057] The production of siRNA from vectors is more commonly carried out through the transcription of short hairpin RNA (shRNA). Kits for the production of vectors containing shRNA are available, for example, the GENESUPPRESSOR™ construction kit from Imgenex, as well as the BLOCK-IT™ Inducible RNAi Plasmid and Lentiviral Vector from Invitrogen.

[0058] ii. Antisense LI RNA can be inhibited using molecules that can be antisense molecules. Antisense molecules are designed to interact with the target nucleic acid molecule either through Watson-Crick base pairing or non-Watson-Crick base pairing. The interaction between the antisense molecule and the target molecule is designed to promote the destruction of the target molecule, for example, through RNase H-mediated RNA-DNA hybrid degradation. Alternatively, the antisense molecule is designed to interrupt processing functions that normally occur with the target molecule, such as transcription or replication. Antisense molecules can be designed based on the sequence of the target molecule. There are numerous methods for optimizing antisense efficiency by finding the most accessible regions of the target molecule. Exemplary methods include in vitro selection experiments as well as DNA modification tests using DMS and DEPC. Antisense molecules preferably bind to the target molecule with a dissociation constant (K -6 10 -8 10 -10 10 -12 or less. d )

[0059] An "antisense" nucleic acid sequence (antisense oligonucleotide) is complementary to the "sense" nucleic acid encoding a protein and can include, for example, a nucleotide sequence complementary to LI RNA. Antisense nucleic acid sequences and delivery methods are well known in the art (Goodchild, Curr. Opin. Mol. Ther., 6(2):120-128(2004), Clawson, et al., Gene Ther., 11(17):1331-1341(2004)). The antisense nucleic acid can be complementary to the entire coding strand of the target sequence or only to a portion thereof. Antisense oligonucleotides can be, for example, about 7, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or more nucleotides in length.

[0060] The ASO can be complementary to the full-length L1RNA, L1 5’UTR, L1RNA ORF1, L1 RNA ORF2, and / or L1 3’UTR. Exemplary antisense oligonucleotides are provided below.

[0061] Oligo against L1 5’UTR GTACCTCAGATGGAAATGCAG (SEQ ID NO: 57) ATGAACCCGGTACCTCAGATG (SEQ ID NO: 58) CCCTAGTGAGATGAACCCGGT (SEQ ID NO: 59) GTCTGGCACTCCCTAGTGAGA (SEQ ID NO: 60) TGCGCCCACTGTCTGGCACTC (SEQ ID NO: 61) CACACTGGCCTGCGCCCACTG (SEQ ID NO: 62) GGTGCGCACACACACTGGCCT (SEQ ID NO: 63) GCTCGCGCAAGGTGCGCACAC (SEQ ID NO: 64) CCCTGCTTCGGCTCGCGCAAG (SEQ ID NO: 65) CAATGCCTCGCCCTGCTTCGG (SEQ ID NO: 66) CCAGGTGAGGCAATGCCTCGC (SEQ ID NO: 67) CTTGCGCTTCCCAGGTGAGGC (SEQ ID NO: 68) TCCCTGACCCCTTGCGCTTCC (SEQ ID NO: 69) GAAAGGGAACTCCCTGACCCC (SEQ ID NO: 70) CTTTGACTCGGAAAGGGAACT (SEQ ID NO: 71) TCACCCCTTTCTTTGACTCGG (SEQ ID NO: 72) GGTGCGTCCGTCACCCCTTTC (SEQ ID NO: 73) CGATTTTCCAGGTGCGTCCGT (SEQ ID NO: 74) GGGAGTGACCCGATTTTCCAG (SEQ ID NO: 75) ATATTCGGGTGGGAGTGACCC (SEQ ID NO: 76) Oligo for L1 ORF1 CTTTGTTCTGTTGCTGGTGAG (SEQ ID NO: 77) CTCCATCCAGCTTTGTTCTGT (SEQ ID NO: 78) CAAAATCATTCTCCATCCAGC (SEQ ID NO: 79) CTCAGCTCGTCAAAATCATTC (SEQ ID NO: 80) GCCTTCTTCTCTCAGCTCGTC (SEQ ID NO: 81) ATCGTCTGAAGCCTTCTTCTC (SEQ ID NO: 82) GAGTAATTTGATCGTCTGAAG (SEQ ID NO: 83) CCGTAGCTCAGAGTAATTTGA (SEQ ID NO: 84) GAATGTCCTCCCGTAGCTCAG (SEQ ID NO: 85) CCTTTGGTTTGAATGTCCTCC (SEQ ID NO: 86) AACTTCTTTGCCTTTGGTTTG (SEQ ID NO: 87) CAAAGTTTTGAACTTCTTTGC (SEQ ID NO: 88) AAATTTTTTTCAAAGTTTTGA (SEQ ID NO: 89) ACATTCTTCTAAATTTTTTTC (SEQ ID NO: 90) TTCTAGTTATACATTCTTCTA (SEQ ID NO: 91) GTATTGGTTATTCTAGTTATA (SEQ ID NO: 92) GCACTTCTCTGTATTGGTTAT (SEQ ID NO: 93) GCTCCTTTAAGCACTTCTCTG (SEQ ID NO: 94) AGCTCCATCAGCTCCTTTAAG (SEQ ID NO: 95) CTTGGTTTTCAGCTCCATCAG (SEQ ID NO: 96) Oligo for L1 ORF2 TGTTATGTGTGAATTTGATCC (SEQ ID NO: 97) AAGTTAATATTGTTATGTGTG (SEQ ID NO: 98) TTTATATTTAAAGTTAATATT (SEQ ID NO: 99) ATTTAGTCCATTTATATTTAA (SEQ ID NO: 100) TAATTGCAGAATTTAGTCCAT (SEQ ID NO: 101) CTGTGTCTTTTAATTGCAGAA (SEQ ID NO: 102) ACTTGCCAGTCTGTGTCTTTT (SEQ ID NO: 103) TCTTTATGCAACTTGCCAGTC (SEQ ID NO: 104) GGGTCTTGACTCTTTATGCAA (SEQ ID NO: 105) GCACACTGATGGGTCTTGACT (SEQ ID NO: 106) TGTGGGATCGGTGGTGATATC (SEQ ID NO: 107) TTTGTATTTCTGTGGGATCGG (SEQ ID NO: 108) CTGATGGTAGTTTGTATTTCT (SEQ ID NO: 109) GTAGTATTCTCTGATGGTAGT (SEQ ID NO: 110) AGAGGTGTTTGTAGTATTCTC (SEQ ID NO: 111) TTATTTGCGTAGAGGTGTTTG (SEQ ID NO: 112) ATTTTCTACTTTATTTGCGTA (SEQ ID NO: 113) TTTCTTCTAGATTTTCTACTT (SEQ ID NO: 114) AATGTATCCATTTCTTCTAGA (SEQ ID NO: 115) TGTGTCGAGGAATGTATCCAT (SEQ ID NO: 116) Oligo for the 3’UTR of L1 TAGCATTAGGTATATCTCCCA (SEQ ID NO: 117) ATGTGTCATCTAGCATTAGGT (SEQ ID NO: 118) GCACCCACTAATGTGTCATCT (SEQ ID NO: 119) CTGGTGCGCTGCACCCACTAA (SEQ ID NO: 120) ATGTGCCATGCTGGTGCGCTG (SEQ ID NO: 121) ATATGTATACATGTGCCATGC (SEQ ID NO: 122) GGTTAGTTACATATGTATACA (SEQ ID NO: 123) ACATTGTGCAGGTTAGTTACA (SEQ ID NO: 124) GTACATGTGCACATTGTGCAG (SEQ ID NO: 125) AAGTTTTAGGGTACATGTGCA (SEQ ID NO: 126) ATTATACTCTAAGTTTTAGGG (SEQ ID NO: 127)

[0062] OSA can be a locked nucleic acid (LNA)-modified ASO. LNA ASOs have been used in many different settings such as antisense gapmers, anti-microRNA (antagomiRs), and antigene approaches. LNA is a modified RNA nucleotide in which the ribose moiety is modified with an extra bridge that connects the 2'-oxygen and 4'-carbon. The bridge "locks" the ribose in the 3'-end (North) conformation that is frequently seen in A-form duplexes. LNA designs can be divided into two major classifications: mixmers and gapmers. In mixmers, LNA and DNA nucleosides are interspersed throughout the sequence of the oligonucleotide, while in gapmers, two LNA segments at either end of the oligonucleotide are separated by a central segment of DNA nucleosides or a gap. Gapmers are preferred for RNA inhibition. This is because a central DNA / PS segment longer than 7-8 DNA nucleotides (nt) recruits the RNA-cleaving enzyme RNase H when the gapmer hybridizes to mRNA.

[0063] Antisense nucleic acids can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, antisense nucleic acids (e.g., antisense oligonucleotides) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecule or the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine-substituted nucleotides can be used. Antisense nucleic acids can also be produced biologically using an expression vector in which the nucleic acid is subcloned in the antisense orientation (i.e., the RNA transcribed from the inserted nucleic acid is in the antisense orientation to the target nucleic acid of interest, which is further described in the subsections below).

[0064] Other examples of useful antisense oligonucleotides (AON / ASO) include alpha-anomeric nucleic acids. Alpha-anomeric nucleic acid molecules form specific double-stranded hybrids with complementary RNA in which the strands run parallel to each other, contrary to normal beta units (Gaultier et al., Nucleic Acids.Res. 15:6625-6641 (1987)). Antisense nucleic acid molecules can also include 2'-o-methyl ribonucleotides (Inoue et al. Nucleic Acids Res. 15:6131-6148 (1987)) or chimeric RNA-DNA analogs (Inoue et al. FEBS Lett., 215:327-330 (1987)).

[0065] Particularly preferred antisense oligonucleotides (ASO) are fluoroarabino nucleic acid (FANA)-modified ASO specific for the L1-ORF1 RNA sequence. FANA ASO binds to the target sequence and acts as a docking element for RNase H-mediated cleavage.

[0066] 1. Aptamer In some embodiments, the inhibitory molecule is an aptamer. An aptamer is a molecule that interacts with a target molecule, preferably in a specific manner. Aptamers can bind to target molecules with very high specificity. For example, aptamers have been isolated that have a binding affinity difference of more than 10,000-fold between a target molecule and another molecule that differs from it only at a single position of that molecule. Because of their strong binding properties and because the surface properties of aptamer targets often correspond to functionally relevant portions of protein targets, aptamers can be potent biological antagonists. Typically, aptamers are small nucleic acids 15-50 bases in length that fold into defined secondary and tertiary structures such as stem-loops or G-quadruplexes. Aptamers can bind to small molecules such as ATP and theophylline, as well as large molecules such as reverse transcriptase and thrombin. Aptamers have a K -12 from target molecules of less than 10 dAptamers can bind to target molecules at a very high concentration. -6 , 10 -8 , 10 -10 , or 10 -12 Less than K d Aptamers preferably bind at a K d K with the target molecule that is at least 10, 100, 1000, 10,000, or 100,000 times lower than d When making comparisons with molecules such as polypeptides, it is preferred that the background molecule is a different polypeptide.

[0067] 2. Ribozymes L1 RNA expression can be inhibited using ribozymes. Ribozymes are nucleic acid molecules that can catalyze chemical reactions, either intramolecularly or intermolecularly. Ribozymes preferably catalyze intermolecular reactions. There are several different types of ribozymes that catalyze nuclease or nucleic acid polymerase type reactions, which are based on ribozymes found in natural systems, such as hammerhead ribozymes. There are also some ribozymes that are not found in natural systems, but have been engineered to catalyze novel specific reactions. Preferred ribozymes cleave RNA or DNA substrates, more preferably RNA substrates. Ribozymes typically cleave nucleic acid substrates through recognition and binding of the target substrate followed by cleavage. This recognition is often based mostly on canonical or non-canonical base pairing interactions. This property makes ribozymes particularly good candidates for target-specific cleavage of nucleic acids, since recognition of the target substrate is based on the target substrate sequence.

[0068] 3. Triplex-forming Oligonucleotides L1 RNA expression can be inhibited using triple-strand forming molecules. A triple-strand forming functional nucleic acid molecule is a molecule that can interact with either a double-stranded nucleic acid or a single-stranded nucleic acid. When the triple-strand molecule interacts with the target region, a structure called a triple-strand is formed in which there is a triple-stranded DNA that forms a complex depending on both Watson-Crick and Hoogsteen base pairing. Triple-strand molecules are preferred because they can bind to the target region with high affinity and specificity. The triple-strand forming molecule preferably binds to the target molecule with a K -6 of 10 -8 or less, 10 -10 or less, 10 -12 or less, or 10 d or less.

