Agents and methods for suppressing the growth of oral bacteria

Abstract

To provide a technique for inhibiting the number of bacteria involved in mucin decomposition in an oral cavity, which can inhibit the growth of oral bacteria that may be involved in mucin decomposition, such as Ruminococcus gnavus, thereby inhibiting the decomposition of mucin in the oral cavity, thereby contributing to the prevention and improvement of unhealthy conditions and diseases in the oral cavity in which mucin deficiency is involved in onset or worsening.SOLUTION: Provided is an agent for inhibiting the growth of oral bacteria containing agaro-oligosaccharides as an active ingredient and having in the genomic DNA a NanA gene consisting of a DNA sequence that has 49.9% or more sequence identity with sequence number 1 (the NanA gene of Ruminococcus gnavus).SELECTED DRAWING: Figure 1

Description

Technical Field

[0001] The present invention relates to an inhibitor for inhibiting the growth of oral bacteria, which contains agarooligosaccharide as an active ingredient. Specifically, the present invention relates to an inhibitor for inhibiting the growth of oral bacteria that has, in its genomic DNA, an N-acetylneuraminic acid lyase gene consisting of a DNA sequence having a sequence identity of 49.9% or more with SEQ ID NO: 1 and contains agarooligosaccharide as an active ingredient.

Background Art

[0002] Mucin is a high-molecular glycoprotein derived from animals and is the main component of mucus produced in the mucosal epithelium of the digestive tract and respiratory tract, salivary glands, etc. It has a structure in which sugar chains are bound to the core protein with a high frequency and generally has strong viscosity and high water retention. Mucin is classified into a secreted type and a membrane-bound type. In addition to its mucosal protection and lubricating effects as a physical barrier, the membrane-bound type is also involved in information transmission into the cytoplasm. The gene encoding the core protein of mucin is denoted as "MUC" and is numbered in the order of discovery. To date, more than 20 types have been reported in humans.

[0003] In the oral cavity, secreted MUC5B and MUC7 are contained as major proteins in saliva (Non-Patent Document 1). In addition, membrane-bound MUC1 is expressed in oral mucosal epithelium (Non-Patent Document 2). In the oral cavity, mucin helps chewing, swallowing, and vocalization of food by its lubricating action, protects the oral mucosa from being damaged, prevents dryness in the oral cavity, captures harmful substances, foreign substances, and infectious microorganisms such as bacteria and viruses in food, and prevents them from contacting mucosal epithelial cells, and is considered to exhibit a cleaning action of being processed by gastric juice by swallowing. For example, it is speculated that there may be a possibility of complaining of a dry feeling in the oral cavity when salivary mucin is low. In addition, there is a report that MUC7 is involved in the growth inhibition of Candida and antibacterial properties (Non-Patent Document 3).

[0004] The functional expression of these mucins is thought to be important for sialic acids (N-acetylneuraminic acid (Neu5Ac), N-glycolylneuraminic acid (Neu5Gc), deaminoneuraminic acid (3-deoxy-D-glycero-D-galacto-2-nonulopyranosonic acid; KDN), etc.) bound to the sugar chain termini. When the sialic acids at the sugar chain termini are decomposed by oral microorganisms, it is considered that mucins aggregate and lose their function (Non-Patent Document 3). In addition, MUC7 has an antibacterial site, and it has been reported that when the sialic acid at the sugar chain terminus is decomposed, the decomposition of the antibacterial site proceeds rapidly (Non-Patent Document 1).

[0005] On the other hand, Ruminococcus gnavus has been reported as a mucin-decomposing bacterium. Ruminococcus gnavus is a commensal bacterium in the intestine and grows using the sialic acid of mucin as a nutrient source. The Ruminococcus gnavus ATCC 29149 strain has been reported to have a unique sialic acid metabolic pathway in which it cleaves 2,7-anhydro-N-acetylneuraminic acid (instead of N-acetylneuraminic acid) from the mucin sugar chain, transports it into the cell, converts it to N-acetylneuraminic acid, and then decomposes it into N-acetylmannosamine and pyruvic acid by N-acetylneuraminic acid lyase (NanA) for metabolism (Non-Patent Document 4).

Prior Art Documents

Patent Documents

[0006]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Summary of the Invention

Problems to be Solved by the Invention

[0007] Therefore, the inventors considered that if the number of bacteria involved in mucin degradation in the oral cavity could be suppressed, the degradation of mucin in the oral cavity could be suppressed, and oral unhealthy states and diseases in which mucin deficiency is involved in the onset and exacerbation could be prevented or improved. That is, the object of the present invention is to provide a technique for suppressing the number of bacteria involved in mucin degradation in the oral cavity.

[0008] As a result of intensive research, the inventors of the present invention have found that agarooligosaccharides, 3,6-anhydro-L-galactose, and oligosaccharides having 3,6-anhydro-L-galactose at the reducing end can suppress the number of bacteria of Lachnococcus gnavus, which is a mucin-degrading bacterium, in the oral cavity. Furthermore, they have found that the number of oral bacteria that possess a homolog of the gene (SEQ ID NO: 1) of NanA, which is a sialic acid-metabolizing enzyme of Lachnococcus gnavus, in genomic DNA can be suppressed. Based on these findings, the inventors have completed the following inventions.

[0009] (1) A first aspect of the agent (which may be referred to as "this agent") according to the present invention is an agent for suppressing the growth of oral bacteria that possess in genomic DNA a NanA gene consisting of a DNA sequence having a sequence identity of 49.9% or more with SEQ ID NO: 1 (the NanA gene of Lachnococcus gnavus), the agent comprising agarooligosaccharides as an active ingredient.

