Compositions for DRG-specific reduction of transgene expression

Abstract

Provided herein are nucleic acid sequences encoding hIDUA and expression cassettes containing these coding sequences. Also provided are vectors, such as recombinant adeno-associated virus (rAAV) vectors, having a vector genome comprising a regulatory sequence operably linked to the hIDUA coding sequence that directs the expression of hIDUA. Also provided are compositions containing these expression cassettes and rAAV vectors, as well as methods for treating MPS1 or related syndromes, such as Hurler, Hurler-Scheie, and / or Scheie syndromes. The provided compositions and methods are further designed to selectively suppress the expression of hIDUA in dorsal root ganglia.

Description

[Background technology]

[0001] The vector platform of choice for in vivo gene therapy is based on primate-derived adeno-associated viruses (AAVs). In the 1960s, gene therapy products were derived from AAVs isolated from adenovirus preparations (Hoggan, MD et al. Proc Natl Acad Sci USA 55:1467-1474, 1966). Although these vectors were safe, many clinical programs failed due to insufficient transduction. At the turn of the 21st century, researchers discovered a family of endogenous AAVs that achieved much higher transduction efficiencies while maintaining a favorable safety profile for vectors (Gao, G., et al. J Virol 78:6381-6388, 2004).

[0002] Adverse host responses to AAV vectors were minimal. In contrast to nonviral and adenoviral vectors, which induce intense acute inflammatory responses (Raper, SE, et al. Mol Genet Metab 80:148-158, 2003; Zhang, Y., et al. Mol Ther 3:697-707, 2001), AAV vectors are not pro-inflammatory. Following administration of AAV vectors, destructive adaptive immune responses against vector-transduced cells, such as cytotoxic T cells, were minimal. In animals and humans, there is evidence that AAV can induce tolerance to the capsid or transgene product under certain circumstances, depending on the serotype, dose, route of administration, and immunosuppressive regimen (Gernoux, G., et al. Hum Gene Ther 28:338-349, 2017; Mays, LE & Wilson, J M Mol Ther 19:16-27,2011, Manno,CS,et al.Nat Med 12:342-347, 2006; Mingozzi, F., et al. Blood 110:2334-2341, 2007). However, it is clear that toxicity may limit the application of this technology in the context of the current explosion in clinical applications of AAV gene therapy.

[0003] The most severe toxicity occurred after intravenous administration of high-dose AAV targeting the CNS and musculoskeletal system. Studies in nonhuman primates (NHPs) showed the acute onset of thrombocytopenia and hypertransaminatemia, which in some cases developed into a fatal syndrome of hemorrhage and shock (Hordeaux, J., et al. Mol Ther 26:664-668, 2018; Hinderer, C., et al. Hum Gene Ther. 29(3):285-298, 2018). Acute elevation of liver enzymes and / or decreased platelets have also been observed in most high-dose AAV clinical trials (AveXis, I. ZOLGENSMA Prescribing Information, 2019, Solid Biosciences Provides SGT-001). Program Update, 2019, Pfizer, Pfizer Presents Initial Clinical Data on Phase 1b Gene Therapy Study for Duchenne Muscular Dystrophy (DMD), 2019, Flanigan, KT et al. Molecular Genetics and Metabolism 126:S54, 2019). Although rare, severe toxicity has been characterized by anemia, renal failure, and complement activation (Solid Biosciences, 2019, Pfizer, 2019).

[0004] More recently, NHPs and pigs receiving AAV vectors either in the cerebrospinal fluid (CSF) or, at high doses, in the blood exhibited degeneration of dorsal root ganglia (DRG) neurons. Problems have been observed (Hinderer, C., et al. Hum Gene Ther. 29(3):285-298, 2018; Hordeaux, J., et al. Mol Ther Methods Clin Dev 10:68-78, 2018; Hordeaux, J., et al. Mol Ther Methods Clin Dev 10:79-88, 2018). This neurotoxicity is associated with degeneration of both peripheral axons in the peripheral nerves and central axons ascending through the posterior columns of the spinal cord.

[0005] Mucopolysaccharidoses are a group of genetic disorders caused by deficiencies of specific lysosomal enzymes involved in the degradation of glycosaminoglycans (GAGs), also known as mucopolysaccharides. The accumulation of partially degraded GAGs interferes with cell, tissue, and organ function. Over time, GAGs accumulate in cells, blood, and connective tissue, increasing cell and organ damage. MPS I, one of the most severe mucopolysaccharidoses (MPS), is caused by a deficiency of the enzyme alpha-L-iduronidase (IDUA). Specifically, IDUA has been reported to remove terminal iduronic acid residues from two GAGs, heparan sulfate and dermatan sulfate. IDUA is located in lysosomes, intracellular compartments that digest and recycle different types of molecules. Over 100 mutations in the IDUA gene have been found to cause mucopolysaccharidoses type I (MPS I), with single nucleotide polymorphisms (SNPs) being the most common.

