Pharmaceutical Kit and Method for Reconstructing a Damaged Nerve Pathway

Abstract

The present invention provides a drug kit for rebuilding a damaged neural pathway, wherein the drug kit comprises a first formulation comprising axonal elongation-inducing protein, nucleic acid encoding said protein, or a vector that expressibly contains DNA encoding said protein. The present invention also provides a method for rebuilding a damaged neural pathway in a patient, the method comprising the administration of the first formulation of this drug kit.

Description

Technical Field

[0001] The present invention relates to a pharmaceutical kit for reconstructing a damaged neural pathway. The present invention also relates to a method for reconstructing a damaged neural pathway.

Background Art

[0002] Neural pathways are damaged by various factors, thereby impairing the functions they are responsible for. For example, in cerebral infarction and stroke, nerve cells exposed to ischemia are deficient, so the neural pathways formed by these nerve cells are damaged and functional disorders occur. A typical example is the voluntary movement disorder (e.g., hemiplegia, etc.) due to damage to the corticospinal tract. The same applies when specific nerve cells are deficient due to neurodegenerative diseases, head injuries, etc. Thus, for diseases caused by damage to neural pathways, cell transplantation to replenish the nerve cells that formed the neural pathway is considered the most effective treatment method.

[0003] In cell transplantation therapy for nerve cells, nerve cells and / or neural progenitor cells are usually transplanted into the damaged site or its vicinity. To obtain a sufficient therapeutic effect, the transplanted cells need to engraft, (in some cases differentiate into desired nerve cells), extend axons to the desired target cells, and form neural connections. However, generally, there is a problem that the axon elongation efficiency of transplanted cells is low, and the proportion of those that can extend axons over a long distance is very low.

[0004] For example, the axons of upper motor neurons present in the motor area of the cerebral cortex pass through the internal capsule, pass through the cerebral peduncle on the ventral side of the midbrain, penetrate the pontine nucleus, enter the spinal cord through the pyramidal decussation from the ventral side of the medulla oblongata, and connect to lower motor neurons in the anterior horn of the spinal cord while descending in the lateral funiculus of the spinal cord. This pathway is called the corticospinal tract, and as described above, it is a pathway with a very high demand for reconstruction. However, in adult humans, it can reach more than 1 m in some cases, so reconstructing this pathway is extremely difficult. Therefore, various devices for reconstructing the corticospinal tract by cell transplantation have been studied.

[0005] For example, in Non-Patent Document 1, in a brain injury model of adult mice, when fetal mouse brains were transplanted immediately after injury, almost no transplantation cell-derived nerve axons reaching the spinal cord were observed. However, when transplantation was performed one week after injury, transplantation cell-derived axons reaching the spinal cord were significantly observed, and a tendency for improvement in motor ability was also observed. This suggested the importance of the timing of cell transplantation.

[0006] In addition, the present inventors have found that in a system in which human ES cell-derived brain organoids are transplanted into a brain injury model of adult mice, CTIP2 or L1CAM can be a marker for nerve cells capable of projecting to the spinal cord (Patent Document 1, Non-Patent Document 2). In particular, since L1CAM is a membrane protein expressed on the cell surface, this enables enrichment of cells having the ability to extend axons up to the spinal cord, that is, cells suitable for reconstruction of the corticospinal tract, in the preparation of cells for human transplantation.

[0007] However, the effects obtained by optimizing the transplantation timing are limited, and the proportion of L1CAM-positive cells contained in brain organoids is very small. Therefore, relying only on cell enrichment would result in a very expensive treatment method. Thus, there has been a strong desire for a method that can replace these methods or be used in combination with these methods and effectively promote axon elongation of transplanted cells, enabling reconstruction of long-distance nerve pathways such as the corticospinal tract.

Prior Art Documents

Patent Documents

[0008]

Patent Document 1

Non-Patent Documents

[0009]

Non-Patent Document 1

[0010] The present invention has been made in view of the above background circumstances, and an object thereof is to provide a method that enables reconstruction of a nerve pathway by cell transplantation even in a long-distance nerve pathway such as the corticospinal tract, and a kit used in the method. [Means for Solving the Problems]

[0011] As a result of intensive studies, the inventors of the present invention have found that when axon elongation-inducing proteins such as L1CAM are overexpressed in the motor cortex of the mouse cerebrum and then cortical neurons (population) are transplanted into the site, axons derived from the transplanted cells can reach the spinal cord. Since L1CAM is a membrane protein involved in axon growth and guidance in mammalian neurogenesis (Maness, P.F. & Schachner, M. Nature Neuroscience, 10(1), 19-26, 2007; Neural recognition molecules of the immunoglobulin superfamily: signaling transducers of axon guidance and neuronal migration), other proteins known as axon guidance cues are expected to have the same effect.

[0012] The above findings were quite unexpected. This is because even if axon guidance factors are expressed in living residual neurons near the damaged sites in the central and peripheral nervous systems, it was predicted that it would be difficult to induce axon elongation to a remote location in the transplanted neurons (population). Specifically, since the periphery of the axon is covered with myelin consisting of oligodendrocytes (central nervous system) or Schwann cells (peripheral nervous system), it was considered difficult for the transplanted neurons to interact with axon guidance factors (e.g., L1CAM, etc.) expressed on the axons of the residual neurons. However, when L1CAM, which is actually an axon guidance factor, was expressed in the residual neurons at the site where transplantation was planned, unexpectedly, it was found that L1CAM was also expressed on the myelin sheath.

[0013] The present invention includes the following features. (1) A pharmaceutical kit for reconstructing a damaged nerve pathway, comprising a first preparation containing, as an active ingredient, an axon elongation-inducing protein, a nucleic acid encoding the protein, or a vector capable of expressing DNA encoding the protein. (2) The pharmaceutical kit according to (1) above, wherein the nerve pathway is the corticospinal tract or another nerve pathway. (3-1) The pharmaceutical kit according to (1) or (2) above, wherein the first preparation is administered to the affected site or its vicinity of a patient having a nerve pathway disorder. (3-2) The pharmaceutical kit according to any one of (1) to (3-1) above, wherein the first preparation is administered to the motor cortex of the cerebral cortex of a patient having a corticospinal tract disorder. (4) The pharmaceutical kit according to any one of (1) to (3-2) above, further comprising a second preparation containing a cell population containing nerve cells and / or their progenitor cells. (5-1) The pharmaceutical kit according to (4) above, wherein the second preparation contains a cell population containing cerebral cortex cells and / or their progenitor cells. (5-2) The pharmaceutical kit according to (5-1) above, wherein the cells are cells expressing Ctip2. (6) The pharmaceutical kit according to any one of (4) to (5-2) above, wherein the cell population is derived from pluripotent stem cells or somatic stem cells. (7) The pharmaceutical kit according to (6) above, wherein the pluripotent stem cells are induced pluripotent stem (iPS) cells or embryonic stem (ES) cells. (8) The pharmaceutical kit according to any one of (1) to (7) above, wherein the axon elongation-inducing protein is at least one axon guidance factor selected from the group consisting of L1CAM, the Netrin family, the Semaphorin family, the Slit family, the Ephrin family, morphogens, and neurotrophic factors. (9) The pharmaceutical kit according to any one of (1) to (8) above, wherein the axon elongation-inducing protein is L1CAM. (10) The pharmaceutical kit according to any one of (1) to (9) above, wherein the protein or the nucleic acid is included in a drug delivery system. (11) The pharmaceutical kit according to any one of (1) to (10) above, wherein the vector is a viral vector. (12) The pharmaceutical kit according to (11) above, wherein the virus vector is an adeno-associated virus (AAV) vector. (13) A pharmaceutical kit according to any one of (4) to (12) above, comprising a first preparation containing an AAV vector containing DNA encoding L1CAM and a second preparation containing the cell population derived from iPS cells or somatic stem cells. (14) A method for reconstructing a damaged nerve pathway in a patient, comprising administering the first preparation of the pharmaceutical kit according to any one of (1) to (13) above to the damaged site or the vicinity thereof in a patient having a nerve pathway disorder. (15) The method according to (14) above, further comprising transplanting the second preparation of the pharmaceutical kit to the damaged site or the vicinity thereof in the patient. (16) A method for reconstructing a damaged corticospinal tract in a patient, comprising administering the first preparation of the pharmaceutical kit according to any one of (1) to (13) above to the motor cortex of the cerebral cortex in a patient having a corticospinal tract disorder. (17) The method according to (16) above, further comprising transplanting the second preparation of the pharmaceutical kit to the damaged site or the vicinity thereof in the cerebral cortex of the patient. (18) The method according to (16) or (17) above, wherein the corticospinal tract disorder is a disorder caused by head trauma or cerebrovascular disorder. (19) The method according to any one of (14) to (18) above, wherein the patient is a human. (20) An axon elongation-inducing protein, a nucleic acid encoding the protein, or a vector capable of expressing DNA encoding the protein, for use in reconstructing a damaged nerve pathway. (21) Use of an axon elongation-inducing protein, a nucleic acid encoding the protein, or a vector capable of expressing DNA encoding the protein, for the manufacture of a reconstructing agent for a damaged nerve pathway.