[0010] (2) This agent may be used for suppressing the expression of NanA in the oral cavity. That is, this agent may be an inhibitor of NanA expression in the oral cavity.

[0011] (3) This agent may be used for suppressing the degradation of oral mucin. That is, this agent may be an inhibitor of oral mucin degradation.

[0012] (4) In the present invention, the oral bacteria may be of the genus Lachnococcus, Fusobacterium, or Blautia.

[0013] (5) In the present invention, the oral bacteria may be Lachnococcus gnavus.

[0014] (6) In the present invention, when the oral bacteria are of the genus Fusobacterium, this agent may be used for preventing or improving a disease selected from gingivitis, periodontal disease, colorectal cancer, and oral cancer. That is, this agent may be a preventive or improving agent for a disease selected from gingivitis, periodontal disease, colorectal cancer, and oral cancer.

[0015] (7) In the present invention, the agarooligosaccharide may contain agarobiose.

[0016] (8) The second aspect of this agent is an agent for suppressing the growth of oral bacteria having a NanA gene consisting of a DNA sequence having a sequence identity of 49.9% or more with SEQ ID NO: 1 in genomic DNA, and 3,6-anhydro-L-galactose or an oligosaccharide having this at the reducing end as an active ingredient.

Effects of the Invention

[0017] According to the present invention, it is possible to suppress the growth of oral bacteria that may be involved in mucin degradation, such as Lachnococcus gnavus and Fusobacterium spp. Thereby, it is possible to suppress the expression of NanA in the oral cavity or suppress the degradation of mucin in the oral cavity, and thus contribute to the prevention and improvement of oral unhealthy conditions and diseases in which mucin deficiency is involved in the onset and exacerbation.

[0018] In addition, the agarooligosaccharide used as an active ingredient in the present invention is an oligosaccharide made from agar, which has been ingested as a food since ancient times, and its safety is extremely high. Therefore, according to the present invention, it is possible to suppress the growth of oral bacteria that may be involved in mucin degradation without any concerns about safety and side effects.

Brief Description of the Drawings

[0019]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Mode for Carrying Out the Invention

[0020] Hereinafter, the present invention will be further described. This agent contains agarooligosaccharide as an active ingredient.

[0021] Agarooligosaccharide is an even-numbered oligosaccharide composed of repeating units of the disaccharide agarobiose consisting of D-galactose and 3,6-anhydro-L-galactose. Examples of agarooligosaccharide include the disaccharide agarobiose as the minimum unit, the tetrasaccharide agarotetraose, the hexasaccharide agarohexaose, the octasaccharide agarooctaose, the decasaccharide agarodecaose, and the like. In the present invention, agarooligosaccharide contains at least one of these oligosaccharides, may consist of one kind, or may contain two or more kinds.

[0022] As shown in the examples described below, among agarooligosaccharides, agarobiose exhibits a particularly high growth inhibitory effect against oral bacteria carrying the NanA gene homolog of Luminococcus gnavus. Therefore, it is preferable that the agarooligosaccharide contains agarobiose. In this case, the agarooligosaccharide may consist only of agarobiose or may contain agarooligosaccharides other than agarobiose. Examples of the content ratio of agarobiose in the agarooligosaccharide in this case include 1 to 100% by mass, 10 to 100% by mass, 20 to 100% by mass, 30 to 100% by mass, 40 to 100% by mass, 50 to 100% by mass, and the like.

[0023] Agarooligosaccharide is an oligosaccharide having 3,6-anhydro-L-galactose at the reducing end. Therefore, the active ingredient of this agent may be 3,6-anhydro-L-galactose or an oligosaccharide having this at the reducing end. Examples of the number of sugars of the oligosaccharide in this case include 2 to 8 sugars, 2 to 10 sugars, 2 to 12 sugars, and the like.

[0024] As the agarooligosaccharide, commercially available agarooligosaccharide (agar oligosaccharide) can be used, or it can also be produced and used according to a conventional method. Examples of a general production method of agarooligosaccharide include, for example, a method of hydrolyzing agar. Hydrolysis includes a method using an acid and a method using an enzyme.

[0025] Examples of the acid decomposition method include a method using a solid acid described in Japanese Patent No. 4796697, a method using a mineral acid such as sulfuric acid or hydrochloric acid, and a method using an organic acid such as acetic acid or citric acid, but any method may be used. According to acid decomposition, an even-numbered sugar having 3,6-anhydro-L-galactopyranose at the reducing end can be obtained.

[0026] In addition, as methods of enzymatic degradation, degradation by α-agarase and degradation by β-agarase can be exemplified. According to α-agarase, just as in the case of acid degradation, even-numbered sugars having 3,6-anhydro-L-galactopyranose at the reducing end can be obtained. Degradation by α-agarase can be carried out, for example, by the method described in Japanese Patent Application Laid-Open No. H2-65789.

[0027] The hydrolyzate of agar may be used as it is as agarooligosaccharide, or the hydrolyzate may be purified or pH-adjusted before use. As purification methods, filtration using filter paper, activated carbon, etc. can be exemplified. Also, the agarooligosaccharide solution obtained by the hydrolysis treatment may be used in a liquid state, or if necessary, it may be made into a powder by vacuum freeze-drying or the like before use.