[0006] There is a need in the art for gene therapy compositions and methods for safely and effectively treating patients diagnosed with MPS I. [Prior art documents] [Non-patent literature]

[0007] [Non-Patent Document 1] Hoggan,MDet al.Proc Natl Acad Sci USA 55:1467-1474,1966 [Non-licensed document 2] Gao,G.,et al.J Virol 78:6381-6388,2004 [Non-licensed document 3] Raper, SE, et al. Mol Genet Metab 80:148-158, 2003

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

Non-licensed Document 7

Non-licensed Document 8

Non-licensed literature 9

Non-licensed literature 10

Non-licensed Document 11

Non-licensed Document 12

Non-licensed Document 13

Non-Patent Document 14

Non-Patent Document 15

Non-Patent Document 16

Non-Patent Document 17

Summary of the Invention

[0008] In one aspect, a recombinant AAV (rAAV) is provided comprising an AAV capsid having packaged therein a vector genome, the vector genome comprising a coding sequence for functional human alpha-L-iduronidase (hIDUA) and regulatory sequences that direct expression of hIDUA in a cell, wherein the coding sequence comprises nucleotides 82-1959 of SEQ ID NO:22, or a sequence at least 95% identical thereto, nucleotides 82-1959 of SEQ ID NO:23, or a sequence at least 95% identical thereto, nucleotides 82-1959 of SEQ ID NO:24, or a sequence at least 95% identical thereto, nucleotides 82-1959 of SEQ ID NO:25, or a sequence at least 95% identical thereto, or nucleotides 82-1959 of SEQ ID NO:26, or a sequence at least 95% identical thereto. In a specific embodiment, the rAAV comprises a coding sequence for functional hIDUA comprising at least amino acids 28-653 of SEQ ID NO:21, or a sequence at least 95% identical thereto. In certain embodiments, hIDUA comprises a native signal peptide. In yet further embodiments, hIDUA comprises the entire length (amino acids 1-653) of SEQ ID NO:21, or a sequence at least 95% identical thereto. In certain embodiments, the hIDUA coding sequence comprises nucleotides 1-1959 of SEQ ID NO:22, or a sequence at least 95% identical thereto, nucleotides 1-1959 of SEQ ID NO:23, or a sequence at least 95% identical thereto, nucleotides 1-1959 of SEQ ID NO:24, or a sequence at least 95% identical thereto, nucleotides 1-1959 of SEQ ID NO:25, or a sequence at least 95% identical thereto, or nucleotides 1-1959 of SEQ ID NO:26, or a sequence at least 95% identical thereto. In certain embodiments, hIDUA comprises a heterologous signal peptide. In certain embodiments, the vector genome comprises a tissue-specific promoter.In certain embodiments, the vector genome comprises at least one dorsal root ganglion (drg)-specific miRNA target sequence specific for at least one of miR-183, miR-182, or miR-96, wherein the at least one target sequence is operably linked to the 3' end of the hIDUA coding sequence. In certain embodiments, the miRNA target sequence is selected from SEQ ID NOs: 1, 2, 3, and 4. In certain embodiments, the vector genome further comprises two, at least three, or at least four drg-specific miRNA target sequences. In certain embodiments, the provided rAAV has an AAV9, AAVhu68, or AAVrh91 capsid.

[0009] In another aspect, an expression cassette is provided comprising a nucleic acid sequence encoding functional human alpha-galactosidase A (hIDUA) and regulatory sequences that direct expression of hIDUA in a cell containing the expression cassette, wherein the coding sequence is selected from the group consisting of nucleotides 82 to 1959 of SEQ ID NO:22, or a sequence at least 95% identical thereto, nucleotides 82 to 1959 of SEQ ID NO:23, or a sequence at least 95% identical thereto, nucleotides 82 to 1959 of SEQ ID NO:24, or a sequence at least 95% identical thereto, Expression cassettes are provided comprising nucleotides 82-1959 of SEQ ID NO:25, or a sequence at least 95% identical thereto, or nucleotides 82-1959 of SEQ ID NO:26, or a sequence at least 95% identical thereto. In certain embodiments, hIDUA comprises a coding sequence for functional hIDUA having at least amino acids 28-653 of SEQ ID NO:21, or a sequence at least 95% identical thereto. In certain embodiments, hIDUA includes a native signal peptide. In certain embodiments, hIDUA comprises the full length (amino acids 1-653) of SEQ ID NO:21, or a sequence at least 95% identical thereto. In further embodiments, the expression cassette comprises a hIDUA coding sequence comprising nucleotides 1-1959 of SEQ ID NO:22, or a sequence at least 95% identical thereto, nucleotides 1-1959 of SEQ ID NO:23, or a sequence at least 95% identical thereto, nucleotides 1-1959 of SEQ ID NO:24, or a sequence at least 95% identical thereto, nucleotides 1-1959 of SEQ ID NO:25, or a sequence at least 95% identical thereto, or nucleotides 1-1959 of SEQ ID NO:26, or a sequence at least 95% identical thereto. In yet another embodiment, the hIDUA comprises a heterologous signal peptide. In certain embodiments, the expression cassette comprises a tissue-specific promoter. In certain embodiments, the expression cassette comprises at least one dorsal root ganglion (drg)-specific miRNA target sequence specific for at least one of miR-183, miR-182, or miR-96, wherein the at least one target sequence is operably linked to the 3' end of the hIDUA coding sequence. In certain embodiments, the miRNA target sequence is selected from SEQ ID NOs: 1, 2, 3, and 4. In certain embodiments, the expression cassette further comprises two, at least three, or at least four drg-specific miRNA target sequences. In certain embodiments, the expression cassette is carried by a non-viral or viral vector. In certain embodiments, the non-viral vector is selected from naked DNA, naked RNA, inorganic particles, lipid particles, polymer-based vectors, or chitosan-based formulations.In certain embodiments, the vector is a recombinant parvovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adenovirus.

[0010] In one aspect, a recombinant nucleic acid is provided that comprises a sequence encoding a functional hIDUA, wherein the coding sequence comprises nucleotides 82 to 1959 of SEQ ID NO: 22, 23, 24, 25, or 26, or a sequence at least 95% identical thereto. In particular embodiments, the nucleic acid comprises a sequence encoding a functional hIDUA, wherein the coding sequence comprises nucleotides 1 to 1959 of SEQ ID NO: 22, 23, 24, 25, or 26, or a sequence at least 95% identical thereto. In a further embodiment, the recombinant nucleic acid is a plasmid.