Advantages of the Invention

[0014] The present invention provides a method for promoting axonal elongation of transplanted cells, which enables reconstruction of long-distance neural pathways such as the corticospinal tract, and a kit for use in the method.

Brief Description of the Drawings

[0015]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Mode for Carrying Out the Invention

[0016] The present invention will be described in more detail. 1. Pharmaceutical Kit The present invention provides a pharmaceutical kit for reconstructing a damaged nerve pathway, which comprises a first preparation containing an axon elongation-inducing protein, a nucleic acid encoding the protein, or a vector capable of expressing DNA encoding the protein as an active ingredient. The pharmaceutical kit of the present invention may consist of the first preparation. In one aspect, the pharmaceutical kit is provided as a reconstructing agent for a damaged nerve pathway, which contains an axon elongation-inducing protein, a nucleic acid encoding the protein, or a vector capable of expressing DNA encoding the protein as an active ingredient.

[0017] As used herein, "nerve pathway" (also referred to as "nerve circuit") refers to nerve pathways in the central nervous system and the peripheral nervous system, including both motor nerve pathways and sensory nerve pathways. Narrowly defined, it can also refer to the pathway formed by the axons of projection neurons. A projection neuron refers to a neuron that extends not only within the nerve population (such as a nerve nucleus or a cerebral cortex area) to which the neuron belongs but also distally, and is responsible for information transmission between different regions.

[0018] The pathways in the central nervous system include the pathways of the central nerves from the cerebral cortex to the spinal cord (including the corticospinal tract), as well as the nerve pathways in the cranial nerves and spinal nerves. In this specification, nerve pathways other than the corticospinal tract may be referred to as "other nerve pathways".

[0019] The corticospinal tract is a nerve pathway in which the origin cells are present in the motor area of the cerebral cortex, pass through the internal capsule, pass through the cerebral peduncle on the ventral side of the midbrain, penetrate the pontine nucleus, enter the spinal cord through the pyramidal decussation from the ventral side of the medulla oblongata, and connect to the motor neurons in the anterior horn of the spinal cord while descending along the lateral funiculus of the spinal cord. It is one of the main nerve circuits that control voluntary movements such as spontaneously moving the hands and feet, and sends motor commands from the cerebral cortex to the spinal cord.

[0020] Generally, when the corticospinal tract is damaged, motor paralysis occurs, and many patients suffer from its sequelae. Although there is an expectation for a treatment method to reconstruct the damaged corticospinal tract by cell transplantation and improve paralysis, it has not yet been clinically applied.

[0021] The cranial nerves include the nerves that connect the brain to organs such as the head, face, eyes, nose, muscles, ears, etc., as well as the vagus nerve that controls the internal organs in the chest and abdomen.

[0022] The spinal nerves are the nerves that connect the spinal cord to other parts of the body and functionally include sensory (or afferent) nerves (including somatic sensory nerves and visceral sensory nerves) and motor (or efferent) nerves (including somatic motor nerves that control skeletal muscles and visceral motor nerves that control the muscles of blood vessels and internal organs).

[0023] An axon has a fibrous structure extending from the nerve cell body and is responsible for the output of signals from the nerve cell. Since the axons extending from the cerebral cortex cross at the pyramids in the lower part of the medulla oblongata below the brain and extend to the opposite side of the spinal cord, the nerve cells in the cerebral cortex on one side control the movement of the limbs on the opposite side.

[0024] As used herein, "disorder of a nerve pathway" means a state in which any one or more of a decrease, degeneration, or disappearance in the number of axons constituting the nerve pathway has occurred, and information transmission through the pathway has been significantly reduced. And "regeneration of (the damaged) nerve pathway" means a state in which any one or more of an increase or regeneration in the number of axons constituting the nerve pathway has occurred, and recovery of information transmission through the pathway can be expected.

[0025] Factors that cause "disorder of a nerve pathway" include cerebrovascular disorders (such as stroke (cerebral infarction, cerebral hemorrhage, subarachnoid hemorrhage, etc.)), brain injuries (such as cerebral contusion, cerebral laceration, etc.), spinal cord injuries (resulting in disorders of movement and sensation distal to the damaged spinal cord), neurodegenerative diseases (such as multiple sclerosis, epilepsy, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Creutzfeldt-Jakob disease, etc.), ophthalmic diseases (glaucoma, etc.), and the like.

[0026] As used herein, "damaged nerve pathway" refers to a nerve pathway in which a disorder of the nerve pathway has occurred due to the above factors or the like.

[0027] For the reconstruction of damaged nerve pathways, in the present invention, a first preparation containing, as an active ingredient, an axon elongation inducer, specifically an axon elongation inducing protein, a nucleic acid encoding the protein, or a vector capable of expressing DNA encoding the protein, is administered to the damaged site or its vicinity in a patient having a nerve pathway disorder (also referred to as a "subject") (typically, administered before transplantation of the second preparation).

[0028] In an adult mouse brain injury model, when fetal mouse brain is transplanted into the mouse brain, axons derived from transplanted cells reaching the spinal cord are significantly observed, and a tendency for improvement in motor ability is also observed (Non-Patent Document 1). Also, by the present inventors, in a living rat brain injury model, neurons derived from the mouse prefrontal cortex are transplanted into the rat brain and rehabilitation is performed, and it has been reported that axon elongation of the transplanted neurons is promoted (T. Shimogawa et al., npj Regenerative Medicine: 2019; Therapeutic effects of combined cell transplantation and locomotor training in rats with brain injury). With the pharmaceutical kit of the present invention, since a nerve pathway damaged by axon elongation can be reconstructed, if necessary, by using rehabilitation or the like in combination, improvement of voluntary movement disorder due to the nerve pathway disorder by the reconstruction can be expected. Therefore, the pharmaceutical kit of the present invention can be used as a therapeutic agent for voluntary movement disorder due to nerve pathway disorder.

[0029] 1.1. The first preparation In the present specification, the "axon elongation inducing protein" refers to a protein that has an effect of inducing axon elongation on nerve cells, includes axon guidance factors, and includes attractive axon guidance factors (simply referred to as "attractive factors"), repulsive axon guidance factors (simply referred to as "repulsive factors"), or both factors thereof.

[0030] "Induction" of axonal elongation involves "attraction", "repulsion", or a combination of them. In order to accurately elongate axons to the target site in neural pathways such as the corticospinal tract, it is known that the involvement of both attractive factors and repulsive factors is necessary (Takuro Toshima et al., Biophysics 51(5), 214 - 217, 2011).

[0031] Information transmission between nerve cells is carried out through synapses constructed by axons and dendrites. In order to form an accurate information transmission network, that is, a neural circuit network, the elongation of nerve axons is under various controls. A representative example is axonal guidance by axon guidance factors.

[0032] Axon guidance factors are defined as molecules that provide spatial information to the growth cone by being region - specifically present in the tissue during development and guide the growth cone to the correct target cell. Axon guidance factors existing in the living body are mainly classified into four modes of action. There are contact factors that act at close range through contact by being expressed on the extracellular matrix and cell membrane, diffusible factors that are secreted and act over long distances by means of a concentration gradient, and for each of them, there are attractive factors and repulsive factors. In the living body, it is considered that these four types of axon guidance factors work cooperatively to guide axons to the correct target (E.T. Stoeckli, Development 2018 145: dev151415 doi:10.1242 / dev.151415). Also, in this context, there is a hypothesis that axon guidance factors or their mRNAs expressed in the nerve cell body, as well as miRNAs involved in the regulation of axon guidance factor expression, are transported to the growth cone via axons (E.T. Stoeckli, supra), but this is not well understood.

[0033] There are various molecular species of axon guidance factors. Among the factors that exhibit repulsive effects, the semaphorin family, ephrin family, slit family, etc. are known. Among the factors that exhibit attractive effects, netrin, semaphorin 3C, brain-derived neurotrophic factor, etc. are known. Growth cones have specific receptor families for individual axon guidance factors, and the expression of the receptors on the plasma membrane defines the sensitivity of the growth cones to axon guidance factors. Furthermore, it is known that growth cones are equipped with a mechanism to switch the reactivity to the same axon guidance factor depending on the location and time.

[0034] As the axon elongation-inducing protein according to the present invention, the above-mentioned axon guidance factors can be preferably used.

[0035] Also, among the proteins (cell adhesion molecules) that are expressed on the membrane of nerve cells and contribute to cell adhesion, there are those that have the effect of inducing axon elongation in nerve cells. A representative example is L1CAM. The axon elongation-inducing protein according to the present invention can also include other nerve cell adhesion molecules (for example, NrCAM, axonin, etc.) that exhibit the above effect.

