Polypeptide

Abstract

In particular, polypeptides capable of inhibiting the binding of IL-7 and / or L-TSLP to IL-7R (IL-7R), as well as constructs and pharmaceutical compositions comprising these polypeptides, are provided.

Description

Technical Field

[0001] The present invention relates to polypeptides capable of inhibiting the binding of IL-7 and / or L-TSLP to IL-7R, constructs and pharmaceutical compositions containing these polypeptides. The present invention further relates to nucleic acids encoding the above polypeptides, methods for preparing the above polypeptides, cDNA and vectors containing the nucleic acids encoding the above polypeptides, host cells capable of expressing or expressing the above polypeptides, and the use of the above polypeptides.

Background Art

[0002] Autoimmune diseases of the gastrointestinal tract Autoimmune diseases of the gastrointestinal tract include inflammatory bowel diseases such as Crohn's disease (CD), and other autoimmune diseases such as eosinophilic esophagitis (EoE). Crohn's disease, also known as Crohn's syndrome or regional enteritis, causes various symptoms. Crohn's disease mainly causes abdominal pain, diarrhea, vomiting, and / or weight loss, but may also cause complications outside the gastrointestinal tract (GIT) such as anemia, rash, arthritis, eye inflammation, fatigue, and lack of concentration (Baumgart et al 2012). Crohn's disease is a currently incurable gastrointestinal disease that is difficult to control with conventional treatments. EoE is a chronic disease defined by marked pathological eosinophil infiltration limited to the esophagus, which causes esophageal dysfunction and, if untreated, fibrosis. Esophageal fibrosis and esophageal stricture are known complications of EoE.

[0003] Antibody-based therapeutics have great potential as effective treatments for autoimmune diseases such as IBD and EoE due to their high specificity for targets and low inherent toxicity. Three anti-TNFα antibodies, infliximab (trade name Remicade), adalimumab (trade name Humira), and certolizumab (or "certolizumab pegol", trade name Cimzia) are clinically used in the treatment of Crohn's disease. However, these antibodies are inherently unstable and are generally considered unsuitable for oral administration because they are susceptible to proteolysis by inflammatory proteases present in the digestive system, gastrointestinal lesions, and the intestinal microbiota. Therefore, these drugs need to be administered by intravenous or subcutaneous injection, and expert training is required to use subcutaneous syringes or needles accurately and safely. These drugs require sterile equipment, liquid formulations of therapeutic polypeptides, vial packaging of the polypeptides in a sterile and stable form, and appropriate sites on the subject for needle insertion. Subjects generally feel psychological stress before receiving an injection and pain during the injection. Long-term treatment with such systemic anti-TNFα antibodies is associated with an increased risk of severe infections and cancer. Furthermore, due to high manufacturing costs, they are currently limited to use in more severe patients.

[0004] Currently, several small molecule anti-inflammatory and immunosuppressive drugs are in clinical development for Crohn's disease (Danese 2012, Shealy et al 2010, and Vetter & Neurath 2017). These drugs are administered orally, but many are absorbed systemically after administration, so they may have a systemic immunosuppressive effect unrelated to their action on gastrointestinal lesions. Furthermore, due to the lack of specificity of small molecules for antibodies, the risk of serious off-target side effects remains high.

[0005] The ability to deliver an oral therapeutic with high selectivity for targets associated with gastrointestinal autoimmune diseases while having exposure and activity limited to the gastrointestinal tract can, in combination with a significant improvement in safety due to reduced systemic exposure, provide efficacy similar to that of injectable antibodies.

[0006] Interleukin-7 (IL-7) and Interleukin-7 receptor (IL-7R) Interleukin 7 (IL-7) is a member of the cytokine family that includes IL-2, IL-4, IL-7, IL15, and IL-21. IL-7 is constitutively produced by non-hematopoietic stem cells and epithelial cells in lymphoid organs, intestine, skin, and liver, and is essential for the development of T lymphocytes in the thymus and the survival and homeostasis control of peripheral T cells (Fry and Mackall, 2002; Fry and Mackall 2005). In the intestinal mucosa, IL-7 further has the ability to promote distinct populations of natural lymphocyte cells with different phenotypes and functions important for the initial priming of the immune response against the pathogenic microbial load, as well as lymphoid tissue organogenesis and several dendritic cell populations, and to control CD4+ lymphoid tissue inducer (LTi) cells (Goldberg et al 2015; Peters et al 2015). Furthermore, IL-7 induces the proliferation of naive T cells and memory T cells and enhances effector T cell responses, preferentially T helper 1 (Th1) and Th17 responses (Dooms, 2013). Due to the functional effects of IL-7 on T cells, IL-7 becomes an important enhancer not only of autoimmunity and inflammation but also of protective immunity.

[0007] The effects of IL-7 on different target cells are mediated through the IL-7R, a heterodimeric complex that includes the IL-7Rα subunit (CD127) and the common cytokine receptor γ chain (γc) (CD132). Full-length human IL-7Rα consists of a 219-residue extracellular domain, a 25-residue transmembrane domain, and a 195-residue intracellular domain. Activation of the receptor induced by IL-7 is thought to first involve IL-7 interacting with IL-7Rα to form a complex, and then recruiting γc to form an activated receptor signaling complex. Association of the two receptor subunits by IL-7 activates intracellular phosphorylation events via the JAK / Stat, PI3 / Akt, and SRC signaling cascades (Walsh, 2012).

[0008] IL-7Rα is available not only in a format bound to the cell membrane but also in a soluble form (sIL-7Rα). sIL-7R is generated by shedding of the membrane-bound receptor and is produced by alternative splicing (of IL-7Rα exon 6) that results in a protein lacking a transmembrane domain. sIL-7Rα present in human plasma mainly derives from alternative splicing (Rose et al 2009). Four common haplotypes of the IL-7Rα gene have been identified (Teutsch et al 2003). Two haplotypes have been associated with changes in the expression and production of the soluble receptor and with susceptibility to autoimmune diseases including multiple sclerosis and type 1 diabetes (Hafler et al 2007).

[0009] In addition to the role of IL-7 / IL-7Rα in human T cell development and homeostasis, preclinical studies have demonstrated the involvement of the IL-7 / IL-7Rα pathway in animal models of different autoimmune and inflammatory diseases. These studies have identified additional IL-7-dependent mechanisms relevant to disease pathology, and the IL-7 / IL-7Rα interaction has come to be regarded as a potential target for the treatment of patients with related autoimmune and chronic inflammatory diseases.

[0010] Preclinical studies have demonstrated that short-term systemic administration of an IL-7Rα blocking antibody results in effective treatment in autoimmune diseases and gastrointestinal inflammation models. In the IBD model, the main mechanism regarding the efficacy after IL-7R-antagonist treatment is thought to involve local depletion or functional suppression of enteritis-inducing T cells (IL-7R+ effector / memory T cells) that express medium to high levels of IL-7Rα (CD127) and can be activated in the inflamed intestine by increased production of IL-7 by stromal and epithelial cells. In healthy mucosa, intestinal resident FOXP3 expresses extremely low levels of IL-7R + CD25 +Regulatory T cells (Treg cells) are expected to suppress dysregulated CD4+ T responses to commensal bacteria. However, Heninger et al 2012 suggested that in an IL-7-rich environment, the ability of FOXP3 + CD25 + conventional T cells of Treg to suppress proliferation is impaired. Thus, in gastrointestinal diseases, blockade of IL-7 / IL-7R signaling can help control T cell-mediated inflammation by inhibiting effector T cell activation and restoring the inhibitory function of regulatory T cells. Evidence from mouse IBD models and ex vivo human tissue studies also suggests that IL-7 / IL-7Rα-dependent activation of innate immune cells, including innate lymphoid cells (ILC), contributes to processes involved in gastrointestinal inflammatory diseases.

[0011] Thymic stromal lymphopoietin (TSLP) and IL-7R TSLP is a cytokine produced by epithelial cells of the skin, lung, intestine, and eye tissues, which is thought to be involved in the control of inflammatory processes at the mucosal surfaces of the body. TSLP stimulates dendritic cells (DCs) and innate lymphoid cells (ILCs) to induce the secretion of Th2 cytokines (IL-4, IL-5, and IL-13), promoting the development of Th2-type inflammation. TSLP underlies the development of several allergic diseases such as atopic dermatitis and rhinitis, and is also thought to promote intestinal diseases including eosinophilic esophagitis (EoE) and ulcerative colitis (UC). Paradoxically, TSLP has also been reported to be important for maintaining immune homeostasis and mucosal protection in the gastrointestinal tract. In recent years, it has been discovered that TSLP can be expressed as two different isoforms, and a biological explanation has been provided for the seemingly contrasting activities of this cytokine (Fornasa et al 2015; Tsilingiri et al 2017). Molecular biology studies have shown that the TSLP gene can give rise to two coding RNAs controlled by two different promoter regions. One transcript encodes the long isoform of TSLP (L-TSLP) of 159 aa (UNIPROT entry Q969D9, SEQ ID NO: 62), and the other transcript encodes the short form of TSLP (S-TSLP) that includes the C-terminal 63 aa of L-TSLP (UNIPROT entry Q969D9-2, SEQ ID NO: 63). L-TSLP acts on target cells via a receptor complex containing the TSLP-specific receptor chain (TSLPR) and the IL-7Rα chain. In recent years, structural studies have shown that the interaction of IL-7 and L-TSLP with the IL-7Rα chain of the TSLP-receptor complex involves a common IL-7Rα binding site (Verstraete et al 2017).

[0012] S-TSLP does not bind to TSLPR and cannot inhibit the binding of L-TSLP to this receptor. To the author's knowledge, the specific receptor for S-TSLP has not been identified to date.

[0013] Importantly, it has been shown that S-TSLP is preferentially expressed by healthy skin and by epithelial and lamina propria cells in healthy intestinal mucosal tissue. S-TSLP has anti-inflammatory activity and in vitro, S-TSLP inhibits the production of pro-inflammatory cytokines by monocyte-derived DCs and contributes to the modulation of CD103+ DCs to an immunotolerogenic phenotype. Thus, S-TSLP produced by the intestinal epithelium is thought to be able to affect basal immune cells including dendritic cells and lymphocytes and promote immunotolerogenic and regulatory responses in the healthy state. S-TSLP further exhibits potent antibacterial (bacterial and fungal) activity, which is thought to be important for protection against microbial invasion of the mucosal epithelium (Bjerkan et al 2016). Expression of S-TSLP in healthy tissue is constitutive but can be upregulated by vitamin D3 or PPARγ agonists or downregulated by pro-inflammatory pathogenic bacteria. L-TSLP is not present in healthy tissue but is expressed in response to pro-inflammatory stimuli and plays an important role in promoting Th2 cytokine-related inflammation by activating the effector functions of DCs and Th2 cells. Naive CD4+ T cells exposed to DCs activated with L-TSLP undergo proliferation and differentiation into Th2 lymphocytes. L-TSLP can also stimulate the Th2 innate immune response through the activation of basophils, ILCs (ILC2), and eosinophils.

[0014] Recent studies have revealed that in intestinal diseases including inflammatory bowel disease and eosinophilic esophagitis (EoE), the expression patterns of both TSLP isoforms change dramatically from the steady state. Rimoldi et al 2005 reported that TSLP (in this example, likely S-TSLP in particular, similar to the findings of Fornasa et al 2015) was constitutively expressed by primary epithelial cells isolated from healthy colon tissue. However, it was found that TSLP expression was not detected in epithelial cells from 6 / 9 patients with CD. The inability of CD epithelial cells to produce S-TSLP in the diseased mucosa disrupts the mechanism that normally helps maintain intestinal homeostasis by creating a non-inflammatory environment. Defects in this mechanism may trigger an unwanted Th1 inflammatory response and contribute to the development of CD. In contrast to the dominant lamina propria Th1 cells in Crohn's disease, T cells from patients with ulcerative colitis have been shown to produce the Th2-type cytokines IL-5 and IL-13, but they show only low levels of IL-4 production, suggesting that they do not exhibit all the characteristics of classical Th2 cells. Functionally, IL-13 has been shown to promote fibrosis, cause changes in tight junction function and apoptosis in intestinal epithelial cells, thereby inducing mucosal ulcers. Recently, Fornasa et al 2015 reported that the expression of TSLP detected by an L-TSLP-specific antibody was significantly increased in the intestinal tissue of patients with ulcerative colitis compared to the levels detected in healthy colon mucosa. Since TSLP-activated dendritic cells (DC) can induce the differentiation of naive CD4+ T cells into IL-5, IL-13, and TNF-producing inflammatory Th2 cells (Liu 2006), inhibition of this upstream cytokine acting at the epithelial cell-dendritic cell interface may prove to be an effective strategy for treating mucosal inflammation in patients with ulcerative colitis.

[0015] Epidemiological data support the involvement of atopic mechanisms and genetic factors in the development of EoE. Importantly, the results of genome-wide association studies have identified TSLP and its receptor TSLPR as candidate genes for the etiology of EoE (Cianferoni and Spergel, 2015). The expression of TSLP is increased in esophageal biopsy specimens from EoE patients and is localized to stratified squamous epithelial cells by immunohistochemical staining (Noti et al 2013). L-TSLP is thought to be a driver upstream of disease pathology as it strongly promotes the production of cytokines (including CCL-26 / eotaxin-3, IL-4, IL-5, IL-9, and IL-13) and fibrosis-promoting factors from Th2 cells, basophils, eosinophils, and mast cells that contribute to inflammation and tissue remodeling.

[0016] In EoE, TSLP is thought to function as an upstream epithelial "master-switch" immediately after the initiation of the inflammatory cascade, and as a result, antagonizing this cytokine may be able to halt the inflammatory cascade further upstream than previous targeted anti-cytokine therapies. This concept is supported by the positive results obtained in a recent trial of tezepelumab (AMG 157), a first-in-class TSLP antagonist mAb in severe asthma patients (Corren et al 2017).

[0017] In light of the above, it will be understood that there are unmet needs for more effective treatments for inflammatory and / or autoimmune diseases such as IBD and EoE. Agents that can inhibit the binding of IL-7 and / or L-TSLP to IL-7R could represent such treatments, particularly if they are orally administrable, and would therefore be highly desirable.

[0018] WO2013056984, WO2015189302, WO2011094259, and WO2011104687 disclose antibodies directed against IL-7R. SUMMARY OF THE INVENTION

[0019] The inventors have generated polypeptides that can inhibit the binding of IL-7 and / or L-TSLP to IL-7R. These polypeptides bind to IL-7Rα. These polypeptides, in particular, benefit from surprisingly high potency. They can cross-react with cynomolgus IL-7Rα and remain stable even when exposed to proteases in the small and large intestines.

[0020] In one embodiment, these polypeptides are further enhanced by engineering. These further enhanced polypeptides are humanized but nevertheless contain sequences that substantially maintain the above advantages.

[0021] In some embodiments, the polypeptides of the invention have been shown to bind to IL-7R with high affinity in Biacore studies and to be potent inhibitors of IL-7R interactions with both IL-7 and the IL-7-related cytokine L-TSLP in ELISA. In functional, cell-based assays, certain polypeptides of the invention inhibit the biological actions (IL-7-induced Stat5 phosphorylation, L-TSLP-induced TARC production) of both cytokines with similar potency to the clinical anti-IL-7R mAb829 (an anti-IL-7Rα monoclonal antibody also known as "GSK2618960" and disclosed in Ellis et al 2019).

[0022] In silico modeling suggests that the dual antagonistic activity of a polypeptide of the present invention is due to the binding of the polypeptide to an epitope of IL-7R that also constitutes the shared binding site of both cytokines. In the specificity test, a polypeptide of the present invention showed no binding activity to other human IL-7R-family or other cytokine receptors. In the interspecies specificity assay, a polypeptide of the present invention did not bind to mouse IL-7R, but bound to cynomolgus monkey and human IL-7R with similar potency. Therefore, cynomolgus monkeys are considered to be a suitable species for preclinical development studies.

[0023] In ex vivo culture of inflamed ulcerative colitis mucosal tissue, an exemplary polypeptide of the present invention was shown to inhibit phosphorylation of signaling proteins and the production of cytokines and chemokines related to pro-inflammatory and immunoregulatory pathways. The results demonstrate that the antagonistic effect of mucosal IL-7R+ve T cells by this polypeptide can inhibit the inflammatory process at least as effectively as clinical anti-IL-7R mAb829 in a model closely related to the disease environment, giving the possibility that the polypeptide of the present invention is particularly effective in patients with ulcerative colitis. In vivo, oral administration of a polypeptide of the present invention to normal mice demonstrated a high level of colonic lumen exposure (micromolar) showing resistance to digestion while passing through the entire digestive system.

[0024] Therefore, these polypeptides can be expected to be useful, inter alia, for the prevention or treatment of autoimmune and / or inflammatory diseases, such as inflammatory bowel diseases (e.g., Crohn's disease or ulcerative colitis) or eosinophilic esophagitis, especially when administered orally.

[0025] The present invention provides polypeptides that can inhibit the binding of IL-7 and / or L-TSLP to IL-7R. The present invention further provides constructs and pharmaceutical compositions comprising these polypeptides. Furthermore, nucleic acids encoding the above polypeptides, methods for preparing the above polypeptides, cDNAs and vectors comprising the nucleic acids encoding the above polypeptides, host cells capable of expressing the above polypeptides, and uses of the above polypeptides are also provided.

[0026] To avoid any doubt regarding the above term "and / or", "a polypeptide capable of inhibiting the binding of IL-7 to IL-7R" encompasses a polypeptide capable of inhibiting the binding of IL-7 and L-TSLP to IL-7R. Similarly, "a polypeptide capable of inhibiting the binding of L-TSLP to IL-7R" encompasses a polypeptide capable of inhibiting the binding of IL-7 and L-TSLP to IL-7R.

[0027] In at least some embodiments, the polypeptides of the present invention can have one or more of the following advantages compared to prior art substances that can inhibit the binding of IL-7 and / or L-TSLP to IL-7R. (i) An increased affinity for IL-7Rα; (ii) An increased specificity for IL-7Rα; (iii) An increased neutralizing ability against the binding of IL-7 or L-TSLP to IL-7R; (iv) Inhibiting the binding of both IL-7 and L-TSLP to IL-7R; (v) An increased cross-reactivity with IL-7Rα from different species such as humans and cynomolgus monkeys; (vi) A reduced immunogenicity when administered, for example, to mice, cynomolgus monkeys, or humans. (vii) In the presence of proteases, such as (a) proteases found in the small intestine and / or large intestine and / or IBD inflammatory proteases, such as trypsin, chymotrypsin, MMP3, MMP10, MMP12, other MMPs, and cathepsin, and (b) in the presence of proteases from gut commensal flora and / or pathogenic bacteria that are actively secreted and / or released by lysis of microbial cells found in the small intestine and / or large intestine, the stability is increased. (viii) Increased stability against proteolytic degradation during production (e.g., resistance to yeast proteases). (ix) Increased suitability for oral administration. (x) Increased suitability for local delivery to the intestinal tract and lamina propria after oral administration. (xi) Increased suitability for local delivery to the esophagus after oral administration. (xii) Increased suitability for expression in heterologous hosts, such as bacteria like Escherichia coli or yeasts belonging to the genus Aspergillus, Saccharomyces, Kluyveromyces, Hansenula, or Pichia, e.g., Saccharomyces cerevisiae or Pichia pastoris. (xiii) Suitability and improved properties for use in pharmaceuticals. (xiv) Suitability and improved properties for use in functional foods. (xv) Improved tissue permeability, such as penetration of inflamed colonic mucosal epithelium and submucosal tissue, to access the submucosal lamina propria. (xvi) Increased suitability for formatting in a multi - specific format, such as a monovalent format or a multivalent format like a bi - head format (e.g., homobihead or heterobihead format). (xvii) Binding to a novel epitope.

[0028] The above advantages (i) to (xvii) can potentially be realized by the polypeptides of the present invention in a monovalent format or a multivalent format such as a bi - head format (e.g., homobihead or heterobihead format).

[0029] Regarding the detailed description of "IL-7R" in the above points (and throughout this specification), since the polypeptide of the present invention specifically binds to the IL-7Rα subunit of IL-7R, it can also be appropriately replaced with "IL-7Rα".