[0011] In another aspect, a host cell is provided that contains the rAAV, expression cassette, or recombinant nucleic acid provided herein.

[0012] In another aspect, a pharmaceutical composition is provided comprising an rAAV, expression cassette, or recombinant nucleic acid provided herein and a pharmaceutically acceptable carrier.

[0013] Also provided in another aspect is a method of treating a subject diagnosed with mucopolysaccharidosis type I (MPS I), the method comprising administering a pharmaceutical composition provided herein to the subject. In certain embodiments, the subject has been diagnosed with Hurler syndrome, Hurler-Scheie syndrome, and / or Scheie syndrome. Also provided is the use of an rAAV, expression cassette, recombinant nucleic acid, or pharmaceutical composition provided herein to treat a subject diagnosed with MPS I, Hurler syndrome, Hurler-Scheie syndrome, and / or Scheie syndrome. [Brief explanation of the drawings]

[0014] [Figures 1A-1C]Figure 1A shows DRG toxicity and secondary axonopathy after intravenous administration of AAV. (Figure 1A) DRGs contain the cell bodies of sensory pseudounipolar neurons, which relay sensory messages from the periphery to the CNS via peripheral axons located in peripheral nerves and central axons located in the ascending dorsal white matter tract of the spinal cord. (Figure 1B) Axonopathy and DRG neurodegeneration. Axonopathy (top left) appears as distinct vacuoles (arrows) that are either empty or filled with macrophages and cellular debris. DRG lesions (top right and bottom left): Arrows indicate neuronal cell body degeneration, while circles indicate mononuclear cell infiltration. The bottom right photograph shows immunostaining for the transgene encoded by AAV (in this case, green fluorescent protein (GFP)). (Figure 1C) Examples of sections with grades 1 to 5 DRG lesions and grades 1 to 4 dorsal spinal cord axonopathy, as well as sections within normal limits (WNL). Severity grades are defined as follows: Grade 5 was not observed at all in the spinal cord. Arrows and circles depict neurodegeneration (left column) and axonopathy (right column) with mononuclear cell infiltration into the DRG. [Figures 2A-2F]High-magnification images of DRG toxicity and secondary axonal damage in the dorsal white matter tract of the spinal cord after intravenous administration of AAV are shown. (Figure 2A) Neuronal cell bodies (circles) in the early lesion are surrounded by proliferating satellite cells and infiltrating mononuclear cells, along with microglial cells (neurophagocytosis). (Figure 2C) As the lesion progresses, neuronal cell bodies show evidence of degeneration (circles), characterized by small, irregularly shaped or acutely shaped cells with fading or absent nuclei and cytoplasmic hyperoxia. (Figure 2E) End-stage neuronal cell degeneration (circles) is accompanied by complete loss of satellite cells, microglial cells, and mononuclear cells (stars). (Figures 2B, 2D, and 2F) Axonal degeneration in the dorsal white matter tracts of the spinal cord, with expanded myelin sheaths with and without myelomarphages (vertical arrows), swollen axons (asterisks), and axonal debris (arrowheads). (Hematoxylin and eosin, 40x magnification, scale bar = 50 μm). [Figure 3A-3B]We demonstrate a model of overexpression-associated toxicity and mitigation strategies using DRG-specific miRNA-induced silencing. (Figure 3A) The cell body of a pseudounipolar sensory neuron is located within the DRG and is surrounded by satellite cells and fenestrated capillaries. The peripheral axons of pseudounipolar sensory neurons are located in the peripheral nerves, while the central axons are located in the dorsal pathway of the spinal cord. AAV vectors hijack and overload the transcription and protein synthesis machinery, thus causing cellular stress (e.g., endoplasmic reticulum (ER) stress for secreted proteins) and a secondary failure to maintain distal axons. Satellite cells undergo reactive proliferation and secrete cytokines, attracting inflammatory cells such as lymphocytes. These reversible changes can lead to cell death. Glial cells and macrophages then infiltrate and phagocytose the neuronal cell body. (Figure 3B) An exemplary AAV expression cassette design for DRG-specific silencing. Four short tandem repeats of a DRG-specific miRNA reverse complement sequence (miR target) are introduced between a stop codon and a poly(A) tail. In DRG neurons, precise base pairing between DRG-specific miRNAs (e.g., miRNA183) and their targets in the 3' untranslated region of mRNAs recruits the RNA-induced silencing complex (RISC), which then triggers silencing by mRNA cleavage. In other cell types that do not express miRNA183, translation and protein synthesis occur without influence from the 3' UTR region. [Figure 4A-4B]Measurement of miR-183 abundance by qRT-PCR is shown. (Figure 4A) Tissues were from NHP rhesus macaques either untreated (not treated with AAV) or treated with a vector not containing the miR target. n = 3 for frontal cortex (cortex), heart, spleen, cerebellum, liver, medulla, and spinal cord (SC). n = 2 for quadriceps (quadriceps) and DRG-cervical segment. miR-183 expression data are expressed as fold change compared to cortex. SD was calculated from biological replicates. One-way ANOVA followed by Tukey's multiple comparison test. *p<0.05, miR183 expression in DRG compared to other tissues. (Figure 4B) miR-183 expression in human SC and DRG from a 25-year-old Caucasian male organ donor with no history of neuropathic pain. Data are expressed as fold change compared to SC. SD was calculated from three replicates of qRT-PCR wells. [Figures 5A-5D]Figure 5A shows miR183 targets specifically silencing transgene expression in vitro and in mouse DRG neurons. (Figure 5A) GFP Western blot from 293 cells cotransfected with a GFP-expressing plasmid carrying miR183 or miR145 targets and a control or miR183-expressing plasmid. Experiments were performed in triplicate. Data are shown as mean values. Error bars indicate standard deviation. (Figure 5B) DRG GFP-positive neurons by IHC quantified on sections from C57BL6 / J mice IV-injected with AAV9.GFP control vector or AAV9.GFP-miR vector at a dose of 4 x 10 GC (n = 3-4 mice per group). Three DRG-enriched miRs were screened: miR183, miR145, and miR182. Data points represent the average percentage of GFP-expressing neurons relative to total DRG neurons per mouse. Data are shown as mean values. Error bars indicate standard deviation. Wilcoxon test: * = p < 0.05, ** = p < 0.01, *** = p < 0.001. (Figure 5C) Representative photograph of GFP immunostaining from DRG quantified in panel B. (Figure 5D) Representative photographs of the cerebellum, cortex, and liver from C57BL6 / J mice IV injected with AAV-PHP.B.GFP control vector or AAV-PHP.B.GFP-miR (miR183, miR145, miR182). [Figures 6A-6C]GFP expression in the brain and peripheral organs from mice is shown. (Figure 6A) GFP direct fluorescence (3-second exposure time) in the brain cortex from C57BL6 / J mice IV-injected with the AAV-PHP.B.GFP control vector or the AAV-PHP.B.GFP-miR vector at a dose of 1 x 10 GC (n = 4 per group). Four DRG-enriched miRs were initially screened: miR183, miR182, miR96, and miR145. (Figure 6B) GFP direct fluorescence in the liver (1-second exposure time), heart (3-second exposure time), and muscle (10-second exposure time) from C57BL6 / J mice IV-injected with the AAV9.GFP control vector or the AAV9.GFP-miR vector at a dose of 4 x 10 GC (n = 3-4 per group). (Figure 6C) Quantification of GFP direct fluorescence intensity from all mice (n = 3-4 per group). One-way ANOVA followed by Tukey's multiple comparison test. *p<0.05, **p<0.01. [Figure 7A-7C]Following ICM administration of AAVhu68.GFP to NHPs, we demonstrate miR183 targeting specifically silences GFP expression in the DRG and reduces toxicity. (Figure 7A) Representative photographs of GFP-immunostained sections of DRG, spinal motor neurons, cerebellum, cortex, heart, and liver from adult rhesus macaques ICM-injected with 3.5 x 10 GC of AAVhu68.GFP control vector (n = 2) or AAVhu68.GFP-miR183 (n = 4). (Figure 7B) Quantification of GFP-positive cells in the DRG (2-4 different lumbar DRGs per animal, n = 2-4 animals per group), spinal cord (lower motor neurons, 2-5 different sections per animal, n = 2-4 animals per group), cerebellum, and cortex in NHPs (five 20x magnification fields per region, n = 2-4 animals per group). Data shown as mean values. Error bars indicate standard deviation. Wilcoxon test: *p<0.05, **p<0.01, ***p<0.001. (Figure 7C) Histopathology 2 months after injection shows dorsal spinal cord axonopathy, peripheral nerve axonopathy (median, peroneal, and radial nerves), and severity grades of DRG neurodegeneration and mononuclear cell infiltration: 1 minimal (less than 10%), 2 mild (10-25%), 3 moderate (25-50%), 4 marked (50-95%), and 5 severe (more than 95% - not observed). Each bar represents one animal. 