[0028] Incidentally, agar is a dehydrated and dried viscous substance extracted from red algae such as tengusa and ogonori, and contains polysaccharides agarose and agaropectin as main components. As raw materials for producing agarooligosaccharides, in addition to agar, substances containing agarose or agaropectin as components can also be used. As such substances, specifically, solutions obtained by hot water extraction of red algae such as the tengusa family, ogonori family, and igisu family, which are raw materials for agar, can be exemplified. Examples of red algae of the tengusa family include macsa, onigusa, oobus, hirakusa, obakusa, and yuikiri. Examples of red algae of the ogonori family include ogonori and oogonori. Examples of red algae of the igisu family include igisu and egonori. These red algae can be used alone or in combination of two or more.

[0029] As shown in the examples described later, the sugar composition of agarooligosaccharides can be confirmed by liquid chromatography including high performance liquid chromatography. Also, thereby, agarooligosaccharides having a desired number of sugars, such as only agarobiose, only agaro-tetraose, and only agaro-hexaose, can be fractionated and separated, and the sugar composition of the agarooligosaccharides can be adjusted before use.

[0030] 3,6-Anhydro-L-galactose can be obtained by using commercially available products such as reagents, or can also be produced by conventional methods. Examples of such production methods include the method described in Japanese Patent No. 4007760. That is, 50 μl of 10-fold concentrated phosphate buffered saline and 50 μl of β-galactosidase phosphate buffered saline solution at 10 units / μl are added to 450 μl of a 100 mM aqueous solution of agarobiose and mixed, and the mixture is reacted at 37 °C for 1 hour. After adding 5 ml of a 1-butanol:ethanol = 1:1 mixture to this reaction solution, the insoluble matter is precipitated by centrifugation, and the obtained supernatant is subjected to column chromatography using a silica gel column, and 1-butanol:ethanol:water = 5:5:1 is used as the eluent and pressurized with a compressor at 0.3 kg / cm 2 and separated. By fractionating so that each fraction is 7 ml, a liquid containing high-purity 3,6-anhydro-L-galactose can be obtained, for example, in fractions from No. 14 to No. 17. By collecting these fractions and drying them under reduced pressure, 3,6-anhydro-L-galactose can be obtained.

[0031] This agent is an agent that suppresses the growth of oral bacteria that possess the NanA gene consisting of a DNA sequence having a sequence identity of 49.9% or more with SEQ ID NO: 1 in genomic DNA. In the present invention, with respect to oral bacteria, suppressing growth and suppressing the number of bacteria are synonymous.

[0032] In the present invention, oral bacteria refer to bacteria that inhabit the oral cavity or bacteria detected from a specimen collected from the oral cavity.

[0033] Whether or not the growth of specific oral bacteria can be suppressed can be confirmed according to a conventional method. For example, as shown in the examples described later, if specific oral bacteria are in an isolated state, the active ingredient of this agent can be added to the culture medium for culturing them, and the degree of growth can be confirmed by a turbidity method or the like in comparison with the case where this agent is not added. Further, if specific oral bacteria are not isolated, the number of bacteria can be confirmed by quantitative PCR using primers specific to the bacteria. That is, the degree of growth inhibition can be confirmed by comparing the number of bacteria by quantitative PCR between the case where the active ingredient of this agent is brought into contact and the case where it is not brought into contact.

[0034] SEQ ID NO: 1 (948 residues) is the DNA sequence of the gene encoding NanA of Luminococcus gnavus. [SEQ ID NO: 1] ATGGCTTTTATGAAGCAAAGGAGCAAAACTATGAGAAATCTTGAGAAGTATAAAGGTGTGATTCCGGCATTTTATGCTTGCTATGACAAAGAAGGAAACATTAGTCCAGAAGGTGTACAGGGACTGACAAAATATTTTGTAAAAAAAGGGGTAAAAGGTGTCTATGTAAACGGTTCTTCCGGAGAATGTATTTATCAGAGTGTGGAGGACCGTAAGATTGTACTTGAGAATGTTATGAAAGTAGCGGAAGGTAAACTTACAGTTATTGCCCATGTGGCCTGCAATAACACGAAGGACAGTCAGGAGCTTGCCAGACATGCAGAAGGGCTGGGGGTAGATGCAATCGCTGCAATTCCTCCCATCTATTTTCACTTACCGGAATATGCTATTGCGCAGTATTGGAATGCCATTAGTGCAGCGGCACCGAACACAGACTTTGTAATTTATAACATACCTCAGCTTGCTGGTGTTGCACTTACACAGAATTTATTTGTAGAGATGAGGAAAAATCCCAACGTCATTGGTGTCAAGAATTCCTCTATGCCGGTACAGGATATCCAAATGTTTAAGCAGGCTGCAGGAGCTGAGTACATTATCTTTAATGGTCCTGATGAGCAGTTTATGAGCGGACGTGTTATCGGGGCAGAGGGTGCAATTGGGGGAACCTATGGTGCTATGCCTGAATTATACTTAAAGTTGGATGAGTGTATAAATGCAGGAAAGATGACAGAGGCAAGAAAAATCCAGTATGCTTGTAATGAGATAATTTACAAAATGTGTTCAGCGCATGGAAATATGTATGCAGTTATTAAAGCAATTCTAAAGATTAATGAAGGACTGGAACTTGGTGCAGTAAGAGAGCCTCTTCCAGCATTGGTAGATGAGGACATGGAGATTGTAAAAGAAGCTGCACAGATGATCTGTGATGCGAAGAAGAAATTTCTATAA