Brief Description of the Drawings

[0030]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

[0031] Description in the sequence listing Polypeptide sequence of SEQ ID NO: 1 - CDR1 of ID-A62U, Polypeptide sequence of SEQ ID NO: 2 - CDR2 of ID-A62U, Polypeptide sequence of SEQ ID NO: 3 - CDR3 of ID-A62U, Polypeptide sequence of SEQ ID NO: 4 - FR1 of ID-A62U, Polypeptide sequence of SEQ ID NO: 5 - FR2 of ID-A62U, Polypeptide sequence of SEQ ID NO: 6 - FR3 of ID-A62U, Polypeptide sequence of SEQ ID NO: 7 - FR4 of ID-A62U, Polypeptide sequence of SEQ ID NO: 8 - ID-A62U, Polypeptide sequence of SEQ ID NO: 9 - V7R-2B6, Polypeptide sequence of SEQ ID NO: 10 - V7R-2E5, Polypeptide sequence of SEQ ID NO: 11 - V7R-2E9, Polypeptide sequence of SEQ ID NO: 12 - V7R-2F6, Polypeptide sequence of SEQ ID NO: 13 - V7R-3B5, Polypeptide sequence of SEQ ID NO: 14 - V7R-4F6, Polypeptide sequence of SEQ ID NO: 15 - V7R-6C12, Polypeptide sequence of SEQ ID NO: 16 - ID-A2U, Polypeptide sequence of SEQ ID NO: 17 - ID-A3U, The polypeptide sequence of SEQ ID NO: 18 - ID - A4U, The polypeptide sequence of SEQ ID NO: 19 - ID - A5U, The polypeptide sequence of SEQ ID NO: 20 - ID - A6U, The polypeptide sequence of SEQ ID NO: 21 - ID - A7U, The polypeptide sequence of SEQ ID NO: 22 - ID - A8U, The polypeptide sequence of SEQ ID NO: 23 - ID - A9U, The polypeptide sequence of SEQ ID NO: 24 - ID - A10U, The polypeptide sequence of SEQ ID NO: 25 - ID - A11U, The polypeptide sequence of SEQ ID NO: 26 - ID - A12U, The polypeptide sequence of SEQ ID NO: 27 - ID - A13U, The polypeptide sequence of SEQ ID NO: 28 - ID - A14U, The polypeptide sequence of SEQ ID NO: 29 - ID - A15U, The polypeptide sequence of SEQ ID NO: 30 - ID - A16U, The polypeptide sequence of SEQ ID NO: 31 - ID - A17U, The polypeptide sequence of SEQ ID NO: 32 - ID - A18U, The polypeptide sequence of SEQ ID NO: 33 - ID - A19U, The polypeptide sequence of SEQ ID NO: 34 - ID - A20U, The polypeptide sequence of SEQ ID NO: 35 - ID - A21U, The polypeptide sequence of SEQ ID NO: 36 - ID - A23U, The polypeptide sequence of SEQ ID NO: 37 - ID - A24U, The polypeptide sequence of SEQ ID NO: 38 - ID - A25U, The polypeptide sequence of SEQ ID NO: 39 - ID - A26U, The polypeptide sequence of SEQ ID NO: 40 - ID - A27U, The polypeptide sequence of SEQ ID NO: 41 - ID - A28U, The polypeptide sequence of SEQ ID NO: 42 - ID - A29U, The polypeptide sequence of SEQ ID NO: 43 - ID - A30U, The polypeptide sequence of SEQ ID NO: 44 - ID - A31U, The polypeptide sequence of SEQ ID NO: 45-ID-A32U, The polypeptide sequence of SEQ ID NO: 46-ID-A33U, The polypeptide sequence of SEQ ID NO: 47-ID-A34U, The polypeptide sequence of SEQ ID NO: 48-ID-A35U, The polypeptide sequence of SEQ ID NO: 49-ID-A36U, The polypeptide sequence of SEQ ID NO: 50-ID-A37U, The polypeptide sequence of SEQ ID NO: 51-ID-A38U, The polypeptide sequence of SEQ ID NO: 52-ID-A39U, The polypeptide sequence of SEQ ID NO: 53-ID-A40U, The polypeptide sequence of SEQ ID NO: 54-ID-A43U, The polypeptide sequence of SEQ ID NO: 55-ID-A50U, The polypeptide sequence of SEQ ID NO: 56-ID-A52U, The polypeptide sequence of SEQ ID NO: 57-ID-A53U, The polypeptide sequence of SEQ ID NO: 58-ID-A54U, The polypeptide sequence of SEQ ID NO: 59-ID-A55U, The polypeptide sequence of SEQ ID NO: 60-ID-A57U, The polypeptide sequence of SEQ ID NO: 61-ID-A59U, The polypeptide sequence of SEQ ID NO: 62-L-TSLP, The polypeptide sequence of SEQ ID NO: 63-S-TSLP, The polypeptide sequence of SEQ ID NO: 64-full-length human common γ-chain receptor, The polypeptide sequence of SEQ ID NO: 65-full-length human IL-7Rα, The polypeptide sequence of SEQ ID NO: 66-full-length cynomolgus monkey IL-7Rα, The polypeptide sequence of SEQ ID NO: 67-cynomolgus monkey IL-7Rα extracellular domain, The polypeptide sequence of SEQ ID NO: 68-human IL-7Rα extracellular domain, The polynucleotide sequence encoding SEQ ID NO: 69-ID-A59U, The polynucleotide sequence encoding SEQ ID NO: 70-ID-A62U, The polypeptide sequence of SEQ ID NO: 71-V7R-2B6 CDR1, The polypeptide sequence of SEQ ID NO: 72-V7R-2E9 CDR2, The polypeptide sequence of SEQ ID NO: 73-V7R-2F6 CDR2, The polypeptide sequence of SEQ ID NO: 74-V7R-4F6 CDR2, The polypeptide sequence of SEQ ID NO: 75-V7R-2B6 CDR2, The polypeptide sequence of SEQ ID NO: 76-ID-A14U CDR2, The polypeptide sequence of SEQ ID NO: 77-V7R-6C12 CDR3, The polypeptide sequence of SEQ ID NO: 78-V7R-2B6 CDR3, The polypeptide sequence preferably occupying residues 9-14 of SEQ ID NO: 79-ID-A62U FR2 (SEQ ID NO: 5), The polypeptide sequence not preferably occupying residues 9-14 of SEQ ID NO: 80-ID-A62U FR2 (SEQ ID NO: 5), The polynucleotide sequence of the 3' primer containing the SpeI site, The polypeptide sequence of CDR1 having any conservative substitution at residue 1 of SEQ ID NO: 82-SEQ ID NO: 1, The polypeptide sequence of CDR2 having any conservative substitution at residues 2, 3, 7, 12, and 16 of SEQ ID NO: 83-SEQ ID NO: 2, The polypeptide sequence of CDR3 having any conservative substitution at residues 3 and 9 of SEQ ID NO: 84-SEQ ID NO: 3, The polypeptide sequence of protease-labile linker formula 1, The polypeptide sequence of protease-labile linker formula 2, The polypeptide sequence of the preferred variant of protease-labile linker formulas 1 and 2, The polypeptide sequence of non-protease-labile linker formula 3, The polypeptide sequence of the preferred non-protease-labile linker.

Best Mode for Carrying Out the Invention

[0032] Polypeptides such as antibodies and antibody fragments that contain immunoglobulin chain variable domains (ICVDs) such as VH and VHH

[0033] A polypeptide is an organic polymer consisting of a number of amino acid residues linked in a chain. As used herein, "polypeptide" is used interchangeably with "protein" and "peptide". A polypeptide is said to be a binding polypeptide when it contains an extension of one or more amino acid residues that form a binding site that can bind to an epitope on a target with an affinity (preferably, as further described herein, represented as a Kd value, Ka value, k on -rate, and / or k off -rate).

[0034] Binding polypeptides include polypeptides such as DARPins (Binz et al. 2003), Affimers™ (Johnson et al. 2012), Fynomers™ (Grabulovski et al. 2007), Centyrins (Goldberg et al. 2016), Affitins (e.g., Nanofitins®, Krehenbrink et al. 2008), cyclic peptides, antibodies, and antibody fragments. Binding polypeptides include Affibodies (Nygren 2008), Affilins (Ebersbach et al. 2007), Alphabodies (Desmet et al 2014), Anticalins (Skerra et al 2008), Avimers (Silverman et al 2005), Kunitz domain peptides (Nixon and Wood 2006), Monobodies (Koide and Koide 2007), nanoCLAMPs (Suderman et al 2017), Adnectins (Lipovsek 2011), and bicyclic peptides.

[0035] Conventional antibodies or immunoglobulins (Igs) are proteins that contain four polypeptide chains: two heavy (H) chains and two light (L) chains. Each chain is divided into a constant region and a variable region. The heavy chain variable domain is abbreviated as VHC herein, and the light chain variable domain is abbreviated as VLC herein. These domains, the domains related thereto, and the domains derived therefrom are referred to herein as immunoglobulin chain variable domains. The VHC domain and the VLC domain are further subdivided into regions of hypervariability called "complementary determining regions" ("CDRs") and can be interspersed with more conserved regions called "framework regions" ("FRs"). The framework regions and the complementary determining regions are precisely defined (Kabat et al 1991). In conventional antibodies, VHC and VLC are each composed of three CDRs and four FRs arranged in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4, from the amino terminus to the carboxy terminus. A conventional antibody tetramer of two immunoglobulin heavy chains and two immunoglobulin light chains is formed, for example, by immunoglobulin heavy chains and immunoglobulin light chains interconnected by disulfide bonds, and the immunoglobulin heavy chains are similarity connected. The heavy chain constant region contains three domains: CH1, CH2, and CH3. The light chain constant region is composed of one domain called CL. The variable domain of the heavy chain and the variable domain of the light chain are binding domains that interact with antigens. The constant region of an antibody typically mediates the binding of the antibody to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1q) of the classical complement system. The term antibody includes immunoglobulins of the types IgA, IgG, IgE, IgD, IgM (and their subtypes), and the light chain of the immunoglobulin may be of the kappa type or the lambda type. The overall structure of an immunoglobulin-gamma (IgG) antibody assembled from two identical heavy (H) chains and two identical light (L) chain polypeptides is well established and highly conserved in mammals (Padlan 1994).

[0036] Exceptions to the conventional antibody structure are found in the sera of camels. In addition to conventional antibodies, these sera have special IgG antibodies. These IgG antibodies are known as heavy chain antibodies (HCAb), lack the L-chain polypeptide, and lack the first constant domain (CH1). In their N-terminal region, the H chains of the homodimeric protein contain a dedicated immunoglobulin chain variable domain called VHH, which serves to associate with its cognate antigen (Muyldermans 2013, Hamers-Casterman et al 1993, Muyldermans et al 1994).

[0037] An antigen-binding fragment (or “antibody fragment” or “immunoglobulin fragment”) as used herein means a part of an antibody that specifically binds to IL-7Rα (e.g., a molecule in which one or more immunoglobulin chains are not full-length but specifically binds to IL-7Rα). Examples of binding fragments included within the term antigen-binding fragment include the following: (i) FAb fragment (a monovalent fragment consisting of the VLC, VHC, CL, and CH1 domains), (ii) F(ab’)2 fragment (a bivalent fragment containing two Fab fragments joined by a disulfide bridge in the hinge region), (iii) Fd fragment (consisting of the VHC and CH1 domains), (iv) Fv fragment (consisting of the VLC and VHC domains of a single arm of an antibody), (v) scFv fragment (consisting of the VLC and VHC domains linked by a synthetic linker using recombinant methods, where the linker causes the VLC and VHC domains to be made as a single protein chain and the VLC and VHC regions pair to form a monovalent molecule), (vi) VH (an immunoglobulin chain variable domain consisting of the VHC domain (Ward et al 1989), (vii) VL (an immunoglobulin chain variable domain consisting of the VLC domain), (viii) V-NAR (an immunoglobulin heavy chain variable domain consisting of the VHC domain derived from cartilaginous fish IgNAR (Roux et al 1998 and Griffiths et al 2013)), (ix) VHH.

[0038] The total number of amino acid residues in VHH or VH may range from 110 to 130, preferably 115 to 120, and most preferably 118.

[0039] The immunoglobulin heavy chain variable domain of the present invention can be obtained, for example, by preparing a nucleic acid encoding the immunoglobulin heavy chain variable domain using techniques for nucleic acid synthesis and then expressing the thus obtained nucleic acid. According to certain embodiments, the immunoglobulin heavy chain variable domain of the present invention does not have an amino acid sequence that is exactly the same as the amino acid sequence of a naturally occurring polypeptide such as the VH domain or VHH domain of a naturally occurring antibody (i.e., shares 100% sequence identity with this amino acid sequence).

[0040] The examples provided herein relate to the immunoglobulin heavy chain variable domain itself that binds to IL-7Rα. However, the principles of the present invention disclosed herein are equally applicable to any IL-7Rα binding polypeptide such as an antibody and an antibody fragment. For example, the anti-IL-7Rα immunoglobulin heavy chain variable domain disclosed herein may be incorporated into a polypeptide such as a full-length antibody. Such an approach has been demonstrated by McCoy et al 2014, who provided an anti-HIV VHH designed as a fusion with the human Fc region (including the hinge, CH2, and CH3 domains) expressed as a dimer construct.

[0041] Substituting at least one amino acid residue in the framework region of a non-human immunoglobulin heavy chain variable domain with the corresponding residue from a human immunoglobulin heavy chain variable domain is humanization. Humanization of the variable domain may reduce immunogenicity in humans.

[0042] Preferably, the polypeptide of the present invention comprises an immunoglobulin chain variable domain. More preferably, the polypeptide of the present invention consists of an immunoglobulin chain variable domain such as an immunoglobulin heavy chain variable domain. Preferably, the polypeptide of the present invention is an antibody or an antibody fragment. More preferably, the polypeptide of the present invention is an antibody fragment. Preferably, the antibody fragment is an immunoglobulin variable domain such as VHH, VH, or VL. Preferably, the antibody fragment is a VHH, VH, VL, V-NAR, scFv, FAb fragment, or F(ab’)2 fragment. Preferably, the antibody fragment is an immunoglobulin heavy chain variable domain. More preferably, the antibody fragment is VHH or VH, and most preferably VHH.

[0043] Specificity, affinity, binding activity, and cross-reactivity Specificity refers to the number of different types of antigens or antigenic determinants to which a specific antigen-binding polypeptide can bind. The specificity of an antigen-binding polypeptide refers to the ability of the antigen-binding polypeptide to recognize a specific antigen as a unique molecular entity and distinguish it from other antigens.

[0044] The affinity, represented by the equilibrium constant (Kd) for dissociation from the target binding polypeptide, is an indicator of the binding strength between the target and the binding site on the binding polypeptide. The smaller the value of Kd, the stronger the binding force between the target and the binding polypeptide (alternatively, the affinity can also be expressed as an affinity constant (Ka), which is 1 / Kd). The affinity can be determined by known methods depending on the specific antigen of interest. Preferably, the affinity is determined using a dynamically switchable biosurface (e.g., see “switchSENSER”, Knezevic et al 2012) or surface plasmon resonance.

[0045] Binding activity is an indicator of the strength of the restriction between an antigen-binding polypeptide and an appropriate antigen. Binding activity is related to both the affinity between the antigen determinant on the antigen-binding polypeptide and its antigen-binding site, and the number of appropriate binding sites present on the antigen-binding polypeptide.

[0046] Preferably, the polypeptide of the present invention has a -7 dissociation constant (Kd) of 10 -8 M or less, more preferably 10 -9 M or less, and even more preferably 10 -10 M or less, and binds to IL-7Rα.

[0047] Preferably, the polypeptide of the present invention binds to IL-7Rα with a dissociation constant lower than that of mAb829 in the same assay. Preferably, the polypeptide of the present invention binds to IL-7Rα with a dissociation constant of 5.67×10 -10 M or less, more preferably lower than 5.67×10 -10 M. mAb829 is also known as "GSK2618960", an anti-IL-7Rα monoclonal antibody disclosed in Ellis et al 2019.

[0048] In one embodiment, the affinity of the polypeptide of the present invention is established by direct coating on a Biacore (or equivalent) sensor plate, or by fusion to Fc and capture with anti-human IgG Fc, and the polypeptide is flowed over the entire plate to detect binding. Preferably, the Biacore T200 plate is used at 25°C in HBS-EP+ (GE Healthcare) running buffer at a flow rate of 30 ul / min.

[0049] An anti-IL-7Rα polypeptide, an IL-7Rα-binding polypeptide, a polypeptide that interacts with IL-7Rα, or a polypeptide against IL-7Rα is an effective polypeptide that binds to IL-7Rα. The polypeptide of the present invention can bind to a linear epitope or a conformational epitope on IL-7Rα.

[0050] Preferably, the polypeptide of the present invention binds to human IL-7Rα. More preferably, the polypeptide of the present invention binds to both human IL-7Rα and at least one additional primate IL-7Rα selected from the group consisting of cynomolgus IL-7Rα, marmoset IL-7Rα, rhesus IL-7Rα, and human IL-7Rα. More preferably, the polypeptide of the present invention binds to both human IL-7Rα and cynomolgus IL-7Rα.

[0051] Preferably, the polypeptide of the present invention neutralizes the binding of human IL-7 and / or human L-TSLP to human IL-7R. More preferably, the polypeptide of the present invention neutralizes the binding of human IL-7 and / or human L-TSLP to both human IL-7R and at least one additional primate IL-7Rα selected from the group consisting of cynomolgus IL-7Rα, marmoset IL-7Rα, rhesus IL-7Rα, and human IL-7Rα. Most preferably, the polypeptide of the present invention neutralizes the binding of human IL-7 and human L-TSLP to human IL-7R.

[0052] Preferably, the polypeptide of the present invention binds to IL-7Rα (e.g., human - IL-7Rα, SEQ ID NO: 65, and / or cynomolgus IL-7Rα, SEQ ID NO: 66) or the γ-chain receptor (e.g., human common γ-chain receptor, SEQ ID NO: 64). More preferably, the polypeptide of the present invention binds to IL-7Rα, and most preferably to human IL-7Rα. More specifically, the polypeptide of the present invention binds to the extracellular region of IL-7Rα (SEQ ID NOs: 67 and 68, the extracellular regions of cynomolgus and human IL-7Rα, respectively), i.e., the polypeptide sequence of IL-7Rα lacking the transmembrane helix and cytoplasmic domain.

[0053] Preferably, IL-7Rα is a polypeptide comprising SEQ ID NO: 65 or SEQ ID NO: 66, and more preferably, IL-7Rα is a polypeptide consisting of SEQ ID NO: 65 or SEQ ID NO: 66. More preferably, IL-7Rα is a polypeptide comprising SEQ ID NO: 65, and more preferably, IL-7Rα is a polypeptide consisting of SEQ ID NO: 65. The polypeptide sequence of mature full-length human IL-7Rα is also available under UniProt entry P16871.

[0054] Polypeptides that can react (``cross-react'') with IL-7Rα from humans and IL-7Rα from other species, such as cynomolgus IL-7Rα, are advantageous because they allow preclinical studies to be carried out more easily in animal models.

[0055] Preferably, the polypeptides of the present invention are directed against epitopes on IL-7Rα that are in and / or form part of the receptor binding site of IL-7 and / or L-TSLP, and when the polypeptides of the present invention bind to IL-7Rα, they can inhibit or reduce the signaling of IL-7 and / or L-TSLP.

[0056] The polypeptides of the present invention bind to one or more epitopes on IL-7Rα. In one aspect of the present invention, polypeptides are provided that bind to the same epitopes on IL-7Rα as V7R-2E5, V7R-2E9, V7R-2F6, V7R-6C12, V7R-2B6, V7R-3B5, or V7R-4F6.

[0057] Preferably, the polypeptides of the present invention are isolated. An ``isolated'' polypeptide is one that has been removed from its original environment. For example, a naturally occurring polypeptide of the present invention is isolated when it is separated from some or all of the substances that coexist in the natural system.

[0058] Potency, inhibition, and neutralization Potency is an indicator of the activity of a therapeutic agent expressed in terms of the amount required to produce an effect of a given strength. A high-potency agent causes a greater response at a lower concentration compared to a low-potency agent that causes a smaller response at a lower concentration. Potency is a function of affinity and efficacy. Efficacy refers to the ability of a therapeutic agent to cause a biological response upon binding to a target ligand and the quantitative magnitude of this response. The term maximum effective concentration (EC50) refers to the concentration of a therapeutic agent that causes a response intermediate between the baseline and the maximum concentration after a specified exposure time. A therapeutic agent can cause inhibition or stimulation. This is generally, and is also used herein, as an indicator of potency.

[0059] The neutralizing polypeptide for the purposes of the present invention is a polypeptide that binds to IL-7Rα and inhibits the binding of IL-7 and / or L-TSLP to IL-7R as measured by ELISA. The specific ELISA method appropriate for determining the level of inhibition in this context is detailed in Example 3 below.

[0060] Preferably, the polypeptide of the present invention neutralizes the binding of IL-7R to IL-7 with an EC50 of 2.00 nM or less, for example, 1.50 nM or less, for example, 1.00 nM or less, for example, 0.90 nM or less, for example, 0.80 nM or less, for example, 0.70 nM or less, for example, 0.65 nM or less, for example, 0.60 nM or less, for example, 0.55 nM or less, for example, 0.50 nM or less, for example, 0.45 nM or less, for example, 0.4 nM or less, for example, 0.35 nM or less, for example, 0.30 nM or less.

[0061] Preferably, the EC50 is established using the IL-7 / IL-7R neutralizing ELISA detailed in Example 3 below.

[0062] Polypeptide and Polynucleotide Sequences For the purpose of comparing two closely related polypeptide sequences, the "percent sequence identity" between a first polypeptide sequence and a second polypeptide sequence can be calculated using NCBI BLAST v2.0 with the standard settings for polypeptide sequences (BLASTP). For the purpose of comparing two closely related polynucleotide sequences, the "percent sequence identity" between a first nucleotide sequence and a second nucleotide sequence can be calculated using NCBI BLAST v2.0 with the standard settings for nucleotide sequences (BLASTN). The parameters W, T, and X of the BLAST algorithm determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses, by default, a word length (W) of 11, an expectation value (E) of 10, M = 5, N = -4, and comparison of both strands. For amino acid sequences, the BLASTP program uses, by default, a word length of 3, an expectation value (E) of 10, an alignment (B) of 50 with the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)), an expectation value (E) of 10, M = 5, N = -4, and comparison of both strands. The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat’l. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the minimum sum probability (P(N)), which provides an indication of the probability that a match between two nucleotide or amino acid sequences occurs by chance. For example, a nucleic acid is considered to be similar to a reference sequence if the minimum sum probability in a comparison of the test nucleic acid and the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.