[0036] Thus, examples of axon elongation-inducing proteins include, but are not limited to, L1CAM, the netrin family (e.g., Netrin-1, Netrin-3, Netrin-4, etc.), the semaphorin family (e.g., Sema3A, Sema3B, Sema3C, Sema6, etc.), the ephrin family (e.g., EphA, EPHB, etc.), the slit family (e.g., Slit2, etc.), morphogens (e.g., hedgehog, Wnt, TGF-β, bone morphogenetic protein (BMP), etc.), neurotrophic factors (e.g., brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF), neurotrophin-3 (NT-3), neurotrophin-4 / 5 (NT-4 / 5), etc.), and preferably L1CAM, or a combination of L1CAM and at least one other axon guidance factor selected from the group consisting of the netrin family, the semaphorin family, the ephrin family, slit, morphogens, and neurotrophic factors.

[0037] L1CAM (L1 cell adhesion molecule) is an axonal glycoprotein belonging to the immunoglobulin superfamily, and its nucleotide sequence / amino acid sequence is registered in humans, for example, as accession numbers NM_000425 / NP_000416, NM_024003 / NP_076493, NM_001143963 / NP_001137435, NM_001278116 / NP_001265045 in NCBI's GenBank (USA), and in mice, for example, as NM_008478 / NP_032504, NM_001374694 / NP_001361623. L1CAM is also known by the aliases CAML1, CD171, HSAS, HSAS1, MASA, MIC5, N-CAM-L1, N-CAML1, NCAM-L1, S10, SPG1. The nucleotide sequence and amino acid sequence of human L1CAM are shown as SEQ ID NO: 1 and SEQ ID NO: 2 respectively, and the nucleotide sequence and amino acid sequence of mouse L1CAM are shown as SEQ ID NO: 3 and SEQ ID NO: 4 respectively in the sequence listing described below, or sequences having 85% or more, 90% or more, or 95% or more sequence identity with the above sequences as long as they have axon-inducing activity.

[0038] "Sequence identity (%)" as used herein can be determined using a protein or gene search system by known algorithms such as BLAST and FASTA, with or without introducing gaps between the two sequences, preferably with introducing gaps (S.F. Altschul et al., Journal of Molecular Biology, 1990; 215: 403-410; W.R. Pearson et al., Proc. Natl. Acad. Sci. U.S.A., 1988; 85: 2444-2448).

[0039] Netrin is one of the axon guidance factors identified as a secreted protein that is secreted from the floor plate of the spinal cord and attracts the axons of spinal commissural neurons. The amino acid sequence and nucleotide sequence of Netrin-1 (sometimes abbreviated as "Ntn1") are available from GenBank and are, for example, the sequences registered as accession numbers NM_004822 (human), BC141294, NM_008744.2 (mouse), or sequences having 85% or more, 90% or more, or 95% or more sequence identity with the above sequences as long as they have axon-inducing activity.

[0040] The amino acid sequence and nucleotide sequence of Sema3C are available from GenBank and are, for example, the sequences registered as accession numbers NM_001350120 (human), NM_006379 (human), NM_001350121 (human), NM_013657.5 (mouse), etc., or sequences having 85% or more, 90% or more, or 95% or more sequence identity with the above sequences as long as they have axon-inducing activity.

[0041] Furthermore, the nucleic acid encoding the axon elongation-inducing protein includes DNA (e.g., cDNA, etc.) or RNA (e.g., mRNA, etc.) encoding proteins such as L1CAM, Netrin, Semaphorin, Slit, Ephrin, Morphogen, Neurotrophic factor, etc. The nucleotide sequences of these DNAs and the amino acid sequences of the proteins are available from nucleotide sequence databases such as GenBank (USA), EMBL (Europe), and DDBJ (Japan).

[0042] The production of axon elongation-inducing proteins and nucleic acids encoding axon elongation-inducing proteins can be carried out, for example, using genetic recombination techniques. Specifically, mRNA is extracted from tissues or cells that express axon elongation-inducing proteins, and the above nucleic acid is produced by synthesizing cDNA. Furthermore, a cassette containing the above nucleic acid (DNA) together with elements such as a control sequence such as a promoter and a selection marker gene sequence such as a drug resistance gene is inserted into a vector such as a plasmid, and the above protein can be produced by a method including inserting it into cells such as animal cells and transforming them. Genetic recombination techniques are described, for example, in M.R. Green and J. Sambrook, Molecular Cloning; A Laboratory Manual, Fourth Ed. (2012) Cold Spring Harbor and can be used.

[0043] Furthermore, vectors that can express DNA encoding axon elongation-inducing proteins can be selected and used from, for example, plasmids, viral vectors, and liposomes that are usable in living organisms (for example, those usable in gene therapy).

[0044] Plasmid vectors can contain elements such as a target gene (or DNA), a promoter, an origin of replication, a polyA addition signal, and a selection marker gene. Plasmids are preferably DNA plasmids that have been approved for safety in gene therapy or regenerative medicine and are manufactured in accordance with GMP. Examples of plasmids include those used for the production of, for example, HGF plasmids for gene therapy (R. Morishita et al., Hypertension 2004; 44(2): 203-209).

[0045] Viral vectors include, for example, AAV, adenovirus, retrovirus (for example, MMLV retrovirus, etc.), lentivirus, Sendai virus, etc., and preferably AAV. AAV vectors are known to be safe because they can express the target gene for a long period of time, have low immunogenicity, and are non-pathogenic viruses.

[0046] An AAV vector can be produced by packaging a replication-deficient genome obtained by inserting a cassette containing a promoter and a gene of interest (or DNA) into a region containing Rep and Cap (proteins necessary for viral replication and capsid formation) between wild-type ITRs (inverted terminal repeats), for example. This production method includes, for example, a step of preparing a vector plasmid in which two genes, Rep and Cap, between ITRs are removed and a promoter and a gene of interest are inserted into the space, a step of supplying Rep and Cap with another plasmid, a step of supplying E1A, E1B, E2A, VA, and E4 genes as helper functions of adenovirus, of which E1A and E1B are from HEK293 cells (transformed with E1A and E1B), and the remaining E2A, E4, and VA are supplied as helper plasmids, a step of transfecting HEK293 cells with these three plasmids, and a step of producing viral particles having only the gene of interest between ITRs without the Rep and Cap genes (Hirokazu Hirai, DOI: 10.14931 / bsd.7632, 2018).

[0047] The above promoter is preferably a promoter that is functional in nerve cells and includes, without limitation, for example, a promoter containing a Tet on / off element, a rapamycin-inducible promoter, a metallothionein promoter, a viral promoter (e.g., CMV promoter, RSV promoter, SV40 promoter, etc.), a cellular promoter (e.g., PGK (phosphoglycerate kinase) promoter, etc.).

[0048] Liposomes are microvesicles composed of a bilayer of amphiphilic lipid molecules and are used for drug delivery of drugs. The lipids that make up liposomes can include, without limitation, for example, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, cholesterol, their derivatives, and mixtures thereof, and the like. Liposomes have a structure that includes a hydrophilic portion and a hydrophobic portion so as to be amphiphilic. The derivative is one in which two, for example, the same or different fatty acid esters are bonded to the glycerol backbone of glycerophospholipid, and examples of the fatty acid here are stearic acid, oleic acid, palmitic acid, myristic acid, linoleic acid, and the like. Liposomes may also be pegylated by binding a polyethylene glycol chain (for example, having a molecular weight of less than 5,000, for example, 3,000 or less, preferably 2,000). Examples of the above derivatives include distearoyl phosphatidylcholine (DSPC), palmitoyloleyl phosphatidylcholine (POPC), dioleoyl-sn-glycero-phosphoethanolamine, and the like.

[0049] The first formulation can include, in addition to the above active ingredient, a pharmaceutically acceptable carrier (for example, physiological saline, phosphate buffered saline, etc.), a neurotrophic factor (for example, BDNF, NGF, etc.), an axon growth or maintenance promoting factor (for example, neurotrophin, transforming growth factor, extracellular matrix component, etc.), and the like.

[0050] 1.2. Second formulation The pharmaceutical kit of the present invention can further include a second formulation containing a cell population containing nerve cells and / or their progenitor cells.

[0051] The cell population containing nerve cells and / or their progenitor cells may or may not contain DNA (for example, a vector, etc.) that can express at least one of the above axon elongation-inducing proteins.

[0052] Preferably, before or after administration of the first preparation, a second preparation containing a cell population containing nerve cells and / or their progenitor cells is administered and transplanted to or near the damaged site of the nerve pathway, whereby reconstruction of the damaged nerve pathway can be further promoted.

[0053] Nerve cells and / or their progenitor cells refer to cells that constitute the nervous system such as the central (brain, spinal cord) and peripheral nervous systems. A nerve progenitor cell means an undifferentiated cell having the ability to differentiate into mature nerve cells. Examples of nerve progenitor cells used in the present invention include, but are not limited to, cerebral cortical nerve progenitor cells, dopamine nerve progenitor cells, GABAergic nerve progenitor cells, motor nerve progenitor cells, retinal ganglion progenitor cells, and the like.