[0069] 4. External guide sequence L1 RNA expression can be inhibited using an external guide sequence. An external guide sequence (EGS) is a molecule that binds to a target nucleic acid molecule to form a complex and is recognized by RNase P that cleaves the target molecule. The EGS can be designed to specifically target a selected RNA molecule. RNase P assists in processing transfer RNA (tRNA) within the cell. By mobilizing bacterial RNase P and using an EGS that mimics the natural tRNA substrate for the target RNA:EGS complex, virtually any RNA sequence can be cleaved. Similarly, eukaryotic EGS / RNase P-directed cleavage of RNA can be utilized to cleave a desired target within eukaryotic cells. Representative examples of methods for making and using EGS molecules to promote cleavage of various different target molecules are known in the art.

[0070] 5. ShRNA L1 RNA expression can be inhibited using small hairpin RNAs (shRNAs) and expression constructs engineered to express shRNAs. Transcription of shRNAs is thought to be initiated by polymerase III (polIII) promoters and to terminate at position 2 of the 4-5-thymidine transcription termination site. Upon expression, shRNAs are thought to fold into stem-loop structures with 3’UU-overhangs, and subsequently, the ends of these shRNAs are processed to convert the shRNAs into siRNA-like molecules of approximately 21 nucleotides (Brummelkamp et al., Science 296:550-553 (2002), Lee et al., Nature Biotechnol. 20:500-505 (2002), Miyagishi and Taira, Nature Biotechnol. 20:497-500 (2002), Paddison et al., Genes Dev. 16:948-958 (2002), Paul et al., Nature Biotechnol. 20:505-508 (2002); Sui (2002) supra, Yu et al., Proc. Natl. Acad. Sci. USA 99(9):6047-6052 (2002).

[0071] B. Formulations Formulations for inhibiting L1 RNA are provided herein. The NAs, small molecules, and peptides described herein can be formulated for parenteral administration, parenteral administration to the skin, or topical administration. The disclosed nucleic acids, small molecules, and peptides can be administered to the skin in an amount effective to inhibit L1 RNA in the skin, using dosage forms and methods for delivering therapeutic agents and nucleic acids to the skin. In certain embodiments, the formulation includes one or more cell-penetrating agents, such as transfection agents. The NA agent is mixed or combined with a transfection agent (or a mixture thereof), and the resulting mixture is used to transfect cells. Preferred transfection agents include cationic lipid compositions, particularly monovalent and polyvalent cationic lipid compositions, more specifically, LIPOFECTIN®, LIPOFECTACE®, LIPOFECTAMINE™, CELLFECTIN®, DMRIE-C, DMRIE, DOTAP, DOSPA, and DOSPER, as well as dendrimer compositions, particularly G5-G10 dendrimers, including high-density star dendrimers, PAMAM dendrimers, graft dendrimers, and dendrigrafts and dendrimers known as SUPERFECT®.

[0072] i. Parenteral formulations The compounds described herein (i.e., L1 RNA, vectors encoding L1 RNA, L1 RNA-inhibiting NAs (or vectors encoding the same), and L1 RNA inhibitors) can be formulated for parenteral administration.

[0073] For example, parenteral administration can include intravenous, intradermal, intraperitoneal, intralesional, intramuscular, and subcutaneous administration to a patient by injection, infusion, and the like.

[0074] Parenteral formulations can be prepared as aqueous compositions using techniques known in the art. Typically, such compositions include injectable formulations, e.g., solutions or suspensions, solid forms suitable for use in preparing a solution or suspension upon addition of a reconstitution medium prior to injection, water-in-oil (w / o) emulsions, oil-in-water (o / w) emulsions, and microemulsions thereof, liposomes, or emulsomes, such as emulsions.

[0075] The carrier can be a solvent or a dispersion medium and includes, for example, water, ethanol, one or more polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), oils such as vegetable oils (e.g., peanut oil, corn oil, sesame oil, etc.), and combinations thereof. Suitable fluidity can be maintained, for example, by the use of a coating such as lecithin, by maintenance of the required particle size in the case of dispersion, and / or by the use of surfactants. In many cases, it is preferred to include an isotonic agent, e.g., sugar or sodium chloride.

[0076] Solutions and dispersions of the free acid or base of the active compound, or their pharmaceutically acceptable salts, can be prepared in a dispersion medium suitably mixed with one or more pharmaceutically acceptable excipients including, but not limited to, water or another solvent, or a surfactant, dispersing agent, emulsifying agent, pH adjuster, viscosity modifier, and combinations thereof.

[0077] Suitable surfactants can be anionic, cationic, amphoteric, or nonionic surfactants. Suitable anionic surfactants include, but are not limited to, those containing carboxylate, sulfonate, and sulfate ions. Examples of anionic surfactants include sodium, potassium, and ammonium salts of long-chain alkyl sulfonates and alkyl aryl sulfonates, such as sodium dodecylbenzenesulfonate; sodium dialkyl sulfosuccinates such as sodium dodecylbenzenesulfonate; sodium dialkyl sulfosuccinates such as sodium bis-(2-ethylthioxyl)-sulfosuccinate; and alkyl sulfates such as sodium lauryl sulfate. Cationic surfactants include, but are not limited to, quaternary ammonium compounds such as benzalkonium chloride, benzethonium chloride, cetrimonium bromide, stearyldimethylbenzylammonium chloride, polyoxyethylene, and coconut amine. Examples of nonionic surfactants include ethylene glycol monostearate, propylene glycol myristate, glyceryl monostearate, glyceryl stearate, polyglyceryl-4 oleate, sorbitan acylate, sucrose acylate, PEG-150 laurate, PEG-400 monolaurate, polyoxyethylene monolaurate, polysorbate, polyoxyethylene octylphenyl ether, PEG-1000 cetyl ether, polyoxyethylene tridecyl ether, polypropylene glycol butyl ether, Poloxamer® 401, stearoyl monoisopropanolamide, and polyoxyethylene hydrogenated tallowamide. Examples of amphoteric surfactants include sodium N-dodecyl-beta-alanine, sodium N-lauryl-beta-iminodipropionate, myristoamphoacetate, lauryl betaine, and lauryl sulfobetaine.

[0078] The formulation can contain preservatives to prevent the growth of microorganisms. Suitable preservatives include, but are not limited to, parabens, chlorobutanol, phenol, sorbic acid, and thimerosal. The formulation can also contain antioxidants to prevent the degradation of the active agent.

[0079] The formulation is typically buffered to a pH of 3 - 8 for parenteral administration upon reconstitution. Suitable buffers include, but are not limited to, phosphate buffers, acetate buffers, and citrate buffers.

[0080] Water-soluble polymers are often used in formulations for parenteral administration. Suitable water-soluble polymers include, but are not limited to, polyvinylpyrrolidone, dextran, carboxymethylcellulose, and polyethylene glycol.

[0081] Sterile injectable solutions can be prepared by incorporating the required amount of the active compound into a suitable solvent or dispersion medium with one or more of the excipients listed above, as required, followed by filtration sterilization. Generally, dispersions are prepared by incorporating various sterilized active ingredients into a sterile vehicle containing a base dispersion medium and other ingredients required from those listed above. In the case of sterile powders for preparing sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying techniques, which yield powders of the active ingredient and any additional desired ingredients from a previously sterile-filtered solution of the same. The powders can be prepared in a manner such that the particles are essentially porous and can enhance the dissolution of the particles. Methods for producing porous particles are well known in the art.

[0082] 1. Controlled Release Formulations The parenteral formulations described herein can be formulated for controlled release, including immediate release, delayed release, sustained release, pulsed release, and combinations thereof.

[0083] a. Nanoparticles and Microparticles For parenteral administration, one or more compounds, and optionally one or more additional active agents, can be incorporated into microparticles, nanoparticles, or combinations thereof that provide controlled release of the compound and / or one or more additional active agents. In embodiments where the formulation contains two or more agents, the agents can be formulated for the same type of controlled release (e.g., delayed, sustained, immediate, or pulsed), or the agents can be formulated independently for different types of release (e.g., immediate and delayed, immediate and sustained, delayed and sustained, delayed and pulsed, etc.).

[0084] For example, a compound and / or one or more additional active agents can be incorporated into polymeric microparticles that provide controlled release of the drug. Release of the agent is controlled by diffusion of the agent from the microparticle and / or degradation of the polymeric particle by hydrolysis and / or enzymatic degradation. Suitable polymers include ethylcellulose and other natural or synthetic cellulose derivatives. Similar to DNA and mRNA, siRNA and miRNA can be delivered via nanocarriers. For example, Benoit et al. Biomacromolecules. 2012;1311:3841-3849 developed a diblock copolymer (pDMAEMA-b-p(DMAEMA-co-PAA-co-BMA)) consisting of an siRNA complex formation block (pDMAEMA) and an endosome escape block (tercopolymer of PAA, BMA, and DMAEMA) for efficient siRNA delivery.

[0085] Polymers such as hydroxypropyl methylcellulose or polyethylene oxide that dissolve slowly in an aqueous environment and form a gel can also be suitable as materials for drug-containing microparticles. Other polymers include, but are not limited to, polyanhydrides, poly(ester anhydrides), polyhydroxy acids such as polylactide (PLA), polyglycolide (PGA), poly(lactide-co-glycolide) (PLGA), poly-3-hydroxybutyrate (PHB) and their copolymers, poly-4-hydroxybutyrate (P4HB) and their copolymers, polycaprolactone and their copolymers, and combinations thereof.

[0086] Alternatively, the agent can be incorporated into microparticles prepared from materials that are insoluble in an aqueous solution or dissolve slowly in an aqueous solution but can be degraded in the GI tract by means including enzymatic degradation, the surfactant action of bile acids, and / or mechanical erosion. As used herein, the term "dissolves slowly in water" refers to materials that do not dissolve in water within 30 minutes. Preferred examples include fats, fatty materials, waxes, wax-like materials, and mixtures thereof. Suitable fats and fatty materials include, but are not limited to, fatty alcohols (such as lauryl, myristyl stearyl, cetyl, or cetostearyl alcohol), fatty acid esters, fatty acid glycerides (monoglycerides, diglycerides, and triglycerides), and fatty acids and derivatives including hydrogenated fats. Specific examples include, but are not limited to, hydrogenated vegetable oil, hydrogenated cottonseed oil, hydrogenated castor oil, hydrogenated oil available under the trade name Sterotex®, stearic acid, cocoa butter, and stearyl alcohol. Suitable waxes and wax-like materials include natural or synthetic waxes, hydrocarbons, and conventional waxes. Specific examples of waxes include beeswax, glycol wax, carnauba wax, candelilla wax, paraffin, and candelilla wax. As used herein, a wax-like material is defined as any material that is normally solid at room temperature and has a melting point of about 30 to 300 °C.

[0087] In some instances, it may be desirable to alter the rate of water penetration into the microparticles. For this purpose, a rate control (infiltration) agent can be formulated with the fats or waxes enumerated above. Examples of rate control materials include certain starch derivatives (e.g., wax-like maltodextrin and drum-dried corn starch), cellulose derivatives (e.g., hydroxypropyl methylcellulose, hydroxypropyl cellulose, methylcellulose, and carboxymethylcellulose), alginic acid, lactose, and talc. Additionally, a pharmaceutically acceptable surfactant (e.g., lecithin) can be added to facilitate the breakdown of such microparticles.

[0088] Proteins that are insoluble in water, such as zein, can also be used as materials for the formation of drug-containing microparticles. Additionally, water-soluble proteins, polysaccharides, and combinations thereof can be formulated into microparticles with a drug and subsequently cross-linked to form an insoluble network. For example, cyclodextrin can be complexed with individual drug molecules and subsequently cross-linked.

[0089] 2. Methods for Making Nanoparticles and Microparticles The encapsulation or incorporation of a drug into a carrier material for generating drug-containing microparticles can be achieved through known pharmaceutical formulation techniques. In the case of formulations in fats, waxes, or wax-like materials, the carrier material is typically heated above its melting temperature, and the drug is added to form a mixture containing drug particles suspended in the carrier material, drug dissolved in the carrier material, or a mixture thereof. Thereafter, the microparticles can be formulated through several methods including, but not limited to, the processes of coagulation, extrusion, spray cooling, or aqueous dispersion. In a preferred process, the wax is heated above its melting temperature, the drug is added, and the molten wax-drug mixture is solidified as the mixture cools under constant stirring. Alternatively, the molten wax-drug mixture can be extruded and spheronized to form pellets or beads. These processes are known in the art. For some carrier materials, it may be desirable to use solvent evaporation techniques to generate drug-containing microparticles. In this case, the drug and the carrier material are co-dissolved in a mutual solvent, and thereafter, microparticles can be generated by several techniques including, but not limited to, forming an emulsion in water or other suitable medium, spray drying, or evaporating the solvent from the bulk solution and grinding the resulting material.

[0090] In some embodiments, the particulate form of the drug is uniformly dispersed in a material that is insoluble or slowly soluble in water. To minimize the size of the drug particles within the composition, the drug powder itself can be milled into a powder to create fine particles prior to formulation. The process of a jet mill, known in the pharmaceutical art, can be used for this purpose. In some embodiments, the particulate form of the drug is homogeneously dispersed in a wax or wax-like material by heating the wax or wax-like material above its melting point and adding the drug particles while stirring the mixture. In this case, a pharmaceutically acceptable surfactant can be added to the mixture to facilitate the dispersion of the drug particles.