[0063] A polypeptide or polynucleotide sequence is said to be identical or similar to another polypeptide or polynucleotide sequence if they share 100% sequence identity over their entire length. Residues in a sequence are numbered from left to right, i.e., from the N-terminus to the C-terminus in the case of a polypeptide, and from the 5’-end to the 3’-end in the case of a polynucleotide.

[0064] The “difference” between sequences means an insertion, deletion, or substitution of a single amino acid residue at a position in the second sequence compared to the first sequence. Two polypeptide sequences can contain one, two, or more such amino acid differences. Otherwise, performing an insertion, deletion, or substitution in a second sequence that is identical (100% sequence identity) to the first sequence will reduce the percentage of sequence identity. For example, if the identical sequence is 9 amino acid residues long, one substitution in the second sequence results in 88.9% sequence identity. If the identical sequence is 17 amino acid residues long, two substitutions in the second sequence result in 88.2% sequence identity. If the identical sequence is 7 amino acid residues long, three substitutions in the second sequence result in 57.1% sequence identity. If the first and second polypeptide sequences are 9 amino acid residues long and share 6 identical residues, the first and second polypeptide sequences share more than 66% identity (the first and second polypeptide sequences share 66.7% identity). If the first and second polypeptide sequences are 17 amino acid residues long and share 16 identical residues, the first and second polypeptide sequences share more than 94% identity (the first and second polypeptide sequences share 94.1% identity). If the first and second polypeptide sequences are 7 amino acid residues long and share 3 identical residues, the first and second polypeptide sequences share more than 42% identity (the first and second polypeptide sequences share 42.9% identity).

[0065] Alternatively, for the purpose of comparing a first reference polypeptide sequence to a second comparative polypeptide sequence, one can also determine the number of additions, substitutions, and / or deletions added to the first sequence to generate the second sequence. An addition is the addition of one amino acid residue to the sequence of the first polypeptide (including an addition at either end of the first polypeptide). A substitution is the replacement of one amino acid residue in the sequence of the first polypeptide with one different amino acid residue. A deletion is the deletion of one amino acid residue from the sequence of the first polypeptide (including a deletion at either end of the first polypeptide).

[0066] For the purpose of comparing a first reference polynucleotide sequence to a second comparative polynucleotide sequence, one can also determine the number of additions, substitutions, and / or deletions added to the first sequence to generate the second sequence. An addition is the addition of one nucleotide residue to the sequence of the first polynucleotide (including an addition at either end of the first polynucleotide). A substitution is the replacement of one nucleotide residue in the sequence of the first polynucleotide with one different nucleotide residue. A deletion is the deletion of one nucleotide residue from the sequence of the first polynucleotide (including a deletion at either end of the first polynucleotide).

[0067] A "conservative" amino acid substitution is an amino acid substitution in which one amino acid residue is replaced with another amino acid residue of a similar chemical structure and is expected to have little effect on the function, activity, or other biological properties of the polypeptide. Such conservative substitutions are preferably substitutions in which one amino acid within the following groups is replaced with another amino acid residue from the same group.

[0068] [Table 1]

[0069] Preferably, the hydrophobic amino acid residue is a nonpolar amino acid. More preferably, the hydrophobic amino acid residue is selected from V, I, L, M, F, W, or C.

[0070] As used herein, the numbering of polypeptide sequences and the definitions of CDRs and FRs are as defined according to the Kabat system (Kabat et al 1991). "Corresponding" amino acid residues between a first and a second polypeptide sequence are the amino acid residues in the first sequence that share the same position as the amino acid residues in the second sequence according to the Kabat system, although the amino acid residues in the second sequence may differ in identity from the first sequence. When the frameworks and CDRs are of the same length according to the Kabat definitions, appropriately corresponding residues share the same number (and letter). Alignment can be achieved manually or using known computer algorithms for sequence alignment, such as NCBI BLAST v2.0 (BLASTP or BLASTN) with standard settings, for example.

[0071] The polypeptide sequence of ID-A62U, which is a polypeptide of the present invention, is described below in the Kabat format.

[0072] [Table 2]

[0073] The polypeptide sequence of ID-A59U, which is a further polypeptide of the present invention, is described below in the Kabat format.

[0074] [Table 3]

[0075] The polypeptide sequence of V7R-2E9, which is a further polypeptide of the present invention, is described below in the Kabat format.

[0076]

Table 4

[0077] Residue numbering from the N-terminus to the C-terminus is shown below. Kabat numbering includes the "H" prefix and is provided in the second row. CDR1, CDR2, and CDR3 are labeled as "CDR-H1", "CDR-H2", and "CDR-H3", respectively.

[0078] Align the polypeptide sequences of the additional polypeptides of the present invention (discussed in Examples 2 and 3) below (note that V7R-6C12 is referred to as IL-7R-6C12 below).

[0079]

Table 5

[0080] Preferably, the polynucleotide used in the present invention is isolated. An "isolated" polynucleotide is one that has been removed from its original environment. For example, a naturally occurring polynucleotide is isolated when it is separated from some or all of the substances coexisting in the natural system. A polynucleotide is considered isolated, for example, when it is cloned into a vector that is not part of its natural environment, or when it is not contained within cDNA.

[0081] In one aspect of the present invention, there is provided a polynucleotide encoding the polypeptide or construct of the present invention. Preferably, the polynucleotide comprises, or consists of, a sequence having at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 99% sequence identity with SEQ ID NO: 69 or 70, most preferably SEQ ID NO: 70. More preferably, the polynucleotide comprises, or (most preferably) consists of, either SEQ ID NO: 69 or 70, most preferably SEQ ID NO: 70. In a further aspect, there is provided a cDNA comprising the polynucleotide.

[0082] In one aspect of the present invention, provided is a polynucleotide comprising, or consisting of, a sequence that shares at least 70%, such as 80% or more, such as 90% or more, such as 95% or more, such as 99% or more sequence identity with any one part of SEQ ID NO: 69 or 70, which encodes the CDR1, CDR2, or CDR3 of the encoded immunoglobulin chain variable domain.

[0083] Preferably, the polypeptide sequence of the present invention comprises at least one modification relative to the natural sequence. Preferably, the polynucleotide sequence of the present invention comprises at least one modification relative to the natural sequence. Preferably, the modification to the polypeptide sequence or polynucleotide sequence is made to enhance the stability of the polypeptide or the encoded polypeptide against proteases present in the intestinal tract (such as trypsin and chymotrypsin).

[0084] The potential characteristics of the CDR and framework of the polypeptide of the present invention are described below.

[0085] CDR1 Preferably, the CDR1 of the polypeptide of the present invention comprises a sequence that shares at least 80% sequence identity with SEQ ID NO: 1, or more preferably, consists of the above sequence.

[0086] Alternatively, the CDR1 of the polypeptide of the present invention comprises a sequence having 2 or fewer, more preferably 1 or fewer additions compared to SEQ ID NO: 1, or more preferably, consists of the above sequence. Preferably, the CDR1 of the polypeptide of the present invention comprises a sequence having 2 or fewer, more preferably 1 or fewer substitutions compared to SEQ ID NO: 1, or more preferably, consists of the above sequence. Preferably, the CDR1 of the polypeptide of the present invention comprises a sequence having 2 or fewer, more preferably 1 or fewer deletions compared to SEQ ID NO: 1, or more preferably, consists of the above sequence.

[0087] Preferably, any residue of CDR1 that is different from its corresponding residue of SEQ ID NO: 1 is a conservative substitution compared to its corresponding residue.

[0088] Preferably, the residues of CDR1 have the following identity (SEQ ID NO: 82).

[0089] [Table 6]

[0090] Preferably, CDR1 comprises SEQ ID NO: 1 or SEQ ID NO: 71, or consists of SEQ ID NO: 1 or SEQ ID NO: 71. More preferably, CDR1 comprises SEQ ID NO: 1, or more preferably, consists of SEQ ID NO: 1.

[0091] CDR2 Preferably, CDR2 of the polypeptide of the present invention comprises a sequence that shares 65% or more, 75% or more, 80% or more, 85% or more, or 90% or more sequence identity with SEQ ID NO: 2, or more preferably consists of the above sequence.

[0092] Alternatively, CDR2 of the polypeptide of the present invention comprises a sequence having 8 or fewer, more preferably 7 or fewer, more preferably 6 or fewer, more preferably 5 or fewer, more preferably 4 or fewer, more preferably 3 or fewer, more preferably 2 or fewer, more preferably 1 or fewer additions compared to SEQ ID NO: 2, or more preferably consists of the above sequence. Preferably, CDR2 of the polypeptide of the present invention comprises a sequence having 8 or fewer, more preferably 7 or fewer, more preferably 6 or fewer, more preferably 5 or fewer, more preferably 4 or fewer, more preferably 3 or fewer, more preferably 2 or fewer, more preferably 1 or fewer substitutions compared to SEQ ID NO: 2, or more preferably consists of the above sequence. Preferably, CDR2 of the polypeptide of the present invention comprises a sequence having 8 or fewer, more preferably 7 or fewer, more preferably 6 or fewer, more preferably 5 or fewer, more preferably 4 or fewer, more preferably 3 or fewer, more preferably 2 or fewer, more preferably 1 or fewer deletions compared to SEQ ID NO: 2, or more preferably consists of the above sequence.

[0093] Preferably, any residue of CDR2 that is different from those corresponding residues of SEQ ID NO: 2 is a conservative substitution compared to those corresponding residues.

[0094] Preferably, the residues of CDR2 have the following identity (SEQ ID NO: 83).

[0095]

Table 7

[0096] Preferably, the residue of CDR2 corresponding to residue number 16 of SEQ ID NO: 2 is Q or K, most preferably K. Preferably, CDR2 comprises SEQ ID NO: 2, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, or SEQ ID NO: 76, or consists of the above SEQ ID NOs. More preferably, CDR2 comprises SEQ ID NO: 2, or more preferably consists of SEQ ID NO: 2.

[0097] CDR3 Preferably, the CDR3 of the polypeptide of the present invention comprises a sequence sharing 60% or more, 70% or more, or 80% or more sequence identity with SEQ ID NO: 3, or more preferably consists of the above sequence.

[0098] Alternatively, the CDR3 of the polypeptide of the present invention comprises a sequence having 3 or fewer, more preferably 2 or fewer, more preferably 1 or fewer additions compared to SEQ ID NO: 3, or more preferably consists of the above sequence. Preferably, the CDR3 of the polypeptide of the present invention comprises a sequence having 3 or fewer, more preferably 2 or fewer, more preferably 1 or fewer substitutions compared to SEQ ID NO: 3, or more preferably consists of the above sequence. Preferably, the CDR3 of the polypeptide of the present invention comprises a sequence having 3 or fewer, more preferably 2 or fewer, more preferably 1 or fewer deletions compared to SEQ ID NO: 3, or more preferably consists of the above sequence. Preferably, any substitution is conservative with respect to those corresponding residues of SEQ ID NO: 3.

[0099] Preferably, any residue of CDR3 that is different from its corresponding residue of SEQ ID NO: 3 is a conservative substitution compared to its corresponding residue.

[0100] Preferably, the residues of CDR3 have the following identity (SEQ ID NO: 84).

[0101] [Table 8]

[0102] Preferably, the sequence of CDR3 includes SEQ ID NO: 3, SEQ ID NO: 77, or SEQ ID NO: 78, or consists of the above sequences. More preferably, CDR3 includes SEQ ID NO: 3, or more preferably consists of SEQ ID NO: 3.

[0103] Special CDR Some particularly suitable CDR sequences are shown in the following table. Preferably, CDR1 of the polypeptide of the present invention is one of the CDR1 sequences described below. Preferably, CDR2 of the polypeptide of the present invention is one of the CDR2 sequences described below. Preferably, CDR3 of the polypeptide of the present invention is one of the CDR3 sequences described below. Preferably, the polypeptide of the present invention includes a combination of two, or more preferably three, of the CDR sequences described below.

[0104] Specific CDRs of the polypeptide of the present invention are provided below. "Example" shows an exemplary ICVD including the CDR and its corresponding sequence identification number.

[0105] [Table 9]

[0106] FR1 Preferably, FR1 of the polypeptide of the present invention includes a sequence sharing 5%, 12%, 18%, 26%, 32%, 38%, 46%, 52%, 58%, 62%, 66%, 68%, 72%, 75%, 78%, 82%, 85%, 90%, 95%, or more sequence identity with SEQ ID NO: 4, or more preferably, consists of the above sequence.

[0107] Alternatively, FR1 of the polypeptide of the present invention includes, or more preferably consists of, a sequence having an addition of 28 or less, more preferably 26 or less, more preferably 24 or less, more preferably 22 or less, more preferably 20 or less, more preferably 18 or less, more preferably 16 or less, more preferably 14 or less, more preferably 13 or less, more preferably 12 or less, more preferably 11 or less, more preferably 10 or less, more preferably 9 or less, more preferably 8 or less, more preferably 7 or less, more preferably 6 or less, more preferably 5 or less, more preferably 4 or less, more preferably 3 or less, more preferably 2 or less, more preferably 1 or less as compared with SEQ ID NO: 4. Preferably, FR1 of the polypeptide of the present invention includes, or more preferably consists of, a sequence having a substitution of 28 or less, more preferably 26 or less, more preferably 24 or less, more preferably 22 or less, more preferably 20 or less, more preferably 18 or less, more preferably 16 or less, more preferably 14 or less, more preferably 13 or less, more preferably 12 or less, more preferably 11 or less, more preferably 10 or less, more preferably 9 or less, more preferably 8 or less, more preferably 7 or less, more preferably 6 or less, more preferably 5 or less, more preferably 4 or less, more preferably 3 or less, more preferably 2 or less, more preferably 1 or less as compared with SEQ ID NO: 4. Preferably, FR1 of the polypeptide of the present invention includes, or more preferably consists of, a sequence having a deletion of 28 or less, more preferably 26 or less, more preferably 24 or less, more preferably 22 or less, more preferably 20 or less, more preferably 18 or less, more preferably 16 or less, more preferably 14 or less, more preferably 13 or less, more preferably 12 or less, more preferably 11 or less, more preferably 10 or less, more preferably 9 or less, more preferably 8 or less, more preferably 7 or less, more preferably 6 or less, more preferably 5 or less, more preferably 4 or less, more preferably 3 or less, more preferably 2 or less, more preferably 1 or less as compared with SEQ ID NO: 4.

[0108] Preferably, any residue of FR1 that is different from its corresponding residue of SEQ ID NO: 4 is a conservative substitution compared to its corresponding residue. Preferably, the residue of FR1 corresponding to residue number 1 of SEQ ID NO: 4 is D or E, and most preferably, D. Preferably, the residues of FR1 corresponding to residue numbers 1 to 5 of SEQ ID NO: 4 are DVQLV. Preferably, FR1 comprises SEQ ID NO: 4, or more preferably, consists of SEQ ID NO: 4. Preferably, the residue of FR1 corresponding to residue number 24 of SEQ ID NO: 4 is S.

[0109] FR2 Preferably, FR2 of the polypeptide of the present invention comprises a sequence having 10%, 15%, 25%, 30%, 40%, 45%, 55%, 60%, 70%, 75%, 85%, 90%, or more sequence identity with SEQ ID NO: 5, or more preferably, consists of the above sequence.

[0110] Alternatively, FR2 of the polypeptide of the present invention comprises, more preferably consists of, a sequence having 13 or fewer, more preferably 12 or fewer, more preferably 11 or fewer, more preferably 10 or fewer, more preferably 9 or fewer, more preferably 8 or fewer, more preferably 7 or fewer, more preferably 6 or fewer, more preferably 5 or fewer, more preferably 4 or fewer, more preferably 3 or fewer, more preferably 2 or fewer, more preferably 1 or fewer additions as compared to SEQ ID NO: 5. Preferably, FR2 of the polypeptide of the present invention comprises, more preferably consists of, a sequence having 13 or fewer, more preferably 12 or fewer, more preferably 11 or fewer, more preferably 10 or fewer, more preferably 9 or fewer, more preferably 8 or fewer, more preferably 7 or fewer, more preferably 6 or fewer, more preferably 5 or fewer, more preferably 4 or fewer, more preferably 3 or fewer, more preferably 2 or fewer, more preferably 1 or fewer substitutions as compared to SEQ ID NO: 5. Preferably, FR2 of the polypeptide of the present invention comprises, more preferably consists of, a sequence having 13 or fewer, more preferably 12 or fewer, more preferably 11 or fewer, more preferably 10 or fewer, more preferably 9 or fewer, more preferably 8 or fewer, more preferably 7 or fewer, more preferably 6 or fewer, more preferably 5 or fewer, more preferably 4 or fewer, more preferably 3 or fewer, more preferably 2 or fewer, more preferably 1 or fewer deletions as compared to SEQ ID NO: 5.

[0111] Preferably, any residue of FR2 that is different from its corresponding residue of SEQ ID NO: 5 is a conservative substitution compared to its corresponding residue. Preferably, the residue of FR2 corresponding to residue number 10 of SEQ ID NO: 5 is R or L, most preferably L. Preferably, the residues of FR2 corresponding to residue numbers 8 - 11 of SEQ ID NO: 5 are KEXE, where X is R or L, most preferably L. Alternatively, the residues of FR2 corresponding to residue numbers 9 - 12 of SEQ ID NO: 5 are GLEW. Preferably, FR2 comprises SEQ ID NO: 5, or more preferably, consists of SEQ ID NO: 5. Preferably, the residue of FR2 corresponding to residue number 2 of SEQ ID NO: 5 is F, and more preferably, further, the residue of FR2 corresponding to residue number 14 of SEQ ID NO: 5 is A. Preferably, the residues of FR2 corresponding to residues 9 - 14 of SEQ ID NO: 5 are ELEFLA (SEQ ID NO: 79). Preferably, the residues of FR2 corresponding to residues 9 - 14 of SEQ ID NO: 5 are not GLEWVS (SEQ ID NO: 80). Preferably, the residue of FR2 corresponding to residue number 9 of SEQ ID NO: 5 is not G. More preferably, the residue of FR2 corresponding to residue number 9 of SEQ ID NO: 5 is E.

[0112] FR3 Preferably, FR3 of the polypeptide of the present invention comprises a sequence sharing 8%, 15%, 20%, 26%, 32%, 40%, 45%, 52%, 58%, 65%, 70%, 76%, 80%, 82%, 85%, 90%, 92%, 95%, or more sequence identity with SEQ ID NO: 6, or more preferably, consists of the above sequence.

[0113] Alternatively, FR3 of the polypeptide of the present invention includes, or more preferably consists of, a sequence having an addition of 29 or less, more preferably 27 or less, more preferably 25 or less, more preferably 23 or less, more preferably 21 or less, more preferably 19 or less, more preferably 17 or less, more preferably 15 or less, more preferably 13 or less, more preferably 11 or less, more preferably 9 or less, more preferably 7 or less, more preferably 6 or less, more preferably 5 or less, more preferably 4 or less, more preferably 3 or less, more preferably 2 or less, more preferably 1 or less, when compared with SEQ ID NO: 6. Preferably, FR3 of the polypeptide of the present invention includes, or more preferably consists of, a sequence having a substitution of 29 or less, more preferably 27 or less, more preferably 25 or less, more preferably 23 or less, more preferably 21 or less, more preferably 19 or less, more preferably 17 or less, more preferably 15 or less, more preferably 13 or less, more preferably 11 or less, more preferably 9 or less, more preferably 7 or less, more preferably 6 or less, more preferably 5 or less, more preferably 4 or less, more preferably 3 or less, more preferably 2 or less, more preferably 1 or less, when compared with SEQ ID NO: 6. Preferably, FR3 of the polypeptide of the present invention includes, or more preferably consists of, a sequence having a deletion of 29 or less, more preferably 27 or less, more preferably 25 or less, more preferably 23 or less, more preferably 21 or less, more preferably 19 or less, more preferably 17 or less, more preferably 15 or less, more preferably 13 or less, more preferably 11 or less, more preferably 9 or less, more preferably 7 or less, more preferably 6 or less, more preferably 5 or less, more preferably 4 or less, more preferably 3 or less, more preferably 2 or less, more preferably 1 or less, when compared with SEQ ID NO: 6.

[0114] Preferably, any residue of FR3 that is different from its corresponding residue of SEQ ID NO: 6 is a conservative substitution compared to its corresponding residue. Preferably, FR3 includes SEQ ID NO: 6, or more preferably, consists of SEQ ID NO: 6. Preferably, the residues of FR3 corresponding to residue numbers 18, 19, and 20 of SEQ ID NO: 6 are NSL. Preferably, the residue of FR3 corresponding to residue number 21 of SEQ ID NO: 6 is R. Preferably, the residue of FR3 corresponding to residue number 22 of SEQ ID NO: 6 is A.

[0115] FR4 Preferably, the FR4 of the polypeptide of the present invention includes a sequence having 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more sequence identity with SEQ ID NO: 7, or more preferably, consists of the above sequence.