0 indicates the absence of lesions. [Figures 8A-8D] Figures 8A-8C show T cell and antibody responses to hIDUA in NHPs. Interferon-gamma ELISPOT responses were measured in lymphocytes isolated from PBMCs, spleens, livers, and deep cervical lymph nodes 90 days after injection. Each animal had triplicate values ​​representing three overlapping peptide pools covering the hIDUA sequence. Red indicates a positive ELISPOT response, defined as a spot-forming unit greater than 55 per 10 lymphocytes and three times higher than the unstimulated medium negative control. (Figure 8D) ELISA assay for anti-hIDUA antibodies, serum dilution 1:1,000. [Figure 9]Cytokine / chemokine concentrations in CSF are shown. Samples were collected at the time of vector administration (D0), and 24 hours (24h), 21 days (D21), and 35 days (D35) after vector administration. Heatmap showing concentrations from Milliplex MAP kits containing the following analytes: sCD137, eotaxin, sFasL, FGF-2, fractalkine, granzyme A, granzyme B, IL-1α, IL-2, IL-4, IL-6, IL-16, IL-17A, IL-17E / IL-25, IL-21, IL-22, IL-23, IL-28A, IL-31, IL-33, IP-10, MIP-3α, perforin, and TNFβ. [Figure 10] Figure 13 shows miR183 targeting specifically silences hIDUA expression in DRG after intravenous administration of AAVhu68.hIDUA to NHPs. Representative photographs of hIDUA expression by anti-hIDUA antibody immunofluorescence (DRG, first row; quantification data provided in Figure 13A), anti-hIDUA IHC (lower motor neurons, cerebellum, and cortex), and anti-IDUA ISH (DRG, last row; quantification data provided in Figure 13A). Anti-IDUA ISH: Exposure time was 200 ms for AAVhu68.hIDUA with or without steroids. Sensory neurons show abundant transgene mRNA expression. Exposure time for AAV.hIDUA-miR183 was 1 second. Sensory neurons have low ISH signals (mRNA) in the nucleus and cytoplasm. mRNA can be seen in satellite cells surrounding the neurons with longer exposure times. [Figures 11A-11C]We demonstrate that miR183-mediated silencing is specific to DRG neurons and completely prevents DRG toxicity in NHPs administered AAVhu68.hIDUA ICM (Figure 11A). Quantification of hIDUA-positive cells in the DRG (5 different DRGs per animal, n = 3 animals per group), spinal cord (lower motor neurons, 2-5 different sections per animal, n = 3 animals per group), cerebellum, and cortex (5 20x magnification fields per region, n = 3 animals per group) in NHPs. Data are shown as mean values. Error bars indicate standard deviation. Wilcoxon test: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. (Figure 11B) Histopathology scoring 3 months after injection: DRG severity grade of 0–5 (plot showing scores from all DRGs in at least three cervical, three thoracic, and three lumbar sections per animal), dorsal axonopathy grade of 0–5 (plot showing scores from all different sections in at least three cervical, three thoracic, and three lumbar spinal cord sections per animal), and median nerve score - the sum of axonopathy and fibrosis severity grades (0–10) established in four sections (right, left proximal, and distal median nerve) per animal. Severity grades defined as follows: 0 no lesion, 1 minimal (less than 10%), 2 mild (10–25%), 3 moderate (25–50%), 4 marked (50–95%), and 5 severe (more than 95% - not observed). Data shown as mean values. Error bars indicate standard deviation. Wilcoxon test: *p<0.05, **p<0.01, ***p<0.001. (FIG. 11C) ISH using a hIDUA transgene-specific probe, high magnification of DRG sensory neurons and satellite cells, 1 second exposure time with nuclear counterstaining with blue DAPI. Arrow: DRG sensory neuron, arrowhead: satellite cell. [Figure 12]Vector biodistribution in the brain, spinal cord, and DRG of NHPs is shown. Vector genomes were quantified by real-time polymerase chain reaction using Taqman reagents and primers / probes targeting the rBG polyadenylation sequence of the vector. Results are expressed as genome copies per diploid genome. Error bars represent standard deviation (n = 3 animals per group). [Figures 13A-13F] IHC of the apoptotic marker activated caspase-3 in DRG is shown, using spleen as a positive control. (Figures 13A and 13B) Degenerating neuronal cell bodies (circles) and surrounding cellular infiltrates (arrowheads) are positive for activated caspase-3 in animals injected with AAVhu68.eGFP and AAVhu68.hIDUA, respectively. (Figure 13C) Animals injected with AAVhu68.eGFP.miR183 show rare positive caspase-3 immunostaining in degenerating neuronal cell bodies (circles). The majority of DRG sections from animals injected with AAVhu68.eGFP.miR183 are negative for activated caspase-3. (Figure 13D) Neurons from animals injected with AAVhu68.hIDUA.miR183 are also negative for activated caspase-3. (Figure 13E) Neuronal cell bodies in an untreated, non-AAV-injected control NHP with normal DRG are diffuse, light brown, consistent with background staining and considered negative. (Figure 13F) The spleen from an AAVhu68-injected NHP, used as a positive control, has a strongly positive, multifocal signal for activated caspase-3 in the cellular debris of the germinal center and multifocal positive signals within leukocytes in the red pulp (arrows). The surrounding white and red pulp are diffuse, light brown, consistent with background staining. Activated caspase-3 IHC, 20x magnification, scale bar = 100 μm. [Figures 14A-14E]IHC for UPR-regulated ATF6 in DRG is shown. (Figure 14A) Degenerating neuronal cell bodies (circles) in animals injected with AAVhu68.eGFP are weakly positive for ATF6, while satellite cells (vertical arrows) surrounding most of the neuronal cell bodies, most notably clusters lacking neuronal cell bodies (horizontal arrows), are strongly ATF6 positive. (Figure 14B) Degenerating neuronal cell bodies (circles) from animals injected with AAVhu68.hIDUA are negative for ATF6 in degenerating neurons, and satellite cells are strongly positive in the cytoplasm (horizontal arrows). (Figure 14C) Satellite cells in clusters lacking neuronal cell bodies in animals injected with AAVhu68.eGFP.miR183 are positive for ATF6, while degenerating neuronal cell bodies (circles) are negative. Most DRG sections from animals injected with AAVhu68.eGFP.miR183 are negative for ATF6 (inset). (Figure 14D) Neuronal cell bodies and satellite cells from animals injected with AAVhu68.hIDUA.miR183 are negative for ATF6. (Figure 14E) Neuronal cell bodies from untreated, non-AAV-injected control NHPs with normal DRGs are also negative for ATF6. ATF6 IHC, 20x magnification, scale bar = 100 μm. [Figures 15A-15E] IHC for the extrinsic apoptosis marker activated caspase-8 in DRGs is shown. Degenerating neuronal cell bodies (circles) are caspase-8 negative in animals injected with AAVhu68.eGFP (Figure 15A), AAVhu68.hIDUA (Figure 15B), and AAVhu68.eGFP.miR183 (Figure 15C). The surrounding cellular infiltrate is strongly positive (arrows). (Figure 15D) Neurons from animals injected with AAVhu68.hIDUA.miR183 are caspase-8 negative, and caspase-8-positive interstitial cells are rare (arrows). (Figure 15E) Neuronal cell bodies from untreated, non-AAV-injected control NHPs with normal DRGs are caspase-8 negative, and caspase-8-positive interstitial cells are rare (arrows). Activated caspase-8 IHC, 40x magnification, scale bar = 50 µm. [Figures 16A-16F]IHC for the endogenous apoptosis marker activated caspase-9 in DRG is shown. (Figure 16A) Degenerating neuronal cell bodies (circles) in animals injected with AAVhu68.eGFP are caspase-9 positive (horizontal arrows) with increased positivity in the cellular infiltrate. (Figure 16B) Degenerating neuronal cell bodies in animals injected with AAVhu68.hIDUA are caspase-9 negative (horizontal arrows) with few caspase-9 positive cells in the cellular infiltrate. (Figure 16C) Neurons from animals injected with AAVhu68.eGFP.miR183 are negative (horizontal arrows) with positive infiltrate cells. (Figure 16D) Neurons from animals injected with AAVhu68.hIDUA.miR183 are negative, and no degenerating neuronal cell bodies are observed. (Figure 16E) Neuronal cell bodies in untreated, non-AAV-injected control NHPs with normal DRG are negative (horizontal arrows) with rare positive interstitial cells. (FIG. 16F) The spleen from a positive control AAVhu68-injected NHP is positive in cellular debris in the germinal center and leukocytes in the red pulp (vertical arrows). Activated caspase-9 IHC, 40x magnification, scale bar = 50 μm. [Figures 17A-17D] Figure 17 shows a comparison of IDUA activity after administration of engineered sequences encoding hIDUA. Wild-type male mice were injected IV with 1x10 GC AAVhu68 for delivery of hIDUA sequences (hIDUACoV1-SEQ ID NO:22, hIDUACoV2-SEQ ID NO:23, hIDUACoV3-SEQ ID NO:24, hIDUACoV4-SEQ ID NO:25, hIDUACoV5-SEQ ID NO:26) or the unoptimized native coding sequence (hIDUAnat). IDUA activity was measured in serum on days 7 and 8 (Figure 17A), and in the brain (Figure 17B), heart (Figure 17C), and liver (Figure 17D) on day 7. [Figures 18A-18F]Results are shown for mice administered AAVhu68.hIDUAcoV1 with or without the miR183 targeting sequence (4x repeats). (Figure 18A) MPS1 mice (IDUA KO) were injected ICV with 1x10 GC and euthanized 30 or 90 days after injection. In the first study using unmodified hIDUA (Vector 1), a cohort of young mice (1-2 months old at the time of treatment) was compared with a cohort of older mice (6-8 months old) with progressive disease at the time of treatment. The second study, using the miR183-targeting modified vector, used only young mice aged 1-3 months. (Figures 18B-18D) IDUA activity in the brain and spinal cord was compared. Brains and one rostral coronal section of the thoracic-lumbar spinal cord were snap-frozen. After tissue lysis and clarification, IDUA enzyme activity was measured using a fluorescent assay based on the artificial substrate 4-methylumbelliferone (4-MU). Results were normalized per mg of protein (Figures 18E and 18F). Tissues were processed to assess storage reduction using LAMP1 immunofluorescence as a marker of treatment efficacy. [Figures 19A-19B] Figure 19 shows results from a sponge effect study involving analysis of miR183 cluster-regulated gene expression (AAV-IDUA vs. AAV-IDUA-4XmiR183) in NHPs. Figure 19A provides miR183 cluster-regulated gene mRNA quantification in the dorsal root ganglion (DRG). Figure 19B provides results in the cortex. There was no increase in expression of miR183 cluster-regulated genes (CACNA2D1 or CACNA2D2), comparing results from AAV-IDUA and AAV-IDUA-miR183 animals in either the DRG (high miR183 abundance) or the frontal cortex (low miR183 abundance). [Figure 20]The