[0035] N-acetylneuraminate lyase (NanA) is an enzyme that has the activity to decompose N-acetylneuramic acid into N-acetylmannosamine and pyruvic acid. The activity of NanA can be confirmed, for example, by the method described in the literature <Jay Prakash Kumar et.al., Crystal structures and kinetics of N-acetylneuraminate lyase from Fusobacterium nucleatum, Acta Cryst. (2018). F74, 725?732>. That is, the pyruvic acid produced by NanA is quantified by a standard binding assay <Zhu, A., Romero, R. & Petty, H. R. (2010). Anal. Biochem. 396, 146?151.>. Specifically, the pyruvic acid produced by the decomposition of N-acetylneuramic acid is oxidized by pyruvate oxidase in the presence of phosphate and oxygen to produce acetyl phosphate, carbon dioxide, and hydrogen peroxide. The oxidation of the fluorescent probe by hydrogen peroxide is catalyzed by horseradish peroxidase, and the hydrogen peroxide produced using the fluorescent generating substrate may be detected <Sugahara, K., Sugimoto, K., Nomura, O. & Usui, T. (1980). Clin. Chim. Acta, 108, 493?498.>.

[0036] Luminococcus gnavus is known to be a commensal in the human intestine as described above, but as shown in the examples described below, it is also an oral bacterium detected from specimens collected from the oral cavity. And it has NanA, a sialic acid-metabolizing enzyme, and grows using the sialic acid of mucin as a nutrient source. Therefore, oral bacteria that possess a homolog of the NanA gene of Luminococcus gnavus in genomic DNA may express NanA and be involved in the degradation of oral mucin. If the number of such bacteria can be suppressed, it may be possible to suppress the expression of NanA in the oral cavity and suppress the degradation of oral mucin.

[0037] The homolog of the NanA gene of Luminococcus gnavus refers to a NanA gene consisting of a DNA sequence having a high sequence identity with SEQ ID NO: 1. Here, examples of the value of the sequence identity include, for example, 49.9% or more, 50% or more, 51% or more, 52% or more, 53% or more, 54% or more, 55% or more, 56% or more, 57% or more, 58% or more, 59% or more, 60% or more, 61% or more, 62% or more, 63% or more, 64% or more, 65% or more, 66% or more, 67% or more, 68% or more, 69% or more, 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 85% or more, 90% or more, 95% or more, etc., and 100% is also included. Note that "sequence identity" refers to sequence consistency and can be used interchangeably with "identity".

[0038] "A DNA sequence having a high sequence identity with SEQ ID NO: 1" can also be referred to as "a DNA sequence in which one or more nucleotides are deleted, substituted, inserted or added in SEQ ID NO: 1". In this case, the number of nucleotides deleted, substituted, inserted or added can be, for example, 1 to 474, 1 to 464, 1 to 455, 1 to 445, 1 to 436, 1 to 427, 1 to 417, 1 to 408, 1 to 398, 1 to 389, 1 to 379, 1 to 341, 1 to 331, 1 to 312, 1 to 284, 1 to 189, 1 to 94, 1 to 90, 1 to 80, 1 to 70, 1 to 60, 1 to 50.

[0039] The sequence identity between a certain DNA sequence and SEQ ID NO: 1 can be confirmed according to conventional methods. For example, it can be confirmed using programs such as FASTA (http: / / www.genome.JP / tools / fasta / ), Basic local alignment search tool (BLAST; http: / / www.ncbi.nlm.nih.gov.), Position-Specific Iterated BLAST (PSI-BLAST; http: / / www.ncbi.nlm.nih.gov.), CLUSTALW (http: / / www.genome.jp / ja / ), MAFFT (http: / / www.genome.jp / ja / ).

[0040] Oral bacteria that possess in their genomic DNA a NanA gene with high sequence identity to Array No. 1 (a homolog of the NanA gene of Luminococcus gnavus), specifically, for example, Luminococcus genus bacteria such as Luminococcus gnavus (genome of ATCC 29149 = JCM6515; CP027002.1) (sequence identity; approximately 100%), Fusobacterium mortiferum (genome of ATCC 9817; CP028102.1) (sequence identity; approximately 65%), Fusobacterium nucleatum (genome of JCM8532; AE009951.2) (sequence identity; approximately 50%), Fusobacterium nucleatum (genome of ATCC 23726; CP028109.1) (sequence identity; approximately 53%) and other Fusobacterium genus bacteria, Blautia wexlerae (genome of MCC298; CP102267.1) (sequence identity; approximately 96%), Blautia luti (genome of JCM17040; AP028156.1) (sequence identity; approximately 71%), Blautia producta (genome of ATCC 27340 = DSM 2950 = JCM 1471; CP048626.1) (sequence identity; approximately 71%), Blautia coccoides (genome of strain YL58; CP022713.1) (sequence identity; approximately 73%) and other Blautia genus bacteria, Enterocloster bolteae (genome of ATCC BAA-613; CP022464.2) (sequence identity; approximately 72%), Anaerotruncus colihominis (genome of DSM 17241 = JCM 15631; CP102255.1) (sequence identity; approximately 72%), Lactobacillus oligofermentans (genome of DSM 15707 = LMG 22743 = JCM 16175; LN898144.1) (sequence identity; approximately 71%), Treponema brennaborense (genome of DSM 12168; CP002696.1) (sequence identity; approximately 69%), Marvinbryantia formatexigens (genome of DSM 14469; CP102268.1) Examples include Streptococcus parasanguinis (genome of ATCC 15912; CP002843.1) (sequence identity; about 68%) and Streptococcus parasanguinis (sequence identity; about 64%).