[0054] Induction of differentiation into nerve cells and / or their progenitor cells can be carried out by the methods described in, for example, JP 2020-202865 A, JP 2019-106895 A, WO2019 / 031595, WO2018 / 074567, JP 2018-029585 A, WO2017 / 183736, JP 2016-198101 A, JP 2013-226159 A, JP 2010-051326 A, US10,752,883A1, US10,093,897A1, US7,531,354A1, M. Zhang et al. Stem Cell Research & Therapy 2018;9:67, B. Shekhar Jha et al., Stem Cell Rev and Rep DOI 10.1007 / s12015-014-9541-0, S.F. McComish, M.A. Caldwell, Phil. Trans. R. Soc. 2018;B373:20170214, E.V. Grigor’eva et al., Cytotechnology 2020;72:649-663, and the like.

[0055] As differentiation-inducing factors, for example, bFGF, BMP inhibitors, BMP / SMAD inhibitors, retinoic acid (RA), sonic hedgehog (SHH), activin, SB431542 (4-[4-(1,3-benzodioxol-5-yl)-5-(2-pyridinyl)-1H-imidazol-2-yl]benzamide) / LDN193189 (4-(6-(4-(piperazin-1-yl)phenyl)pyrazolo[1,5-a]pyrimidin-3-yl)quinoline), and combinations thereof, or miRNAs, etc. can be used.

[0056] Hereinafter, methods for inducing the differentiation of neural cells and / or neural progenitor cells from pluripotent stem cells or somatic stem cells will be exemplified.

[0057] ES cells, which are one type of pluripotent stem cells, are embryo-derived stem cells derived from the inner cell mass of a blastocyst, which is an embryo after the morula stage, such as the 8-cell stage, of a fertilized egg, and have the ability to differentiate into all cells that make up an adult, so-called pluripotency, and the ability to proliferate by self-renewal. ES cells were discovered in mice in 1981 (M.J. Evans and M.H. Kaufman, Nature 1981; 292: 154-156), and thereafter, ES cell lines have also been established in primates such as humans and monkeys (J.A. Thomson et al., Science 1998; 282: 1145-1147; J.A. Thomson et al., Proc. Natl. Acad. Sci. USA 1995; 92: 7844-7848; J.A. Thomson et al., Biol. Reprod. 1996; 55: 254-259; J.A. Thomson and V.S. Marshall, Curr. Top. Dev. Biol. 1998; 38: 133-165).

[0058] Induced pluripotent stem cells (iPS cells), which are another type of pluripotent stem cells, are somatic cell-derived artificial stem cells that can be created by introducing specific reprogramming factors into somatic cells in the form of DNA or proteins, and have characteristics almost equivalent to those of ES cells, such as pluripotency of differentiation and the ability to proliferate by self-renewal (K. Takahashi and S. Yamanaka, Cell 2006; 126: 663-676; K. Takahashi et al., Cell 2007; 131: 861-872; J. Yu et al., Science 207; 318: 1917-1920; M. Nakagawa et al., Nat. Biotechnol. 2008; 26: 101-106; WO2007 / 069666).

[0059] The reprogramming factors are, for example, genes specifically expressed in ES cells, their gene products or non-coding RNAs (e.g., miRNAs, etc.) or genes that play important roles in maintaining the undifferentiated state of ES cells, their gene products or non-coding RNAs (e.g., miRNAs, etc.), or small molecular compounds, etc. Examples of reprogramming factors include Oct3 / 4, Sox2, Sox1, Sox3, Sox15, Sox17, Klf4, Klf2, c-Myc, N-Myc, L-Myc, Nanog, Lin28, Fbx15, ERas, ECAT15-2, Tcl1, beta-catenin, Lin28b, Sall1, Sall4, Esrrb, Nr5a2, Tbx3, etc. These reprogramming factors may be used alone or in combination. Combinations of reprogramming factors are described in WO2007 / 069666, WO2008 / 118820, WO2009 / 007852, WO2009 / 032194, WO2009 / 058413, WO2009 / 057831, WO2009 / 075119, WO2009 / 079007, WO2009 / 091659, WO2009 / 101084, WO2009 / 101407, WO2009 / 102983, WO2009 / 114949, WO2009 / 117439, WO2009 / 126250, WO2009 / 126251, WO2009 / 126655, WO2009 / 157593, WO2010 / 009015, WO2010 / 033906, WO2010 / 033920, WO2010 / 042800, WO2010 / 050626, WO2010 / 056831, WO2010 / 068955, WO2010 / 098419, WO2010 / 102267, WO2010 / 111409, WO2010 / 111422, WO2010 / 115050, WO2010 / 124290, WO2010 / 147395, WO2010 / 147612, D. Huangfu et al., Nat. Biotechnol. 2008; 26: 795-797, Y. Shi et al., Cell Stem Cell 2008; 2: 525-528, S. Eminli et al., Stem Cells 2008; 26: 2467-2474, D. Huangfu et al., Nat Biotechnol.Combinations described in 2008;26:1269-1275, Y. Shi et al., Cell Stem Cell 2008;3:568-574, Y. Zhao et al., Cell Stem Cell 2008;3:475-479, A. Marson, Cell Stem Cell 2008;3:132-135, B. Feng et al., Nat Cell Biol. 2009;11:197-203, R. L. Judson et al., Nat. Biotech. 2009;27:459-461, C. A. Lyssiotis et al., Proc Natl Acad Sci USA. 2009;106:8912-8917, JB Kim et al., Nature 2009;461:649-643, J. K. Ichida et al., Cell Stem Cell 2009;5:491-503, J. C. Heng et al., Cell Stem Cell 2010;6:167-74, J. Han et al. Nature 2010;463:1096-100, P. Mali et al., Stem Cells 2010;28:713-720, etc. are exemplified.

[0060] Furthermore, examples of another stem cell that can differentiate into neurons and / or their neural progenitor cells include somatic stem cells, and examples include neural stem cells, mesenchymal stem cells, etc.

[0061] The method for obtaining, for example, cerebral cortical neurons and / or their neural progenitor cells, which are the active ingredients of the second preparation, is not particularly limited, but for example, the method by the present applicant (WO2016 / 167372) can be exemplified.

[0062] This method includes the following steps. (i) A step of culturing pluripotent stem cells in suspension in a medium containing a TGFβ inhibitor, bFGF, a Wnt inhibitor, and a BMP inhibitor for at least 3 days. (ii) A step of culturing the cells obtained in the above step (i) in suspension in a medium containing a Wnt inhibitor and a BMP inhibitor for at least 6 days. (iii) The step of further culturing the cells obtained in the above step (ii), and (iv) The step of extracting cells that are positive for at least one marker protein selected from the group consisting of CD231, PCDH17, and CDH8.

[0063] The above TGFβ inhibitor is, for example, SB431542, A-83-01 (3-(6-methyl-2-pyridinyl)-N-phenyl-4-(4-quinolinyl)-1H-pyrazole-1-carbothioamide), etc.

[0064] The above Wnt inhibitor is, for example, a PORCN inhibitor, C59, LGK-974, etc.

[0065] The above BMP inhibitor is, for example, LDN193189, etc.

[0066] The above medium may further contain serum or a serum substitute. The medium in the above step (i) can further contain a ROCK inhibitor (for example, Y-27632 (T. Ishizaki et al., Mol. Pharmacol. 2000; 57: 976-983)).

[0067] It is known that cerebral cortical neural progenitor cells are characterized by the expression of specific cell markers such as Pax6, Ctip2, Emx1, and Fezf, or miRNAs (for example, Japanese Patent Laid-Open No. 2020-202865).

[0068] The cerebral cortical neurons and / or their neural progenitor cells obtained by the above method are preferably cells that express Ctip2, for example, neurons in the motor area of the cerebral cortex (for example, Ctip2 + CoupTF1 - ).

[0069] The nerve cells of the present invention such as cerebral cortical nerve cells and / or their neural progenitor cells produced in the present invention and / or their neural progenitor cells may be produced as a purified cell population or as a cell population containing other cell types. For example, in the produced cell population, they can preferably be contained at 60% or more, 70% or more, 80% or more, or 90% or more.

[0070] As another example of nerve cells / neural progenitor cells, a method for inducing the differentiation of dopaminergic neural progenitor cells from pluripotent stem cells includes, for example, (i) a step of adherent culturing pluripotent stem cells on an extracellular matrix in a medium containing a reagent selected from the group consisting of a BMP inhibitor, a TGFβ inhibitor, an SHH signal stimulator, FGF8, and a GSK3β inhibitor, and (ii) a step of suspension culturing the cells obtained in the above step (i) in a culture solution containing a neurotrophic factor, such as a method for inducing the differentiation of dopaminergic neural progenitor cells (WO2015 / 034012).

[0071] Examples of neurotrophic factors include NGF, BDNF, NT-3, NT-4 / 5, Neurotrophin 6 (NT-6), bFGF, acidic FGF, FGF-5, Epidermal Growth Factor (EGF), Hepatocyte Growth Factor (HGF), Insulin, Insulin Like Growth Factor 1 (IGF1), Insulin Like Growth Factor 2 (IGF2), Glia cell line-derived Neurotrophic Factor (GDNF), TGF-b2, TGF-b3, Interleukin 6 (IL-6), Ciliary Neurotrophic Factor (CNTF), and LIF. Preferred neurotrophic factors are GDNF and / or BDNF.