results of AAV9 transduction of various vectors carrying the eGFP transgene, with or without four copies of the miR183 target sequence at low (5 x 105) or high (2.5 x 108) concentrations, are shown. Low and high doses without miR183 were tested at a multiplicity of infection (MOI) of 100 (for low-dose AAV9-eGFP) or 10 (for high-dose AAV9-eGFP), with or without adenovirus type 5 (Ad5) helper cotransfection. All DRG neurons were transduced, and no visible signs of toxicity were observed. No GFP expression was observed in DRG neurons, although some expression was observed in fibroblast-like cells. This result confirms the suppression of GFP transcription by the 4x miR183 target expression cassette. [Figure 21] Results from a sponge effect study in rat DRG cells are shown. The data show that miR183 levels are reduced in rat DRG cells when the cells are transduced with AAV9-eGFP-miR183. AAV9-eGFP-miR183- demonstrates target engagement with GFP-miR183 mRNA. [Figures 22A-22C] Figure 22 shows the effect of miR183 sponge effect study in rat DRG cells, evaluated with three known miR183-regulated transcripts. Figure 22A shows the results of CACANA2D1 relative expression in rat DRG cells after delivery of mock vector, AAV-GFP, or AAV-GFP-miR183 vector. Figure 22B shows the results of CACANA2D2 relative expression in rat DRG cells after delivery of mock vector, AAV-GFP, or AAV-GFP-miR183 vector. Figure 22C shows the results of ATF3 expression in rat DRG cells after delivery of mock vector, AAV-GFP, or AAV-GFP-miR183 vector. No changes were observed in the relative expression of mRNA levels of these three miR183-regulated transcripts. [Figure 23]Neuroanatomical and microscopic findings are shown. DRG neuronal cell bodies (A) project axons centrally into the ascending (sensory) dorsal white matter tracts of the spinal cord (C) and the peripheral nervous system (D). (A1-D1) Neuroanatomical relationships of microscopic lesions associated with DRG pathology. Neuronal cell body degeneration in the DRG (circle, A1) leads to axonal degeneration (vertical arrow, B1) with or without periaxonal fibrosis (horizontal arrow, B1) extending both centrally and peripherally to the nerve root. Axonal degeneration in the DRG nerve root extends centrally into the ascending dorsal white matter tracts of the spinal cord (vertical arrow, C1) and peripheral nerves (vertical arrow, D1) with or without periaxonal fibrosis (horizontal arrow, D1). (A2-D2) Normal DRG, DRG nerve root, dorsal white matter of the spinal cord, and peripheral nerve. (Hematoxylin and eosin, 20x magnification, scale bar = 100 μm). (E-H) High-magnification images of various stages of DRG pathology. (E) Early in the degenerative process, neuronal cell bodies appear relatively normal (circles), containing only proliferating satellite cells along with microglial cells and infiltrating mononuclear cells (neurophagocytosis). (F) As the lesion progresses, neuronal cell bodies show evidence of degeneration (vertical arrows), characterized by small, irregularly shaped or acutely shaped cells with fading or absent nuclei and cytoplasmic hyperoxia. (G) Neuronal cell body degeneration (circles) can lead to the complete loss of satellite cells, microglial cells, and mononuclear cells (stars), which is considered end-stage degeneration. (H) Normal DRG. (Hematoxylin and eosin, 40x magnification, scale bar = 50 μm.) [Figures 24A-24D]The effects of study characteristics on the severity of DRG pathology are shown. Mean pathology scores in DRG (black) and dorsal spinal cord (SC) axons (gray) are shown for different (Figure 24A) routes of administration, (Figure 24B) vector doses, (Figure 24C) post-injection times for tissue collection, and (Figure 24D) study conduct in accordance with GLP guidelines. Mean results with standard errors of the mean are shown. Tables indicate the number of animals (n) in each group and the number of histological sections scored (count). Intergroup comparisons were performed using Wilcoxon rank-sum tests within each DRG and spinal cord region (i.e., cervical, thoracic, lumbar). Combined p-values ​​were calculated for overall DRG or spinal cord intergroup comparisons using the Fisher method, with statistical significance assessed at the 0.05 level. * indicates significance for intergroup comparisons, and # indicates significance for comparisons with the vehicle control group (Figure 24A) or the 180+ day time point (Figure 23C). *,#p<0.05, **,##p<0.01, ***,###p<0.001, ****,####p<0.0001. Color code for statistical symbols: DRG is black, SC is gray. [Figures 25A-25B] The effect of animal characteristics on the severity of DRG pathology is shown. (Figure 25A) Mean pathological scores in DRG (black) and dorsal spinal cord (SC) axons (gray) for animals of different ages at injection and for animals of different sexes (rhesus monkeys only) are shown. The table shows the average results with standard errors of the mean. The table indicates the number of animals (n) in each group and the number of histological sections scored (counts). Intergroup comparisons were performed using Wilcoxon rank-sum tests within each DRG and spinal cord region (i.e., cervical, thoracic, lumbar). Combined p-values ​​were calculated for overall DRG or spinal cord intergroup comparisons using the Fisher method, with statistical significance assessed at the 0.05 level. * indicates significance for intergroup comparisons, and # indicates significance for comparisons with the infant group (Figure 25A). *,#p<0.05; **,##p<0.01; ***,###p<0.001; ****,####p<0.0001. Statistical symbol color code: DRG is black, SC is gray. [Figures 26A-26D]The effect of vector characteristics on the severity of DRG pathology is shown. Average pathology scores in DRG (black) and dorsal spinal cord (SC) axons (gray) are shown for different (Figure 26A) capsids, (Figure 26B) promoters, and (Figure 26C) transgenes, as well as secreted transgenes (Figure 26D) versus nonsecreted transgenes. Transgenes are ranked 1–20 based on the severity of SC pathology. Average results with standard errors of the mean are shown. Tables indicate the number of animals (n) in each group and the number of histological sections scored (count). (Figures 26A, 26B, and 26D) Intergroup comparisons were performed using Wilcoxon rank-sum tests within each DRG and spinal cord region (i.e., cervical, thoracic, and lumbar). Combined p-values ​​were calculated for overall DRG or spinal cord intergroup comparisons using the Fisher method, with statistical significance assessed at the 0.05 level. * indicates significance of intergroup comparison. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Color code for statistical symbols: DRG is black, SC is gray. C=cervical, T=thoracic, L=lumbar region. [Figure 27] Regional pathology scores with distribution of severity grades are shown. The mean percentage of pathology scores with standard errors of the mean (red dots and bars) and distribution of severity grades by region (stacked bar graphs) are shown. The table shows the number of animals (n) in each group and the number of histological sections scored (count). Comparisons between mean values ​​were performed using Wilcoxon rank-sum tests between TRG and DRG, and between DRG and each region of SC (i.e., cervical, thoracic, and lumbar). Statistical significance was assessed at the 0.05 level. * indicates significance for comparisons between the trigeminal ganglion (TRG) and DRG, and # indicates significance for comparisons by region between DRG and SC. **p<0.01, ####p<0.0001. [Figures 28A-28B]Peripheral nerve pathology is shown. Mean percentage of pathological score with standard error of the mean (red dots and bars) and distribution of severity grade per peripheral nerve (stacked bar graph). The table shows the number of animals (n) in each group and the number of histological sections scored (count). Statistical analysis was not performed because some peripheral nerves were not collected in most studies. [Figures 29A-29D] The effect of study characteristics on the severity of DRG pathology, broken down by spinal cord region, is shown. Mean pathological scores in the DRG (black) and dorsal spinal cord (SC) axon (gray) regions are shown for different (Figure 29A) routes of administration, (Figure 29B) vector doses, (Figure 29C) time post-injection for tissue collection, and (Figure 29D) study conduct in accordance with GLP guidelines. Mean results with standard error of the mean. Table indicates the number of animals (n) in each group and the number of histological sections scored (count). C = cervical, T = thoracic, L = lumbar region. [Figure 30A-30B] The effect of animal characteristics on the severity of DRG pathology, broken down by spinal cord region, is shown. (Figure 30A) Mean pathological scores in the DRG (black) and dorsal spinal cord (SC) axon (gray) regions for animals of different ages at the time of injection, and (Figure 30B) different sexes (rhesus monkeys only). Average results with standard error of the mean. The table shows the number of animals (n) in each group and the number of histological sections scored (counts). C = cervical, T = thoracic, L = lumbar region. [Figures 31A-31C] The effect of vector characteristics on the severity of DRG pathology, broken down by spinal cord region, is shown. Average pathology scores in the DRG (black) and dorsal spinal cord (SC) axon (gray) regions with different (Figure 31A) capsids, (Figure 31B) promoters, and (Figure 31C) transgenes are ranked 1-20 based on the severity of SC pathology. Average results with standard error of the mean. Table indicates the number of animals (n) and number of histological sections scored (count) in each group. C = cervical, T = thoracic, L = lumbar region. DETAILED DESCRIPTION OF THE INVENTION