[0041] Among these, the genus Fusobacterium is a Gram-negative, non-motile, anaerobic, non-spore-forming bacillus belonging to the family Fusobacteriaceae and is known to be a resident bacterium in the oral cavity that is involved in the onset and exacerbation of various diseases and unhealthy conditions. For example, Fusobacterium nucleatum is a causative bacterium of gingivitis, periodontal disease, and colorectal cancer, and it has also been reported that it may promote the progression of oral cancer through multiple mechanisms of action such as activation of cell proliferation, promotion of cell infiltration, induction of chronic inflammation, and immune evasion (Jay Prakash Kumar et al., Crystal structures and kinetics of N-acetylneuraminate lyase from Fusobacterium nucleatum, Acta Cryst. (2018). F74, 725?732) (McIlvanna et al. Fusobacterium nucleatum and oral cancer: a critical review, BMC Cancer (2021) 21:1212). Therefore, this agent can be used for the prevention and improvement of diseases selected from gingivitis, periodontal disease, colorectal cancer, and oral cancer by suppressing the growth of the genus Fusobacterium in the oral cavity.

[0042] Whether or not a certain oral bacterium possesses a homolog of the NanA gene of Luminococcus gnavus can be confirmed according to a conventional method. For example, if the genomic DNA of the bacterium is sequenced and the sequence information of the genome can be obtained, the presence or absence of the homolog can be confirmed. Also, as shown in the examples described later, PCR may be performed using the genomic DNA of the bacterium as a template and primers capable of amplifying the homolog, and the presence or absence of amplification may be confirmed. If a considerable amount of PCR product is observed, it can be said that the bacterium possesses the homolog.

[0043] In the present invention, oral mucin refers to mucin present in the oral cavity. Examples of oral mucin include mucin (such as MUC5B and MUC7) contained in the above-mentioned saliva and mucin (such as MUC1) of oral mucosal epithelial cells.

[0044] Whether the degradation of oral mucin is suppressed can be confirmed according to conventional methods. For example, as described in Non-Patent Document 3, the amounts of MUC5B and MUC7 in saliva can be measured by the ELISA method (Enzyme-Linked Immuno Sorbent Assay) using a commercially available ELISA kit. Therefore, by comparing the amounts of mucin when contacted with agarooligosaccharide and when not contacted, the degree of suppression of mucin degradation can be confirmed.

[0045] The agent according to the present invention can be used as it is as food and drink, supplements, pharmaceuticals, quasi-drugs, cosmetics, etc., or can be used in combination with other components as a raw material for food and drink, supplements, pharmaceuticals, quasi-drugs, cosmetics, etc. These products can be manufactured by methods known to those skilled in the art using agarooligosaccharide as a raw material.

[0046] The dosage (intake amount) of agarooligosaccharide can be appropriately set according to the administration subject, the form of the product, and the purpose. Specifically, as the dosage, for example, for adults per day, it can be exemplified as 0.0125 mg / kg body weight or more, 0.025 mg / kg body weight or more, 0.05 mg / kg body weight or more, 0.1 mg / kg body weight or more, 1000 mg / kg body weight or less, 800 mg / kg body weight or less, 600 mg / kg body weight or less, 400 mg / kg body weight or less, 200 mg / kg body weight or less.

[0047] The content of agarooligosaccharide in the product can also be appropriately set according to the form and use of the product. Specifically, as the content, for example, 0.0001% by mass or more, 0.001% by mass or more, 0.01% by mass or more, 0.1% by mass or more, 100% by mass or less, 90% by mass or less, 80% by mass or less, 70% by mass or less, 60% by mass or less, 50% by mass or less, 40% by mass or less, 35% by mass or less, 30% by mass or less, 10% by mass or less, 5% by mass or less, etc. can be exemplified.

[0048] Hereinafter, the present invention will be described based on examples. Note that the technical scope of the present invention is not limited to the features shown by these examples.

Examples

[0049] <Test method> (1) Preparation of agarooligosaccharide 50 g of agar (Ultra Agar AX-30, manufactured by Ena Food Industry Co., Ltd.) was added to 1000 g of purified water, heated and dissolved, then 2 g of concentrated sulfuric acid was added, and the mixture was stirred at 90 °C for 3 hours. After adjusting the pH to 3.5 with sodium hydroxide, it was treated with activated carbon and further filtered through filter paper to collect the filtrate. This was further filtered through a filter with a pore size of 0.1 μm to collect the filtrate, which was powdered by vacuum freeze-drying to obtain agarooligosaccharide powder.