[0072] The analysis of the induction of nerve cells and their progenitor cells can be performed, for example, by gene expression such as nestin, PAX6, SO1X, and OTX2.

[0073] Dopaminergic neural progenitor cells are, for example, floor plate cells having the ability to differentiate into midbrain dopaminergic neurons, cells of the neuroectoderm characterized by expression markers such as intermediate filament protein Nestin, and the like. Mature midbrain dopaminergic neurons are known to be characterized by, for example, the expression of specific cell markers such as tyrosine hydroxylase (TH), FOXA2, Nurr1, or miRNAs (for example, Japanese Patent Application Laid-Open No. 2020-202865).

[0074] As yet another example of nerve cells / neural progenitor cells, a method for inducing differentiation of retinal ganglion cells and their progenitor cells from pluripotent stem cells (for example, iPS cells or ES cells) is shown below (for example, International Publication No. 2016 / 021709).

[0075] This method produces retinal ganglion cells and their progenitor cells via the production of retinal progenitor cells. Specifically, iPS cells are cultured in a retinal differentiation medium (containing a Wnt signal inhibitor and a Rock inhibitor), and further cultured in a medium containing FBS, cultured in a medium containing a Wnt signal activator and an Shh signal activator, cultured in a retinal maturation medium containing retinoic acid and N2 supplement, and cultured in a medium containing BDNF. By this method, retinal ganglion cells and their progenitor cells can be produced. Induction of retinal ganglion cells can be confirmed by the expression of markers such as Brn3b, Math5, Sncg, Islet1, Tuj1, and the like.

[0076] A method for producing retinal ganglion cells and their progenitor cells is also described, for example, in International Publication No. 2017-532954.

[0077] 2. Method for Reconstructing a Damaged Nerve Pathway The present invention further provides a method for reconstructing a damaged nerve pathway in a patient, which includes administering the first preparation of the above pharmaceutical kit to the damaged site or the vicinity thereof in a patient having a nerve pathway disorder.

[0078] The first formulation of the above pharmaceutical kit is as described in the above Section 1.1.

[0079] Neuropathies are disorders caused by nerve damage (e.g., trauma, laceration, ischemia, hemolysis, neurodegeneration, etc.) in the central and peripheral nervous systems, and include, for example, cerebrovascular disorders (e.g., stroke (cerebral infarction, cerebral hemorrhage, subarachnoid hemorrhage), etc.), brain injuries (e.g., cerebral contusion, cerebral laceration, etc.), spinal cord injuries (resulting in motor and sensory impairments distal to the damaged spinal cord), neurodegenerative diseases (e.g., multiple sclerosis, epilepsy, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Creutzfeldt-Jakob disease, etc.), ophthalmic diseases (glaucoma, etc.), and other diseases. Diseases such as the above-mentioned cerebrovascular disorders, brain injuries, and neurodegenerative diseases are disorders related to the cerebrum (including cerebral cortex disorders), and often develop severe functional impairments such as movement, language, and memory. In addition, the above-mentioned ophthalmic diseases are likely to develop severe visual impairments.

[0080] In the above method, the first formulation is administered to the affected site or its vicinity in the patient. In such disorders, nerve cell loss often occurs due to nerve damage. In this case, it is preferable that viable nerve cells partially remain at the affected site or its vicinity, or that some nerve cells are degenerated and some remain. It is considered that the viable nerve cells induce nerve cell proliferation and axonal elongation by the first formulation, thereby reconstructing the damaged nerve pathway (corticospinal tract or other nerve pathways).

[0081] In this regard, the present invention also provides, according to an embodiment, a method for reconstructing a damaged corticospinal tract in a patient, which includes administering the first formulation of the above pharmaceutical kit to the cerebral cortex, particularly the motor area, of a patient having a corticospinal tract disorder.

[0082] Corticospinal tract disorder includes, for example, paralysis of motor function due to interruption of the corticospinal tract when the motor area is damaged by the above-mentioned cerebrovascular disorder or head trauma (or brain injury). Therefore, the first formulation can be administered to the affected site or its vicinity in the damaged motor area.

[0083] The dosage of the first preparation is not particularly limited as long as it is an amount capable of inducing axonal elongation (i.e., an effective amount), and is appropriately selected according to the severity, age, weight, gender, etc. of the patient.

[0084] In the above method, in order to further assist the growth or proliferation of nerve cells at the damaged site, preferably, the second preparation of the above pharmaceutical kit may be transplanted to the damaged site of the patient or in the vicinity thereof.

[0085] The above second preparation is as described in 1.2. above, and contains, as an active ingredient, a cell population containing nerve cells and / or their progenitor cells, or a cell population containing cerebral cortical nerve cells and / or their progenitor cells. The preparation of these cells or cell populations is as described above.

[0086] The number of nerve cells or cerebral cortical nerve cells and / or their progenitor cells required for the above transplantation is not particularly limited as long as the graft can engraft after administration. For example, 1×10 5 or more, 1×10 6 or more, 1×10 7 or more, 1×10 8 or more, 1×10 9 or more, etc., and may be appropriately increased or decreased according to the severity, age, weight, gender, etc. of the patient.

[0087] The above second preparation may be administered before the administration of the first preparation, simultaneously with the administration of the first preparation, or at any time after the administration of the first preparation. As a preferred embodiment, the second preparation may be administered after the administration of the first preparation, more preferably, 1 day to 60 days after the administration of the first preparation, still more preferably 5 days to 30 days after, even more preferably 7 days to 20 days after, and most preferably 10 days to 14 days after the administration of the first preparation.

[0088] The above-mentioned first formulation or the above-mentioned cells are suspended in a carrier (or excipient) such as physiological saline or phosphate-buffered saline (PBS), and can be administered, for example, by injection through a hole drilled in the patient's skull to the nerve pathway disorder site of the patient or its vicinity. Transplantation of cerebral cortical neurons can be performed by a method as described in, for example, P. Piccini et al., Nature Neuroscience, 2, 1137, 1999, C. R. Freed et al., N Engl J Med.; 344: 710-9, 2001, etc. In the case of injection, it can be directly administered to the above-mentioned disorder site or its vicinity (or periphery) in the patient's brain, spinal cord or periphery using an appropriate device such as a syringe, cannula or catheter.

[0089] As used herein, "patient" is a mammal, including, for example, primates including humans, rodents, ornamental animals, pet animals, etc., preferably humans.

Examples

[0090] The present invention will be further specifically described by the following examples, but the scope of the present invention is not limited by the examples. The terms used in the examples will be described below. (i) mL1CAM-FLAG This term refers to the mouse L1CAM protein with a FLAG tag added to the C-terminus or the nucleic acid encoding the same. (ii) pAAV[Exp]-CMV>mL1cam[NM_008478.3] / FLAG This term refers to AAV packaged with a construct encoding mL1CAM-FLAG (Figure 3A) under the control of the CMV promoter. It may also be abbreviated as mL1cam-AAV and sometimes referred to as an L1CAM expression vector. (iii) pAAV[Exp]-CMV>mNtn1[NM_008744.2]:T2A:mCherry:WPRE This term refers to an AAV plasmid containing a nucleic acid encoding the mNtn1 protein and a nucleic acid encoding the mCherry protein under the control of the CMV promoter. Due to the sequence encoding the T2A peptide, the mNtn1 protein and the mCherry protein are expressed as separate proteins. WPRE represents the woodchuck hepatitis virus posttranscriptional regulatory element, a post-transcriptional regulator. Also, the plasmid packaged into AAV9 is abbreviated as rAAV9-Ntn1-mCherry. (iv)pAAV[Exp]-CMV>mSema3a[NM_001243072.1]:T2A:mCherry:WPRE This term refers to an AAV vector containing a nucleic acid encoding the mSema3a protein and a nucleic acid encoding the mCherry protein under the control of the CMV promoter. Due to the sequence encoding the T2A peptide, the mSema3a protein and the mCherry protein are expressed as separate proteins. Also, the plasmid packaged into AAV9 is abbreviated as rAAV9-Sema3a-mCherry. (v)pAAV[Exp]-CMV>mSema3c[NM_013657.5]:T2A:mCherry:WPRE This term refers to an AAV plasmid containing a nucleic acid encoding the mSema3c protein and a nucleic acid encoding the mCherry protein under the control of the CMV promoter. Due to the sequence encoding the T2A peptide, the mSema3c protein and the mCherry protein are expressed as separate proteins. Also, the plasmid packaged into AAV9 is abbreviated as rAAV9-Sema3c-mCherry.