[0015] Provided herein are expression cassettes and replication-deficient adeno-associated viruses ("AAV") for delivery of the human alpha-L-iduronidase (hIDUA) gene to a human subject. The recombinant AAV ("rAAV") vector ("rAAV.hIDUA") used to deliver the hIDUA gene has tropism for the CNS (e.g., an rAAV with an AAVhu68 capsid), and the hIDUA transgene is encoded by specific expression control elements (e.g., For example, CB7, a chicken β-actin promoter with a cytomegalovirus enhancer element. In certain embodiments, a pharmaceutical composition suitable for intrathecal, intracisternal, and systemic administration is provided, comprising a suspension of an expression cassette or rAAV.hIDUA vector in a formulation buffer comprising a physiologically compatible aqueous buffer, a surfactant, and optional excipients.

[0016] In certain aspects, the compositions and methods provided herein are useful in therapies for the delivery of functional hIDUA, in which transgene expression is suppressed in DRG neurons by including miRNA target sequences in the vector genome or expression cassette. As used herein, the terms "suppressed" and "suppression" include partial reduction, complete abolition, or silencing of transgene expression. Transgene expression may be assessed using assays appropriate for the selected transgene. The provided compositions and methods reduce DRG toxicity characterized by neurodegeneration, secondary dorsal spinal cord axon degeneration, and / or mononuclear cell infiltration. In certain embodiments, the expression cassette or vector genome includes one or more miRNA target sequences in the 3' untranslated region (UTR) of the gene product coding sequence. Preferably, two or more miRNA target sequences are provided in tandem, optionally separated by a spacer sequence. In certain embodiments, three or more miRNA target sequences are provided in tandem, optionally separated by a spacer sequence. In certain embodiments, eight miRNA target sequences are provided in tandem, optionally separated by spacer sequences.