[0091] The particles can also be coated with one or more modified release coatings. Solid esters of fatty acids that are hydrolyzed by lipase can be spray-coated onto microparticles or drug particles. Zein is an example of a natural water-insoluble protein. By spray-coating or wet granulation techniques, drug-containing microparticles or drug particles can be coated. In addition to natural water-insoluble materials, some substrates of digestive enzymes can be treated by cross-linking procedures to obtain the formation of an insoluble network. Many methods of cross-linking proteins initiated by both chemical and physical means have been reported. One of the most common methods of obtaining cross-linking is the use of chemical cross-linking agents. Examples of chemical cross-linking agents include aldehydes (glutaraldehyde and formaldehyde), epoxy compounds, carbodiimides, and genipin. In addition to these cross-linking agents, oxidized natural sugars have been used to cross-link gelatin. Cross-linking can also be achieved using enzymatic means, for example, transglutaminase is approved as a GRAS substance for cross-linking seafood products. Finally, cross-linking can be initiated by physical means such as heat treatment, ultraviolet irradiation, and gamma-ray irradiation.

[0092] To produce a coating layer of cross-linked protein surrounding the drug-containing microparticles or drug particles, a water-soluble protein can be spray-coated onto the microparticles and subsequently cross-linked by one of the above methods. Alternatively, the drug-containing microparticles can be microencapsulated within the protein by coacervation phase separation (e.g., by the addition of salt) and subsequently cross-linked. Some proteins suitable for this purpose include gelatin, albumin, casein, and gluten.

[0093] Polysaccharides can also be crosslinked to form a water-insoluble network. In many polysaccharides, this can be achieved by reaction with calcium salts or polyvalent cations that crosslink the main polymer chains. Pectin, alginate, dextran, amylose, and guar gum are subjected to crosslinking in the presence of polyvalent cations. Complexes can also be formed between oppositely charged polysaccharides; for example, pectin and chitosan can complex via electrostatic interactions.

[0094] 3. Injectable / Implantable Formulations The compounds described herein can be incorporated into injectable / implantable solid or semi-solid implants, such as polymer implants. In one embodiment, the compound is incorporated into a polymer that is liquid or paste at room temperature but exhibits an increase in viscosity to form a semi-solid or solid material upon contact with an aqueous medium such as physiological fluid. Exemplary polymers include, but are not limited to, hydroxyalkanoate polyesters derived from the copolymerization of at least one unsaturated hydroxy fatty acid copolymerized with a hydroxyalkanoic acid. The polymer can be melted, mixed with the active substance, and molded or injection molded into a device. Such melt assembly requires a polymer with a melting point lower than the temperature at which the delivered material and the polymer degrade or become reactive. The device can also be prepared by solvent casting, in which the polymer is dissolved in a solvent, the drug is dissolved or dispersed in the polymer solution, and then the solvent is evaporated. The solvent process requires that the polymer be soluble in an organic solvent. Another method is the compression molding of a mixed powder of the polymer and the drug, or polymer particles filled with the active agent.

[0095] Alternatively, the compound can be incorporated into a polymeric matrix and formed, compressed, or extruded into a device that is solid at room temperature. For example, the compound can be incorporated into a biodegradable polymer such as a polyanhydride, polyhydroalkanoic acid (PHA), PLA, PGA, PLGA, polycaprolactone, polyester, polyamide, polyorthoester, polyphosphazene, proteins and polysaccharides (such as collagen, hyaluronic acid, albumin and gelatin), and combinations thereof, and compressed into a solid device such as a disk or extruded into a device such as a rod. Polyamides for nucleic acid delivery are described in U.S. Patent No. 8,236,280.

[0096] Release of one or more compounds from the implant can be varied by selection of the polymer, the molecular weight of the polymer, and / or modification of the polymer to increase degradation, such as pore formation and / or incorporation of hydrolysable bonds. Methods of modifying the properties of biodegradable polymers to vary the release profile of compounds from implants are well known in the art.

[0097] ii. Enteral formulations Suitable oral dosage forms include tablets, capsules, solutions, suspensions, syrups, and lozenges. Tablets can be made using compression or molding techniques well known in the art. Gelatin or non-gelatin capsules can be prepared as hard or soft capsule shells, and liquid, solid, and semi-solid filling materials can be encapsulated using techniques well known in the art.

[0098] The formulations can be prepared using pharmaceutically acceptable carriers. As generally used herein, "carrier" includes, but is not limited to, diluents, preservatives, binders, lubricants, disintegrants, swelling agents, fillers, stabilizers, and combinations thereof.

[0099] The carrier can also include all components of the coating composition and can include plasticizers, dyes, colorants, stabilizers, and flow promoters.

[0100] Examples of suitable coating materials include cellulose polymers such as cellulose acetate phthalate, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, hydroxypropyl methyl cellulose phthalate, and hydroxypropyl methyl cellulose acetate succinate; polyvinyl acetate phthalate, acrylic polymers and copolymers, and methacrylic resins, zein, shellac, and polysaccharides commercially available under the trade name EUDRAGIT® (Roth Pharma, Westerstadt, Germany), but are not limited thereto.

[0101] Furthermore, the coating material may contain conventional carriers such as plasticizers, dyes, colorants, flow promoters, stabilizers, pore formers, and surfactants.

[0102] A "diluent", also referred to as a "filler", is typically necessary to increase the bulk of a solid dosage form, thereby providing a practical size for tableting or bead and granule formation. Suitable diluents include, but are not limited to, dicalcium phosphate dihydrate, calcium sulfate, lactose, sucrose, mannitol, sorbitol, cellulose, microcrystalline cellulose, kaolin, sodium chloride, dried starch, hydrolyzed starch, pregelatinized starch, silicon dioxide, titanium dioxide, magnesium aluminum silicate, and powdered sugar.

[0103] "Binder" is used to impart cohesive properties to solid dosage forms and thus ensure that tablets or beads or granules are intact after formation of the dosage form. Suitable binder materials include starches, pregelatinized starches, gelatin, saccharides (including sucrose, glucose, dextrose, lactose, and sorbitol), polyethylene glycol, waxes, acacia, tragacanth, natural and synthetic gums such as sodium alginate, hydroxypropylmethylcellulose, hydroxypropylcellulose, ethylcellulose, and celluloses including beagle, and synthetic polymers such as acrylic acid and methacrylic acid copolymers, methacrylic acid copolymers, methyl methacrylate copolymers, aminoalkyl methacrylate copolymers, polyacrylic acid / polymethacrylic acid, and polyvinylpyrrolidone, but are not limited thereto.

[0104] "Lubricant" is used to facilitate tablet manufacture. Examples of suitable lubricants include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, glyceryl behenate, polyethylene glycol, talc, and mineral oil.

[0105] "Disintegrant" is used to promote dosage form disintegration or "dispersion" after administration and generally includes starches, sodium starch glycolate, sodium carboxymethyl starch, sodium carboxymethyl cellulose, hydroxypropylcellulose, pregelatinized starch, clays, celluloses, arginine, gums, or crosslinked polymers such as crosslinked PVP (Polyplasdone® XL from GAF Chemical Corp), but are not limited thereto.

[0106] "Stabilizers" are used, for example, to inhibit or interfere with drug degradation reactions including oxidation reactions. Suitable stabilizers include, but are not limited to, antioxidants, butylated hydroxytoluene (BHT), ascorbic acid, its salts and esters, vitamin E, tocopherol and its salts, sulfites such as sodium metabisulfite, cysteine and its derivatives, citric acid, propyl gallate, and butylated hydroxyanisole (BHA).

[0107] 1. Enteric Formulations with Controlled Release Oral dosage forms such as capsules, tablets, solutions, suspensions, etc. can be formulated for controlled release. For example, one or more compounds and optionally one or more additional active agents can be formulated into nanoparticles, microparticles, and combinations thereof, and encapsulated in soft or hard gelatin or non-gelatin capsules, or dispersed in a dispersion medium to form an oral suspension or syrup. The particles can be formed from the drug and a controlled release polymer or matrix. Alternatively, the drug particles can be coated with one or more controlled release coatings before being incorporated into the final dosage form.

[0108] In another embodiment, one or more compounds and optionally one or more additional active agents are dispersed in a matrix material and gelate or emulsify upon contact with an aqueous medium such as physiological fluid. In the case of a gel, the matrix swells while entrapping the active agent, and the active agent is slowly released over time by diffusion and / or degradation of the matrix material. Such a matrix can be formulated as a tablet or as a filling material for hard and soft capsules.

[0109] In yet another embodiment, one or more compounds, and optionally one or more additional active agents, are formulated into a marketed oral dosage form such as a tablet or capsule, and the solid dosage form is coated with one or more controlled release coatings such as a delayed release coating or a sustained release coating. The coating can also contain the compound and / or additional active agents.

[0110] a. Sustained-release dosage form Sustained-release formulations are generally prepared as diffusion or osmotic systems and are known in the art. Diffusion systems typically consist of two types of devices, reservoirs and matrices, which are well-known and described in the art. Matrix devices are generally prepared by compressing a drug in tablet form with a slowly dissolving polymer carrier. The three main types of materials used in the preparation of matrix devices are insoluble plastics, hydrophilic polymers, and aliphatic compounds. Plastic matrices include, but are not limited to, methyl acrylate-methyl methacrylate, polyvinyl chloride, and polyethylene. Hydrophilic polymers include, but are not limited to, cellulosic polymers such as methyl and ethyl cellulose, hydroxyalkyl celluloses such as hydroxypropyl cellulose, hydroxypropyl methyl cellulose, sodium carboxymethyl cellulose, and Carbopol® 934, polyethylene oxide, and mixtures thereof. Aliphatic compounds include, but are not limited to, various waxes such as carnauba wax and glyceryl tristearate, and wax-type materials including hydrogenated castor oil or hydrogenated vegetable oil, or mixtures thereof.

[0111] In certain preferred embodiments, the plastic material is a pharmaceutically acceptable acrylic polymer, including, but not limited to, copolymers of acrylic acid and methacrylic acid, methyl methacrylate, methyl methacrylate copolymers, ethoxyethyl methacrylate, cyanoethyl methacrylate, aminoalkyl methacrylate copolymers, poly(acrylic acid), poly(methacrylic acid), methacrylic acid alkylamine copolymer poly(methyl methacrylate), poly(methacrylic acid) (anhydride), polymethacrylate, polyacrylamide, poly(methacrylic anhydride), and glycidyl methacrylate copolymers.

[0112] In certain preferred embodiments, the acrylic polymer consists of one or more ammonio methacrylate copolymers. Ammonio methacrylate copolymers are well known in the art and are described in NF XVII as completely polymerized copolymers of acrylic and methacrylic acid esters having a low content of quaternary ammonium groups.

[0113] In a preferred embodiment, the acrylic polymer is an acrylic resin lacquer such as those commercially available from Rohm Pharma under the trade name EUDRAGIT®. In a further preferred embodiment, the acrylic polymer comprises a mixture of two acrylic resin lacquers commercially available from Rohm Pharma under the trade names EUDRAGIT® RL30D and EUDRAGIT® RS30D, respectively. EUDRAGIT® RL30D and EUDRAGIT® RS30D are copolymers of acrylic and methacrylic esters having a low content of quaternary ammonium groups, and the molar ratio of ammonium groups to the remaining neutral (meth)acrylic esters is 1:20 for EUDRAGIT® RL30D and 1:40 for EUDRAGIT® RS30D. The average molecular weight is about 150,000. EUDRAGIT® S-100 and EUDRAGIT® L-100 are also preferred. The code designations RL (high permeability) and RS (low permeability) refer to the permeation characteristics of these agents. The EUDRAGIT® RL / RS mixture is insoluble in water and digestive fluids. However, multi-particle systems formed to contain the same are swellable and permeable in aqueous solutions and digestive fluids.

[0114] The above-mentioned polymers such as EUDRAGIT® RL / RS can be mixed together in any desired ratio to obtain a sustained-release formulation having a desirable dissolution profile. Desirable sustained-release multiparticulate systems can be obtained, for example, from 100% EUDRAGIT® RL, 50% EUDRAGIT® RL and 50% EUDRAGIT® RS, and 10% EUDRAGIT® RL and 90% EUDRAGIT® RS. Those skilled in the art will recognize that other acrylic polymers, such as EUDRAGIT® L, etc., can also be used.

[0115] Alternatively, the sustained-release formulation can be prepared using an osmotic system or by applying a semipermeable coating to the dosage form. In the latter case, a desired drug release profile can be achieved by combining low-permeability and high-permeability coating materials in a suitable ratio.

[0116] Devices having the different drug release mechanisms described above can be combined in a final dosage form containing a single or multiple units. Examples of multiple-unit cases include, but are not limited to, multilayer tablets and capsules containing tablets, beads, or granules. The immediate-release portion can be added to the sustained-release system by any means, such as applying an immediate-release layer on top of the sustained-release core using a coating or compression process, or in a multiple-unit system such as a capsule containing sustained- and immediate-release beads.