[0116] Alternatively, the FR4 of the polypeptide of the present invention includes a sequence having 10 or less, more preferably 9 or less, more preferably 8 or less, more preferably 7 or less, more preferably 6 or less, more preferably 5 or less, more preferably 4 or less, more preferably 3 or less, more preferably 2 or less, more preferably 1 or less addition compared to SEQ ID NO: 7, or more preferably, consists of the above sequence. Preferably, the FR4 of the polypeptide of the present invention includes a sequence having 10 or less, more preferably 9 or less, more preferably 8 or less, more preferably 7 or less, more preferably 6 or less, more preferably 5 or less, more preferably 4 or less, more preferably 3 or less, more preferably 2 or less, more preferably 1 or less substitution compared to SEQ ID NO: 7, or more preferably, consists of the above sequence. Preferably, the FR4 of the polypeptide of the present invention includes a sequence having 10 or less, more preferably 9 or less, more preferably 8 or less, more preferably 7 or less, more preferably 6 or less, more preferably 5 or less, more preferably 4 or less, more preferably 3 or less, more preferably 2 or less, more preferably 1 or less deletion compared to SEQ ID NO: 7, or more preferably, consists of the above sequence.

[0117] Preferably, any residue of FR4 that is different from its corresponding residue of SEQ ID NO: 7 is a conservative substitution compared to its corresponding residue. Preferably, FR3 includes SEQ ID NO: 6, or more preferably, consists of SEQ ID NO: 7.

[0118] All polypeptides Preferably, the polypeptide of the present invention includes a sequence having 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with SEQ ID NO: 8, or more preferably, consists of the above sequence.

[0119] Alternatively, the polypeptide of the present invention includes, or more preferably consists of, a sequence having an addition of 20 or less, more preferably 15 or less, more preferably 10 or less, more preferably 9 or less, more preferably 8 or less, more preferably 7 or less, more preferably 6 or less, more preferably 5 or less, more preferably 4 or less, more preferably 3 or less, more preferably 2 or less, more preferably 1 or less when compared with SEQ ID NO: 8. Preferably, the polypeptide of the present invention includes, or more preferably consists of, a sequence having a substitution of 20 or less, more preferably 15 or less, more preferably 10 or less, more preferably 9 or less, more preferably 8 or less, more preferably 7 or less, more preferably 6 or less, more preferably 5 or less, more preferably 4 or less, more preferably 3 or less, more preferably 2 or less, more preferably 1 or less when compared with SEQ ID NO: 8. Preferably, the polypeptide of the present invention includes, or more preferably consists of, a sequence having a deletion of 20 or less, more preferably 15 or less, more preferably 10 or less, more preferably 9 or less, more preferably 8 or less, more preferably 7 or less, more preferably 6 or less, more preferably 5 or less, more preferably 4 or less, more preferably 3 or less, more preferably 2 or less, more preferably 1 or less when compared with SEQ ID NO: 8.

[0120] Preferably, the N-terminus of the polypeptide is D. Preferably, the polypeptide includes SEQ ID NO: 8, or more preferably consists of SEQ ID NO: 8.

[0121] Framework embodiments In one aspect of the present invention, a polypeptide is provided that includes four framework regions (FR1 to FR4), each framework region being a variant of the corresponding framework region of ID-A62U (i.e., SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7). Preferably, each variant framework region shares at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, or more preferably at least 90% identity with its corresponding framework region of ID-A62U. More preferably, the variant framework region comprises, or more preferably consists of, the corresponding framework region of ID-A62U. Preferably, the polypeptide comprising the four framework regions is an antibody or an antibody fragment. Preferably, the antibody fragment is a VHH, VH, VL, V-NAR, scFv, FAb fragment, or F(ab’)2 fragment. More preferably, the antibody fragment is a VHH or VH, and most preferably a VHH.

[0122] Epitope Example 5 details the epitope modeling work performed on V7R-2E9, a polypeptide of the present invention. This work shows that V7R-2E9 binds to the following residues of IL-7Rα. Residues that fill regions particularly important at the interface are highlighted in bold. The residue numbering corresponds to SEQ ID NO: 65.

[0123]

Table 10

[0124] Accordingly, in one aspect of the present invention, there is provided a polypeptide that binds to an epitope on IL-7Rα (SEQ ID NO: 65) and includes at least one residue of IL-7Rα selected from the list consisting of Glu27, Ser31, Leu57, Val58, Glu59, Lys77, Lys78, Phe79, Leu80, Leu81, Ile82, Thr104, Lys137, Lys138, Tyr139, Lys141, His191, Tyr192, and Phe193. Preferably, the polypeptide binds to an epitope on IL-7Rα that includes at least 8, more preferably at least 15, and even more preferably at least all of the residues of IL-7Rα selected from this list.

[0125] It may be noted that certain residues of IL-7Rα fill regions that are particularly important for the interface with V7R-2E9. Accordingly, in a further aspect of the present invention, there is provided a polypeptide that binds to an epitope on IL-7Rα (SEQ ID NO: 65) and includes at least one residue of IL-7Rα selected from the list consisting of Ser31, Val58, Phe79, Leu80, Leu81, Ile82, Lys138, Tyr139, and Phe193. Preferably, the polypeptide binds to an epitope on IL-7Rα that includes at least Val58, Leu80, and Lys138 of IL-7Rα. More preferably, they are Val58, Leu80, Lys138, Ile82, and Tyr139 of IL-7Rα. Even more preferably, they are Val58, Leu80, Lys138, Ile82, Tyr139, Leu81, and Phe79 of IL-7Rα. Preferably, the polypeptide binds to an epitope on IL-7Rα that includes at least 5, more preferably at least 7, and even more preferably all of the residues of IL-7Rα selected from Ser31, Val58, Phe79, Leu80, Leu81, Ile82, Lys138, Tyr139, and Phe193.

[0126] Preferably, in this context, "binding to an epitope" can be defined such that upon polypeptide binding, the relevant residues of IL-7Rα that constitute the epitope have at least its BSA as mentioned in the above table with respect to the relevant residues.

[0127] Linker and multimer The constructs according to the present invention comprise a plurality of polypeptides and may preferably be multivalent. Such constructs may comprise at least two identical polypeptides according to the present invention. A construct consisting of two identical polypeptides according to the present invention is a "homo-bivalent head". In one aspect of the present invention, constructs comprising two or more identical polypeptides of the present invention are provided.

[0128] Alternatively, the construct may comprise at least two polypeptides that are different but both polypeptides according to the present invention ("hetero-bivalent head").

[0129] Alternatively, such constructs may comprise (a) at least one polypeptide according to the invention and (b) at least one polypeptide such as an antibody or an antigen-binding fragment thereof that is not a polypeptide of the invention (also a “heterohead”). The at least one polypeptide of (b) may bind to the IL-7R (e.g., to that of (a) via a different epitope) or, alternatively, to a target other than the IL-7R. Preferably, the different polypeptide (b) binds to, for example, interleukins (such as IL-1, IL-1ra, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, IL-17, and -18), interleukin receptors (such as IL-6R), transcription factors (such as NF-kB), cytokines (such as TNF-α, IFN-γ, TGF-β), transmembrane proteins (such as gp130 and CD3), surface glycoproteins (such as CD4, CD20, CD40), soluble proteins (such as CD40L), integrins (such as a4b7 and AlphaEbeta7), adhesion molecules (such as MAdCAM), chemokines (such as IP10 and CCL20), chemokine receptors (such as CCR2 and CCR9), inhibitory proteins (such as SMAD7), kinases (such as JAK3), G protein-coupled receptors (such as the sphingosine-1-P receptor), or other inflammatory mediators or immunologically relevant ligands involved in human pathological processes. Thus, the different polypeptide (b) binds to, for example, IL-6R, IL-6, IL-12, IL-1-β, IL-17A, TNF-α, or CD3, or to other inflammatory mediators or immunologically relevant ligands involved in human pathological processes.

[0130] The construct can be multivalent and / or multispecific. A multivalent construct (such as a bivalent construct) contains two or more binding polypeptides and thus presents two or more sites where binding to one or more antigens can occur. Examples of multivalent constructs can be homobivalent or heterobivalent. A multispecific construct (e.g., a bispecific construct) contains two or more different binding polypeptides that present two or more sites where (a) binding to two or more different antigens can occur, or (b) binding to two or more different epitopes on the same antigen can occur. A multispecific construct can be heterobivalent. A multispecific construct is multivalent.

[0131] Preferably, the polypeptide contained within the construct is an antibody fragment. More preferably, the polypeptide contained within the construct is selected from the list consisting of VHH, VH, VL, V-NAR, scFv, Fab fragment, or F(ab’)2 fragment. More preferably, the polypeptide contained within the construct is VH or VHH, and most preferably, VHH.

[0132] Preferably, the polypeptide contained within the construct is selected from the list consisting of ICVD (e.g., VHH, VH, VL), V-NAR, scFv, Fab fragment, or F(ab’)2 fragment. More preferably, the polypeptide contained within the construct is ICVD, more preferably, the polypeptide contained within the construct is VH or VHH, and most preferably, VHH.

[0133] The polypeptides of the present invention can be linked to each other directly (i.e., without using a linker) or via a linker. Preferably, the linker is a protease-labile linker or a non-protease-labile linker. The linker is preferably a polypeptide and is selected to enable binding of the polypeptide to its epitope. When used for therapeutic purposes, the linker is preferably non-immunogenic in the subject to whom the polypeptide is administered. Preferably, all polypeptides are connected by non-protease-labile linkers. Preferably, the protease-labile linker is [-(Ga S) x -BJB’-(G a S) y -] z is of the format: where J is lysine or arginine; B is 0 - 5 amino acid residues selected from R, H, N, Q, S, T, Y, G, A, V, L, W, P, M, C, F, K, or I; B’ is 0 - 5 amino acid residues selected from R, H, N, Q, S, T, Y, G, A, V, L, W, M, C, F, K, or I; a is 1 - 10; x is 1 - 10; y is 1 - 10; and z is 1 - 10 (SEQ ID NO: 85). Preferably, a is 4. Most preferably, a is 4, J is lysine, B is 0, x is 1, y is 1, and z is 1. Alternatively, the protease - labile linker is -(G4S) x -K-(G4S) y - is of the format: where x and y are each independently 1 - 5 (SEQ ID NO: 86), more preferably -(G4S)2 - K-(G4S)2 - (SEQ ID NO: 87).

[0134] Preferably, the non - protease - labile linker is (G4S) x (SEQ ID NO: 88) is of the format. More preferably, x is 1 - 10, more preferably x is 4 - 8, more preferably x is 4, 6, or 8. Most preferably, x is 6 (SEQ ID NO: 89).

[0135] Vectors and Hosts As used herein, the term "vector" is intended to refer to a nucleic acid molecule that can carry another nucleic acid to which it is linked. One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop to which additional DNA segments can be ligated. Another type of vector is a viral vector, to which additional DNA segments can be ligated to the viral genome. Certain vectors are capable of autonomous replication in the host cells into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian and yeast vectors). Other vectors (e.g., non-episomal mammalian vectors) can integrate into the genome of the host cell upon introduction into the host cell and are thereby replicated with the host genome. In addition, certain vectors can direct the expression of genes to which they are operably linked. Such vectors are referred to herein as "recombinant expression vectors" (or simply "recombinant vectors"). Generally, expression vectors useful in recombinant DNA technology are often in the form of plasmids. As used herein, the terms "plasmid" and "vector" can be used interchangeably since the plasmid is the most commonly used form of vector. However, the present invention contemplates other forms of expression vectors such as viral vectors (e.g., replication-defective retroviruses, adenoviruses, and adeno-associated viruses) that perform equivalent functions, as well as bacteriophage-based and phagemid-based systems. The present invention further relates to polypeptide sequences, or nucleotide sequences encoding multivalent and / or multispecific constructs. As used herein, the term "recombinant host cell" (or simply "host cell") is intended to refer to a cell into which a recombinant expression vector has been introduced. Such term is also intended to refer to not only the particular subject cell but also the progeny of such a cell.

[0136] In one aspect of the present invention, there is provided a vector comprising a polynucleotide encoding the polypeptide or construct of the present invention, or a cDNA comprising said polynucleotide. In a further aspect of the present invention, there is provided a host cell transformed with said vector that is capable of expressing the polypeptide or construct of the present invention. Preferably, the host cell is a bacterium such as Escherichia coli, or a yeast belonging to the genus Aspergillus, Saccharomyces, Kluyveromyces, Hansenula, or Pichia, for example, Saccharomyces cerevisiae or Pichia pastoris.

[0137] Autoimmune and / or inflammatory diseases Autoimmune diseases occur when the immune system reacts detrimentally to normal body tissues. Autoimmune diseases can result in tissue damage, abnormal organ growth, and / or changes in organ function. The disorder can affect only one organ or tissue type, or it can affect multiple organs and tissues. Organs and tissues commonly affected by autoimmune diseases include blood components, such as red blood cells, blood vessels, connective tissue, endocrine glands, such as the thyroid or pancreas, muscle, joints, and skin. Inflammatory diseases are diseases characterized by inflammation. Many inflammatory diseases are autoimmune diseases, and vice versa.

[0138] The polypeptide, pharmaceutical composition, or construct of the present invention is suitable for use as a medicament and is more suitable for use in the treatment of autoimmune and / or inflammatory diseases.

[0139] The polypeptide of the present invention (preferably when delivered orally), in which IL-7 and / or L-TSLP contribute to at least a certain proportion of the disease state, ideally treats inflammatory diseases, and the polypeptide can access tissues in which IL-7 and / or L-TSLP are biologically active.

[0140] The polypeptide of the present invention binds to the receptor (IL-7R). Thus, it can also interfere with yet-to-be-discovered cytokines or other binding partners of IL-7R that may be involved in the disease.

[0141] Inhibition of IL-7 and L-TSLP binding to IL-7R Evidence that various isoforms of TSLP are differentially expressed and act via various signaling pathways suggests that the short isoforms of this cytokine are not physiologically beneficial effects, but rather that the disease-related activity of L-TSLP can be selectively targeted. The polypeptides of the present invention inhibit the binding of IL-7 to IL-7R. Information from in-silico modeling of the interaction between the V7R-2E9 molecule and IL-7Rα and the recently published structure of the TSLP:TSLPR:IL-7R complex (Verstraete et al., 2017) strongly suggests that the V7R-2E9 and other polypeptides of the present invention inhibit the binding of both IL-7 and L-TSLP to IL-7Rα. The ability of V7R-2E9 to potently block both receptor binding and cell-based biological activities of IL-7 (IL-7-induced STAT5 phosphorylation) and L-TSLP (TSLP-induced TARC secretion) was confirmed. Since V7R-2E9 binds to IL-7Rα rather than TSLP, it is expected that V7R-2E9 and related ICVDs will block only the pro-inflammatory activity of L-TSLP and that the important mucosal homeostasis function of S-TSLP will not be affected.

[0142] Inflammatory bowel disease (IBD) Chronic inflammatory bowel diseases, Crohn's disease, and ulcerative colitis, which afflict both children and adults, are examples of autoimmune and inflammatory diseases of the GIT (Hendrickson et al., 2002). Ulcerative colitis is defined as a condition in which the inflammatory response and morphological changes remain confined to the colon. The rectum is involved in 95% of patients. The inflammation is mostly restricted to the mucosa and consists of a continuous disorder of variable severity, with ulcers, edema, and bleeding along the length of the colon (Hendrickson et al., 2002). Ulcerative colitis is usually manifested by the presence of bloody and mucous stools, along with the most severe lower abdominal cramps during passage of stools. Clinically, the presence of diarrhea with blood and mucus differentiates ulcerative colitis from irritable bowel syndrome, which is blood-free. Unlike ulcerative colitis, the symptoms of Crohn's disease are usually subtle, leading to a delay in diagnosis. Factors such as the location, extent, and severity of the disorder determine the range of gastrointestinal symptoms. Patients with ileocolonic involvement usually have postprandial abdominal pain, tenderness in the right lower abdomen, and sometimes, inflammatory masses. Symptoms associated with Crohn's disease of the gastroduodenum include early satiety, nausea, vomiting, epigastric pain, or dysphagia. Perianal diseases with anal tags, deep anal fissures, and fistulas are common (Hendrickson et al., 2002).

[0143] Preferably, the polypeptide, pharmaceutical composition, or construct of the present invention is used in the treatment of autoimmune and / or inflammatory diseases of the GI (gastrointestinal) tract in which IL-7 and / or L-TSLP contribute to the pathogenesis of the disease.

[0144] Preferably, the polypeptide, pharmaceutical composition, or construct of the present invention is used in the treatment of autoimmune and / or inflammatory diseases of the GI tract selected from the list consisting of Crohn's disease, ulcerative colitis, irritable bowel disease, type II diabetes, glomerulonephritis, autoimmune hepatitis, Sjogren's syndrome, celiac disease, and drug-induced or radiation-induced mucositis (more preferably Crohn's disease or ulcerative colitis, most preferably ulcerative colitis).

[0145] Eosinophilic esophagitis (EoE) Eosinophilic esophagitis (also spelled eosinophilic oesophagitis and known as allergic esophagitis) is an allergic inflammatory disease of the esophagus involving eosinophils, a type of white blood cell. Symptoms include dysphagia, food impaction, vomiting, and heartburn. Preferably, the polypeptide, pharmaceutical composition, or construct of the invention is used in the treatment of eosinophilic esophagitis. More preferably, the polypeptide, pharmaceutical composition, or construct is used in the treatment of eosinophilic esophagitis and is administered orally.

[0146] Other autoimmune / inflammatory diseases For example, other diseases of the GIT that can be treated by oral administration of the polypeptide of the invention include, for example, mucositis of inflammatory diseases (preferably drug-induced and radiation-induced mucositis), asthma, idiopathic pulmonary fibrosis, atopic dermatitis, allergic conjunctivitis, allergic rhinitis, Netherton syndrome, food allergy, allergic diarrhea, eosinophilic gastroenteritis, allergic bronchopulmonary aspergillosis (ABPA), allergic fungal rhinosinusitis, cancer, COPD, keloid, chronic rhinosinusitis (CRS), nasal polyps, chronic eosinophilic pneumonia, eosinophilic bronchitis, celiac disease, and Churg-Strauss syndrome.

[0147] In mucositis, lesions can occur anywhere from the mouth to the anus. In the case of oral and esophageal lesions, a preparation of an oral rinse or cream containing the variable domain can be used. In the case of anal and rectal lesions, a suppository, cream, or foam containing the variable domain is suitable for topical application. The immunoglobulin chain variable domain is removed from the lamina propria or other inflammatory sites via absorption into the bloodstream at the site of inflammation or via lymphatic clearance followed by influx into the bloodstream. Thus, the domain reaches the liver via the bloodstream and is removed by glomerular filtration in the kidney. Therefore, there is sufficient logical basis to conclude that the domain functions therapeutically in diseases such as autoimmune hepatitis, type II diabetes, and glomerulonephritis.

[0148] In one embodiment, the polypeptide or construct of the invention is preferably in the form of a cream, nanoparticle, ointment, or hydrogel and is preferably used in the treatment or prevention of atopic dermatitis by topical delivery to and / or through the skin.

[0149] Preferably, the polypeptide, pharmaceutical composition, or construct is used in the treatment of other autoimmune / inflammatory diseases that cause a certain percentage of the conditions in which IL-7 and / or L-TSLP are observed.

[0150] Therapeutic Use and Delivery A therapeutically effective amount of the polypeptide, pharmaceutical composition, or construct of the present invention, upon single or multiple administrations to a subject, is an amount effective to significantly inhibit, in the subject, the binding of IL-7 and / or L-TSLP to the IL-7R. The therapeutically effective amount may vary depending on factors such as the disease state, the age, sex, and weight of the individual, and the ability of the polypeptide, pharmaceutical composition, or construct to induce the desired response in the individual. The therapeutically effective amount is also an amount where the therapeutically beneficial effect exceeds any toxic or detrimental effects of the polypeptide, pharmaceutical composition, or construct of the present invention. The polypeptide or construct of the present invention may be incorporated into a pharmaceutical composition suitable for administration to a subject. The polypeptide or construct of the present invention may be in the form of a pharmaceutically acceptable salt.

[0151] The pharmaceutical composition of the present invention can be preferably formulated for oral, intramuscular, subcutaneous, or intravenous delivery. The pharmaceutical composition of the present invention may be in various forms. These forms include, for example, liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, tablets, pills, powders, liposomes, and suppositories, such as liquid, semi-solid, and solid dosage forms. Solid dosage forms are preferred. The polypeptide, pharmaceutical composition, or construct of the present invention may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, lozenges, capsules, elixirs, suspensions, syrups, wafers, etc. For the treatment of eosinophilic esophagitis, delivery in the form of lozenges is particularly preferred. For the treatment of atopic dermatitis, delivery in the form of creams is particularly preferred.

[0152] Typically, a pharmaceutical composition comprises a polypeptide or construct of the invention and a pharmaceutically acceptable diluent or carrier. Examples of pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, and combinations thereof. Pharmaceutically acceptable carriers further include minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers that enhance the shelf life or effectiveness of the polypeptide or construct of the invention. The pharmaceutical composition includes antiadherents, binders, coatings, disintegrants, flavorings, colorants, lubricants, adsorbents, preservatives, sweetening agents, freeze dry excipients (including lyoprotectants) or compression aids.

[0153] In patients with EoE and UC, it is thought that the epithelial barrier of the inflamed intestinal mucosa is impaired, and as a result, the permeation of the orally administered polypeptide of the invention into the underlying mucosal tissue is promoted, which in some cases results in the inhibition of both IL-7 activity and L-TSLP activity in the target tissue at the site of inflammation. Oral administration of the polypeptide of the invention should limit systemic inhibition of IL-7 activity and L-TSLP activity and reduce the risk of the general immunosuppression associated with conventional IL-7 and TSLP antibodies administered by injection. Short-term anti-IL-7R antibody treatment, such as that performed in animal models, can result in long-term clinical effects (remission) due to the depletion of pathogenic T cells. However, repeated systemic administration of existing IL-7Rα-blocking antibodies to patients results in the inhibition of thymic T cell development and the depletion of peripheral T cells, and is likely to result in significant systemic immunosuppression. Inflammatory bowel diseases (Crohn's disease and ulcerative colitis) and EoE are mostly confined to the gastrointestinal tract, and as a result, oral administration of the polypeptide of the invention to the inflamed intestinal mucosa achieves local effects with limited systemic exposure, thereby offering the potential to reduce the risk of immunosuppression in tissues not affected by the disease.