[0017] As used herein, a "therapeutically effective amount" refers to an amount of a composition (e.g., an rAAV.hIDUA composition) that delivers and expresses a sufficient amount of enzyme to target cells to alleviate or treat one or more symptoms of MPS1 and / or Hurler and / or Hurler-Scheie and / or Scheie syndrome. "Treatment" may include preventing the worsening of one of the symptoms of MPS1 syndrome and, if possible, reversing one or more of those symptoms. Methods for assessing therapeutic efficacy are described in detail below. A "therapeutically effective amount" for human patients may be predicted based on animal models. Examples of suitable cat and dog models have been previously described. See C. Hinderer et al., Molecular Therapy (2014); 22 12, 2018-2027; A. Bradbury, et al., Human Gene Therapy Clinical Development. March 2015, 26(1):27-37 (which are incorporated herein by reference). Regarding canine models, they are typically immunosuppressed animal models or tolerized animals, since intravenous administration in dogs has been observed to induce a strong and sustained antibody response against human IDUA, while administration is well tolerated in human patients. In these models, reversal of certain symptoms may be observed, and / or prevention of the progression of certain symptoms may be observed. For example, correction of corneal opacity may be observed, and / or correction of lesions in the central nervous system (CNS) may be observed, and / or reversal of perivascular and / or meningeal gag storage may be observed.