[0117] Sustained-release tablets containing hydrophilic polymers are prepared by techniques generally known in the art, such as direct compression, wet granulation, or dry granulation. These formulations typically incorporate a polymer, a diluent, a binder, a lubricant, and an active pharmaceutical ingredient. Common diluents include inert powder materials such as starches, powdered celluloses, particularly crystalline cellulose and microcrystalline cellulose, sugars such as fructose, mannitol, and sucrose, cereal flours, and similar edible powders. Typical diluents include, for example, various types of starches, lactose, mannitol, kaolin, calcium phosphate or calcium sulfate, inorganic salts such as sodium chloride, and powdered sugars. Powdered cellulose derivatives are also useful. Typical tablet binders include materials such as starches, gelatin, and sugars such as lactose, fructose, and glucose. Natural and synthetic gums including acacia, alginates, methylcellulose, and polyvinylpyrrolidone can also be used. Polyethylene glycol, hydrophilic polymers, ethylcellulose, and waxes can also function as binders. Lubricants are necessary in tablet formulations to prevent the tablet and punch from sticking to the die. Lubricants are selected from slippery solids such as talc, magnesium stearate, calcium stearate, stearic acid, and hydrogenated vegetable oils.

[0118] Sustained-release tablets containing wax materials are generally prepared using methods known in the art, such as direct blending, solidification, and aqueous dispersion methods. In the solidification method, the drug is mixed with the wax material, either spray solidified or solidified, and sieved for processing.

[0119] b. Delayed-release dosage forms Delayed-release formulations can be prepared by coating a solid dosage form with a polymer film that is insoluble in the acidic environment of the stomach and soluble in the neutral environment of the small intestine.

[0120] Sustained-release dosage units can be prepared, for example, by coating a selected coating material on a drug or a drug-containing composition. The drug-containing composition can be, for example, a tablet for incorporation into a capsule, a tablet for use as an inner core in a "coated core" dosage form, or a plurality of drug-containing beads, particles, or granules for incorporation into either a tablet or a capsule. Preferred coating materials include bioerodible, progressively hydrolyzable, progressively water-soluble, and / or enzymatically degradable polymers, which can be conventional "enteric" polymers. Enteric polymers, as will be understood by those skilled in the art, become soluble in the higher pH environment of the lower gastrointestinal tract or are eroded slowly as the dosage form passes through the gastrointestinal tract, while enzymatically degradable polymers are degraded by bacterial enzymes present in the lower gastrointestinal tract, particularly the colon.Coating materials suitable for achieving delayed release include cellulose polymers such as hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxymethyl cellulose, hydroxypropyl methyl cellulose, hydroxypropyl methyl cellulose acetate succinate, hydroxypropyl methyl cellulose phthalate, methyl cellulose, ethyl cellulose, cellulose acetate, cellulose acetate phthalate, cellulose acetate trimellitate, and sodium carboxymethyl cellulose; preferably acrylic acid polymers and copolymers formed from acrylic acid, methacrylic acid, methyl acrylate, ethyl acrylate, methyl methacrylate, and / or ethyl methacrylate, and other methacrylic resins including EUDRAGIT® L30D-55 and L100-55 (soluble at pH 5.5 or higher), EUDRAGIT® L-100 (soluble at pH 6.0 or higher), EUDRAGIT® S (soluble at pH 7.0 or higher as a result of a higher degree of esterification), and EUDRAGITS® NE, RL, and RS (water-insoluble polymers with different degrees of permeability and swelling), which are commercially available under the trademark Eudragit® (Rohm Pharma, Westerstadt, Germany); vinyl polymers and copolymers such as polyvinyl pyrrolidone, vinyl acetate, vinyl acetate phthalate, vinyl acetate crotonic acid copolymer, and ethylene-vinyl acetate copolymer; enzymatically degradable polymers such as azopolymers, pectin, chitosan, amylose, and guar gum; including, but not limited to, zein and shellac. Combinations of different coating materials may also be used. Multilayer coatings using different polymers may also be applied.

[0121] The preferred coating weight for a particular coating material can be readily determined by one skilled in the art by evaluating the individual release profiles of tablets, beads, and granules prepared with varying amounts of various coating materials. It is a combination of materials, methods, and application forms that produce the desired release characteristics and can only be determined from clinical trials.

[0122] The coating composition may contain conventional additives such as plasticizers, pigments, colorants, stabilizers, and flow promoters. Plasticizers are usually present to reduce the brittleness of the coating and generally exhibit about 10% to 50% by weight based on the dry weight of the polymer. Examples of typical plasticizers include polyethylene glycol, propylene glycol, triacetin, dimethyl phthalate, diethyl phthalate, dibutyl phthalate, dibutyl sebacate, triethyl citrate, tributyl citrate, triethyl acetylcitrate, castor oil, and acetylated monoglyceride. Stabilizers are preferably used to stabilize the particles in the dispersion. Typical stabilizers are nonionic emulsifiers such as sorbitan esters, polysorbates, and polyvinylpyrrolidone. Flow promoters are recommended to reduce the adhesion effect during film formation and drying and generally exhibit about 25% to 10% by weight of the polymer weight in the coating solution. One effective flow promoter is talc. Other flow promoters such as magnesium stearate and glycerol monostearate may also be used. Dyes such as titanium dioxide may also be used. Small amounts of antifoaming agents such as silicone (e.g., simethicone) may also be added to the coating composition.

[0123] iii. Topical formulations Dosage forms suitable for topical administration include creams, ointments, plasters, sprays, gels, lotions, emulsions, and transdermal patches. The formulation can be formulated for transmucosal, trans-epithelial, trans-endothelial, or transdermal administration. The formulation can include known excipients used in topical formulations and can include, but are not limited to, sunscreens, surfactants, preservatives, peeling agents, antiperspirants, colorants, thickeners, skin lighteners, vitamins, and other therapeutically active agents in a cosmetically acceptable carrier. The composition can further contain one or more chemical penetration enhancers, membrane permeants, membrane transporters, emollients, surfactants, stabilizers, buffers, and combinations thereof.

[0124] "Penetration enhancer" is known in the art and includes, but is not limited to, fatty alcohols, fatty acid esters, fatty acids, fatty alcohol ethers, amino acids, phospholipids, lecithin, cholates, enzymes, amines and amides, complexing agents (liposomes, cyclodextrins, modified celluloses, and diimides), macrocyclic lactones, ketones and anhydrides, and macrocyclic compounds such as cyclic ureas, surfactants, N-methylpyrrolidone and its derivatives, DMSO and related compounds, ionic compounds, azones and related compounds, and solvents such as alcohols, ketones, amides, polyols (e.g., glycols). Examples of these classes are known in the art.

[0125] "Preservative" can be used to prevent the growth of fungi and microorganisms. Suitable antifungal and antimicrobial agents include, but are not limited to, benzoic acid, butyl paraben, ethyl paraben, methyl paraben, propyl paraben, sodium benzoate, sodium propionate, benzalkonium chloride, benzethonium chloride, benzyl alcohol, cetylpyridinium chloride, chlorobutanol, phenol, phenylethyl alcohol, and thimerosal.

[0126] "Surfactant" is a surfactant that reduces surface tension, thereby increasing the emulsifying, foaming, dispersing, spreading, and wetting properties of the product. Suitable nonionic surfactants include, but are not limited to, emulsifying wax, glyceryl monooleate, polyoxyethylene alkyl ether, polyoxyethylene castor oil derivative, polysorbate, sorbitan ester, benzyl alcohol, benzyl benzoate, cyclodextrin, glyceryl monostearate, poloxamer, povidone, and combinations thereof. In one embodiment, the nonionic surfactant is stearyl alcohol.

[0127] Local application, for example, topical application of naked DNA, DNA / liposome or emulsion complexes, liposome creams, and local nucleic acid delivery using physical methods such as ablation, electroporation, and micro-mechanical disruption methods

[0128] Methods for delivering nucleic acid (NA) to the skin are known in the art. Physical methods include micro-needle injection, microporation, electroporation, iontophoresis, sonophoresis, or passive delivery using polymer nanoparticles, liposomes, peptides, or dendrimers. (Reviewed in Zakrewsky, et al., J. Control Release, 219:445-456 (2015)).

[0129] Intradermal injection is the simplest and most direct method for delivering NA to the skin. Here, the barrier properties of the SC are completely overcome by directly injecting the NA into the viable tissue layer of the skin. Useful intradermal needles include micro-needle arrays. Micro-needle arrays include needles with a length of only 100-700 μm. When placed on the skin, their sharp tips allow for easy insertion into the stratum corneum, while their short length ensures sufficient penetration into the skin without damaging nerves in deeper skin tissues. Micro-needles can be used for the delivery of nucleic acids disclosed herein, for example, plasmid DNA encoding L1 RNA, cationic lipid-DNA complexes (about 100 nm in diameter), siRNA, etc.

[0130] Microporation is another technique that uses physical disruption of the stratum corneum (SC) for the delivery of large therapeutic agents or therapeutic carriers. An array of resistive elements can be placed on the skin. The pulsed current passing through the array results in local ablation of the keratinocytes in contact with the array. Alternatively, an erbium:yttrium-aluminum-garnet (Er:YAG) laser array can be used for local ablation of the SC and epidermis. This technique has been used successfully to deliver plasmid DNA, CpG oligonucleotides, siRNA, etc. to the skin.

[0131] Electroporation can be used to permeabilize the skin and enhance the passive diffusion of drugs. The mechanism of electroporation is quite different from that of electrically induced microporation. Electrically induced microporation utilizes an electric field to induce thermal ablation of the SC microstructures that create pores in the skin. In contrast, electroporation is the application of short-duration (<0.5 s) and high-intensity (<100 V) electrical pulses to the skin, which results in a transient permeabilization of the lipid bilayer within the skin and simultaneously makes the cell membranes of epidermal keratinocytes permeable. Electroporation is also expected to create aqueous pores through the skin. The efficient delivery of nucleic acid molecules to the skin by the combined use of a microneedle roller and a flexible combinatorial electroporation array has been published in Huang, et al., Theranostics 2018;8(9):2361-2376.

[0132] Iontophoresis can be used to facilitate the transport of charged drugs such as NA. A continuous low-intensity (<10 V) electric field is applied with a constant current.

[0133] Liposomes have also been extensively tested for nucleic acid delivery in the treatment of skin diseases.

[0134] Higher-order globular complexes of nucleic acids (globular nucleic acids) have shown potential for treating skin diseases through their enhanced delivery to the skin, internalization into skin cells, and protection of NA from degradation. Specifically, gold nanoparticles coated with a high-order and covalently linked dense layer of siRNA resulted in passive transport through intact mouse SC and were limitedly localized in the dermis and epidermis.

[0135] The formulation can include known skin penetration enhancers. Some peptides have been identified to have the ability to enhance the transport of NA to the skin and induce a therapeutic response. The first of these peptides discovered using phage display screening was TD-1 (ACSSSPSKHCG) (SEQ ID NO: 55). Hsu and Mitragotri identified another peptide, the SPACE peptide (ACTGSTQHQCG) (SEQ ID NO: 56), which has the ability to enhance not only the delivery of siRNA across the skin but also intracellular uptake using phage display screening (Hsu T, Mitragotri S Proc Natl Acad Sci USA. 2011 108(38):15816-21).

[0136] The present invention will be further understood by the following non-limiting examples.

Examples

[0137] I. Delivery of LINE-1 retrotransposon RNA to mesenchymal stem cells derived from osteoporotic patients stimulates osteogenic differentiation and bone matrix production Materials and Methods Participants From 103 Norwegian women (aged 50 - 86 years) with highly variable BMD, 30 were selected according to age, weight, and major serum parameters and divided into the following two groups: osteoporosis (T-score ≤ -2.5) and healthy subjects (T-score > -1). The procedures for patient registration, iliac bone biopsy, and blood sampling have been previously reported. (47)(48) Participants were recruited through newspaper advertisements and / or included via the Lovisenberg Diaconal Hospital outpatient clinic. The study was approved by the Norwegian Regional Ethics Committee (REK number: 2010 / 2539) and conducted in accordance with the Helsinki Declaration.

[0138] Human MSC differentiation Bone marrow-derived MSCs (#C-12974, PromoCell GmbH, Heidelberg, Germany) were grown on 0.1% gelatin solution (#07903, StemCell)-coated plates up to passage 4. The growth medium (#PT-3001, Lonza) was changed every 3 days. Osteogenic differentiation was induced by replacing the growth medium with osteogenic differentiation medium (#PT-3002, Lonza) in 70% confluent cells seeded on 1:50 Matrigel (#356237, Corning)-coated plates. Adipogenic differentiation was induced by 3 cycles of induction / maintenance with adipogenic differentiation medium (#PT-3004, Lonza) in confluent cells seeded on 1:50 Matrigel (#356237, Corning)-coated plates.