[0154] Accordingly, the polypeptide, pharmaceutical composition, or construct of the present invention is preferably administered orally. The polypeptide, pharmaceutical composition, or construct is orally delivered to the buccal cavity, pharynx, and esophagus (more preferably the esophagus) (such as for the treatment of EoE), or may be orally delivered to the duodenum, jejunum, ileum, cecum, colon, rectum, and / or anal canal (such as for the treatment of IBD).

[0155] An important issue regarding oral delivery is to ensure that a sufficient amount of the polypeptide, pharmaceutical composition, or construct reaches the required region of the gastrointestinal tract. Factors that prevent the polypeptide, pharmaceutical composition, or construct of the present invention from reaching the required region of the gastrointestinal tract include the presence of proteases in digestive secretions that can degrade the polypeptide, pharmaceutical composition, or construct of the present invention. Preferably, the polypeptide, pharmaceutical composition, or construct of the present invention is substantially stable in the presence of one or more of such proteases due to the inherent properties of the polypeptide or its construct. Preferably, the polypeptide or construct of the present invention is lyophilized before being incorporated into the pharmaceutical composition.

[0156] The polypeptide of the present invention can also be provided with an enteric coating. An enteric coating is a polymeric barrier applied to oral medications that helps protect the polypeptide from the low pH of the stomach. Materials used for enteric coatings include fatty acids, waxes, shellac, plastics, and vegetable fibers. Suitable enteric coating components include methyl acrylate-methacrylic acid copolymer, cellulose acetate succinate, hydroxypropyl methylcellulose phthalate, hydroxypropyl methylcellulose acetate succinate (hypromellose acetate succinate), polyvinyl acetate phthalate (PVAP), methyl methacrylate-methacrylic acid copolymer, sodium alginate, and stearic acid. Suitable enteric coatings include pH-dependent release polymers. These are polymers that are insoluble at the strongly acidic pH found in the stomach but dissolve rapidly at a weakly acidic pH. Thus, preferably, the enteric coating does not dissolve in the acidic secretions of the stomach (pH ~ 3) but dissolves in the higher pH environment present in the small intestine (pH above 6) or colon (pH above 7.0). The pH-dependent release polymer is selected such that the polypeptide or construct of the present invention is released at approximately the time its dose reaches the small intestine.

[0157] When administered orally for the treatment of IBD, the polypeptide of the present invention is preferably provided with an enteric coating. When administered orally for the treatment of EoE, the polypeptide of the present invention is preferably provided in the form of a compressed troche.

[0158] The polypeptide, construct, or pharmaceutical composition of the present invention is delivered locally. Such pharmaceutical compositions may preferably be in the form of creams, ointments, lotions, gels, foams, transdermal patches, powders, pastes, or tinctures, and preferably contain vitamin D3 analogs (e.g., calcipotriol and maxacalcitol), steroids (e.g., fluticasone propionate, betamethasone valerate, and clobetasol propionate), retinoids (e.g., tazarotene), coal tar, and dithranol. Topical agents are often used in combination with each other (e.g., vitamin D3 and steroids) or further combined with agents such as salicylic acid.

[0159] The polypeptide, construct, or pharmaceutical composition of the present invention can be formulated into a preparation for injection by dissolution, suspension, or emulsification in an aqueous solvent or a non-aqueous solvent, such as vegetable oil or other similar oils, synthetic fatty acid glycerides, esters of higher fatty acids, or propylene glycol, and, desirably, using conventional additives, such as solubilizing agents, isotonic agents, suspending agents, emulsifying agents, stabilizers, and preservatives. Acceptable carriers, excipients, and / or stabilizers are non-toxic to the recipient at the dosage and concentration used, and include buffers, such as phosphates, citrates, and other organic acids; antioxidants including ascorbic acid, glutathione, cysteine, methionine, and citric acid; preservatives (ethanol, benzyl alcohol, phenol, m-cresol, p-chlor-m-cresol, methyl paraben or propyl paraben, benzalkonium chloride, or combinations thereof); amino acids such as arginine, glycine, ornithine, lysine, histidine, glutamic acid, aspartic acid, isoleucine, leucine, alanine, phenylalanine, tyrosine, tryptophan, methionine, serine, proline, and combinations thereof; monosaccharides, disaccharides, and other carbohydrates; low molecular weight (less than about 10 residues) polypeptides; proteins such as gelatin or serum albumin; chelating agents such as EDTA; sugars such as trehalose, sucrose, lactose, glucose, mannose, maltose, galactose, fructose, sorbose, raffinose, glucosamine, N-methylglucosamine, galactosamine, and neuraminic acid; and / or nonionic surfactants such as polysorbate, POE ether, poloxamer, Triton-X, or polyethylene glycol.

[0160] For all delivery modes, the polypeptide, pharmaceutical composition, or construct of the present invention may be formulated in a buffer to stabilize the pH of the composition between 5 and 50, or more preferably between 15 and 40, or more preferably between 25 and 30 g / liter. Examples of suitable buffer components include physiological salts such as sodium citrate and / or citric acid. Preferably, the buffer contains 100 to 200, more preferably 125 to 175 mM of physiological salt, such as sodium chloride. Preferably, the buffer is selected to have a pKa close to the pH of the composition or the physiological pH of the patient.

[0161] The concentration of an exemplary polypeptide or construct in a pharmaceutical composition can range from about 1 mg / mL to about 200 mg / mL, or from about 50 mg / mL to about 200 mg / mL, or from about 150 mg / mL to about 200 mg / mL.

[0162] An aqueous formulation of the polypeptide, construct, or pharmaceutical composition of the present invention can be prepared in a pH buffer solution, for example, in the range of about 4.0 to about 7.0 or about 5.0 to about 6.0, or alternatively at a pH of about 5.5. Examples of suitable buffers include phosphate buffer, histidine buffer, citrate buffer, succinate buffer, acetate buffer, and other organic acid buffers. The concentration of the buffer can be, for example, about 1 mM to about 100 mM, or about 5 mM to about 50 mM, depending on the desired tonicity of the buffer and the formulation.

[0163] The tonicity of a pharmaceutical composition can be altered by including a tonicity modifier. Such tonicity modifiers can be charged or uncharged chemical species. Representative uncharged tonicity modifiers include sugars or sugar alcohols or other polyols, preferably trehalose, sucrose, mannitol, glycerol, 1,2-propanediol, raffinose, sorbitol or lactitol (especially trehalose, mannitol, glycerol, or 1,2-propanediol). Representative charged tonicity modifiers include salts such as combinations of sodium ions, potassium ions, or calcium ions with chloride ions, sulfate ions, carbonate ions, sulfite ions, nitrate ions, lactate ions, succinate ions, acetate ions, or maleate ions (especially sodium chloride or sodium sulfate); or amino acids such as arginine or histidine. Preferably, the aqueous formulation is isotonic, although hypertonic or hypotonic solutions may also be suitable. The term "isotonic" refers to a solution having the same osmotic pressure as some other solution, such as physiological saline or serum, which is used as a comparison. The isotonic agent may be used in an amount of about 5 mM to about 350 mM, for example, in an amount of 1 mM to 500 nM. Preferably, at least one isotonic agent is included in the composition.

[0164] Surfactants can also be added to the pharmaceutical composition to reduce aggregation of the formulated polypeptide or construct and / or to minimize the formation of microparticles in the formulation and / or to reduce adsorption. Exemplary surfactants include polyoxyethylene sorbitan fatty acid esters (Tween), polyoxyethylene alkyl ethers (Brij), alkylphenyl polyoxyethylene ethers (Triton-X), polyoxyethylene-polyoxypropylene copolymers (poloxamers, Pluronics®), and sodium dodecyl sulfate (SDS). Examples of suitable polyoxyethylene sorbitan-fatty acid esters include polysorbate 20 and polysorbate 80. Exemplary concentrations of the surfactant can range from about 0.001% w / v to about 10% w / v.

[0165] During the lyophilization process, a lyoprotectant may also be added to protect the polypeptide or construct of the present invention from destabilizing conditions. For example, known lyoprotectants include saccharides (including glucose, sucrose, mannose, and trehalose); polyols (including mannitol, sorbitol, and glycerol); and amino acids (including alanine, glycine, and glutamic acid). The lyoprotectant may be included in an amount of about 10 mM to 500 mM.

[0166] The dosage range for administration of the polypeptide, pharmaceutical composition, or construct of the present invention is for generating the desired therapeutic effect. The required dosage range depends on the exact nature of the polypeptide, pharmaceutical composition, or construct of the present invention, the route of administration, the nature of the formulation, the age of the patient, the nature, extent, or severity of the patient's disease, (if any) contraindications, and the judgment of the attending physician. Variations in these dosage levels can be adjusted using standard and empirical methods for optimization.

[0167] The appropriate daily dosage of the polypeptide, pharmaceutical composition, or construct of the present invention ranges from 50 ng to 50 mg per kg, for example, 50 μg to 40 mg per kg of body weight, for example, 5 to 30 mg per kg. The unit dosage may vary from less than 100 mg, but is typically in the range of 250 to 2000 mg per administration, and the unit dosage may be administered daily or more frequently, for example, 2, 3, or 4 times per day, or less frequently, for example, every other day, or once a week, once every two weeks, or once a month.

[0168] In one aspect of the present invention, there is provided the use of the polypeptide, pharmaceutical composition, or construct of the present invention in the manufacture of a medicament for the treatment of autoimmune diseases. In a further aspect of the present invention, there is provided a method for treating an autoimmune disease, comprising the step of administering to a person in need a therapeutically effective amount of the polypeptide, pharmaceutical composition, or construct of the present invention.

[0169] In one aspect of the present invention, there is provided the use of the polypeptide, pharmaceutical composition, or construct of the present invention in the manufacture of a medicament for the treatment of autoimmune and / or inflammatory diseases. In a further aspect of the present invention, there is provided a method of treating an autoimmune and / or inflammatory disease comprising the step of administering to a person in need thereof a therapeutically effective amount of the polypeptide, pharmaceutical composition, or construct of the present invention.

[0170] The term "treatment" is intended to encompass prophylaxis as well as therapeutic treatment. Treatment of a disease encompasses treatment of its exacerbation and, for the purpose of preventing recurrence of the disease symptoms, treatment of a patient in remission from the disease symptoms.

[0171] Combination therapy The pharmaceutical composition of the present invention may also contain one or more active agents (e.g., active agents suitable for treating the diseases described herein). It is within the scope of the present invention to use the pharmaceutical composition of the present invention in a method of treating an autoimmune disease as an adjunct to, or in combination with, other established treatments commonly used in the treatment of autoimmune diseases.

[0172] In the case of treating IBD (such as Crohn's disease or ulcerative colitis), possible combinations include, for example, 5-aminosalicylic acid, or its prodrugs (such as sulfasalazine, olsalazine, or bisalazide); corticosteroids (such as prednisone, methylprednisolone, or budesonide); immunosuppressants (such as cyclosporine, tacrolimus, methotrexate, azathioprine, or 6-mercaptopurine); anti-TNF-α antibodies (such as infliximab, adalimumab, certolizumab pegol, or golimumab); anti-IL12 / IL23 antibodies (such as ustekinumab); anti-IL6R antibodies or small molecule IL12 / IL23 inhibitors (such as apilimod); anti-α-4-β-7 antibodies (such as vedolizumab); MAdCAM-1 blockers (such as PF-00547659); antibodies against the cell adhesion molecule α-4-integrin (such as natalizumab); antibodies against the IL2 receptor α subunit (such as daclizumab or basiliximab); JAK3 inhibitors (such as tofacitinib or R348); Syk inhibitors, and their prodrugs (such as fostamatinib and R-406); phosphodiesterase-4 inhibitors (such as tetomilast); HMPL-004; probiotics; Dersalazine; semapimod / CPSI-2364; and combinations with one or more active agents selected from the list including protein kinase C inhibitors (such as AEB-071). The most suitable combination agents are infliximab, adalimumab, certolizumab pegol, or golimumab.

[0173] Accordingly, another aspect of the present invention provides a pharmaceutical composition of the present invention in combination with one or more additional effective agents, such as one or more of the active agents described above.

[0174] In a further aspect of the present invention, the polypeptide, pharmaceutical composition, or construct is administered sequentially, simultaneously, or separately with at least one active agent selected from the above list.

[0175] Similarly, another aspect of the present invention is (A) a polypeptide, pharmaceutical composition, or construct of the present invention, and (B) one or more other active agents to provide a combination product comprising, wherein each of components (A) and (B) is formulated by mixing with a pharmaceutically acceptable adjuvant, diluent, or carrier. In this aspect of the present invention, the combination product can be either a single (combination) formulation or a kit-of-parts. Thus, this aspect of the present invention encompasses a combination formulation comprising a polypeptide, pharmaceutical composition, or construct of the present invention, and another therapeutic agent, mixed with a pharmaceutically acceptable adjuvant, diluent, or carrier.

[0176] The present invention also (i) a polypeptide, pharmaceutical composition, or construct of the present invention, mixed with a pharmaceutically acceptable adjuvant, diluent, or carrier, and (ii) a formulation comprising one or more other active agents, mixed with a pharmaceutically acceptable adjuvant, diluent, or carrier in a kit-of-parts, wherein components (i) and (ii) are each provided in a form suitable for administration in combination with the other.

[0177] Accordingly, component (i) of the kit of parts is the above component (A) mixed with a pharmaceutically acceptable adjuvant, diluent, or carrier. Similarly, component (ii) is the above component (B) mixed with a pharmaceutically acceptable adjuvant, diluent, or carrier. One or more other active agents (i.e., the above component (B)) can be any of the agents described above with respect to the treatment of autoimmune diseases such as, for example, IBD (e.g., Crohn's disease and / or ulcerative colitis). Where component (B) is more than one active agent, these additional active agents can be formulated with each other, with component (A), or they can be formulated separately. In one embodiment, component (B) is one other therapeutic agent. In another embodiment, component (B) is two other therapeutic agents. The combination product (either the combined formulation or the kit of parts) of this aspect of the invention may be used in the treatment or prevention of autoimmune diseases (e.g., the autoimmune diseases described herein).

[0178] Stability In one embodiment, the polypeptide or construct of the invention is delivered orally. Accordingly, the polypeptide or construct of the invention preferably substantially retains its neutralizing capacity and / or neutralizing efficacy when delivered orally.

[0179] Preferably, when orally administered and after exposure to the intestinal tract (e.g., after exposure to proteases in the small intestine and / or large intestine and / or IBD inflammatory proteases), the polypeptide or construct of the present invention substantially retains its neutralizing ability and / or efficacy. Such proteases include enteropeptidase, trypsin, chymotrypsin, and inflammatory proteases of inflammatory bowel disease (such as MMP3, MMP12, and cathepsin). Proteases in the small intestine and / or large intestine, or proteases produced in the small intestine and / or large intestine, include proteases supplied from the intestinal microbiota and / or pathogenic bacteria. For example, the protease is a cell membrane-attached protease, an excreted protease, and a protease released upon cell lysis. Most preferably, the proteases are trypsin and chymotrypsin.

[0180] Preferably, the intestinal tract is the intestinal tract of a dog, pig, human, cynomolgus monkey, or mouse. More preferably, the intestinal tract is the intestinal tract of a human, cynomolgus monkey, or mouse, and most preferably the human intestinal tract. The small intestine preferably consists of the duodenum, jejunum, and ileum. The large intestine preferably consists of the cecum, colon, rectum, and anal canal. The gastrointestinal tract consists of only the small intestine and the large intestine, in contrast to the gastrointestinal tract. In one embodiment, the polypeptide or construct of the present invention is substantially resistant to proteases in the gastrointestinal tract, most preferably the human gastrointestinal tract.

[0181] Stability in the buccal cavity, pharynx, and esophagus The buccal cavity, pharynx, and esophagus precede the stomach in the gastrointestinal tract. Preferably, when the polypeptide or construct of the present invention is delivered orally and after exposure to the buccal cavity, pharynx, and esophagus (e.g., after exposure to proteases in the buccal cavity, pharynx, and esophagus), it substantially retains its neutralizing ability and / or neutralizing efficacy. Proteases in the buccal cavity, pharynx, and esophagus include proteases obtained from the commensal microbiota and / or pathogenic bacteria. For example, the protease is a cell membrane-attached protease, an excreted protease, and a protease released by cell lysis.

[0182] Preferably, the buccal cavity, pharynx, and esophagus are those of dogs, pigs, humans, cynomolgus monkeys, or mice. More preferably, the buccal cavity, pharynx, and esophagus are those of humans, cynomolgus monkeys, or mice, and most preferably those of humans.

[0183] The polypeptide or construct of the present invention substantially retains its neutralizing ability when preferably 10% or more, more preferably 20% or more, more preferably 30% or more, more preferably 40% or more, more preferably 50% or more, more preferably 60% or more, more preferably 70% or more, more preferably 80% or more, more preferably 90% or more, more preferably 95% or more, or most preferably 100% of the original neutralizing ability of the polypeptide or construct of the present invention is retained after exposure to proteases present in the small intestine and / or large intestine and / or IBD inflammatory proteases.

[0184] Preferably, the polypeptide or construct of the present invention substantially retains its neutralizing ability after being exposed to proteases present in the small intestine and / or large intestine and / or IBD inflammatory proteases, for example, at 37°C for a maximum of at least 2 hours, more preferably a maximum of at least 3 hours, more preferably a maximum of at least 4 hours, more preferably a maximum of at least 5 hours, more preferably a maximum of at least 5.5 hours, more preferably a maximum of at least 6, more preferably a maximum of at least 6.5 hours, more preferably a maximum of at least 7, more preferably a maximum of at least 7.5, more preferably a maximum of at least 10, more preferably a maximum of at least 13, or more preferably a maximum of at least 16 hours.

[0185] The neutralizing ability of the polypeptide or construct of the present invention is preferably 10% or more, more preferably 20% or more, more preferably 30% or more, more preferably 40% or more, more preferably 50% or more, more preferably 60% or more, more preferably 70% or more, more preferably 80% or more, more preferably 90% or more, more preferably 95% or more, and is retained after exposure to intestinal conditions, more preferably the small intestine or large intestine, more preferably human fecal extract for at least 2 hours, more preferably at least 3 hours, more preferably at least 4 hours, more preferably at least 5 hours, more preferably at least 6 hours, more preferably at least 7 hours, more preferably 9 hours, more preferably at least 11 hours, more preferably at least 13 hours, more preferably at least 16 hours.

[0186] The neutralizing ability of the polypeptide or construct of the present invention is preferably 10% or more, more preferably 20% or more, more preferably 30% or more, more preferably 40% or more, more preferably 50% or more, more preferably 60% or more, more preferably 70% or more, more preferably 80% or more, more preferably 90% or more, more preferably 95% or more, and is retained after exposure to the supernatant of the mouse small intestine for preferably at least 1 hour, more preferably at least 2 hours, more preferably at least 3 hours, more preferably at least 4 hours, more preferably at least 5 hours, or more preferably at least 6 hours.

[0187] Preferably, 10% or more, more preferably 20% or more, more preferably 30% or more, more preferably 40% or more, more preferably 50% or more, more preferably 60% or more, more preferably 70% or more of the dosage of the polypeptide or construct of the present invention retains the neutralizing ability against IL-7 and / or L-TSLP, and at least 2 hours after administration, more preferably at least 3 hours, more preferably at least 4 hours, more preferably at least 5 hours, more preferably at least 6 hours, more preferably at least 7 hours, more preferably at least 9 hours, more preferably at least 11 hours, more preferably at least 13 hours, or more preferably at least 16 hours later, it remains in the feces of mice, cynomolgus monkeys, and / or humans (preferably, excreted feces or feces taken out from the intestinal tract).

[0188] Preferably, 10% or more, more preferably 20% or more, more preferably 30% or more, more preferably 40% or more, more preferably 50% or more, more preferably 60% or more, more preferably 70% or more, more preferably 80% or more, more preferably 90% or more, more preferably 95% or more, more preferably 99% or more, and most preferably 100% of the administered amount of the polypeptide or construct of the present invention remains intact when exposed to proteases in the small intestine and / or large intestine and / or IBD inflammatory proteases, the polypeptide or construct of the present invention remains substantially intact.

[0189] "Stability" and "survival", for example, "stability %" and "survival %" are used interchangeably herein. "Substantially retain the neutralizing ability" and "substantially resistant" are used interchangeably herein.

[0190] In one embodiment of the present invention, based on their stability in the digest of human fecal supernatant, a polypeptide is provided that comprises, or more preferably consists of, any one of the polypeptide sequences of ICVD described below.