[0091] [Example 1] <Axonal Extension from the Grafts in the Cerebral Cortex Overexpressing L1CAM to the Spinal Cord> 1. Experiments and Methods <Animals> All animal experiments in this study were approved by the Institutional Animal Care and Use Committee of Kyoto University (Kyoto, Japan) and were conducted in accordance with the Kyoto University Animal Experimentation Regulations. In this study, the number of animals used and the diseases were minimized.

[0092] Sixteen 13-week-old male mice (C57BL / 6NCrSlc) were used as transplantation recipients, and graft tissues were obtained from 15 fetal mice derived from 2 EGFP transgenic mice (C57BL / 6-Tg[CAG-EGFP]). All mice were purchased from Shimizu Laboratory Supplies (Kyoto, Japan). The mice were group-housed under a 12-hour light / dark cycle and allowed free access to food and water.

[0093] <Vector> A construct encoding mL1CAM-FLAG under the control of the CMV promoter (Figure 3A) was generated, and this construct was packaged into AAV9 to construct pAAV[Exp]-CMV>mL1cam[NM_008478.3] / FLAG (manufactured by VectorBuilder). The ID of this vector is VB190707-1042dgs, and detailed information regarding this vector can be obtained from VectorBuilder (vectorbuilder.com) using this ID. In addition, as a control vector, pAAV[Exp]-CMV>mCherry:WPRE was constructed in the same manner as above (manufactured by VectorBuilder). The ID of this vector is VB190114-1227see.

[0094] <Vector injection> A mixture of medetomidine hydrochloride (0.75 mg / kg), midazolam (4 mg / kg), and butorphanol (5 mg / kg) was intraperitoneally injected into recipient mice for anesthesia, and the mice were fixed in a stereotaxic apparatus to keep their heads in a horizontal position. A midline scalp incision was made, and two small window-like holes were drilled in the skull at the upper part of the rostral forelimb area (RFA) of the motor cortex (1.0 mm anterior and 1.0 mm lateral from the bregma) and at the upper part of the caudal forelimb area (CFA) of the motor cortex (0.5 mm posterior and 1.8 mm lateral from the bregma) using a drill (Miniature, Tokyo). Then, 0.3 μl of the mL1cam-AAV solution (1.0×10 13 copies / ml) (n = 8), the mCherry-AAV solution (1.0×10 13 copies / ml) as a negative control (n = 8), or an equal volume of vehicle (PBS(-)) (n = 8) was injected into the RFA and CFA at a depth of 1.0 mm and 0.5 mm respectively using a sterilized 33-gauge microsyringe (Ito Seisakusho, Shizuoka).

[0095] <Harvesting and Transplantation of Cerebral Cortex Tissue> Transplantation was performed 1 week after the injection of the above vector or vehicle. Cerebral cortex tissue was harvested from E14.5 EGFP transgenic mice (fetuses), transferred to HBSS (Gibco, USA), and placed on ice until transplantation. The tissue was aspirated and 0.3 μl of it was transplanted into the injection sites (at a depth of 1.0 mm and 0.5 mm in the RFA and CFA respectively) of the mice that had received the vector injection using a sterilized 22-gauge injection needle (Hamilton, USA).

[0096] <Immunostaining> Twelve weeks after transplantation, the mice were deeply anesthetized by intraperitoneal injection of pentobarbital (50 mg / kg), and perfused transcardially with 4% paraformaldehyde (PFA) (Wako Pure Chemical Industries, Osaka). The brain and spinal cord were post-fixed with PFA overnight and transferred to a PBS solution containing 30% sucrose, and stored at 4°C. Then, the above brain and spinal cord were embedded in O.C.T. compound (Sakura Finetek Japan, Tokyo), and sections with a thickness of 35 μm were prepared using a cryostat (CM-3050; Leica Biosystems, USA).

[0097] The sections were subjected to membrane permeabilization treatment (room temperature, 45 minutes) using a PBS solution containing 0.3% Triton X-100 (Sigma-Aldrich, USA), blocked (room temperature, 30 minutes) in a PBS solution containing 2% skim milk powder (BD Biosciences, USA), and then treated with primary antibodies (4°C, overnight) and secondary antibodies (room temperature, 2 hours together with secondary antibodies conjugated with Alexa488, 594, and 647 respectively). The primary antibodies used were rabbit anti-EGFP antibody (1:1000, #598; Medical & Biological Laboratories, Nagoya, Japan), mouse anti-FLAG M2 antibody (1:1000, #F1804; Sigma-Aldrich), rabbit anti-mCherry antibody (1:500, #ab167453; abcam, UK), and rat anti-L1CAM antibody (1:1000, #MAB5674; R&D Systems, USA). The secondary antibodies used were secondary antibodies conjugated with Alexa488, 594, and 647 respectively. Nuclear staining was performed using 4’,6-diamidino-2-phenylindole (DAPI).

[0098] The signals of the secondary antibody and DAPI were visualized using a confocal laser microscope (LSM700, Carl Zeiss, USA; Yokogawa Electric, Ishikawa). The maximum intensity projection (MIP) images of EGFP / DAPI were created using CellPathfinder software (Yokogawa Electric) and converted into tiled figures using Fiji software (J. Schindelin et al., Nat Methods, 2012;9(7):676-682). Nine sections per mouse were used for analysis. The number of axons derived from the grafts labeled with the anti-EGFP antibody was manually counted in the sagittal sections, and the average number of axons was further recorded.

[0099] <Statistical analysis> Statistical analysis was performed using PRISM 9 (GraphPad Software). The significant difference between the two groups was determined by the Mann-Whitney test. A difference was considered statistically significant when the p-value was <0.05. The data were presented as the mean ± standard error of the mean (SEM).

[0100] 2. Results Figure 1 shows immunostaining images of sections of the encapsulated (Figure 1A) and its contralateral spinal cord (Figure 1B) obtained from a transplantation experiment using PBS(-) as a negative control. In the encapsulated region, no FLAG-positive (red) axons were observed in the negative control group, and very few EGFP-positive (green) axons (i.e., axons derived from transplanted cells) were also observed. In contrast, in the L1CAM expression vector injection group, a large number of EGFP-positive (green) axons were observed, and they basically merged with L1CAM·FLAG double-positive (an intermediate color between red and white) axons (right panel of Figure 1A).

[0101] Furthermore, in the contralateral spinal cord, no EGFP-positive (green) axons were observed in the control group, but multiple EGFP-positive (green) axons were observed in the L1CAM expression vector injection group, and they merged with L1CAM·FLAG double-positive (an intermediate color between red and white) axons.

[0102] From these results, in the control group, very few axons from the transplanted cells-derived neurons could extend to the internal capsule, but in the L1CAM expression vector injection group, there were many transplanted cells-derived neurons whose axons extended beyond the internal capsule to the spinal cord, and it was revealed that those axons were closely attached to the axons of the recipients expressing L1CAM.

[0103] Figure 2 shows the quantitative analysis results of the number of EGFP-positive nerve axons in the ipsilateral internal capsule, ipsilateral cerebral peduncle, and contralateral spinal cord in the L1CAM expression vector injection group and the control group.

[0104] From Figure 2, it was shown that in the L1CAM expression vector injection group, the number of nerve axons derived from the graft was significantly and remarkably larger than that in the control group in any of the internal capsule, cerebral peduncle, and spinal cord, which are important parts of the corticospinal tract. In particular, the fact that a large number of axon extensions to the spinal cord, which were almost absent in the control group, were observed is a surprising result.

[0105] Therefore, it was shown that by overexpressing L1CAM in the recipient's brain prior to cell transplantation, axon extension from the transplanted cells-derived neurons was significantly promoted, and it became possible to reach the spinal cord.

[0106] [Example 2] [Axon Extension from Grafts in the Cerebral Cortex Overexpressing Axon-Inducing Molecules Other than L1CAM to the Spinal Cord] Next, the effect on axon extension when overexpressing axon-inducing molecules other than L1CAM was verified. 1. Experiment and Method [Animal] The same animals as in Example 1 were used.

[0107] [Vector] In this example, the adeno-associated virus (AAV) vectors used for overexpression of axon guidance molecules, pAAV[Exp]-CMV>mL1cam[NM_008478.3] / FLAG (Vector ID: VB190707-1042dgs), pAAV[Exp]-CMV>mNtn1[NM_008744.2]:T2A:mCherry:WPRE (Vector ID: VB190108-1270grn), pAAV[Exp]-CMV>mSema3a[NM_001243072.1]:T2A:mCherry:WPRE (Vector ID: VB190108-1271fpe), pAAV[Exp]-CMV>mSema3c[NM_013657.5]:T2A:mCherry:WPRE (Vector ID: VB190108-1273msn) and pAAV[Exp]-CMV>mCherry:WPRE (Vector ID: VB190114-1227see) were constructed by VectorBuilder and packaged into AAV9 (rAAV9-L1cam / FLAG, rAAV9-Ntn1-mCherry, rAAV9-Sema3A-mCherry, rAAV9-Sema3C-mCherry, rAAV9-mCherry). The vector IDs can be used to search for detailed information about the vectors at Vectorbuilder.com.