[0139] Genomic DNA extraction and TaqMan qPCR-based L1 CNV assay High-molecular-weight genomic DNA (HMW-gDNA) was isolated using the MagAttract HMW DNA kit (#67563, Qiagen) according to the manufacturer's instructions. During lysis, the samples were treated with RNase H and proteinase K (both provided in the kit) at 37 °C for at least 1 h to remove RNA / DNA substrates and protein contamination, respectively. The isolated HMW-gDNA was finally treated with exonuclease I (#M0568, NEB) at 37 °C for 30 min and then inactivated at 80 °C for 15 min to remove free ssDNA. The HMW-gDNA was then analyzed for L1 copy number using the 7900HT Fast Real-Time PCR (Applied Biosystems). All copy number assays in L1 were normalized with human centromeric alpha satellite (SATA) as an endogenous control for DNA input concentration. Each sample was analyzed in triplicate. For each reaction, a 20 μl mixture of gDNA (25 pg), target-specific primers (0.2 μM), target-specific FAM-labeled probe (0.4 μM), ROX passive reference dye (0.4 μl, #1725858, Bio-Rad), and IQ Multiplex Powermix (10 μl, #1725849, Bio-Rad) was incubated at 95 °C for 3 min, followed by incubation in 40 cycles of denaturation at 95 °C for 45 s and primer annealing / extension at 59 °C for 45 s. TaqMan probe and primer sequences for L1 with active retrotransposition ability used in the CNV test have been published (Coufal, et al. Nature (2009), doi:10.1038 / nature08248, Goodier, et al. DNA (2014), doi:10.1186 / 1759-8753-5-11), shown below, and are the primers and probes used in this test.

[0140] L1 5’UTR-ORF1 Forward primer: 5’-GAATGATTTTGACGAGCTGAGAGAA-3’ (SEQ ID NO: 2); Reverse primer: 5’-GTCCTCCCGTAGCTCAGAGTAATT-3’ (SEQ ID NO: 3); Probe sequence: 5’-AAGGCTTCAGACGATC-3’ (30,37) (SEQ ID NO: 4); L1 ORF2 Forward primer: 5’-TGCGGAGAAATAGGAACACTTTT-3’ (SEQ ID NO: 5); Reverse primer: 5’-TGAGGAATCGCCACACTGACT-3’ (SEQ ID NO: 6); Probe sequence: 5’-CTGTAAACTAGTTCAACCATT-3’ (30,37) (SEQ ID NO: 7).

[0141] SATA Forward primer: 5’-GGTCAATGGCAGAAAAGGAAAT-3’ (SEQ ID NO: 8); Reverse primer: 5’-CGCAGTTTGTGGGAATGATTC-3’ (SEQ ID NO: 9); Probe sequence: 5’-TCTTCGTTTCAAAACTAG-3’ (30,37) (SEQ ID NO: 10); RPL13A Forward primer: 5’-GAAAGCCAAGATCCACTACC-3’ (SEQ ID NO: 11); Reverse primer: 5’-TGGGTCTTGAGGACCTCTGT-3’ (SEQ ID NO: 12); RUNX2 Forward primer: 5’-TCAACGATCTGAGATTTGTGGG-3’ (SEQ ID NO: 13); Reverse primer: 5’-GGGGAGGATTTGTGAAGACGG-3’ (SEQ ID NO: 14); OCN Forward primer: 5’-GGCGCTACCTGTATCAATGG-3’ (SEQ ID NO: 15); Reverse primer: 5’-GTGGTCAGCCAACTCGTCA-3’ (SEQ ID NO: 16); OPN Forward primer: 5’-GAAGTTTCGCAGACCTGACAT-3’ (SEQ ID NO: 17); Reverse primer: 5’-GTATGCACCATTCAACTCCTCG-3’ (SEQ ID NO: 18); BSP Forward primer: CACTGGAGCCAATGCAGAAGA (SEQ ID NO: 19); Reverse primer: 5’-TGGTGGGGTTGTAGGTTCAAA-3’ (SEQ ID NO: 20); OSX Forward primer: 5’-CCTCTGCGGGACTCAACAAC-3’ (SEQ ID NO: 21); Reverse primer: 5’-AGCCCATTAGTGCTTGTAAAGG-3’ (SEQ ID NO: 22); TBP Forward primer: 5’-GCTGGCCCATAGTGATCTTT-3’ (SEQ ID NO: 23); Reverse primer: 5’-CTTCACACGCCAAGAAACAGT-3’ (SEQ ID NO: 24); PPARγ Forward primer: 5’-ACCAAAGTGCAATCAAAGTGGA-3’ (SEQ ID NO: 25); Reverse primer: 5’-ATGAGGGAGTTGGAAGGCTCT-3’ (SEQ ID NO: 26); FABP4 Forward primer: 5’-ACTGGGCCAGGAATTTGACG-3’ (SEQ ID NO: 27); Reverse primer: 5’-CTCGTGGAAGTGACGCCTT-3’ (SEQ ID NO: 28); FASN Forward primer: 5’-AAGGACCTGTCTAGGTTTGATGC-3’ (SEQ ID NO: 29); Reverse primer: 5’-TGGCTTCATAGGTGACTTCCA-3’ (SEQ ID NO: 30); LPL Forward primer: 5’-AGGATGTGGCCCGGTTTATC-3’ (SEQ ID NO: 31); Reverse primer: 5’-CCAAGGCTGTATCCCAAGAGAT-3’ (SEQ ID NO: 32); GFP-968 / 1013 Forward primer: 5’-GCACCATCTTCTTCAAGGACGAC-3’ (SEQ ID NO: 33); Reverse primer: 5’-TCTTTGCTCAGGGCGGACTG-3’ (SEQ ID NO: 34);

[0142] Specificity analysis of L1 TaqMan primers and probes was performed. The L1-5’-ORF1 primer and probe set matched 309 sequences (246 L1HS-Ta1, 1 L1HS-Ta0, 1 L1HS-preTa, 61 L1PA2), and the L1-ORF2 primer and probe set matched 181 sequences (161 L1HS-Ta1, 3 L1-HS-Ta0, 4 L1HS-preTa, 6 L1PA2, 1 L1PA3, 5 L1PA4).

[0143] Lamivudine 3TC treatment Lamivudine 3TC (#L1295, Sigma) was resuspended in DMSO and added to the cell culture medium at a final concentration of 150 μM every 24 hours.

[0144] Mineralization assay Cells were washed with PBS and fixed with 4% paraformaldehyde for 15 minutes. Mineralization was evaluated by using the OsteoImage Mineralization Assay (#LOPA503, Lonza) according to the manufacturer's instructions. Mineralization was quantitatively assayed at the appropriate excitation (492) / emission (520) wavelengths using a GloMax Discover plate reader (Promega).

[0145] Lipid content assay The cells were washed once in PBS and incubated for 10 minutes with AdipoRed assay reagent (#LOPT7009, Lonza). Lipid content was quantitatively assayed at the appropriate excitation (485) / emission (572) wavelengths using a GloMax Discover plate reader (Promega).

[0146] RNA Extraction and cDNA Preparation The cells were collected and resuspended in 1 ml of QIAzol lysis reagent (#79306, Qiagen). Total RNA was then purified using an RNeasy Plus Mini kit (#74134, Qiagen) with minimal modification to the manufacturer's instructions. DNase treatment (RNase-free DNase set, #79254, Qiagen) was performed to remove any residual DNA. The quality and concentration of the RNA were confirmed using a Nanodrop2000 spectrophotometer (ThermoFisher). cDNA was synthesized from 200 ng of each RNA sample using a SuperscriptIII First Strand cDNA Synthesis System (#18080051, ThermoFisher) according to the manufacturer's protocol.

[0147] L1 RNA Transfection The vector human-L1_pBluescriptII sk(+) carrying the full-length L1 sequence was custom-prepared by GenScript, USA. Large-scale human L1 mRNA was transcribed, modified in vitro, and purified by TriLink Biotechnologies, USA (ARCA capping and 2'-O-methylation (CapI), completely substituted with 5-methyl-C, 25% substitution with cyanine-5-U, and 75% substitution with pseudouridine, enzymatically polyadenylated, DNase and phosphatase treatment, silica membrane purification). L1 RNA was transfected into differentiated osteoblasts on day 7 using Lipofectamine(™) MessengerMAX(™) (Invitrogen, USA, catalog No. LMRNA003) with a modified protocol using less RNA amount (10-fold less) than recommended. RFP mRNA (System Bioscience, USA, catalog No. MR800A-1) was used as a negative control. Three days after transfection, the bone matrix was quantified by OsteoImage mineralization assay (Lonza, Basel, Switzerland, catalog No. LOPA503).

[0148] Alizarin red staining The osteoblasts were washed with 1×PBS (Kantonsapotheke, Zurich, Switzerland, catalog No. A171012) and fixed with 4% (v / v) formaldehyde in 1×PBS (Sigma, USA, catalog No. F8775) for 30 minutes. After washing twice with ddH2O, alizarin red staining solution (0.7 g of alizarin red S (Sigma, USA, catalog No. A5533) diluted in 50 mL of ddH2O, pH = 4.2) was added for 20 minutes. Then, the cells were washed four times with ddH2O, dried, and stored in the dark until image acquisition. For absorbance measurement, alizarin red S was eluted from the stained osteoblasts with 300 μl of 10% (w / v) cetylpyridinium chloride in 0.01 M Na2HPO4 / NaH2PO4 aqueous solution, pH = 7 for 1 hour. 150 microliters were transferred to a 96-well plate and the absorbance was measured at 560 nm. 10% (w / v) cetylpyridinium chloride in 0.01 M Na2HPO4 / NaH2PO4 aqueous solution was used as a blank. Images were acquired, processed, and analyzed as previously reported (Eggerschwiler et al., Stem Cell Res. Ther. (2019). doi:10.1186 / s13287-019-1170-8).

[0149] Gene expression analysis in differentiating osteoblasts and adipocytes Real-time quantitative polymerase chain reaction (qPCR) was performed using a 7900HT Fast Real-Time PCR System (Applied Biosystems). Each sample was analyzed in triplicate and normalized for cDNA input concentration to an endogenous control, ribosomal protein L13A (RPL13A) for osteogenesis, and TATA binding protein (TBP) for adipogenesis. No-template and no-RT were included as negative controls. For each 15-μl reaction, 10 ng (1 ng for L1) of cDNA was mixed with 1 μM of specific primer mix and 7.5 μl of Sybr Select Master mix (#4472908, Life Technologies). The reaction was incubated at 95 °C for 10 min, followed by 40 cycles of incubation at 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 30 s. Ct values were calculated by 7900HT Fast Real-Time PCR RQ Manager software (Applied Biosystems) and then normalized as ΔCt between the gene of interest and the endogenous calibrator. Primers used in this study for gene expression analysis were designed using Primer3 (http: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). In all primer pairs, each primer corresponded to a different exon. The amplicon length was 80 - 130 nucleotides. Primer sequences are reported in Table 1.

[0150] In vitro retrotranslocation assay 150×10 3Individual MSCs were incubated with 3 μg of LRE3-EGFP plasmid (kindly provided by Professor Fred Gage) and electroporated using the Neon transfection system (ThermoFisher). Cells were subjected to one pulse of 990 V at 40 ms, allowed to recover for 48 hours, and then induced to differentiate into mature osteoblasts for 2 weeks. Cells were harvested and DNA was isolated. Using 50 ng of DNA as a template, the EGFP sequence was amplified with intron-adjacent oligos to distinguish between the intron (1243 bp, not retrotransposed) containing the RC-L1 sequence carried by the plasmid and the newly inserted spliced one (343 bp, retrotransposed). The PCR reaction was performed in a final volume of 20 μl using 0.5 μM of each primer and 10 μl of Hot start premix Taq DNA polymerase (#R028A, Takara), incubated at 94 °C for 30 seconds for denaturation, 58 °C for 30 seconds for primer annealing, and 72 °C for 1 minute for primer extension. The cycle was repeated 30 times. The GFP primer sequences are publicly available (38) and are reported in Table 1.

[0151] Cell cycle analysis 2×105 MSCs were trypsinized at 37 °C for 5 minutes, washed with PBS and 2% BSA, passed through a 70 μm strainer (#352350, Corning), and then fixed at -20 °C for 30 minutes in 70% ethanol. After washing with PBS and 4% BSA, the cells were resuspended in PBS, incubated with RNase at 37 °C for 1 hour. The cells were then washed and resuspended in 100 μl of flow cytometry staining buffer (R&D System, #FC001). 10 μl of 1 mg / mL propidium iodide (PI) staining solution (#P3566) was added to the single-cell solution, gently mixed, and incubated in the dark for 5 minutes. Cell cycle analysis was performed using BD FACSDiva software on a BD FACSCantoII flow cytometry system.