[0191] V7R-2E9, ID-A59U, ID-A2U, ID-A9U, ID-A10U, ID-A11U, ID-A12U, ID-A14U, ID-A15U, ID-A16U, ID-A17U, ID-A18A, ID-A19U, ID-A20U, ID-A21U, ID-A24U, ID-A43U, ID-A25U, ID-A30U, ID-A31U, ID-A50U, ID-A33U, ID-A52U, ID-A34U, ID-A53U, ID-A35U, ID-A54U, ID-A36U, ID-A55U, ID-A37U, ID-A38U, ID-A57U, ID-A39U, ID-A40U, V7R-2F6, V7R-6C12, V7R-2B6, V7R-3B5, V7R-4F6, V7R-2E5, ID-A3U, ID-A4U, ID-A5U, ID-A6U, ID-A7U, ID-A8U, ID-A13U, ID-A23U, ID-A26U, ID-A27U, ID-A28U, ID-A29U, and ID-A32U.

[0192] Also provided is a polypeptide comprising three complementarity-determining regions (CDR1-CDR3) and four framework regions (FR1-FR4), wherein CDR1 comprises, or more preferably consists of, the CDR1 sequence of any of the above ICVDs, CDR2 comprises, or more preferably consists of, the CDR2 sequence of any of the above ICVDs, and CDR3 comprises, or more preferably consists of, the CDR3 sequence of any of the above ICVDs. Most preferably, the polypeptide comprises all three CDRs from one of the above ICVDs.

[0193] Based on their stability in human fecal supernatant digests, more preferably provided is a polypeptide comprising, or more preferably consisting of, the polypeptide sequence of any one of the ICVDs described below.

[0194] V7R-2E9, ID-A59U, ID-A2U, ID-A9U, ID-A10U, ID-A11U, ID-A12U, ID-A14U, ID-A15U, ID-A16U, ID-A17U, ID-A18A, ID-A19U, ID-A20U, ID-A21U, ID-A24U, ID-A43U, ID-A25U, ID-A30U, ID-A31U, ID-A50U, ID-A33U, ID-A52U, ID-A34U, ID-A53U, ID-A35U, ID-A54U, ID-A36U, ID-A55U, ID-A37U, ID-A38U, ID-A57U, ID-A39U, ID-A40U, V7R-2F6, V7R-6C12, V7R-2B6, V7R-3B5, V7R-4F6, and V7R-2E5.

[0195] Also provided is a polypeptide comprising three complementarity-determining regions (CDR1-CDR3) and four framework regions (FR1-FR4), wherein CDR1 comprises or more preferably consists of the CDR1 sequence of any of the above ICVDs, CDR2 comprises or more preferably consists of the CDR2 sequence of any of the above ICVDs, and CDR3 comprises or more preferably consists of the CDR3 sequence of any of the above ICVDs. Most preferably, the polypeptide comprises all three CDRs from one of the above ICVDs.

[0196] Based on their stability in human fecal supernatant digests, more preferably provided is a polypeptide comprising or more preferably consisting of the polypeptide sequence of any one of the ICVDs described below.

[0197] V7R-2E9, ID-A59U, ID-A2U, ID-A9U, ID-A10U, ID-A11U, ID-A12U, ID-A14U, ID-A15U, ID-A16U, ID-A17U, ID-A18A, ID-A19U, ID-A20U, ID-A21U, ID-A24U, ID-A43U, ID-A25U, ID-A30U, ID-A31U, ID-A50U, ID-A33U, ID-A52U, ID-A34U, ID-A53U, ID-A35U, ID-A54U, ID-A36U, ID-A55U, ID-A37U, ID-A38U, ID-A57U, ID-A39U, ID-A40U.

[0198] A polypeptide is also provided that comprises three complementarity-determining regions (CDR1-CDR3) and four framework regions (FR1-FR4), wherein CDR1 comprises, or more preferably consists of, any one of the CDR1 sequences of the above ICVDs, CDR2 comprises, or more preferably consists of, any one of the CDR2 sequences of the above ICVDs, and CDR3 comprises, or more preferably consists of, any one of the CDR3 sequences of the above ICVDs. Most preferably, the polypeptide comprises all three CDRs from one of the above ICVDs.

[0199] Preparation method The polypeptides of the present invention can be obtained or manipulated, for example, using the techniques disclosed in Green and Sambrook 2012 Molecular Cloning: A Laboratory Manual 4th Edition Cold Spring Harbour Laboratory Press.

[0200] Monoclonal antibodies can be produced using hybridoma technology by fusing myeloma (B cell cancer) cells selected for their ability to grow in tissue culture and the absence of antibody chain synthesis with B cells that produce the specific antibody (Kohler and Milstein 1975, and Nelson et al. 2000).

[0201] Monoclonal antibodies directed against a determined antigen can be obtained, for example, a) immortalizing lymphocytes obtained from the peripheral blood of an animal pre-immunized with the determined antigen, with an immortal cell and preferably a myeloma cell, in order to form hybridomas, b) culturing the immortalized cells (hybridomas) formed and recovering the cells producing the antibody with the desired specificity, which can be obtained by:

[0202] Alternatively, the use of hybridoma cells is not required. Thus, monoclonal antibodies can be a) cloning a DNA or cDNA sequence obtained from lymphocytes of an animal (preferably pre-immunized with the determined antigen), particularly peripheral blood lymphocytes, into a vector, particularly a phage, more particularly a filamentous bacteriophage, b) transforming a prokaryotic cell with the above vector under conditions allowing the production of the antibody, c) selecting the antibody by subjecting it to antigen-affinity selection, d) recovering the antibody with the desired specificity, which can be obtained by a process comprising:

[0203] Methods are known for immunizing camels, cloning the VHH repertoire of circulating B cells in the blood (Chomezynnski and Sacchi 1987), and isolating antigen-specific VHHs from immune (Arbabi-Ghahroudi et al. 1997) and non-immune (Tanha et al. 2002) libraries using phage, yeast, or ribosome display (WO92 / 01047, Nguyen et al. 2001, and Harmsen et al. 2007).

[0204] Antigen-binding fragments of antibodies such as scFv fragments and Fv fragments are isolated and expressed in E. coli (Miethe et al. 2013, Skerra et al. 1988, Ward et al. 1989).

[0205] Although silent with respect to the amino acid sequence of the polypeptide, mutations can be made to DNA or cDNA that result in codons preferred for translation in a particular host. For example, the codons preferred for translation of nucleic acids in E. coli and S. cerevisiae are known.

[0206] Mutations in the polypeptide can be achieved, for example, by substitution, addition, or deletion to the nucleic acid encoding the polypeptide. Substitutions, additions, or deletions to the nucleic acid encoding the polypeptide can be introduced by many methods including, for example, error-prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, iterative ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis (Ling et al. 1997), gene rearrangement, gene site saturation mutagenesis (GSSM), synthetic ligation rearrangement (SLR), or combinations of these methods. Modifications, additions, or deletions to the nucleic acid can also be introduced by methods including recombination, iterative sequence recombination, phosphorothioate-modified DNA mutagenesis, uracil-containing template mutagenesis, gapped duplex mutagenesis, point mismatch repair mutagenesis, repair-deficient host strain mutagenesis, chemical mutagenesis, radiogenic mutagenesis, deletion mutagenesis, restriction-selection mutagenesis, restriction-purification mutagenesis, ensemble mutagenesis, chimeric nucleic acid multimer generation, or combinations thereof.

[0207] In particular, artificial gene synthesis may be used (Nambiar et al. 1984, Sakamar and Khorana 1988, Well et al. 1985, and Grundstrom et al. 1985). The gene encoding the polypeptide of the present invention can be synthetically produced, for example, by solid-phase DNA synthesis. The entire gene can be de novo synthesized without the need for a precursor template DNA. To obtain the desired oligonucleotide, the building blocks are sequentially coupled to the growing oligonucleotide chain in the order required by the sequence of the product. When the chain assembly is complete, the product is released from the solid phase into solution, deprotected, and harvested. The product can be isolated by high-performance liquid chromatography (HPLC) to obtain the desired oligonucleotide of high purity (Verma and Eckstein 1998).

[0208] The expression of immunoglobulin chain variable domains such as VH and VHH can be achieved using an appropriate expression vector in prokaryotic cells such as bacteria, for example, Escherichia coli (for example, according to the protocol disclosed in WO94 / 04678, which is incorporated herein by reference and further detailed below). The expression of immunoglobulin chain variable domains such as VH and VHH can also be achieved using eukaryotic cells, for example, insect cells, CHO cells, Vero cells, or appropriate yeast cells belonging to the genus Aspergillus, Saccharomyces, Kluyveromyces, Hansenula, or Pichia. Preferably, S. cerevisiae is used (for example, according to the protocol disclosed in WO94 / 025591, which is incorporated herein by reference and further detailed below).

[0209] Specifically, VHH is a) cloning the DNA or cDNA sequence encoding a VHH optionally containing a His-tag (for example, obtained from the lymphocytes of a camelid animal or synthetically produced) into a Bluescript vector (Agilent Technologies), b) After amplification using a 5' primer specific for the VHH containing the XhoI site and a 3' primer containing the SpeI site having the sequence TCTTAACTAGTGAGGAGACGGTGACCTG (SEQ ID NO: 81), the step of recovering the cloned fragment c) After digestion of the vector with the restriction enzymes XhoI and SpeI, the step of cloning the fragment recovered in phase into the Immuno PBS vector (Huse et al. 1989) d) The step of transforming host cells, particularly Escherichia coli, by transfection with the recombinant Immuno PBS vector of step c e) The step of recovering the expression product of the VHH coding sequence by affinity purification, such as chromatography on a column using nickel affinity resin, for example, if the VHH contains a His tag, protein A, cation exchange A process comprising can be prepared using Escherichia coli cells according to the method disclosed in WO94 / 04678

[0210] Alternatively, immunoglobulin chain variable domains such as VH and VHH a) The step of obtaining a DNA or cDNA sequence encoding a VHH having a determined specific antigen-binding site b) The step of amplifying the obtained DNA or cDNA using a 5' primer containing a start codon and a HindIII site and a 3' primer containing a stop codon having an XhoI site c) The step of recombining the amplified DNA or cDNA into the HindIII (position 2650) site and XhoI (position 4067) site of plasmid pMM984 (Merchlinsky et al. 1983) d) The step of transfecting permissive cells, particularly NB-E cells (Faisst et al. 1995), with the recombinant plasmid e) The step of recovering the obtained product Can be obtained by a process comprising

[0211] Furthermore, immunoglobulin chain variable domains such as VHH or VH can be produced using Escherichia coli or S. cerevisiae according to the methods disclosed in Frenken et al. 2000 and WO99 / 23221 (which are hereby incorporated by reference in their entirety).

[0212] Blood samples were taken from immunized llamas, lymphocyte populations were enriched by discontinuous gradient centrifugation on Ficoll (a neutral, highly branched, high-mass, hydrophilic polysaccharide that dissolves readily in aqueous solution - Pharmacia), total RNA was isolated by acid guanidium thiocyanate extraction (Chomezynnski and Sacchi 1987), and after performing first-strand cDNA synthesis (using a cDNA kit such as RPN 1266 Amersham), DNA fragments encoding VHH and VH fragments and a part of the short or long hinge region were amplified by PCR using the specific primers detailed on pages 22 and 23 of WO99 / 23221. Upon digestion of the PCR fragments with PstI and HindIII or BstEII, DNA fragments of approximately 300 - 450 bp in length were purified by agarose gel electrophoresis and ligated into the Escherichia coli phagemid vector pUR4536 or the episomal S. cerevisiae expression vector pUR4548, respectively. pUR4536 is derived from pHEN (Hoogenboom et al. 1991) and contains the lacI q gene and unique restriction sites to enable cloning of llama VHH and VH genes. pUR4548 is derived from pSY1 (Harmsen et al. 1993). The BstEII site in the leu2 gene was removed from this plasmid by PCR, and the cloning site between the SUC2 signal sequence and terminator was replaced to facilitate cloning of the VH / VHH gene fragments. VH / VHH has a c-myc tag at the C-terminus for detection. Individual Escherichia coli JM109 colonies were grown in 1% glucose and 100 mg of L-1 It is transferred to a 96-well microtiter plate containing 150 ml of 2TY medium supplemented with ampicillin. After overnight growth (37 °C), the plate is made into two sets in 2TY medium containing 100 mg of L -1 ampicillin and 0.1 mM IPTG. After further overnight incubation and optionally freezing and thawing, the cells are centrifuged and pelleted, and the supernatant can be used in ELISA. Individual S. cerevisiae colonies are transferred to test tubes containing selective minimal medium (0.7% yeast nitrogen base supplemented with essential amino acids and bases, 2% glucose), and grown at 30 °C for 48 hours. Then, the cultures are diluted 10-fold in YPGal medium (containing 1% yeast extract, 2% bacto peptone, and 5% galactose). After 24 hours and 48 hours of growth, the cells are pelleted, and the culture supernatant can be analyzed by ELISA. The absorbance at 600 nm (OD600) is optionally measured.

[0213] Furthermore, immunoglobulin chain variable domains such as VH / VHH can be produced using S. cerevisiae using the following procedure.

[0214] Isolate the naturally occurring DNA sequence encoding VH / VHH, or obtain a synthetically generated DNA sequence encoding VH / VHH that contains a 5'-UTR, a signal sequence, a stop codon, and is flanked by a SacI site and a HindIII site (such synthetic sequences can be generated as outlined above or ordered from commercial suppliers such as Geneart (Life Technologies), for example).

[0215] To transfer the VH / VHH gene into the multicopy integration (MCI) vector pUR8569 or pUR8542, the restriction sites are used as follows. For double digestion of 25 ul of VHH DNA (Geneart plasmid or MCI vector), 1 ul of SacI, 1 ul of HindIII, and 3 ul of buffer appropriate for double digestion such as NEB buffer 1 (New England Biolabs), the DNA sequence encoding VHH, optionally contained within a shuttle vector, cassette, or other synthetic gene construct, and the MCI vector with SacI and HindIII are cut overnight at 37 °C. 25 ul of digested DNA encoding VHH and 25 ul of digested MCI vector are electrophoresed on a 1.5% agarose gel containing 1×TAE buffer, and then gel extraction is performed using, for example, the QIAquick Gel Extraction Kit (Qiagen). Ligation of the digested MCI vector and digested DNA encoding VH / VHH is set up with 100 ng of vector, 30 ng of VHH gene, 1.5 ul of 10× ligase buffer, 1 ul of T4 DNA ligase, and ddH2O. Then, ligation is carried out overnight at 16 °C.

[0216] Next, transform E. coli cells. In the case of chemically competent XL-1 Blue cells, thaw 200 ul of heat-competent XL-1 Blue cells, add 5 ul of ligation mix on ice for about 30 minutes, and then perform a heat shock at 42 °C for 90 seconds. Then, add 800 ul of Luria-Bertani low-salt medium supplemented with 2% glucose and allow the cells to recover at 37 °C for 2 hours. Plate the cells on Luria-Bertani agar and ampicillin (100 ug / ml) plates and maintain them at 37 °C overnight. In the case of electrocompetent TG1 E. coli cells, use an electroporation cuvette. In the electroporation cuvette, thaw 50 ul of electrocompetent TG1 cells and 1 ul of ligation mix on ice for about 15 minutes. Place the cuvette in the holder and apply a pulse. Add 500 ul of 2TY medium and allow the cells to recover at 37 °C for 30 minutes. Plate 100 ul of the cells on Luria-Bertani, agar plates containing ampicillin (100 ug / ml) and 2% glucose. Maintain the plates at 37 °C overnight.

[0217] After cloning the VH / VHH gene into E. coli as detailed above, S. cerevisiae can be transformed with the linearized MCI vector. Before performing the transformation, several steps are carried out as follows: (i) the DNA must be changed from circular to linear by digestion, otherwise, the DNA cannot integrate into the yeast genome, and (ii) the digested DNA must have impurities removed by ethanol precipitation. Furthermore, during the transformation process, the yeast cells become semi-permeable, allowing the DNA to pass through the cell membrane.

[0218] Preparation for yeast transformation: Perform an HpaI digestion of a midi-prep prepared from a selected E. coli colony expressing the VH / VHH gene as follows. Prepare a 100 ul solution containing 20 ng of the midi-prep, 5 ul of HpaI, 10 ul of an appropriate buffer such as NEB4 buffer (BioLabs), and ddH2O.

[0219] Cut the DNA with HpaI overnight at room temperature. Next, perform ethanol precipitation (and set aside 5 μl of the sample from the HpaI digestion). Add 300 μl of 100% ethanol to the 95 μl of HpaI-digested midiprep, vortex, and spin at full speed for 5 minutes. If a pellet is present, carefully decant, add 100 μl of 70% ethanol, and then spin again at full speed for 5 minutes. Decant the sample again and maintain at 50 - 60 °C until the pellet is dry. Resuspend the pellet in 50 μl of ddH2O. Load 5 μl on a gel alongside the 5 μl of HpaI digestion sample.

[0220] Yeast transformation: Prepare YNBglu plates. Use 10 g of agar + 425 ml of water (sterilized), 25 ml of filtered 20×YNB (3.35 g of YNB (Yeast Nitrogen Base Minimal Medium) in 25 ml of sterilized H2O), and 50 ml of sterile 20% glucose, and pour into Petri dishes. Take one yeast colony from the master plate and grow it overnight at 30 °C in 3 ml of YSD (Yeast Extract Soytone Dextrose). The next day, prepare approximately 600 ml of YSD and use it to fill three flasks with 275 ml, 225 ml, and 100 ml of YSD. Add 27.5 μl of the yeast YSD culture to the first flask and mix gently. Take 75 ml from the first flask and put it into the second flask and mix gently. Take 100 ml from the second flask and put it into the third flask and mix gently. Grow until an OD660 of 1 - 2 is reached. Divide the flask that has reached this OD into four Falcon tubes, approximately 45 ml each. Spin at 4200 rpm for 2 minutes. Discard the supernatant. Resuspend the pellet in two Falcon tubes containing 45 ml of H2O (reducing the number of tubes from 4 to 2). Spin at 4200 rpm for 2 minutes. Resuspend the pellet in 45 ml of H2O (reducing the number of tubes from 2 to 1). Spin at 4200 rpm for 2 minutes. Gently dissolve the pellet in 5 ml of lithium acetate (LiAc) (100 mM) and spin for a few seconds. Carefully discard some of the LiAc, keeping more than half of the LiAc in the tube. Vortex the cells, boil the carrier DNA for 5 minutes, and quickly cool in ice water. Add 240 μl of PEG, 50 μl of cells, 36 μl LiAc (1 M), 25 μl of carrier DNA, and 45 μl of ethanol-precipitated VH / VHH to a 15 ml tube. Mix gently after each step (process a blank sample similarly, but without using ethanol-precipitated VH / VHH). Incubate at 30 °C for 30 minutes, gently invert 3 - 4 times, then perform a heat shock at 42 °C for 20 - 25 minutes. Spin briefly at a maximum of 6000 rpm. Gently remove the supernatant, add 250 μl of ddH2O, and mix.Streak all of that onto a YNBglu plate until the plate dries and grow it at 30 °C for 4 - 5 days. Finally, prepare YNBglu by dividing the plate into six equal parts, number those parts from 1 to 6, inoculate the largest colony, and streak number 1. Repeat for the other colonies, from largest to smallest, from 1 to 6. Grow it large at 30 °C for 3 - 4 days until colonies are produced. VH / VHH clones are grown using glucose as a carbon source, and induction of VH / VHH expression is done by activating the galactose-7-promoter by addition of 0.5% galactose. Perform a 3 mL small-scale culture to test the colonies and select those showing the best expression of VH or VHH. Then use this colony for purification.

[0221] Purification: VH / VHH is purified by cation exchange chromatography using a strong anion resin (such as Capto S). On the first day, selected yeast colonies expressing VH / VHH are seeded into 5 ml of YSD medium (YS medium + 2% glucose), and the cells are grown overnight at 30 °C in a sealed sterile 25 mL tube (while shaking at 180 rpm). On the second day, 5 ml of the overnight culture is diluted into 50 mL of freshly prepared YS medium + 2% glucose + 0.5% galactose, and the cells are grown for 2 nights at 30 °C in a 250 ml aerated and controlled flask (while shaking at 180 rpm). On the fourth day, the cells are spun down at 4200 rpm for 20 minutes in a centrifuge. Cation exchange purification step using a strong anion resin: Adjust the pH of the supernatant containing the ligand to 3.5. Wash 0.75 ml of resin (+ / - 0.5 mL of slurry) per 50 mL of supernatant with 50 mL of ddH2O and then wash 3 times with binding buffer. Add the washed resin to the supernatant and incubate the suspension at 4 °C for 1.5 hours on a shaker. Pellet the VH / VHH bound to the resin by centrifugation at 500 g for 2 minutes and wash this with wash buffer. Decant the supernatant and resuspend the resin in 10 mL of binding buffer. Place a filter in a PD-10 column, pour the resin into the column, allow the resin to settle for a while, and then add a filter on top of the resin. Wait until all of the binding buffer has flowed out. Elute the VH / VHH with 6 x 0.5 ml of elution buffer. Collect the eluate fractions in Eppendorf tubes. Measure the protein concentration of the 6 eluted fractions by Nanodrop. Pool the fractions containing VHH and transfer the solution to a dialysis membrane with a 3,500 Da cut-off. Dialyze the purified protein solution overnight at 4 °C against 3 L of PBS. On the fifth day, dialyze the purified protein solution for an additional 2 hours at 4 °C against 2 L of fresh PBS. Finally, calculate the final concentration by BCA.