[0108] <Vector injection> A mixture of medetomidine hydrochloride (0.75 mg / kg), midazolam (4 mg / kg), and butorphanol (5 mg / kg) was injected intraperitoneally into the mice for anesthesia, and the mice were fixed in a stereotaxic apparatus so that their heads were horizontal. A midline scalp incision was made, and two small windows in the skull covering the rostral forelimb area (RFA) (1.0 mm anterior and 1.0 mm lateral to bregma) and caudal forelimb area (CFA) (0.5 mm posterior and 1.8 mm lateral to bregma) of the motor cortex were drilled using a drill (Miniature Machine Co., Ltd., Tokyo, Japan). Then, 0.3 μl of the rAAV vector solution (1.0 x 10 13 genome copies / ml) or PBS was injected into the RFA and CFA at depths of 1.0 mm and 0.5 mm using a 33-gauge sterile microsyringe (ITO Manufacturing Co., Ltd., Shizuoka Prefecture).

[0109] <Transplantation> Transplantation was performed on the same day or 1 week or 2 weeks after the injection of the vector or PBS. Cortical tissue from E14.5 EGFP transgenic mice was collected, transferred to HBSS (Gibco, Gaithersburg, MD, USA), and stored on ice until transplantation. The tissue was aspirated and transplanted into RFA and CFA (described above) at depths of 1.0 mm and 0.5 mm using a sterile 22-gauge needle (Hamilton Company, Reno NV, USA) (0.3 μl / site).

[0110] <Statistical analysis> Statistical analysis was performed using PRISM 9 (GraphPad Software). In the comparison in in vivo experiments, the significance of the difference was determined by the Kruskal-Wallis test (unpaired, non-parametric). When the p-value was <0.05, the difference was judged to be statistically significant. The data were shown as the mean ± standard error of the mean (SEM).

[0111] 2. Results Figure 4 shows the results of quantitatively analyzing the number of GFP + neurites in the CST (ipsilateral internal capsule, ipsilateral cerebral peduncle, contralateral spinal cord). When axon guidance molecules were forcibly expressed in the corticospinal tract of the host brain, only L1CAM promoted axon outgrowth from the graft. Next, 1 week before transplantation, rAAV vectors carrying the genes of netrin1, semaphorin3A, semaphorin3C, L1CAM, and mCherry were injected into the motor cortex, respectively. Donor cells were collected from the frontal cortex of E14.5 GFP transgenic mice and transplanted. GFP + axons were counted for the number of GFP + axons in the CST of the host (ipsilateral internal capsule, ipsilateral cerebral hemisphere, contralateral spinal cord). The number of axons was significantly higher in the L1CAM group than in the control group. There was no significant difference in the number of axons between the other axon guidance molecule groups and the control group.

[0112] Sema3A, which acts axon-repellently at the generation stage, is distributed in the deepest part of the cerebral cortex, and Sema3C, which acts attractively, is distributed in a slightly shallower layer (D. Bagnard et al., Development: 5043-5053, 1998; Semaphorins act as attractive and repulsive guidance signals during the development of cortical projections). In addition to these coordinated expressions, netrin-1 diffuses from the basal ganglia primordium to form a concentration gradient (C. Metin et al., Development: 5063-5074, 1997; A role for netrin-1 in the guidance of cortical efferents). Since axon guidance is achieved by the complex interactions of these factors, it is presumed that for netrin1, semaphorin3A, and semaphorin3C, the axon elongation effect was not fully exerted by simply forcing the expression of at least a single molecule. On the other hand, although axon elongation is achieved by the complex interactions of multiple axon elongation factors, it was surprising that an axon guidance effect was observed even when only L1CAM was forcibly expressed in the host CST.

[0113] [Example 3] <Co-culture experiment of L1CAM-expressing cells and primary neurons> In vitro, it was verified whether the homophilic binding of L1CAM promotes neurite outgrowth. 1. Experiment and method <Transfection of HEK-293 cells expressing L1CAM> The DNA segment encoding L1CAM / FLAG was PCR amplified from pAAV[Exp]-CMV>mL1cam[NM_008478.3] / FLAG (Vector ID: VB190707-1042dgs) using 15 bp overlapping primers (FOR: tcctaccctcgtaaacaagtttgtacaaaaaagcaggctg (SEQ ID NO: 5), REV: aactagaaggcacagctacttgtcgtcatcgtctttgtag (SEQ ID NO: 6)). The PiggyBac transposon plasmid (VB201202-1242kvw) containing TRE3G, TetOn3G, and the puromycin resistance gene (Puro) was linearized by PCR using overlapping primers, and the L1cam / FLAG PCR product was ligated via In-Fusion (Clontech, Mountain View, CA, USA). HEK-293 cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS), 100 U / ml penicillin, and 100 μg / ml streptomycin.

[0114] HEK-293 cells were detached with Trypsin in PBS, centrifuged at 200 g for 3 minutes, the supernatant was discarded, and the pellet was resuspended in 1 ml of DMEM. After measuring the cell number, 1×10 6 HEK-293 cells were transferred to a new 1.5 ml reaction tube and centrifuged again under the above conditions. The supernatant was discarded, and the pellet was resuspended in 100 μl of Opti-MEM® I (Gibco). 1 μg of the PB Tet-On-L1CAM / FLAG plasmid and 1 μg of pCAG-PBase (Transposase) were mixed and added to the cell suspension, which was then transferred to an electroporation cuvette (2 mm gap, Nepa Gene Co., Ltd., Chiba, Japan). Electroporation was performed using a Nucleofector 2b (Lonza, Basel, Switzerland) with program P023. After 2 days of incubation, 1 μg / ml of Puromycin was added for selection. After 5 days of selection, the cells were passaged.

[0115] <Western blotting> Wild-type HEK-293 cells and HEK-293 cells expressing L1CAM / FLAG were seeded at 300,000 cells / well and cultured in 6-well plates. After becoming confluent, the cell culture plates were placed on ice and the cells were washed with ice-cold PBS. After aspirating the PBS, ice-cold RIPA buffer (150 mM sodium chloride, 1.0% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS (sodium dodecyl sulfate), 50 mM Tris (pH 8.0), 1:100 protease inhibitor cocktail, distilled water) (0.5 mL per well) was added. Then, it was transferred to a pre-cooled microtube and left standing at 4°C for 30 minutes. Then, the tube was centrifuged at 12,000 rpm for 20 minutes at 4°C. The supernatant was collected, and the protein concentration was measured using the Pierce BCA Protein Assay Kit (Thermo science; REF 23227) and an absorbance microplate reader. Equal amounts of protein (10 μg) were denatured at 95°C for 5 minutes using 2× Laemmili Sample Buffer (Bio-Rad, Hercules, CA, USA) containing 10% 2-mercaptoethanol. Then, the samples were loaded into the wells of Any kD Mini-PROTEAN TGX Precast Protein Gels (Bio-Rad). A mixture of 5 μL of Precision Plus Protein WesternC Protein Standards (Bio-Rad) and 1 μL of StrepTactin-HRP conjugate (Bio-Rad) was loaded as a marker. Electrophoresis was performed for 30 minutes at 200 V, 0.06 A, and 300 W using Running Buffer (10% 10× Tris / Glycine / SDS buffer (Bio-Rad) in DW). Subsequently, electroblotting was performed under the conditions of 100 V, 3.00 A, 300 W, and 90 minutes using blotting buffer (8% 10× Tris / Glycine (Bio-Rad), 20% MeOH, distilled water), and the gel was transferred to an Immun-Blot PVDF Membrane (Bio-Rad).The membrane was blocked with Tris-buffered saline with Tween-20 (TBST) containing 5% skim milk and 0.1% Tween-20 at room temperature for 1 hour, incubated with primary antibodies (rat anti-L1CAM (1:5000, #MAB5674, R&D Systems), mouse anti-β-actin (1:5000, #A2228, Sigma-Aldrich)) overnight at 4°C, and then incubated with horseradish peroxidase-conjugated secondary antibodies (anti-rat IgG-HRP (1:10000, #sc-2006, Santa Cruz), anti-mouse IgG-HRP (1:10000, #ab6820, abcam)) for 90 minutes at room temperature. Signals were detected using Pierce ECL Plus Western Blotting Substrate (Thermo Fisher). Images were acquired with ImageQuant LAS4000 (Cytiva, Tokyo, Japan).