[0050] The composition of the prepared agarooligosaccharide was measured using high performance liquid chromatography (Prominence (registered trademark) HPLC system, manufactured by Shimadzu Corporation). The measurement conditions were as follows: two columns (TSKgel (registered trademark) α-2500, manufactured by Tosoh Corporation) were connected in series, elution was carried out under the conditions of solvent H2O, flow rate 0.3 ml / min, and temperature 60 °C, and detection was by RI (differential refraction). The results were as follows (the values are in mass%, the same hereinafter). In this example, a composition containing the following 2-10 sugars was referred to as "agarooligosaccharide". Disaccharide (agarobiose): 31.5 Tetrasaccharide (agarotetraose): 30.1 Hexasaccharide (agaropentaose): 21.2 Octasaccharide (agaroctaose): 11.6 10 - sugar (agarodecaose): 5.6

[0051] (2) Preparation of 2 - sugar to 8 - sugar The agarooligosaccharides prepared by Test Method (1) were subjected to recycling size - exclusion chromatography to fractionate the fractions containing 2 - sugar, 4 - sugar, 6 - sugar, and 8 - sugar, respectively. The recycling size - exclusion chromatography was carried out under the following conditions. ≪Conditions of Recycling Size - Exclusion Chromatography≫ System: LaboACE LC - 7080 Plus (Nippon Bunseki Kogyo) Column: JAIGEL - W252 / W253 (Nippon Bunseki Kogyo) Mobile phase: An aqueous solution containing 0.005% (v / v) acetic acid and 10% (v / v) ethanol Flow rate: 3.5 mL / min The composition of each fraction was confirmed by high - performance liquid chromatography under the conditions described in Test Method 1(1). Each fraction was dried to obtain agarobiose, agarotetraose, agarohexaose, and agarooctaose. In this example, agarobiose, agarotetraose, agarohexaose, and agarooctaose may be referred to as "2 - sugar", "4 - sugar", "6 - sugar", and "8 - sugar", respectively.

[0052] (3) Culture medium The culture medium used was a medium appropriately modified based on the Brain - Heart Infusion medium (※1) described in the literature <G. Le Blay et. al., In vitro inhibition activity of nisin A, nisin Z, pediocin PA - 1, Letters in Applied Microbiology, Volume45, Issue3, September 2007, Pages 252 - 257>. ※1 Composition of Brain-Heart Infusion medium; brain-heart infusion, 5 g / L yeast extract, 5 g K2HPO4, 8 g glucose, 0.5 g L-cysteine hydrochloride, 1 g Tween 80, 0.005 g hemin, 0.002 g vitamin K1, 1 mg resazurin, 50 mL salt solution (※2). ※2 Composition of salt solution (per 1 L); 5 g sodium acetate, 2 g ammonium citrate, 0.2 g MgSO2·7H2O, 0.05 g MnSO4·H2O, pH 6.8.

[0053] <Example 1> Growth inhibitory effect on Ruminococcus gnavus (1) Culture in the presence of agarooligosaccharide Ruminococcus gnavus JCM6515 (RIKEN BioResource Research Center, Microbial Materials Development Laboratory (JCM)) was cultured on sheep blood agar medium (M) (composition per 1 L of purified water: 14.5 g of casein-tryptic digest, 5.0 g of soybean-papain digest, 5.0 g of sodium chloride, 1.5 g of growth factor, 50 mL of defibrinated sheep blood, 14.0 g of agar, pH 7.3) (BD, Japan) to obtain colonies. After inoculating a single colony into 3.0 mL of the culture medium, it was statically cultured anaerobically at 37°C for 3 days using an anaerobic culture kit "AnaeroPack" (Mitsubishi Gas Chemical) and used as a seed mother liquor.

[0054] Agarooligosaccharide was added to the culture medium to a final concentration of 0% by mass, 0.01% by mass, 0.10% by mass, and 0.20% by mass to obtain this culture medium. After dispensing 0.5 mL / well of this culture medium into Deep Well Plates (AxyGen Scientific, CA, USA), 0.25 μL of the seed mother liquor was inoculated into each well, and it was statically cultured anaerobically at 37°C using an anaerobic culture kit "AnaeroPack" (Mitsubishi Gas Chemical).

[0055] (2) Measurement of the number of bacteria by turbidimetry Twenty microliters of the culture broth was collected 24 hours and 48 hours after the start of static culture, and diluted 10-fold by adding 180 μL of water. The absorbance (OD660) of the diluted culture broth was measured using a microplate reader (Wako SUNRISE Rainbow). The culture medium was also diluted 10-fold and measured in the same manner. After subtracting the measured value of the culture medium from the measured value of the culture broth, the result was multiplied by 10 and taken as the absorbance (OD660) of the culture broth. The results are shown in Figure 1.

[0056] As shown in Figure 1, at both 24 hours and 48 hours, the higher the final concentration of agarooligosaccharide in this culture medium, the lower the value of absorbance (OD660). That is, agarooligosaccharide inhibited the number of Luminococcus gnavus bacteria in a concentration-dependent manner in this culture medium. From this result, it became clear that agarooligosaccharide can inhibit the growth of the genus Luminococcus.

[0057] (3) Culture in the presence of disaccharides to octasaccharides Agarooligosaccharide was replaced with disaccharide, tetrasaccharide, hexasaccharide, or octasaccharide, and Luminococcus gnavus was cultured by the method described in Example 1(1) of this example. The number of bacteria was measured by the turbidity method described in Example 1(2) of this example. The final concentration of disaccharides to octasaccharides in the medium was 0.2% by mass (2000 μg / mL), and the culture times were 23 hours, 31 hours, and 47 hours. As comparative controls, samples with agarooligosaccharide added at the same concentration and samples without the addition of either agarooligosaccharide or disaccharides to octasaccharides (no addition) were cultured in the same manner and the number of bacteria was measured. The results are shown in Figure 2.