[0152] Antisense oligonucleotide delivery For the L1 knockdown experiment, five different ASOs specific to the LINE-1 ORF1 RNA region modified with FANA (2'-deoxy-2'-fluoroarabinonucleic acid), and one scramble (SCR) used as a negative control, were delivered by gymnosis (AUMbiotech) according to the manufacturer's instructions. The lyophilized oligonucleotides were resuspended in nuclease-free water at a concentration of 500 μM and then diluted to 5 μM in cell culture medium every three days.

[0153] Statistical analysis To determine the significance between two means, comparisons were made by the appropriate Student's t-test when a confidence level of 0.05 was accepted as statistically significant. *=P value < 0.05, **=P value < 0.005, ***=P value < 0.0005, ****=P value < 0.00005. In the correlation analysis, the p value and coefficient of determination (R squared, R2) were calculated using GraphPad (https: / / www.graphpad.com / quickcalcs / ). The number of biological replicates (N) is shown in the legend of the plot or figure.

[0154] Results The L1 DNA copy number is expanded in the genome of healthy bone. Variations in the copy number of L1 with active retrotransposition potential were analyzed in genomic DNA from 30 iliac crest biopsies from age-matched postmenopausal women classified as healthy (CTR, n = 14, BMD t-score ≥ -1) or osteoporotic (OP, n = 16, BMD t-score < -2.5) (data not shown). Briefly, all donors had a standard Norwegian diet and similar dietary supplements and lifestyle factors including physical activity. They were in normal endocrine, clinical, biochemical, and nutritional status and were postmenopausal without estrogen medication for at least 2 years. They had not received drug therapy known to affect bone turnover and had no other primary or secondary diseases of the skeleton. Absorption markers (serum TRAP5B, 1CTP, urinary NTX, or urinary DPD) did not differ between patients and controls, and they were all within the normal clinical test range according to international standards. Among the bone formation markers, serum osteocalcin was within the normal range and did not differ between groups, while bone-specific alkaline phosphatase (ALP), although within the normal variation range, was significantly higher in osteoporosis (p < 0.019).

[0155] To estimate the variation in L1 genomic copy number, TaqMan qPCR was coupled with isolation of high-molecular-weight genomic DNA and used to remove ssDNA (e.g., reverse-transcribed but not integrated L1 cDNA) and RNA / DNA substrates by exonuclease I and RNase H treatment, respectively, as reported in this method. This procedure excludes the detection of L1 sequences not integrated into the genome and is thus state-of-the-art to avoid overestimation of their genomic copy number, as previously predicted (Goodier, et al. DNA (2014), doi:10.1186 / 1759-8753-5-11, Goodier, et al. DNA (2016), doi:10.1186 / s13100-016-0070-z) and recently reported (34). TaqMan qPCR was used to amplify two different regions of the L1 DNA sequence (5’UTR-ORF1 and ORF2) with a copy number variant (CNV) assay.

[0156] The variation in L1 copy number between the two groups was very significant for both arrays, showing a strong decrease in patients (Figure 1A). Two sets of validated TaqMan primers and probes specific for L1 with potentially active retrotransposition ability (see methods for TaqMan primer and probe specificity analysis) were used (Coufal, et al. Nature (2009), doi:10.1038 / nature08248, Muotri, et al. Nature (2010), doi:10.1038 / nature09544). Consistently, the relative variation in L1 copy number observed between healthy individuals and patients represents a difference limited to a small fraction of the potentially active L1HS-Ta1 family. The data show that the L1 5’UTR-ORF1 copy number in the bone genome is positively correlated with BMD at all sites measured in the head (R2 = 0.275, p = 0.006) (Figure 1B), hip (R2 = 0.355, p = 0.0005) (Figure 1C), and spine (R2 = 0.347, p = 0.0006) (Figure 1D). In contrast, no statistically significant correlation was observed between clinical parameters and individual parameters not strictly related to bone metabolism, such as body weight (R2 = 0.012, p = 0.565) (Figure 1E), body mass index (R2 = 0.031, p = 0.356) (Figure 1F), parathyroid hormone levels in serum (R2 = 0.041, p = 0.282) (Figure 1G), and age (R2 = 0.028, p = 0.375) (Figure 1H). Consistent results were obtained when clinical parameters were correlated with L1 ORF2 copy number using defined primers and probes (Figure 2A - G).

[0157] To evaluate whether the variation in L1 copy number between CTR and OP women is tissue-specific to bone, a copy number variant (CNV) assay was performed on the genomes of peripheral blood mononuclear cells (PBMCs) collected from the same donors. In the PBMC genome, the L1 copy number was significantly lower than that in healthy bone, but most importantly, no variation was observed between the CTR and OP groups (Figure 2H). These results suggest that when osteoporotic patients are compared with healthy donors, quantitative variation in L1 genomic copy number is specifically detected in bone and not in other mesoderm-derived tissues that are not affected by the pathology, indicating the bone specificity of L1 dynamics in osteoporosis.

[0158] Osteogenic differentiation of MSCs induces L1 genomic expansion. The genetic causes of osteoporosis are unknown, but are associated with incomplete differentiation of MSCs towards the osteogenic lineage in the bone marrow niche. The observed decrease in L1 copy number in the genome of postmenopausal osteoporotic bone indicates a potential association between L1 mobilization and bone development, suggesting that failure of L1 reactivation may be involved in defective bone formation. Therefore, additional tests investigated whether L1 retrotransposon activation and expansion occur during physiological bone formation of adult MSCs. Bone marrow-derived MSCs isolated from the iliac crest of healthy donors were differentiated into mature osteoblasts for 3 weeks (Figure 3A). Osteoid nodules deposited by mature osteoblasts were detected by light microscopy (Figure 3A). Increased mineralized matrix deposition and osteogenic gene expression indicated that osteogenic differentiation occurred well ex vivo (data not shown, Figures 3C-D). Furthermore, the onset of mineralization can vary between MSC donors, and age-matched donors showing similar mineralization kinetics (Figure 3C) and similar marker gene expression (Figure 3D) were selected (nearly the same age as the tested cohort) to ensure consistent behavior of the cell line. First, real-time qPCR was used to monitor the timeline of L1 expression in developing osteoblasts, and it was observed that intracellular levels of L1 RNA gradually increased shortly after osteogenic induction and then decreased at the end of differentiation (Figure 3B). Using a TaqMan qPCR-based CNV assay on HMW-gDNA, the test investigated whether differentiation-induced L1 expression was associated with changes in L1 from the beginning of genomic integration. As shown in Figure 3B, the L1 copy number increased significantly in mature osteoblasts (day 21) compared to undifferentiated cells (day 7). A base assay based on an engineered L1 retrotranslocation GFP-reporter has been used in several previous studies (Coufal, et al. Nature (2009), doi:10.1038 / nature08248, Ostertag, et al. Nucleic Acids Res (2000), doi:gkd248[pii], MacIa, et al. Genome Res. (2017), doi:10.1101 / gr.206805.116), and it was confirmed that L1 propagation is associated with the differentiation of bone cells (Figure 3E).

[0159] L1 dynamic impairment is harmful to osteoblast maturation To understand whether L1 reactivation and genomic expansion in developing osteoblasts affect the osteogenic phenotype, L1 RNA was knocked down by using a fluoroarabino nucleic acid (FANA)-modified antisense oligonucleotide (ASO) specific to the L1-ORF1 RNA sequence. FANA ASO binds to the target sequence and acts as a docking element for RNase H-mediated cleavage (Figure 4A), thereby avoiding any off-target effects of the RNA-induced silencing complex (RISC). Importantly, the L1 sequence is frequently present in the introns of genes and thus in the nuclear precursors of many RNAs that can be targets of anti-L1 ASO. The ASOs used for knockdown of L1 RNA are mostly excluded from the cell nucleus (data not shown). This further reduces the potential for off-targets. A mixture of five FANA ASOs was delivered to differentiating osteoblasts every three days, and the expression of bone-related genes was analyzed by real-time qPCR. Somewhat surprisingly, moderate depletion of L1 RNA (Figure 4F) was sufficient to induce a significant decrease in the expression of the osteoblast-related transcription factors osterix (OSX, -43%) and Runt-related transcription factor 2 (RUNX2, -23%) analyzed 16 days after induction of osteogenesis. Furthermore, similar observations were made for the osteoblast-specific gene osteocalcin (OCN or BGLAP, -10%) and for osteopontin (OPN, -40%) and bone sialoprotein (BSP, -44%), two major non-collagenous components of bone tissue (Figure 4B). The results showed that somatic L1 RNA depletion impairs the ability of cells to activate the osteogenic program and generate mineralized bone.

[0160] NRTI-mediated inhibition of L1 genomic expansion reduces maturation and impairs mineralization of developing osteoblasts Furthermore, in initial tests, we investigated whether blocking ORF2-mediated L1 retrotransposition by the NRTI lamivudine 3TC (3TC), which inhibits L1 copy number expansion in developing osteoblasts, affects osteoblast maturation and function. Differentiating osteoblasts were treated daily for 3 weeks with and without 3TC, and L1 copy number was measured at three different time points of differentiation. As expected, the drug efficiently inhibited L1 DNA expansion during osteoblast maturation (Figure 4C). To evaluate the potential phenotypic effects of 3TC on osteogenic markers, the expression of marker genes with (3TC) and without (DMSO) 3TC treatment was analyzed in differentiating osteoblasts. A very significant decrease in the expression of OPN (-23%), OSX (-50%), and BSP (-60%) was observed in cells that had differentiated to the end (day 21) (Figure 4D). Consistently, mineral matrix deposition was significantly decreased (-60%) (Figure 4E). The potential detrimental effects of the drug on cell viability were excluded by propidium iodide staining followed by cell cycle FACS analysis of osteoblasts treated with 3TC. The results of FACS cell cycle analysis and measurement of the number of apoptotic cells in the sub-G1 peak of human mesenchymal stem cells treated (3TC) or not treated (DMSO) with lamivudine 3TC showed no significant differences (data not shown). These results support the hypothesis of L1 genomic expansion inhibition, which represents a tight link between NRTI treatment and mineralization loss in patients under ART.

[0161] MSCs differentiating into adipocytes lack L1 mobilization The results uniformly show that when L1 reactivation is inhibited, MSCs cannot efficiently differentiate into functional osteoblasts. In postmenopausal osteoporosis, red bone marrow changes from red to white as the fat content increases (Devlin, et al. Lancet Diabetes Endocrinol. (2015), doi:10.1016 / S2213-8587(14)70007-5, Ambrosi, et al. Cell Stem Cell (2017), doi:10.1016 / j.stem.2017.02.009). When mesodermal precursors were differentiated into adipocytes ex vivo (Figure 5A), lipid droplets accumulated by adipocytes were easily detected by light microscopy (Figure 5A). The increase in intracellular fatty acid content and adipogenic gene expression indicated that adipogenesis occurred without problems ex vivo (Fg. 9A - B).

[0162] The expression and copy number of L1 (Figure 5B) were monitored, and no significant changes were observed during differentiation. This is consistent with previous reports indicating that MSCs differentiating into adipocytes are not competent for retrotransposition (MacIa, et al. Genome Res. (2017), doi:10.1101 / gr.206805.116). Finally, as shown with different 5 donors, 3TC-mediated inhibition of L1 expansion in MSCs did not significantly affect adipogenic marker gene expression (Figure 5C), and intracellular lipid accumulation did not change (Figure 5D). These tests led to the conclusion that in developing MSCs, somatic L1 reactivation is lineage-specific and appears necessary for the osteogenic program, while it is not involved in the formation of adipocytes, a common cell type in the bone marrow niche of osteoporosis patients.

[0163] Delivery of LINE-1 retrotransposon RNA to mesenchymal stem cells stimulates osteogenic differentiation and bone matrix production Bone L1 copy number correlates with mature osteoblast and osteocyte activity. Figures 6A - F show the correlation between L1 copy number and the expression of genes specific to osteoblasts, osteocytes, and osteoclasts in biopsies from 30 selected participants. The RUNX2 transcript level in osteoblasts was marginally significant in the 5’UTR - ORF1 region (Figures 6A and 6B). Of the four osteocyte markers, two were positively correlated with L1 copy number. SOST (p = 0.005 for 5’UTR - ORF1, p = 0.0002 for ORF2) (Figures 6A, C and D), and MEPE (p = 0.007 for 5’UTR - ORF1, p = 0.0006 for ORF2) (Figures 6A, E and F). Also, a significant correlation was observed between SPP1, which is generally expressed in both mature osteoblasts and osteocytes, and the 5’UTR - ORF1 region copy number (p = 0.009) (Figures 6A and G), but not for the osteoclast - specific markers ACP5 and CALCR (Figure 6A). These data strongly associate the decrease in L1 copy number in the bone of osteoporotic patients with impairment of osteoblast / osteocyte anabolic activity within the same tissue.