[0222] Although described with respect to VH / VHH, the techniques described above may be used for scFv, Fab, Fv, and other antibody fragments as required. Multiple antigen-binding fragments (preferably VH / VHH) may be fused by chemical cross-linking by reacting an organic derivatizing agent, such as described by Blattler et al. 1985, with amino acid residues. Alternatively, the antigen-binding fragments may be genetically fused at the DNA level, i.e., a polynucleotide construct encoding a complete polypeptide construct containing one or more antigen-binding fragments may be formed. One way to join multiple antigen-binding fragments via a genetic pathway is by ligating the sequences encoding the antigen-binding fragments, either directly or via a peptide linker. For example, the carboxy terminus of the first antigen-binding fragment may be ligated to the amino terminus of the next antigen-binding fragment. This ligation mode can be extended to ligate antigen-binding fragments for the construction of functional constructs such as tri-, tetra-, etc. Methods for producing multivalent (e.g., bivalent) VHH polypeptide constructs are disclosed in WO96 / 34103, which is hereby incorporated by reference in its entirety.

[0223] Preferably, the polypeptides of the present invention (in particular, the VHHs of the present invention) can be produced in a fungus such as yeast (e.g., S. cerevisiae) according to the method disclosed in WO02 / 48382, which includes the growth of the fungus on a medium containing a carbon source, where 50-100 wt% of the carbon source is ethanol. The large-scale production of VHH fragments in S. cerevisiae is described in Thomassen et al. 2002.

[0224] In one aspect of the invention, a process for the preparation of a polypeptide or construct of the invention is provided, the process comprising i) cloning the polynucleotide of the invention into a vector such as a plasmid, ii) Transforming cells such as bacterial cells or yeast cells that can produce the polypeptide or construct of the present invention with the vector under conditions that enable the production of the polypeptide or construct. iii) A step of recovering the polypeptide or construct by affinity chromatography or the like.

[0225] The further set items of the embodiments of the present invention are as follows.

[0226] Item 1. A polypeptide capable of inhibiting the binding of IL-7 and / or L-TSLP to IL-7R. 2. The polypeptide according to item 1, wherein the polypeptide is capable of inhibiting the binding of IL-7 to IL-7R. 3. The polypeptide according to item 1, wherein the polypeptide is capable of inhibiting the binding of L-TSLP to IL-7R. 4. The polypeptide according to any one of items 1-3, wherein the polypeptide is capable of inhibiting the binding of IL-7 to IL-7R and the binding of L-TSLP to IL-7R. 5. The polypeptide according to any one of items 1-4, wherein the polypeptide binds to IL-7Rα. 6. The polypeptide comprises three complementarity-determining regions (CDR1-CDR3) and four framework regions (FR1-FR4), wherein CDR1 comprises a sequence sharing 60% or more sequence identity with SEQ ID NO: 1, CDR2 comprises a sequence sharing 60% or more sequence identity with SEQ ID NO: 2, and CDR3 comprises a sequence sharing 60% or more sequence identity with SEQ ID NO: 3. The polypeptide according to any one of items 1-5. 7. The polypeptide according to item 6, wherein CDR1 comprises a sequence sharing 80% or more sequence identity with SEQ ID NO: 1, CDR2 comprises a sequence sharing 80% or more sequence identity with SEQ ID NO: 2, and CDR3 comprises a sequence sharing 80% or more sequence identity with SEQ ID NO: 3. 8. The polypeptide according to item 7, wherein CDR1 contains SEQ ID NO: 1 or SEQ ID NO: 71, CDR2 contains SEQ ID NO: 2, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, or SEQ ID NO: 76, and CDR3 contains SEQ ID NO: 3, SEQ ID NO: 77, or SEQ ID NO: 78. 9. The polypeptide according to item 8, wherein the polypeptide contains SEQ ID NO: 8. 10. The polypeptide according to any one of items 1 - 9, wherein the polypeptide is an antibody or an antibody fragment. 11. The polypeptide according to any one of items 1 - 10, wherein the polypeptide neutralizes IL - 7R that binds to IL - 7 with an EC50 of 2 nM or less. 12. The polypeptide according to any one of items 1 - 11, wherein the polypeptide is substantially resistant to proteases in the human gastrointestinal tract. 13. The polypeptide according to any one of items 1 - 12, which is used as a drug. 14. The polypeptide according to item 13, which is used in the treatment of autoimmune diseases and / or inflammatory diseases. 15. The polypeptide according to any one of items 13 or 14, wherein the polypeptide is used for oral administration. Next, the present invention will be further described by the following non - limiting examples.

Examples

[0227] Example 1: Immunization and phage library construction Two llamas were each immunized with soluble human recombinant IL - 7Rα. Blood was collected from both llamas at various time points during the immunization process, and IL - 7Rα binding and neutralization were tested to monitor the development of the immune response against IL - 7Rα. The analysis showed that only one llama developed a good anti - IL - 7Rα antibody titer, while the other llama was unable to respond to the IL - 7Rα immunization. At the end of the immunization, RNA isolated from leukocytes collected from the reactive llama was used to generate 12 separate phage display libraries.

[0228] Example 2: Library Selection for Phages with Human IL-7Rα Binding Activity A library selection strategy was developed to isolate ICVDs that bind to epitopes present on the extracellular domain of the IL-7Rα subunit, including ICVDs that interfere with the binding of IL-7 to IL-7R. Several methods were used for the selective enrichment of phages presenting ICVDs with IL-7Rα binding properties and other desirable properties, including high binding affinity and resistance to intestinal proteases. Phages present in the eluates from various library selections were used to infect E. coli, individual colonies were picked onto a master plate, grown, and clonal cultures were generated. The periplasmic supernatants containing the selected monoclonal ICVDs were used in primary evaluation tests to identify those with the required properties.

[0229] From a total of 630 library-selected clones picked on the original 8 master plates screened, a final set of 7 primary clones was selected for production in E. coli, the ICVDs were affinity purified, and further detailed evaluation tests were performed.

[0230] The DNA sequences of the 7 primary clones (V7R-2E5, V7R-2E9, V7R-2F6, V7R-6C12, V7R-2B6, V7R-3B5, and V7R-4F6) isolated above were recloned into vector pMEK222 for production in E. coli (thus introducing C-terminal FLAG and 6xHis tags), and then affinity purification was performed and further detailed evaluation tests were carried out. The polypeptide sequences of these ICVDs excluding the FLAG and His tags are shown in the alignment provided above in the section entitled "Polypeptide and Polynucleotide Sequences". The clinical anti-IL-7R antibody mAb829 (a 150 kDa antibody containing heavy and light chains, also known as "GSK2618960" disclosed by Ellis et al 2019) was produced and used as a control in many of the following examples.

[0231] An important objective of the following examples was to identify those ICVD clones that have the ability to inhibit IL-7 that binds to IL-7R and have a certain degree of intrinsic resistance to inactivation by proteases in the small intestine.

[0232] Example 3: Potency and protease resistance of primary clones Potency The potency of seven primary clones was evaluated using an IL-7 / IL-7R neutralizing ELISA.

[0233] The primary clones were subcloned from phagemid into the pMEK222 plasmid, a C-terminal FLAG-6xHis tag was added, and they were expressed in E. coli. These ICVDs were expressed from E. coli TG1 and purified via the 6xHis tag.

[0234] Seven-point dilution series of the clones were prepared in 1% BSA (2× assay concentration) starting from 300 nM and using a dilution factor of 3.2. The mAb829 control antibody was used as a positive control in the ELISA in a concentration range of 10 nM to 0.088 nM (2× assay concentration). For each clone dilution, sufficient amounts were prepared in triplicate, and sufficient amounts were prepared in two triplicates (two plates) for mAb829. 85 μL (or 170 μL) of each ICVD (or mAb829) dilution was mixed with 85 μL (or 170 μL) of 10 ng / mL IL-7 (2× assay concentration). 85 μL of IL-7 was mixed with 85 μL of blocking buffer to give an IL-7 (1×) full binding signal in each plate. Only the blocking buffer was added to each plate as a blank. Subsequently, the bound IL-7 was measured using biotinylated anti-hIL-7 and then Extravidin-HRP. The TMB reaction was stopped after 30 minutes.

[0235] A corrected by ELISA signal blank 450 Using the data and "Log (inhibitor) vs. Response - Variable slope (four parameters)", EC 50 values were generated and the curve was fitted to EC50 These values were generated and are shown in Table 1 below. All ICVDs were shown to be as effective as the control mAb829 in inhibiting the binding of hIL-7 to hIL-7R and were shown to be slightly more effective than mAb829.

[0236] Protease resistance Seven purified ICVDs were incubated in the presence of supernatant from mouse small intestine ("mouse SI") and supernatant prepared from pooled human fecal samples ("HFP").

[0237] Stock dilutions of all ICVDs were prepared in 1×PBS containing 1% BSA at 250 μg / mL (final volume of 30 μL). Subsequently, digestion reaction mixtures were prepared for each ICVD in PCR strips at a final volume of 60 μL, with the ICVD at a final concentration of 20 μg / mL (55.2 μL of digestion matrix at 250 μg / mL + 4.8 μL of ICVD). For non-ICVD controls, 4.8 μL of 1×PBS was used instead. Then, 25 μL of each individual digestion reaction was transferred to (i) a new PCR tube containing cold stop buffer (these were used as the T = 0 time point) and frozen at -80 °C; and (ii) a new empty PCR tube and incubated in a PCR thermocycler at 37 °C for digestion (for digested non-ICVD control samples). The digested samples in mouse SI were removed from the thermocycler after 2 hours, and the digested samples in HFP were removed after 4 hours. The samples were immediately stopped with 25 μL of cold stop buffer and frozen at -80 °C until analysis.

[0238] The digested samples were tested by ELISA as detailed above for "Potency" at a final starting dilution of 1:100 and were then serially diluted six-fold using a dilution factor of 1.8 (for digested samples) or 2.1 (for undigested samples) and analyzed in triplicate wells on each plate. Since protease digestion should not occur theoretically in these samples, undigested samples (0 hours) were considered the standard curve (they were processed on ice and stop buffer was added immediately after addition of the digestion matrix).

[0239] If digestion occurs in the "digested" sample, a leftward curve shift is expected (T = compared to 0 hours). The greater the shift, the more unstable the ICVD. "Survival %" represents the level of activity retained after digestion.

[0240] All clones showed a high level of resistance to proteolysis in both matrices, and V7R-2E9 was identified as the most protease-resistant ICVD, showing complete resistance to pooled digestion of human feces for up to 4 hours.

[0241] These results are summarized in Table 1 below.

[0242]

Table 11

[0243] All of these polypeptides of the present invention showed surprisingly high efficacy and survival rates in the digestive matrix. Although these ICVDs are clearly related, it should be noted that the CDRs and frameworks of these polypeptides have many residues that differ from each other (see the alignment provided in "Polypeptide and Polynucleotide Sequences" above).

[0244] Example 4: Further Efficacy Assays Performed on V7R-2E9 and Control mAb829 Neutralization ELISA of IL-7 / IL-7R The IL-7 / IL-7R neutralization ELISA described above in Example 3 was performed again on V7R-2E9 and the clinical anti-IL-7R control antibody, mAb829. These results are shown in Table 2 below.

[0245] TSLP / TSLPR / IL-7R ELISA The ability of V7R-2E9 to neutralize the binding of the L-TSLP / TSLP-R complex to IL-7Rα was tested. A 96-well plate was coated with 0.25 μg / mL of recombinant human IL-7Rα-His6-Fc + 5 μg / mL of BSA and then blocked. V7R-2E9 was serially diluted and mixed 1:1:1 with recombinant human L-TSLP (final concentration of 15 ng / mL) and human TSLP-R (final concentration of 20 ng / mL). The mixture was then incubated for 30 minutes to allow binding and then added to the IL-7Rα-coated plate. After a 2-hour incubation, the bound L-TSLP was detected with 0.3 μg / mL of 0 biotinylated rabbit anti-hTSLP antibody at 50 μL / well, followed by detection with 1 / 2000 Extravidin-HRP at 50 μL / well, and the neutralization level of the binding of the L-TSLP / TSLP-R complex to IL-7Rα by ICVD was determined using GraphPad Prism. The results are shown in Table 2 below.

[0246] IL-7-induced pSTAT5 in hPBMC The ability of V7R-2E9 to inhibit the binding of IL-7 to IL-7Rα and interfere with STAT5 phosphorylation was tested in vitro in human lymphocytes. These human peripheral blood mononuclear cells (PBMC) respond to exogenous IL-7 by stimulation of intracellular STAT5 phosphorylation via IL-7R signaling, and this response can be abrogated by IL-7Rα-specific ICVD that prevents IL-7 / IL-7R binding.

[0247] A lymphocyte-rich population was isolated from human buffy coat and stored in 90% FBS 10% DMSO in liquid nitrogen. The cells were thawed and rested for recovery in complete RPMI-1640. After recovery, the cells were 100 μl, 2.5×10 5Cells were plated in a round-bottom 96-well plate at the cell / well level and starved for 1 hour in complete RPMI without FBS. After starvation, the desired ICVD concentration was added to each well (50 μL / well), and the plate was incubated at room temperature for 15 minutes. Then, 50 μL / well of IL-7 was added to each well, and the plate was incubated at 37 °C with 5% CO2 for 15 minutes. The reaction was stopped by quickly cooling the plate on ice, followed by centrifugation to remove the supernatant. Subsequently, the cells were processed for fixation, permeabilization, and intracellular staining of pSTAT5. The cells were incubated with 100 μL / well of Cytofix / Cytoperm solution (BD Bioscience #554722) on ice for 20 minutes, washed twice with 150 μl / well of 1× Perm / Wash buffer (BD Bioscience #554723), incubated with 200 μL / well of Perm buffer III (BD Bioscience #558050) on ice for 30 minutes, and washed twice with 150 μL / well of 1× PBS 2% BSA (FACS buffer). Then, the cells were stained with 25 μL / well of pSTAT5 antibody ([47 / Stat5(pY694)](A488)(BD Bioscience #612598)) or isotype control mouse IgG1 ([B11 / 6](FITC)(Abcam #ab91356)) at room temperature for 1 hour. The reaction was stopped by adding 150 μL / well of FACS buffer. After one wash / centrifugation step, the cells were finally resuspended in 200 μL / well of FACS buffer, and data were obtained using a CytoFlex flow cytometer (Beckman Coulter). Data analysis was performed using FlowJo software. The results are shown in Table 2 below.

[0248] TSLP-induced TARC secretion in human monocytes To confirm the IL-7R neutralizing activity in the detailed human monocyte cell assay, V7R-2E9 was also tested. Human monocytes show a TARC secretion response in the medium after stimulation with TSLP as a result of the binding of cell surface IL-7R and TSLP / TSLP-R. The ability of anti-IL-7Rα ICVD to inhibit the binding of TSLP / TSLP-R to IL-7R and interfere with TARC secretion was tested in vitro in human monocytes.

[0249] Monocytes were isolated from human buffy coats and plated in flat-bottom 96-well plates (1×10 5 cells per well containing 100 μl / well) in complete RPMI. To enhance the purity of monocytes, the plated cells were allowed to rest at 37 °C in 5% CO2 for 2 hours, after which the medium in each well was aspirated and subsequently non-adherent cells were removed by gently washing twice with warm cRPMI. The cells were incubated at 37 °C in 5% CO2 (diluted in complete RPMI, final volume of 100 μL / well) for 24 hours in the presence of TSLP with the desired concentration of ICV. After 24 hours of incubation, 75 μL of supernatant / well was collected and stored at -80 °C for further analysis of secreted TARC.

[0250] The neutralizing level of human TSLP by the anti-IL-7Rα agent was tested. 96-well plates were coated with 50 μL / well of anti-human TARC antibody and then blocked. Human TARC standards were serially diluted in assay diluent and then 50 μL / well of the recovered culture supernatant and 50 μL / well of the standards were added to the plates coated with anti-TARC. Bound human TARC was detected with a biotinylated anti-human TARC polyclonal antibody and then avidin-HRP. The neutralizing level of human TSLP by the agent was determined. The results are shown in Table 2 below.

[0251]

Table 12

[0252] In summary, V7R-2E9 was shown to inhibit the binding of IL-7 and L-TSLP to IL-7R with similar potency as the control clinical anti-IL-7R antibody mAb829 in both ELISA and cell assays.

[0253] Example 5: Epitope Modeling A model structure and epitope for V7R-2E9 were established in silico. This model was developed using the Protein Data Bank (PDB) "4ybq" file as a template. 4ybq is the heavy chain of FV bound to rat GLUT5 facilitative glucose transporter member 5. The 4ybq template is particularly similar to V7R-2E9 in terms of CDR3 loop length and predicted conformation. The PDB entry "3di3" is the high-resolution structure of IL-7 bound to IL-7Rα. By simply removing IL-7 from this structure, a target receptor for docking with the predicted V7R-2E9 structure was obtained.

[0254] Since the HEX 8.0 docking method used acts locally across the surface of each domain, more target regions were selected than the IL-7Rα structure and were carried out in parallel. The best solution for V7R-2E9 is representative of a cluster of 46 solutions, which has a very high energy score of -894 (DARS force field) and had no "bumps" (unacceptably close atomic positions) after energy minimization. Figure 3 shows a ribbon schematic of the position of V7R-2E9 docked on the IL-7Rα target. V7R-2E9 is located at the interface between the N-terminal and C-terminal domains.

[0255] Table 3 shows the epitope residues of IL-7Rα that contact V7R-2E9. Residues that fill particularly important areas at the interface are highlighted in bold (by reference to SEQ ID NO: 65).

[0256]

Table 13

[0257] Example 6: Optimization for Reducing Immunogenicity The amino acid sequence of V7R-2E9 was aligned with human VH3 germline antibody sequences to identify potential humanization changes. Eighteen single mutations and two combinations of changes at the end of framework 2 / start of CDR2 were introduced into the V7R-2E9 parental ICVD sequence to generate mutants from E. coli. The ICVDs were first tested for potency in an IL-7 / IL-7R neutralization ELISA. The clones showed IL-7R neutralizing activity equivalent to or greater than that of V7R-2E9, indicating that none of the mutations introduced into the parental ICVD had a detrimental effect on antigen binding. Subsequently, all clones were digested in human fecal supernatant material for 16 hours and their relative survival was measured (Table 4).

[0258] [Table 14]

[0259] Subsequently, mutations that retained high potency in the IL-7 / IL-7Rα-His6-Fc ELISA and maintained resistance similar to that of a pool of human feces were combined to produce 19 humanized ICVDs (Table 5).

[0260] [Table 15]

[0261] Table 6 summarizes the most advantageous humanized ICVDs among these 19 humanized ICVDs that maintained potency and resistance to both human fecal proteases and mouse intestinal proteases.

[0262] [Table 16]

[0263] Of particular note is ICVD ID-A62U, which includes E1D (for yeast expression to avoid production of products with a cyclized N-terminal glutamate) and the humanized mutations R45L, Q65K, K87R, and S88A. Another ICVD of particular note is ID-A59U, which includes E1D, Q65K, K87R, and S88A. ID-A59U has a pI of 5.1 and a molecular weight of 12.966 kDa (pI and molecular weight were calculated using CLC Sequence Viewer).

[0264] Example 7: Potency Assay Performed on Humanized V7R-2E9 Mutant The potency and efficacy (maximal inhibition) of ID-A40U (produced in E. coli) were confirmed in vitro by IL-7 / IL-7R neutralizing ELISA and in an IL-7-induced STAT5 phosphorylation assay in human PBMC. EC 50 values were corrected for ELISA signal blank A 450 data and "Log (Inhibition) vs. Response - Variable Slope (Four Parameters)" were used to generate and fit the curve in Graphpad Prism to generate EC 50 was generated.

[0265] The results are shown in Table 7a together with the control drug.

[0266]

Table 17

[0267] In another experiment, these same assays were performed on ID-A62U (produced in S. cerevisiae) together with the control drug. The results are shown in Table 7b and Figure 4.

[0268]

Table 18

[0269] The ability of ID-A62U to neutralize the binding of the L-TSLP / TSLP-R complex to IL-7Rα was tested with mAb829 by the method described above in Example 4. The results are shown in Table 7c below. Prior to illustration, subtraction was performed on the data set and normalized to the highest concentration of the antibody tested (to overcome the high level of background on the plate).

[0270]

Table 19

[0271] In summary, ID-A62U and ID-A40U were shown to have potency comparable to or greater than that of the control clinical anti-IL-7R antibody mAb829.

[0272] Example 8: Biacore Estimation of ICVD-IL-7R Binding Affinity The binding kinetics of ID-A40U were compared with those of the mAb829 clinical antibody in a Biacore assay. IL-7Rα-His6-Fc was directly coated onto a Biacore sensor chip (for mAb829 analysis), captured by anti-human IgG Fc (for ICVD analysis), and ICVD / Ab was flowed over the chip to detect binding. ID-A40U had an affinity (K -11 ) of 7.8×10 D M, and mAb829 had a slightly lower affinity (K -10 ) of 5.67×10 D M. The results indicate that ID-A40U demonstrates strong binding to the antigen.

[0273] Example 9: Cross-Reactivity with IL-7Rα from Toxicological Species The cross-reactivity of ID-A40U, ID-A59U, and ID-A62U that bind to IL-7Rα from toxicological species was examined.

[0274] A 96-well plate was coated with 0.5 μg / mL of recombinant human IL-7RαHis6-Fc + 5 μg / mL of BSA and then blocked. 0.5 nM of ICVD was mixed 1:1 with a selected test compound serially diluted in 1% BSA and then incubated for 30 minutes to allow binding before adding to the plate coated with IL-7Rα. After a 2-hour incubation, the bound ICVD was detected with 50 μL / well of 1 / 20,000 anti-FLAG-HRP goat antibody (GeneTex, GTX21238) to determine the neutral level of ICVD-IL-7Rα binding by the test compound.