[0058] As shown in Fig. 2, the samples to which agarooligosaccharides, disaccharides, and tetrasaccharides were added had significantly smaller absorbance (OD660) values than the sample without addition, regardless of the culture time. The samples to which hexasaccharides were added also had significantly smaller absorbance at culture times of 23 hours and 31 hours and were also considerably smaller at 47 hours, compared to the sample without addition. The samples to which octasaccharides were added also had significantly smaller absorbance at a culture time of 23 hours and were also considerably smaller at 31 hours, compared to the sample without addition. From these results, it was revealed that agarooligosaccharides, agarobiose, agarotetraose, agarooctaose, and agarooctaose can suppress the growth of the genus Luminococcus. Since all of these oligosaccharides have 3,6-anhydro-L-galactose at the reducing end, it was revealed that 3,6-anhydro-L-galactose or oligosaccharides having this at the reducing end can suppress the growth of the genus Luminococcus.

[0059] In addition, for the disaccharides and tetrasaccharides, no increase in absorbance was observed with the passage of the culture time, and the absorbance values were significantly small at any culture time. From these results, it was revealed that among agarooligosaccharides, agarobiose and agarotetraose have a significantly large growth inhibitory effect on the genus Luminococcus.

[0060] <Example 2> Growth inhibitory effect on Fusobacterium nucleatum (1) Culture in the presence of agarooligosaccharides Ruminococcus gnavus JCM6515 was replaced with Fusobacterium nucleatum JCM8532 (RIKEN BioResource Center, Microbial Materials Development Laboratory (JCM)), and cultured by the method described in Example 1(1), and the absorbance of the culture solution was measured by the turbidity method described in Example 1(2). However, the culture time was 48 hours. The results are shown in Fig. 3.

[0061] As shown in Fig. 3, the higher the final concentration of agarooligosaccharide in the main culture medium, the smaller the value of absorbance (OD660). That is, agarooligosaccharide inhibited the number of Fusobacterium nucleatum bacteria in a concentration-dependent manner in the main culture medium. From this result, it became clear that agarooligosaccharide can inhibit the growth of the genus Fusobacterium.

[0062] (2) Cultivation in the presence of disaccharide and tetrasaccharide Agarooligosaccharide was replaced with disaccharide and tetrasaccharide, and Fusobacterium nucleatum was cultured by the method described in Example 2(1) of the present invention, and the number of bacteria was measured by the turbidimetry method. The final concentrations in the media of disaccharide and tetrasaccharide were 0.2% by mass (2000 μg / mL), and the culture times were 23 hours, 31 hours, and 47 hours. As comparative controls, samples with agarooligosaccharide added at the same concentration and samples without the addition of any of agarooligosaccharide, disaccharide, and tetrasaccharide (no addition) were also cultured in the same manner and the number of bacteria was measured. The results are shown in Fig. 4.

[0063] As shown in Fig. 4, the samples with disaccharide and tetrasaccharide added had significantly smaller values of absorbance (OD660) compared to the sample without addition, regardless of the length of the culture time. In particular, for the disaccharide, no increase in absorbance was observed with the passage of the culture time, and the absorbance values were significantly smaller at any culture time. The sample with agarooligosaccharide added also had a significantly smaller absorbance at 23 hours of culture time and was also considerably smaller at 31 hours compared to the sample without addition. From this result, it became clear that agarooligosaccharide, agarobiose, and agarotetraose can inhibit the growth of the genus Fusobacterium. In particular, it became clear that agarobiose has a significantly greater growth inhibitory effect on the genus Fusobacterium.

[0064] In addition, since all of agarooligosaccharide, agarobiose, and agarotetraose have 3,6-anhydro-L-galactose at the reducing end, it became clear that 3,6-anhydro-L-galactose or an oligosaccharide having this at the reducing end can inhibit the growth of the genus Fusobacterium.

[0065] <Example 3> Growth inhibitory effect of oral bacteria carrying the NanA gene homolog of Ruminococcus gnavus (1) Design of specific primers As homologs of the NanA gene of Ruminococcus gnavus ((a) in Table 1 below), (i) to (g) in Table 1 below were extracted using EMBOSS Matcher (European Bioinformatics Institute (EMBL-EBI) https: / / www.ebi.ac.uk / Tools / psa / emboss_matcher / ).

Table 1

[0066] Subsequently, based on (a) to (e) in Table 1 (SEQ ID NOs: 1 to 4), the following were prepared as specific primers capable of amplifying the NanA genes of Ruminococcus gnavus and the genus Blautia. ≪For amplification of the NanA gene of Ruminococcus gnavus and...≫ Forward primer; 5’- TTKTTGGARACACAGACGGA -3’ (SEQ ID NO: 10) Reverse primer; 5’- ACCAGGTYTCTCCCTCATCATC -3’ (SEQ ID NO: 11)

[0067] Also, based on (k) to (q) in Table 1 (SEQ ID NOs: 6 to 8), the following were prepared as specific primers capable of amplifying the NanA gene of Streptococcus parasanguinis. ≪For amplification of nanA of Streptococcus parasanguinis≫ Forward primer; 5’- GCTTTTTACGCCTGCTATGA -3’ (SEQ ID NO: 12) Reverse primer; 5’- TACATTCGCCRGARGATCCGTT -3’ (SEQ ID NO: 13)

[0068] In addition, the following were prepared as universal primers capable of amplifying the V3-V4 region of the 16S ribosomal RNA gene of all bacteria. ≪For amplification of 16S ribosomal RNA (V3-V4 region) gene of all bacteria≫ Forward primer; 5’- CGGTGAATACGTTCCCGG -3’ (SEQ ID NO: 14) Reverse primer; 5’- TACGGCTACCTTGTTACGACTTC -3’ (SEQ ID NO: 15)

[0069] (2) Cultivation of oral bacteria in the presence of agarooligosaccharide The teeth were rubbed all over with a cotton swab. This cotton swab was placed in a 1.5 mL volume Eppendorf tube containing 700 μL of the culture medium, and the adherents on the cotton swab were transferred to the medium by pressing against the wall of the tube, which was used as the seed mother liquor. Agarooligosaccharide was added to the culture medium to a final concentration of 0% by mass, 0.01% by mass, 0.02% by mass, or 0.10% by mass to obtain the main culture medium. After dispensing 0.5 mL / well of the main culture medium into Deep Well Plates (AxyGen Scientific, CA, USA), 0.25 μL of the seed mother liquor was inoculated into each well, and static cultivation was carried out anaerobically at 37 °C using an anaerobic culture kit “AnaeroPack” (Mitsubishi Gas Chemical).