[0164] Delivery of synthetic L1 RNA to MSCs from osteoporotic patients induces matrix mineralization in culture Osteoporotic bone shows a clear deficit in L1 reactivation in vivo, likely with negative consequences for osteoblast bone formation. Therefore, additional tests attempted to examine whether direct delivery of L1 RNA to MSCs obtained from osteoporotic donors could differentiate into osteoblasts and improve their maturation and bone-forming capacity. MSCs were isolated from the femurs of 4 healthy donors and 4 patients and tested for their ability to support osteogenic differentiation (Figure 7B). Low doses of Cy5-conjugated synthetic full-length L1 RNA (Figure 8A–G) were transfected into these differentiating osteoblasts with high efficiency (Figure 7B). As expected, exogenous lipofectamine-mediated RNA delivery resulted in the formation of intracellular vesicles (Figure 7B, red foci) from which the L1 RNA was slowly released over time (Kirschman, J. L. et al Nucleic Acids Res. 2017; doi:10.1093 / nar / gkx290). Cells from patients showed significantly delayed and reduced mineralization (Figure 7A), while cells transfected with L1 RNA showed restored bone matrix production (Figure 7C). Notably, the RNA was stabilized and the innate immune system within the cell was avoided using capping, 2'-O-methylation of the 5' end, polyadenylation (200 adenosines), complete substitution with 5-methylcytidine (m5C), and 75% substitution with pseudouridine (Koski et al., J. Immunol 2004; doi:10.4049 / jimmunol.172.7.3989, Pardi et al., Methods Mol. Biol. (2013). doi:10.1007 / 978-1-62703-260-5_2, Ludwig, J. et al. Nat. Struct. Mol. Biol. (2010). doi:10.1038 / nsmb.1863, Kariko et al., Immunity (2005). doi:10.1016 / j.immuni.2005.06.008, Anderson, B. R. et al. Nucleic Acids Res. (2010). doi:10.1093 / nar / gkq347, Kormann, et al. Nat. Biotechnol. (2011) doi:10.1038 / nbt.1733).

[0165] Therefore, neither apoptosis nor interferon-responsive genes were induced upon L1 RNA transfection (Figure 8G). The results indicate that in all patients tested, delivery of L1 RNA to differentiated MSCs in vivo greatly enhanced osteoblast maturation and completely rescued the formation of mineralized matrix.

[0166] Discussion Primary osteoporosis is one of the most common and costly diseases worldwide in terms of social costs and human disability (Cunningham, et al. Osteoporos.Int. (2016), doi:10.1007 / s00198-016-3620-9). Secondary osteoporosis, which frequently occurs due to other diseases, drug therapies, and inadequate nutrition, can be even more frequent, but is less noted, especially in patients receiving NRTI-based antiretroviral therapy. These studies reported that structural variations in the L1 genome were associated with bone density in 30 postmenopausal women, and it was observed that the amount of L1 DNA copies was higher in healthy bone compared to osteoporotic bone (Figure 1A). Notably, this structural L1-driven genomic variation between CTR and OP women was observed particularly in bone, but not in peripheral blood obtained from the same donor, which also represents cells of mesenchymal origin (Figure 2H). This in vivo observation of well-defined postmenopausal healthy women versus osteoporotic women suggested that the expansion of L1 elements could represent the genomic record of normal bone development and / or structural maintenance. Using human bone marrow-derived mesenchymal stem cell precursors to recapitulate adult ex vivo bone formation, the study demonstrated the developmentally regulated reactivation and mobilization of L1 associated with osteoblast maturation (Figure 3A - B). ASO-mediated degradation of L1 RNA, as well as NRTI-mediated inhibition of L1 retrotransposition during bone formation, had a significant effect on osteoblast maturation, with a detrimental effect on mineralization (Figure 4A - E). The dramatic phenotypic effect is not due to general cytotoxic effects (Figure 5A - B), and appears to be specific to the lineage and bone formation developmental program, as shown by the lack of a significant effect of L1 loss of function on adipogenesis (Figure 5A - D). Notably, NRTI-mediated inhibition of L1 genomic expansion did not change the expression of major adipogenic genes or lipid accumulation in developing adipocytes.Reduced L1 activity in differentiating MSCs results in impaired bone formation and reduced osteoblast-dependent mineralization, but our results that lipid accumulation in developing adipocytes is not restricted are consistent with the bone loss and increased bone marrow adipose tissue characteristic of primary osteoporosis disorders (Hawkes, et al. Bone (2018), doi:10.1016 / j.bone.2018.03.012). Furthermore, it has recently been demonstrated that in vivo lamivudine treatment increases bone marrow adipose tissue in mice (Cecco, et al. Nature 566, 73 - 78 (2019)). Our data are consistent with the well-documented association between NRTI-based therapy and bone loss in patients (Grigsby, et al. Osteoporos.Int. (2004), doi:10.1007 / s00198-004-1627-0, Brown, et al. AIDS (2006), doi:10.1097 / QAD.0b013e32801022eb, Madeddu, et al, QJ Nucl Med Mol Imaging (2004)), and the fact that ORF2 is an established and recognized target of NRTIs (Jones, et al. PLoSOne (2008), doi:10.1371 / journal.pone.0001547, Bachiller, et al. Brain.Behav.Immun. (2017), doi:10.1016 / j.bbi.2016.12.018). The possibility of osteoclast involvement was also considered. However, all serum markers of bone resorption and osteoclast activity were similar in osteoporotic and healthy postmenopausal women (data not shown). The possibility of osteoclast involvement was specifically investigated by measuring serum tartrate-resistant phosphatase 5b (TRAP5b) in an extended cohort of 99 postmenopausal women with varying BMD (Figure 10). There was a small but not significant inverse correlation between BMD and serum TRAP5b (p = 0.13, R2 = 0.026). Also, no difference was observed between healthy and patient groups (p = 0.31, data not shown). Thus, it is unlikely that undetected effects of L1-mediated action in osteoclasts could alter these results.The serum ALP level in the patients was higher (p = 0.019), but the value was within the normal range, suggesting a compensatory but insufficient bone formation against the primary osteoporosis process. The functional importance of L1 reactivation in non-pathological contexts such as bone development as well as early embryogenesis (Kano, et al. Genes Dev. (2009), doi:10.1109 / TLA.2016.7459581, van den Hurk, et al. Hum. Mol. Genet. (2007), doi:10.1093 / hmg / ddm108, Fadloun, Nat. Struct. Mol. Biol. (2013), doi:10.1038 / nsmb.2495, Jachowicz, et al. Nat. Genet. (2017), doi:10.1038 / ng.3945) and the developing brain (Coufal, et al. Nature (2009), doi:10.1038 / nature08248, Bedrosian, et al., doi:10.1126 / science.aah3378) remains poorly understood. Indeed, L1 and other transposon activities are complex phenomena involving several steps from long non-coding RNA (lncRNA) production to loci specific to regulated DNA damage and repair, chromatin remodeling, and cis-effects at the integration sites. Therefore, it is conceivable that more than one mechanism triggered by L1 reactivation contributes to tissue-specific phenotype expression. Therefore, future studies are needed to clarify whether inhibition of L1 retrotransposon dynamics can be a causative event of osteoporosis onset or an associated event. However, the reported fact that L1 dynamics support bone formation and healthy bone and osteoporotic bone are distinguished in vivo by L1-related genomic structural variations may suggest a new research frontier that was not previously predicted for the development of strategies to reduce bone loss in postmenopausal women and patients under antiretroviral regimens.

[0167] II. L1 RNA inhibition preserves H3K9M3 heterochromatin that prevents tissue degeneration in a mouse progeria model The LINE-1 (L1) element can cause cytotoxicity by activating a pro-inflammatory response due to the accumulation of L1 RNA / cDNA in the cytoplasm, independent of its retrotransposition. These studies examined L1 expression in LAKI mice and found a correlation between the transcription of interspersed repeats and the development of the aging phenotype.

[0168] Materials and Methods Animals and In Vivo Treatments: All animal procedures were conducted in accordance with NIH guidelines and approved by the Salk Institute's Institutional Animal Care and Use Committee. A mouse model of Hutchinson-Gilford progeria syndrome (HGPS) carrying the LMNA mutation G609G (LAKI) was generated by Carlos Lopez-Otin at the University of Oviedo, Spain, and generously donated by Brian Kennedy of the Buck Institute.

[0169] Experiments using WT and LAKI mice were performed on 8-week-old male and female mice. For lifespan experiments, male and female littermates were randomly assigned to control and experimental groups. Animals showing signs of ill health before the start of the experiment were excluded. Inclusion criteria were not used. Mice were housed in a temperature-controlled room (22 ± 1°C) with a 12-hour light / dark cycle between 06:00 and 18:00 and had free access to water and diet.

[0170] LINE-1-specific or scrambled 2'-deoxy-2'-fluoro-β-D-arabinonucleotide (FANA ASO) was delivered by intraperitoneal or subcutaneous injection at a dose of 2 - 10 mg / Kg once every two weeks.

[0171] Isolation and Culture of Tail Tip Fibroblasts: Tail tip fibroblasts (TTF) were isolated from WT and LAKI mice and cultured at 37°C in DMEM (Invitrogen) containing Gluta-MAX, non-essential amino acids, and 10% fetal bovine serum (FBS). For LINE-1 knockdown, TTF were incubated with 1 μM FANA ASO dissolved in the medium every 2 days and collected after 1 week for senescence marker expression or immunohistochemistry.

[0172] Histological analysis: For histological analysis, tissue samples were collected at 16 weeks of age, 8 weeks after FANA-ASO injection. Mice were perfused with PBS and 10% buffered formalin solution. Subsequently, tissues were fixed overnight at 4°C in 10% buffered formalin solution, cryopreserved overnight with 30% sucrose in PBS, embedded in OCT matrix (Kaltek), and flash frozen in liquid nitrogen. 7-μm frozen sections were used for hematoxylin and eosin staining (H&E) or immunohistochemistry.

[0173] Immunohistochemistry: Cells were fixed with 4% formaldehyde in PBS for 10 minutes at room temperature (RT). After fixation, cells were treated with 0.5% Triton X-100 in PBS for 5 minutes at RT. After blocking with 4% BSA in PBS for 30 minutes, cells were incubated with the primary antibody overnight at 4°C, followed by washing in PBS and incubation with the corresponding secondary antibody for 1 hour at RT. Cells were mounted using DAPI-Fluoromount-G (SouthernBiotech). Acquisition of confocal images was performed using a Zeiss LSM780 laser scanning microscope (Carl Zeiss Jena). Images were obtained in z-sections at 0.25-μm intervals using appropriate lasers (488-nm, 568-nm, 633-nm, and 405-nm). Laser intensity was usually set at 3% - 5% transmission of the maximum intensity, and the settings were established to avoid signal saturation for any of the lasers.

[0174] Tissue sections were subjected to permeabilization and antigen retrieval using HistoVT One (Nacalai Tesque). Subsequently, the tissue sections were blocked with 5% fraction V BSA (Sigma-Aldrich) and immunoglobulin masking reagent (Vector laboratories) in PBS and incubated overnight with the primary antibody. Finally, the tissue sections were incubated with the secondary antibody in blocking buffer for 60 minutes at room temperature (invitrogen). The tissue sections were mounted with DAPI Fluoromount G mounting medium (Southern Biotech.).

[0175] Fluorescence in situ hybridization: RNA-FISH or ImmunoRNA FISH in TTF and tissue sections was performed according to the manufacturer's standard protocol (Biosearch Technologies). Fixation was carried out with 3% paraformaldehyde (PFA) for 15 minutes, followed by permeabilization with 1% tritonX-100 for 5 minutes at room temperature prior to hybridization. Hybridization was performed overnight at 38 °C using 48 single molecule probes designed to span the length of the active mouse L1spa element that recognizes most of the transcribed LINE-1 RNA. The probe set was designed and produced by Biosearch Technologies. Custom Stellaris® FISH probes labeled with CalFluor610 were designed against L1spa using the Stellaris® FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com / stellarisdesigner.

[0176] LINE-1 RNA in vitro transcription and SUV39 enzyme activity assay: LINE-1 RNA was transcribed in vitro using the MAXIscript transcription kit (Invitrogen) with the pTNC7 plasmid containing the L1spa element as a template. Prior to the reaction, pTNC7 was linearized with the NotI restriction enzyme for full-length sense LINE-1 RNA or the XhoI restriction enzyme for antisense LINE-1 RNA. The transcribed RNA was purified with the RNAeasy mini kit (qiagen) according to the RNA clean-up protocol. Recombinant Suv39H1 (Activemotif) histone methyltransferase (HMT) activity was assayed using the EpiQuik™ Histone Methyltransferase Activity / Inhibition Assay Kit (Epigentek) according to the manufacturer's instructions. Briefly, 1 μg of recombinant SUV39H1 was incubated with 10 ng or 50 ng of in vitro transcribed sense LINE-1 RNA. Antisense LINE-1 RNA was used as a negative control as in Camacho et al. elife 2017. 1 μg of SUV39H1 was used in the assay alone or complexed with RNA, in parallel with 1 μl of positive control enzyme. Absorbance was read at 450 nm by a microplate reader, and HMT activity was calculated as HMT activity = OD (sample - blank) / incubation period (hours).