[0116] <In vitro assay> In the in vitro assay, 10,000 HEK-293 (PB-L1Cam / Flag) cells were seeded into each well of a collagen (COSMO)-coated 96-well plate and incubated at 37°C. Doxycycline (100 ng / mL) was added to the medium to induce the expression of the Tet-On gene and maintained throughout the experiment. After the cells formed a confluent monolayer, 100 ng / mL of mitomycin was added, and then the cells were incubated at 37°C for 2 hours to arrest proliferation. Cortical neurons from embryonic day 14 EGFP transgenic mice were collected, enzymatically dissociated using Neuron Dissociation Solutions (FUJIFILM Wako Pure Chemical Corporation, Osaka), and suspended in Neuron Culture Medium (FUJIFILM Wako Pure Chemical Corporation) supplemented with 10% FBS (Merck). Then, 10,000 of these neurons were seeded onto the above-cultured HEK cells at 10,000 cells / cm 2They were seeded at a density of

[0117] 2. Results Figure 6 shows the results of Western blotting. In the cells prepared in this example, it was confirmed that the target protein, L1CAM, was expressed. Figure 7 shows the results of the in vitro assay, and Figure 8 shows the results of quantitatively analyzing the time course of the neurite length of primary neurons on HEK-L1. On the second day of co-culture, the axons of neurons on HEK cells expressing L1CAM (DOX) extended longer than those on cells not expressing it. When the inhibitor 5G3 was added, axon elongation was inhibited regardless of the expression of L1CAM.

[0118] From the above, it was shown that in humans as well as in mice, and even in cells other than neurons, L1CAM exerts an axon elongation effect at least through homophilic binding. That is, the axon elongation phenomenon shown in Example 1 is not dependent on the cell type or the animal species from which the cells are derived, and it was shown that whether the cells express L1CAM or not is an important point. Therefore, not only cells derived from living organisms but also cells induced to differentiate from pluripotent stem cells (e.g., cerebral neurons / precursor cells) can be expected to have the same axon elongation effect if they express L1CAM. On the other hand, since axon elongation was inhibited by 5G3 regardless of the expression of L1CAM, it is suggested that mechanisms other than homophilic binding are involved in axon elongation promotion by L1CAM.

[0119] [Example 4] [Observation of L1CAM Expression by Electron Microscope] To explore the mechanism of the axonal elongation effect, the expression of L1CAM in the host brain transplanted with the graft was observed by electron microscopy. 1. Experiment and method Transplantation was performed 1 week after intracortical injection of AAV-L1CAM / FLAG. Cortical tissue was collected from E14.5 EGFP transgenic mice (fetuses), aspirated, and transplanted in 0.3 μl aliquots using a sterile 22-gauge injection needle (Hamilton, USA) into the injection sites (at depths of 1.0 mm and 0.5 mm in the respective RFA and CFA) of the mice that had received the vector injection. Three months later, brain specimens were collected, embedded, frozen, and then sectioned at 35 μm. Brain sections were washed twice with PBS and incubated for 15 minutes in PBS containing 0.3% H2O2 and 0.4% Photo-Flo (Kodak, Rochester, NY, USA). After washing three times with PBS for 10 minutes each, the sections were blocked with 2% skim milk in PBS for 1 hour at room temperature and incubated overnight at 4 °C with a rabbit anti-GFP antibody (1:1000, #598, Medical and Biological Laboratories Company Limited) in 2% skim milk in PBS. After washing three times with PBS for 10 minutes each, the sections were incubated for 2 hours at room temperature with a biotin-conjugated goat anti-rabbit IgG antibody in 2% skim milk in PBS and then washed three times with PBS for 10 minutes each. Subsequently, an avidin-biotin complex (vector laboratories inc, Burlingame, CA, USA) was used for reaction at room temperature for 1 hour. After washing three times with PBS for 10 minutes each, the reaction was carried out at room temperature for 20 minutes with 0.02% 3,3’-Diaminobenzidine, tetrahydrochloride (DAB-4HCl; DOJINDO, Kumamoto, Japan) and 0.0002% H2O2 in 50 mM Tris-HCl, pH 7.6. After dehydration, the samples were embedded in epoxy resin and cut into ultrathin sections with a thickness of 70 nm using an ultramicrotome (EM UC6; Leica Biosystems). After washing with PBS, the sections were blocked with 2% skim milk for 5 minutes.Next, the sections were reacted with primary antibodies (rabbit anti-GFP antibody (1:1000, #598, MBL International), rat anti-L1CAM antibody (1:30, #MAB5674, R&D Systems, Inc), mouse anti-FLAG M2 antibody (1:30, #F1804, Sigma-Aldrich)) at 4°C overnight. The sections were washed with PBS (7 times, 1 minute each), and then reacted with secondary antibodies (biotin-conjugated goat anti-rabbit IgG antibody (1:1000; #BA-1000, Vector laboratories, Burlingame, CA, USA), goat anti-rat IgG (25nm Gold) (1:30; #ab41513, Abcam), goat anti-mouse IgG (10nm Gold) (1:30, #ab39619, Abcam)) at room temperature for 2 hours. Then, they were fixed with 2% Glutaraldehyde diluted with PBS for 15 minutes and washed with distilled water. The sections were stained with uranyl acetate and lead citrate and observed using an electron microscope (JEM1400Flash, JEOL Ltd., Tokyo, Japan). TEM was performed in the Electron Microscopy Research Unit of the Department of Anatomy, Graduate School of Medicine, Kyoto University.

[0120] 2. Results Figure 9 shows micrographs of the host brain transplanted with grafts. It was shown that L1CAM was expressed on the myelin sheath of the host brain, and axons derived from the grafts ran outside the myelin sheath of the host brain axons.

[0121] [Example 5] <Induction of Neurons Expressing L1CAM> Finally, neurons expressing L1CAM, which are candidates for cells to be transplanted, were induced from human iPS cells. 1. Experiments and Methods As a cell line, S17 was used. The maintenance culture of human iPS cells (established using the Sendai virus vector CytoTune 2.0LG) was performed in StemFit medium on a 6-well plate coated with iMatrix-511 silk. One day before transferring the cells to a 96-well plate (day -1), the medium was replaced with StemFit medium C-free medium supplemented with 5 μM SB431542. From the next day (day 0), differentiation induction was carried out until day 18 using the method described in the literature (Sakaguchi et al, 2019, Stem Cell Reports). On day 18, the organoids were transferred from the 96-well plate to a 90-mm dish, and cultured with orbital shaking under 20% O2 conditions in a late-differentiation medium (DMEM-F12 / GlutaMAX, 1x N2 supplement, 1% CD Lipid Concentrate, 1% Penicilin / Streptomycin, 0.1% Amphotericin B). The medium was changed every 3 - 4 days. On the 39th day of differentiation induction, the organoids were fixed with 4% paraformaldehyde and evaluated by fluorescence immunostaining.

[0122] 2. Results Figure 10 shows the results of immunostaining of cerebral organoids on the 39th day after differentiation. Expression of L1CAM is observed at a site corresponding to the cortical plate (Ctip2 positive, Pax6 negative) in the developmental stage. Thus, cells expressing both L1CAM and Ctip2 can be suitably used for human treatment.

Industrial Applicability

[0123] The present invention enables the reconstruction of damaged neural pathways (e.g., the corticospinal tract).

[0124] This application is based on Japanese Patent Application No. 2021-078918 (filing date: May 7, 2021), the content of which is incorporated herein in its entirety.

Claims

A pharmaceutical kit for reconstructing a damaged nerve pathway by transplanting a cell population containing nerve cells and / or their progenitor cells into the motor cortex of the cerebral cortex, the pharmaceutical kit comprising a first preparation containing as an active ingredient an L1CAM, a nucleic acid encoding L1CAM, or a vector capable of expressing DNA encoding L1CAM, wherein the first preparation is administered to the motor cortex of the cerebral cortex of a patient with corticospinal tract damage. Claim 2 The pharmaceutical kit according to claim 1, wherein the corticospinal tract damage is a damage caused by head trauma or cerebrovascular disease. Claim 3 The pharmaceutical kit according to claim 1, further comprising a second preparation containing a cell population containing nerve cells and / or their progenitor cells. Claim 4 The pharmaceutical kit according to claim 3, wherein the second preparation is transplanted into or near the damaged site of the cerebral cortex of the patient. Claim 5 The pharmaceutical kit according to claim 3, wherein the second preparation contains a cell population containing cerebral cortex cells and / or their progenitor cells. Claim 6 The pharmaceutical kit according to claim 3, wherein the second preparation is administered after the administration of the first preparation. Claim 7 The pharmaceutical kit according to claim 6, wherein the second preparation is administered 7 to 20 days after the administration of the first preparation. Claim 8 The pharmaceutical kit according to claim 3, wherein the cell population is derived from pluripotent stem cells or somatic stem cells. Claim 9 The pharmaceutical kit according to claim 8, wherein the pluripotent stem cells are induced pluripotent stem (iPS) cells or embryonic stem (ES) cells. Claim 10 The pharmaceutical kit according to claim 1, wherein the L1CAM or the nucleic acid encoding L1CAM is included in a drug delivery system. Claim 11 The pharmaceutical kit according to claim 1, wherein the vector is a viral vector. Claim 12 The pharmaceutical kit according to claim 11, wherein the viral vector is an adeno-associated virus (AAV) vector.

13. The pharmaceutical kit according to claim 3, comprising a first preparation containing an AAV vector containing DNA encoding L1CAM, and a second preparation containing the cell population derived from iPS cells or somatic stem cells.

14. The pharmaceutical kit according to any one of claims 1 to 13, wherein the patient is a human.

Images