[0070] (3) Measurement of the total number of oral bacteria by turbidimetry After 30 hours, 20 μL of the culture solutions in which the final concentration of agarooligosaccharide in the main culture medium was 0% by mass and 0.1% by mass were collected, and diluted 10-fold by adding 180 μL of water. The absorbance (OD660) of the diluted culture solutions was measured using a microplate reader (Wako SUNRISE Rainbow). The culture medium was also diluted 10-fold and measured in the same manner. After subtracting the measured value of the culture medium from the measured value of the culture solution and multiplying the result by 10, this was taken as the absorbance (OD660) of the culture solution. This absorbance (OD660) is generally used as an index correlated with the total number of oral bacteria. The results are shown in Figure 5.

[0071] As shown in Fig. 5, the absorbance (OD660) when the final concentration of agarooligosaccharide in the main culture medium was 0% by mass was 0.34, whereas the absorbance (OD660) when the concentration was 0.1% by mass was 0.35, showing almost no change. From these results, it was revealed that agarooligosaccharide hardly affects the total number of all bacteria when the added concentration in the medium is 0.1% by mass or less.

[0072] (4) Measurement of the number of bacteria carrying the NanA gene by quantitative PCR After 30 hours, the culture solutions in the main culture medium with final agarooligosaccharide concentrations of 0% by mass, 0.01% by mass, and 0.02% by mass were centrifuged, and genomic DNA was extracted from the collected precipitate using a stool mini kit (QIAGEN) according to the instructions. Using the recovered genomic DNA as a template, quantitative PCR was performed using the real-time PCR reagent "PowerTrack? SYBR Green Master Mix" (ThermoFisher) and the primers of SEQ ID NOs: 10 to 15 above to determine the DNA copy number of each gene. The annealing temperature was set to 50°C (for the nanA gene) or 60°C (for the 16S rRNA gene). Generally, bacteria are considered to have an average of about 4 copies of the 16S rRNA gene. Therefore, the value obtained by dividing the DNA copy number of the 16S rRNA gene by 4 reflects the total number of bacteria, and the DNA copy number of each NanA gene can be said to reflect the number of bacteria carrying each NanA gene. From this, the value obtained by dividing the "DNA copy number of each NanA gene" by the value obtained by dividing the "DNA copy number of the 16S rRNA gene by 4" was calculated and defined as the "proportion of bacteria carrying the NanA gene". The results are shown in Fig. 6.

[0073] As shown in Fig. 6, the proportion of bacteria carrying the NanA gene of Luminococcus gnavus and Blautia was 1.1% when the final concentration of the agarooligosaccharide in the main culture medium was 0% by mass, while it was 0.44% at 0.01% by mass and 0.0035% at 0.02% by mass. That is, the agarooligosaccharide suppressed the proportion of bacteria carrying the NanA gene of Luminococcus gnavus and Blautia in a concentration-dependent manner in the main culture medium.

[0074] The proportion of bacteria carrying the NanA gene of Streptococcus parasanguinis was also 0.10% when the final concentration of the agarooligosaccharide in the main culture medium was 0% by mass, while it was 0.023% at 0.01% by mass and 0.013% at 0.02% by mass. That is, the agarooligosaccharide suppressed the proportion of bacteria carrying the NanA gene of Streptococcus parasanguinis in a concentration-dependent manner in the main culture medium.

[0075] From these results, it was revealed that agarooligosaccharide, 3,6-anhydro-L-galactose, or an oligosaccharide having this at the reducing end can suppress the growth of oral bacteria carrying a NanA gene having high sequence identity with the NanA gene (SEQ ID NO: 1) of Luminococcus gnavus.

Claims

1. An inhibitor for the growth of oral bacteria that has in its genomic DNA an N - acetylneuraminic acid lyase gene consisting of a DNA sequence having a sequence identity of 49.9% or more with SEQ ID NO: 1, said agent having an agarooligosaccharide as an active ingredient.

2. The agent according to claim 1, which is used for suppressing the expression of N - acetylneuraminic acid lyase in the oral cavity.

3. The agent according to claim 1, which is used for suppressing the degradation of oral mucin.

4. An inhibitor for the growth of Luminococcus gnavus, said agent having an agarooligosaccharide as an active ingredient.

5. The agent according to claim 1, wherein the agarooligosaccharide is an agarooligosaccharide containing agarobiose.

6. A method for suppressing the growth of oral bacteria that have in their genomic DNA an N - acetylneuraminic acid lyase gene consisting of a DNA sequence having a sequence identity of 49.9% or more with SEQ ID NO: 1, the method comprising the step of administering an agarooligosaccharide to a subject (excluding methods of operating, treating or diagnosing a human).

Images