[0177] RNA extraction and real-time qPCR: Total RNA was extracted from cells and tissues using the RNAeasy Plus mini kit (Qiagen), followed by cDNA synthesis using the iScript Reverse Transcription Supermix (Bio-Rad) for RT-PCR. qPCR was performed using the SsoAdvanced SYBR Green Supermix or iQ Multiplex Powermix (Bio-Rad).

[0178] mp16-Fwd CGTGAACATGTTGTTGAGGC (SEQ ID NO: 35), mp16-Rev GCAGAAGAGCTGCTACGTGA (SEQ ID NO: 36), mp21-Fwd CGGTGTCAGAGTCTAGGGGA (SEQ ID NO: 37), mp21-Rev ATCACCAGGATTGGACATGG (SEQ ID NO: 38), mAtf3-Fwd CTCTGGCCGTTCTCTGGA (SEQ ID NO: 39), mAtf3-Rev GGTCGCACTGACTTCTGAGG (SEQ ID NO: 40), mGadd45b-Fwd CGGCCAAACTGATGAATGT (SEQ ID NO: 41), mGadd45b-Rev TCTGCAGAGCGATATCATCC (SEQ ID NO: 42), mBtg2-Fwd GCGAGCAGAGACTCAAGGTT (SEQ ID NO: 43), mBtg2-Rev TAGCCAGAACCTTTGGATGG (SEQ ID NO: 44), mMMP13-Fwd TGATGAAACCTGGACAAGCA (SEQ ID NO: 45), mMMP13-Rev GGTCCTTGGAGTGATCCAGA (SEQ ID NO: 46), mIL6-Fwd TGATGCACTTGCAGAAAACA (SEQ ID NO: 47), mIL6-Rev ACCAGAGGAAATTTTCAATAGGC (SEQ ID NO: 48), mLap2a-Fwd TTCTCGAGCGACGAGGAG (SEQ ID NO: 49), mLap2a-Rev AGCCTGGGCTTATCAGTTTT (SEQ ID NO: 50), mGapdh-Fwd GGCAAATTCAACGGCACAGT (SEQ ID NO: 51), mGapdh-Rev GTCTCGCTCCTGGAAGATGG (SEQ ID NO: 52), mL1-Fwd GCGGTTCCTCAGAAAATTGG (SEQ ID NO: 53), mL1-Rev TGCCCAGGAGAGGTATTGCT (SEQ ID NO: 54).

[0179] Aging-related beta-galactosidase enzyme activity assay: The aging-related beta-galactosidase (SA-βgal) assay was performed briefly as described herein. Briefly, cells were first fixed with 4% paraformaldehyde at room temperature for 5 minutes. Next, the cells were washed twice with PBS and incubated overnight at 37°C in a staining solution containing 40 mM citric acid / Na phosphate buffer, 5 mM K 4 [Fe(CN) 6 3H 2 O, 5 mM K 3 [Fe(CN) 6 , 150 mM sodium chloride, 2 mM magnesium chloride, and 1 mg / ml X-gal. Finally, the cells were washed twice with PBS and once with methanol. The plates were dried and photographs of the cells were taken using a bright-field microscope.

[0180] Results and discussion Using multiplex TaqMan assays, the expression of three active mouse L1 subfamilies (L1-Tf, L1-Gf, and L1-Af) was measured in tail tip fibroblasts (TTF) isolated from wild-type (WT) and LAKI mice. In LAKI TTF, 3- to 6-fold higher expression of L1 elements was observed (Figure 11A). L1 expression was further confirmed using RNA fluorescence in situ hybridization assay (FISH), and notably, strong accumulation of L1 RNA was observed in the nucleus (Figure 11B). To knockdown L1 RNA from both the cytoplasmic and nuclear compartments, L1-specific 2’F-ANA modified AON (L1-AON) was used. L1 RNA depletion was confirmed by qPCR and RNA FISH (Figure 11C-D). Interestingly, LAKI TTF treated with L1-AON showed significantly lower expression of stress response genes (p16, p21, Atf3, and Gadd45b) in the p53 tumor suppressor pathway, the aging-related metalloprotease Mmp13, and the pro-inflammatory interleukin IL1a (Figure 11E). Consistently, the number of cells positive for the senescence-associated β-galactosidase enzyme (SA-β-gal) decreased in LAKI TTF treated with L1-AON (Figure 11F).

[0181] LAKI mice are characterized by significantly low levels of H3K9me3 and decondensed heterochromatin. Treatment with L1-AON increased the intensity of H3K9me3 heterochromatin foci in LAKI cells compared to scrambled-treated control cells and approached the levels in WT (wild-type) cells (data not shown, Figure 12A). As a result, the number of cells with abnormal nuclear structure also decreased (data not shown, Figure 12B).

[0182] The SUV39H1 / 2 enzyme, a chromatin modifier involved in trimethylation of H3K9, can bind to repetitive RNAs, specifically L1 RNAs transcribed from the "sense" DNA strand. RNA immunoprecipitation (RIP) was performed, and the results showed that both the 5' and 3' ends of L1 RNA were bound by the SUV39H1 / 2 protein (right bar of each pair of bars) in LAKI TTF (Figure 12C). Furthermore, SUV39H1 / 2 foci co-localized with L1 RNA spots in LAKI TTF (data not shown). Considering that L1-ASO treatment restored heterochromatin and decreased the expression of aging-related genes, further tests were conducted to determine whether L1 RNA plays an inhibitory role on SUV39H1 / 2 accumulated in the nucleus of LAKI cells. An H3K9-specific histone methyltransferase assay was performed using recombinant SUV39H1 / 2 protein in the presence of L1 sense-strand transcripts. L1 antisense transcripts were used as a negative control. L1 sense RNA exerted a strong inhibitory effect on SUV39H1 / 2 enzyme activity compared to the activity of the protein alone or with L1 antisense RNA (Figure 12D).

[0183] To test whether in vivo depletion of L1 RNA can have any beneficial effect on LAKI mice in preventing the onset of the aging phenotype, LAKI mice were treated starting at 8 weeks of age with both scramble and L1-AON. Mice were subjected to intraperitoneal injection of AON (T.B.D.). L1-AON-treated LAKI mice were sacrificed at 16 weeks of age for molecular and histological analysis. Knockdown of L1 RNA in several tissues including skin, tibialis anterior skeletal muscle, liver, kidney, spleen, and stomach was confirmed by qPCR (Figure 13A). Importantly, 8 weeks of L1-AON treatment restored the level of the H3K9me3 heterochromatin mark compared to scramble AON-injected mice (data not shown). Furthermore, L1-AON treatment decreased the expression of SASP genes in the different tissues analyzed (Figure 13B).

[0184] The beneficial effects of L1 FANA oligomers in human cells derived from Hutchinson-Gilford progeria syndrome (HGPS) patients or Werner syndrome (WRN- / -) fibroblasts were also investigated. Consistent with the data obtained in mice, human cells from both progeria and Werner syndrome are characterized by higher expression of L1 RNA (Figure 14A). Using human-specific L1-AONs, cells show a decrease in SA-β-Gal activity and a decrease in the expression of senescence-related genes (Figures 14B-D). Furthermore, even in the human system, L1 RNA depletion is associated with the restoration of H3K9me3 heterochromatin (Figures 14E-F).

[0185] To evaluate the effectiveness of a treatment that protects organs from the pathological changes associated with premature aging, histological analysis of tissues impaired in progeria syndrome (Cesta, 2006, Khanna et al., 1988, Kurban and Bhawan, 1990, Zhou et al., 2008, Osorio et al., 2011) was performed. Hematoxylin-eosin staining revealed that mice injected with L1-AONs had an improved histological profile of the skin, spleen, stomach, and kidneys (data not shown). In particular, the skin was characterized by a thicker epidermal layer, the initial nuclei were more extensive in the spleen, the volume of the gastric epithelial layer was higher, and the diameter of the renal glomeruli was increased (Figure 13C). Collectively, these results confirm that stable reduction of L1 RNA improved age-related histological changes in multiple organs of LAKI mice.

[0186] Finally, the body weight and lifespan of the treated mice were monitored. Consistent with the histological analysis, L1-AON treatment prevented the progressive decrease in body weight typical of LAKI mice compared to control and untreated mice (Figure 13D), and an increase in median lifespan (15-25%) was observed (Figure 13E).

[0187] Endogenous L1 elements are transcriptionally active in both physiologically (above) and pathologically (HGPS, Figures 11A - 11E) aged cells. This study shows that in a model of accelerated aging such as Hutchinson - Gilford progeria syndrome, the accumulation of L1 RNA in the nucleus leads to the loss of heterochromatin and increased expression of SASP - related genes. Here, the data show that knockdown of this repetitive RNA using AONs prevented the de - condensation of H3K9me3 heterochromatin and reduced the expression of age - related genes. Furthermore, in vivo depletion of L1 RNA in LAKI mice delayed the onset of early - aging phenotypes, weight loss in different tissues, and increased the lifespan of treated mice. Additionally, a novel function of L1 RNA as a negative regulator of SUV39H1 / 2 was demonstrated.

[0188] In summary, in this study, for the first time, it is shown that antisense oligonucleotide - based therapy against repetitive RNA is sufficient to improve age - related phenotypes in LAKI mice. Thus, specifically AON - based interventions, or other interventions that reduce the level of L1 RNA in vivo, could be attractive treatment options for devastating diseases such as Hutchinson - Gilford progeria syndrome.

[0189] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosed invention belongs. Publications and the materials cited therein are specifically incorporated herein by reference.

[0190] One of ordinary skill in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

1. A composition for increasing the copy number of L1HS-Ta1, the composition comprising a vector encoding L1HS-Ta1 or a fragment thereof in a pharmaceutically acceptable carrier.

2. The composition according to claim 1, comprising ORF1 or ORF2 of the L1HS-Ta1.

3. The composition according to any one of claims 1 to 2, wherein the L1HS-Ta1 or a fragment thereof is in an expression vector.

4. The composition according to claim 3, wherein the expression vector is selected from the group consisting of a plasmid, a minicircle DNA (mcDNA), and a viral vector.

5. The composition according to claim 4, wherein the vector is selected from the group consisting of a bacteriophage, a baculovirus, a tobacco mosaic virus, a herpes virus, a cytomegalovirus, a retrovirus, a vaccinia virus, an adenovirus, and an adeno-associated virus.

6. The composition according to claim 4 or 5, wherein the expression vector is in a bone progenitor cell.

7. The composition according to claim 6, wherein the bone progenitor cell is a bone marrow-derived mesenchymal stem cell.

8. The composition according to claim 6 or 7, wherein the L1HS-Ta1 comprises SEQ ID NO:

1.

9. A composition according to any one of claims 1 to 8 for use in a method of increasing L1HS-Ta1 expression in a subject in need thereof, the method comprising administering to the subject an effective amount of the composition according to any one of claims 1 to 8 to increase L1HS-Ta1 expression in one or more cells in the subject.

10. The composition according to claim 9, wherein the method comprises administering genetically engineered bone progenitor cells that express L1HS-Ta1 or a functional fragment thereof to a site in the subject in need thereof.

11. The composition according to claim 10, wherein the cells are autologous cells.

12. The composition according to claim 10 or 11, wherein the method comprises administering the cells to a site in need of bone growth or repair.

13. The composition according to any one of claims 10 to 12, wherein the site is a spinal fixation site or a fracture site.

14. The composition according to any one of claims 10 to 13, which is effective for increasing the bone mass index at the fracture site or spinal fixation site in a subject diagnosed with a condition selected from the group consisting of degenerative disc disease, spondylolisthesis, spinal stenosis, scoliosis, fractured vertebrae, infectious diseases, intervertebral disc herniation, and tumors.

15. The composition according to any one of claims 9 to 14, wherein the composition contains SEQ ID NO:

1.

16. A composition for use in treating progeria syndrome or skin aging, wherein the composition is a composition for reducing the L1 RNA copy number, the composition contains one or more agents for inhibiting L1 RNA expression in a pharmaceutically acceptable carrier, and the one or more agents for reducing the L1 RNA expression are selected from the group consisting of capsaicin, GBS-149, entecavir, lamivudine, L1 RNA ASO, L1 RNA ORF1 ASO, and L1 RNA ORF2 ASO.

17. The composition according to claim 16, wherein the ASO is complementary to a fragment of L1 RNA, L1 RNA ORF1, or L1 RNA ORF2.

18. The composition according to claim 17, wherein the ASO has a length of 24 nucleotides or less.

19. The composition according to any one of claims 16 to 18, for use in a method of reducing the L1 RNA copy number in a subject in need of a reduction in the L1 RNA copy number, the method comprising administering to the subject the composition according to any one of claims 16 to 18.

20. The composition according to claim 19, wherein the composition is administered by injection.

21. The composition according to claim 20, wherein the method comprises subcutaneously administering the composition to the subject.

22. The composition according to any one of claims 16 to 21, wherein the composition alleviates one or more symptoms of progeria syndrome in a subject.

23. The composition according to any one of claims 16 to 22, wherein the composition alleviates one or more symptoms of skin aging.

Images