[0275] In this assay, it was found that mouse IL-7Rα did not interfere with ICVD / IL-7Rα binding, indicating that mice or rats are inappropriate species for toxicology testing. However, cynomolgus IL-7Rα interfered with these ICVD bindings to human IL-7Rα (Figures 5 and 6), making cynomolgus monkeys appropriate toxicology species for these ICVDs and related ICVDs.

[0276] Example 10: Specificity for off-target cytokines ID-A40U was tested for selectivity against proteins that associate with human IL-7Rα, substantially by the method described in Example 9. Human IL-12Rβ1 and human IL-12Rβ2 were found to be the human proteins most closely related to IL-7Rα identified using the NCBI BLASTp tool, having 29% and 30% sequence identity with IL-7Rα, respectively. In a competitive IL-7R binding ELISA assay, hIL-12Rβ1, and the selection of receptors within the IL-7R family (IL-2R, IL-21R, and IL-9R), or unrelated receptors (TNFR-2 and IL-6R) were tested for their ability to inhibit the binding of ID-A40U to human IL-7Rα immobilized on the plate. None of human IL-12Rβ1, IL-2R, IL-21R, IL-9R, TNFR-2, or IL-6R interfered with the binding of ID-A40U to IL-7Rα, but increasing amounts of human IL-7Rα were added to generate a dose-dependent curve (Figure 7). This indicated that the binding of ID-A40U ICVD to off-target molecules is very unlikely to occur in humans.

[0277] Example 11: Resistance to gastrointestinal extracts Ex vivo incubations in intestinal supernatants can predict the stability of ICVD in the gastrointestinal tracts of cynomolgus monkeys and humans. The activities of the major small intestinal proteases, trypsin, and chymotrypsin are conserved across mammalian species, while the proteases present in the large intestine are likely produced by the host species-specific gut microbiota. To generate a test matrix that reflects these two environments, pooled mouse small intestinal supernatants and pooled fecal supernatants were prepared. Both of these matrices are highly digestible for unselected and unmanipulated ICVD.

[0278] ICVD ID-38F has high stability in these matrices (see WO2016 / 156465), and this property predicts high stability of ID-38F during passage through the intestine.

[0279] V7R-2E9, ID-A24U, and ID-A40U were tested for their survival in gastrointestinal extracts from both mouse and human sources. ICVD was incubated for 6 hours at 37°C in mouse small intestine supernatant and for 16 hours in human feces supernatant. Survival was measured by IL-7 / IL-7R neutralization ELISA. All constructs showed good survival in all digestive matrices tested (Figure 8, where "SI" = mouse small intestine fluid and "HF" = human feces supernatant). ID-A40U contains the same functional mutations as ID-A59U produced in yeast.

[0280] In another experiment, ID-A62U was tested for survival rate in the same human feces supernatant assay along with ID-A41U (the labile control ICVD). ID-A62U showed approximately 100% survival compared to approximately 40% survival of ID-A41U (Figure 9).

[0281] These were stringent tests involving long incubations. Therefore, any of these ICVDs are expected to survive very well in the gastrointestinal environment.

[0282] Example 12: Resistance to Gastrointestinal Matrix Metalloproteinases The levels of activated matrix metalloproteinases (MMPs) are increased in the inflamed mucosa of patients with intestinal diseases. These MMPs can digest native human IgG, including the human IgG scaffold (Biancheri et al. 2015), and therapeutic agents. In the case of the anti-TNFα therapeutic etanercept, this digestion causes a significant decrease in TNFα neutralizing efficacy. To confirm that ID-A40U is resistant to MMPs, mAb829 was detected by Western blotting after incubation at 37 °C for 22 h in the presence of human MMP3, MMP12, or TCNB buffer, together with ID-A40U and Enbrel. Enbrel and mAb829 were detected with anti-human IgG conjugated to peroxidase specific for the γ-chain. Controls of ID-A40U and TCNB buffer alone were detected with pAb 1219, and pAb SwineαRabbit conjugated to primary rabbit α-ICVD and a second HRP.

[0283] After incubation, as measured by Western blotting, ID-A40U was not digested by MMPs (Figure 10) and showed a band with a molecular weight corresponding to the expected full-length ICVD (lacking the Flag-His6 tag that is cleaved during digestion). However, after the same incubation time, MMP3 and MMP12 digested full-length etanercept and mAb829 into smaller fragments. After incubation with MMPs, ID-A40U was shown to be fully effective in neutralizing IL-7R, as measured using an IL7 / IL-7R functional ELISA. "F / H" in Figure 10 means the presence of the FLAG / His tag.

[0284] Example 13: Passage and Survival in the Mouse Gastrointestinal Tract The results of the above in vitro tests showed that the optimized V7R-2E9 derivative is resistant to inactivation by proteases present in supernatant extracts prepared from the contents of the mouse small intestine. Subsequent tests were performed to examine the stability of ID-A24U and ID-A40U during passage through the mouse gastrointestinal system.

[0285] Both ID-A24U and ID-A40U were formulated with ID-38F (anti-TNFα ICVD, see WO2016 / 156465) in a mixture of milk and bicarbonate to protect against denaturation at low pH and digestion by pepsin in the stomach. After administering ICVD to mice by oral gavage, the concentrations of ICVD in the stomach, small intestine, cecum, and colon were determined 6 hours after administration. In addition, the ICVD concentrations in fecal pellets collected at one-hour intervals were measured.

[0286] ID-A24U and ID-A40U in feces collected from all mice 4 to 6 hours after administration were measured, and ID-A40U was also measured at the 3-hour time point from two mice (Figure 11). Instead, during the first 3 hours, ID-A24U in feces collected from mouse 6 (M6) was measured, and in this mouse, transit was shown to be particularly rapid compared to other mice.

[0287] These results suggest that both ID-A24U and ID-A40U can survive passage through the mouse GI tract. Overall, the transit times of ID-A24U and ID-A40U appear to be very similar, except for one mouse (M6 and M12) within each group. At the time of sorting (6 hours), most of ID-A24U and ID-A40U were present in the cecum (CAE) and colon (COL) of all mice, and moderately high amounts were still measured in the stomach (STO) and small intestine (SI). Based on the concentrations calculated taking into account the dilution factors used in the slurry preparations, the expected concentrations of ID-A24U and ID-A40U at the time of sorting were between 22.7 μM and 140 μM and between 12 μM and 22.5 μM, respectively, in feces (Figure 11). The expected concentrations of ID-A24U in the cecum and colon were between 2.9 μM and 8 μM and between 9.7 μM and 16.5 μM, respectively. The expected concentrations of ID-A40U in the cecum and colon were between 0.9 μM and 1.2 μM and between 0.8 μM and 6.2 μM, respectively (Figure 12).

[0288] ID-38F, which was used as a control in this study, was measured at high levels in all fecal and lower GIT samples, as previously observed. The expected concentrations of ID-38F varied between 0.04 μM and 2.1 μM in the cecum, between 0.33 μM and 5.1 μM in the colon, and between 4.9 μM and 48 μM in feces at the 6-hour time point in 6 mice. Replicate experiments were performed for ID-A40U and ID-38F. Similar results were obtained (Figures 13 and 14).

[0289] Overall, these results suggest that ID-A24U and ID-A40U survive well and similarly to ID-38F when passing through mice, delivering high concentrations of active ICVD to the cecum and colon. This may reflect the relative stability of each ICVD in these intestinal compartments, as previously observed in vitro. ID-A24U and ID-A40U have been shown to be stable in the mouse small intestine. Therefore, it is expected that these and related ICVDs will have high stability in the human GI tract.

[0290] Example 14: Human IBD Tissue Testing Tests were conducted to examine the activity of V7R-2E9 in a human ex vivo model that replicates the environment of inflamed bowel disease tissue. V7R-2E9 and controls (ID-2A, an anti-C. difficile toxin ICVD; mAb829, and IgG1k (a recombinant antibody of a non-IL-7R-binding purified human IgG1k isotype control)) were tested in ex vivo cultures for their effects on tissue lintegrin protein levels and production of inflammatory cytokines using tissue collected from 4 patients with active ulcerative colitis.

[0291] Analysis of tissue lysates on the Pathscan phosphoprotein array (Figs. 15 - 18) showed that during biopsies of 3 out of 4 UC patients, V7R-2E9 treatment inhibited phosphorylation of a substantial proportion of the 39 proteins detected on the array, compared to biopsies treated with the corresponding ID-2A. mAb829 also inhibited protein phosphorylation levels in biopsies from the same 3 UC patients, and the pattern of inhibition obtained appeared similar to the pattern of inhibition achieved with V7R-2E9. The sum of the phosphorylation intensity values for each biopsy was calculated from the intensities of all 39 phosphoproteins on the array. The results presented in Fig. 19 show that V7R-2E9 and mAb829 inhibited the total phosphorylation levels in biopsies from 3 responsive UC patients, but had little or no effect on total phosphorylation in the biopsy from patient UC2700. This patient presented with active disease even while being administered azathioprine (a T cell inhibitor) as part of those agents, and thus, resistance to T cell-directed therapy may account for the lack of response to antibodies (V7R-2E9 and mAb829) targeting IL-7R-mediated T cell activation.

[0292] Analysis of the media from biopsies of patients UC2698, UC2701, and UC2703 showed that V7R-2E9 treatment also inhibited the production of several cytokines, including IL-1β, IL-6, IL-8, and TNFα, but had no effect on the production of the anti-inflammatory cytokine IL-10 (data not shown). Consistent with the results of the phosphoprotein analysis, V7R-2E9 did not inhibit the production of pro-inflammatory cytokines in the cultures from the biopsy of patient UC2700.

[0293] In conclusion, antagonism of IL-7R in UC biopsy tissues by V7R-2E9 inhibited phosphorylation of signaling proteins and the production of cytokines and chemokines associated with pro-inflammatory and immunoregulatory pathways. The results demonstrated that antagonism of mucosal IL-7R+ve T cells by V7R-2E9 (and mAb829) can inhibit the inflammatory process in a model closely related to the disease environment.

[0294] Example 15: Yeast productivity in fermentative culture S. cerevisiae expressing ID-A59U was inoculated into 5 liters of ethanol-fed fermentation. The broth supernatant at the end of fermentation (EoF) was analyzed for ID-A59U concentration by SDS-PAGE and IL-7 / IL-7Rα-His6-Fc functional ELISA. SDS-PAGE showed a high yield of ≤2 g / L, and functional ELISA confirmed that ID-A59U was fully active at EoF and the final yield was at least 1.5 g / L. S. cerevisiae expressing ID-A62U was inoculated into a 50 mL shake flask expression system. A high yield of ICVD was obtained.

[0295] Conclusions from the above examples Polypeptides were identified that benefit from high potency in a cell assay system measuring neutralization of IL-7Rα activity, including inhibition of the binding of IL-7 and / or L-TSLP to IL-7Rα. These polypeptides also, in some cases, benefit from high stability in the supernatant of the small intestine and / or human feces. A humanized derivative of one particular polypeptide (V7R-2E9) was produced, which retained substantially the same potency or benefited from increased potency compared to unmodified V7R-2E9, but also retained resistance to intestinal proteases and the ability to be produced effectively in S. cerevisiae. The most preferred combination of mutations to V7R-2E9 (R45L, Q65K, K87R, S88A), including the E1D yeast production mutation, is embodied by ID-A62U.

[0296] Miscellaneous Rules All documents mentioned in this application, including patents and patent applications, are hereby incorporated by reference into this specification to the maximum extent possible.

[0297] Throughout this specification and the following claims, unless the context requires otherwise, the word "comprising", and variations such as "comprises" and "comprising", are to be understood as including the recited integer, step, group of integers, or group of steps, but not excluding other integers, steps, group of integers, or group of steps.

[0298] This application, of which this specification and the claims form a part, may be used as a basis for priority in any subsequent application. The claims of such subsequent applications may relate to any feature or combination of features described herein. They may take the form of product, composition, process, or use claims and, by way of example and without limitation, may include the following claims.

[0299] References The following references are hereby incorporated by reference in their entirety into this specification. Arbabi-Ghahroudi et al FEBS Lett 1997 414:521-526 Baumgart et al The Lancet 2012 380(9853):1590-605 Bjerkan et al Pharmaceuticals (Basel).2016 9(3). pii: E41 Blattler et al Biochemistry 1985 24:1517-1524 Chomezynnski and Sacchi Anal Biochem 1987 162:156-159 Cianferoni and Spergel Curr Allergy Asthma Rep. 2015 15(9):58 Corren et al N Engl J Med.2017 377(10):936-946 Crawley et al J Immunol.2010 184(9):4679-4687 Danese Gut 2012 61:918-932 Desmet et al Nature Communications 2014 5:5237 Dooms J Autoimmun. 2013 45:40-48 Ebersbach et al. J. Mol. Biol. 2007 372 (1):172-185 Ellis et al Br J Clin Pharmacol. 2019 85(2):304-315 Faisst et al J Virol 1995 69:4538-4543 Fornasa et al J Allergy Clin Immunol.2015 136(2):413-422 Frenken et al J Biotech 2000 78:11-21 Fry & Mackall Blood 2002 99(11):3892-3904 Fry & Mackall J Immunol.2005 174(11):6571-6576 Goldberg et al Nat Rev Gastroenterol Hepatol 2015 (5):271-283 Goldberg et al Protein Eng Des Sel.2016 29(12):563-572 Green and Sambrook Molecular Cloning:A Laboratory Manual 2012 4th Edition Cold Spring Harbour Laboratory Press Griffiths et al Antibodies 2013 2:66-81 Grundstrom et al Nucl.Acids Res 1985 13:3305-3316 Hafler et al N Engl J Med.2007 357(9):851-862 Hamers-Casterman et al Nature 1993 363(6428):446-448 Harmsen et al Gene 1993 125:115-123 Harmsen et al Appl Microbiol Biotechnol 2007 77(1):13-22) Hendrickson et al Clin Microbiol Rev 2002 15(1):79-94 Heninger et al J Immunol.2012 189(12):5649-5658 Hoogenboom et al Nucl Acid Res 1991 19:4133-4137 Huse et al Science 1989 246 (4935):1275-1281 Johnson et al Anal.Chem. 2012 84(15):6553-6560 Kabat et al Sequences of Proteins of Immunological Interest, Fifth Edition U.S. Department of Health and Human Services, 1991 NIH Publication Number 91-3242 Kohler and Milstein Nature 1975 256:495-497 Koide and Koide Methods Mol.Biol. 2007 352: 95-109 Krehenbrink et al J. Mol.Biol. 2008 383 (5):1058-1068 Ling et al Anal Biochem 1997 254(2):157-178 Lipovsek Protein Eng Des Sel. 2011 24(1-2):3-9 Liu J Exp Med 2006 203(2):269-273 Liu et al Nat Med.2010 16(2):191-197 (retraction in: Nat Med. 2013 19(12):1673) McCoy et al Retrovirology 2014 11:83 Merchlinsky et al J. Virol.1983 47:227-232 Miethe et al J Biotech 2013 163(2):105-111 Muyldermans et al Protein Eng 1994 7(9):1129-1135 Muyldermans Annu Rev Biochem 2013 82:775-797 Nambiar et al Science 1984 223:1299-1301 Nelson et al Molecular Pathology 2000 53(3):111-117 Nguyen et al Adv Immunol 2001 79:261-296 Nixon and Wood Curr Opin Drug Discov Devel.2006 9(2):261-268 Noti et al Nat Med. 2013 19(8):1005-1013 Nygren FEBS J. 2008 275(11):2668-2676 Padlan Mol Immunol 1994 31:169-217 Peters et al Immunol Lett.2015 172:124-131 Rimoldi et al Nat Immunol. 2005 6(5):507-514 Rose et al J Immunol.2009 182(12):7389-7397 Roux et al Proc Natl Acad Sci USA 1998 95:11804-11809 Sandborn et al N Engl J Med.2007 357:228-238 Sakamar and Khorana Nucl.Acids Res 1988 14:6361-6372 Shealy et al mAbs 2010 2:428-439 Silverman et al Nat.Biotechnol. 2005 23(12):1556-1561 Skerra et al Science 1988 240(4855):1038-1041 Skerra et al FEBS J. 2008 275 (11):2677-83 Suderman Protein Expression and Purification 2017 134:114-124 Tanha et al J Immunol Methods 2002 263:97-109 Teutsch et al Eur J Hum Genet.2003 11(7):509-515 Thomassen et al Enzyme and Micro Tech 2002 30:273-278 Tsilingiri et al Cell Mol Gastroenterol Hepatol. 2017 3(2):174-182 Verma and Eckstein Annu Rev Biochem 1998 67:99-134 Verstraete et al Nat Commun. 2017 8:14937. doi: 10.1038 / ncomms14937 Vetter & Neurath, Therapeutic Advances in Gastroenterology, 2017, 10(10):773 - 790 Walsh, Immunological Reviews, 2012, 250(1):303 - 316 Ward et al., Nature, 1989, 341:544 - 546 Wells et al., Gene, 1985, 34:315 - 323

Claims

1. A polypeptide capable of inhibiting the binding of IL-7 and / or L-TSLP to IL-7R, wherein the polypeptide comprises an immunoglobulin heavy chain variable domain that binds to IL-7Rα, and the immunoglobulin heavy chain variable domain comprises three complementarity-determining regions (CDR1 - CDR3) and four framework regions (FR1 - FR4), wherein the immunoglobulin heavy chain variable domain CDR1 comprises the amino acid sequence set forth in SEQ ID NO: 1, CDR2 comprises the amino acid sequence set forth in SEQ ID NO: 2, and CDR3 comprises the amino acid sequence set forth in SEQ ID NO: 3, wherein the immunoglobulin heavy chain variable domain is a VHH, polypeptide.

2. The polypeptide according to claim 1, wherein the polypeptide is capable of inhibiting the binding of IL-7 to IL-7R.

3. The polypeptide according to claim 1, wherein the polypeptide is capable of inhibiting the binding of L-TSLP to IL-7R.

4. The polypeptide according to any one of claims 1 - 3, wherein the polypeptide is capable of inhibiting the binding of IL-7 to IL-7R and the binding of L-TSLP to IL-7R.

5. The polypeptide according to any one of claims 1 - 4, wherein CDR1 consists of the amino acid sequence set forth in SEQ ID NO: 1, CDR2 consists of the amino acid sequence set forth in SEQ ID NO: 2, and CDR3 consists of the amino acid sequence set forth in SEQ ID NO:

3.

6. The polypeptide according to any one of claims 1 - 5, wherein the polypeptide comprises an amino acid sequence sharing at least 75% sequence identity with the amino acid sequence set forth in SEQ ID NO: 8, or consists of an amino acid sequence sharing at least 75% sequence identity with the amino acid sequence set forth in SEQ ID NO:

8.

7. The polypeptide according to claim 6, wherein the polypeptide comprises the amino acid sequence set forth in SEQ ID NO:

8.

8. The polypeptide according to claim 7, wherein the polypeptide consists of the amino acid sequence set forth in SEQ ID NO:

8.

9. The polypeptide according to any one of claims 1-8, wherein the polypeptide binds to an epitope on IL-7Rα comprising at least one residue of IL-7Rα selected from the list consisting of Glu27, Ser31, Leu57, Val58, Glu59, Lys77, Lys78, Phe79, Leu80, Leu81, Ile82, Thr104, Lys137, Lys138, Tyr139, Lys141, His191, Tyr192, and Phe193.

10. A construct comprising at least one polypeptide according to any one of claims 1-9 and at least one different polypeptide.

11. The polypeptide according to any one of claims 1-10, wherein the polypeptide neutralizes the binding of IL-7R to IL-7 with an EC50 of 2.00 nM or less.

12. The polypeptide according to claim 1-9 and 11, wherein the polypeptide binds to IL-7Rα with an equilibrium dissociation constant (Kd) of 10 －７ M or less.

13. The polypeptide according to any one of claims 1-9 and 11-12, which is resistant to trypsin and chymotrypsin.

14. A pharmaceutical composition comprising the polypeptide according to any one of claims 1-9 and 11-13 or the construct according to claim 10 and one or more pharmaceutically acceptable excipients or carriers.

15. The pharmaceutical composition according to claim 14, comprising at least one additional active agent.

16. The pharmaceutical composition according to any one of claims 14 or 15 for use as a medicament.

17. The pharmaceutical composition for use according to claim 16, wherein the pharmaceutical composition is for use in the treatment of autoimmune diseases and / or inflammatory diseases.

18. The pharmaceutical composition for use according to claim 17, wherein the autoimmune disease and / or inflammatory disease is Crohn's disease or ulcerative colitis.

19. The pharmaceutical composition for use according to claim 17, wherein the autoimmune disease and / or inflammatory disease is atopic dermatitis.

20. The pharmaceutical composition for use according to claim 17, wherein the autoimmune disease and / or inflammatory disease is asthma.

21. The pharmaceutical composition for use according to any one of claims 16 - 20, wherein the pharmaceutical composition is for use in oral administration.

22. The pharmaceutical composition for use according to any one of claims 16 - 20, wherein the pharmaceutical composition is for use in topical administration.

23. A polynucleotide encoding the polypeptide according to any one of claims 1 - 9 and 11 - 13 or the construct according to claim 10.

24. The polynucleotide according to claim 23, wherein the polynucleotide comprises the polynucleotide sequence set forth in SEQ ID NO: 70 or consists of the polynucleotide sequence set forth in SEQ ID NO: 70.

Images