[0018] The goal of treatment is to functionally replenish a patient's alpha-L-iduronidase deficiency through rAAV-based CNS-directed gene therapy as a viable approach to treating the disease. When expressed from the rAAV vectors described herein, expression levels of at least about 2% of normal levels detected in CSF, serum, neurons, or other tissues or fluids can provide therapeutic benefit. However, higher expression levels can be achieved. Such expression levels can be from 2% to about 100% of normal functional human IDUA levels. In certain embodiments, higher-than-normal expression levels can be detected in CSF, serum, or other tissues or fluids.

[0019] As used herein, the term "NAb titer" refers to the amount of neutralizing antibodies (e.g., anti-AAV Nabs) that neutralize the physiological effects of the targeted epitope (e.g., AAV) produced. Anti-AAV NAb titers can be measured, for example, as described in Calcedo, R., et al., "Worldwide Epidemiology of Neutralizing Antibodies to Adeno-Associated Viruses." Journal of Infectious Diseases, 2009. 199(3): pp. 381-390, which is incorporated herein by reference.

[0020] "Comprising" is a term that means including other elements or method steps. When "comprising" is used, the associated embodiment may also use the terms "consisting of," which excludes other elements or method steps, and "consisting essentially of," which excludes any element or method step that would materially change the nature of the embodiment or invention. It should be understood that descriptions using the term "comprising" or "essentially of" are included. Although various embodiments herein are presented using the term "comprising," it should also be understood that, under various circumstances, relevant embodiments may be described using the terms "consisting of" or "consisting essentially of."

[0021] It should be noted that the terms "a" or "an" refer to one or more; for example, "a vector" refers to one or more vectors. Thus, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably herein.

[0022] As used herein, the term "about" means a variability of plus or minus 10% from a given reference, unless otherwise specified.

[0023] Human alpha-L-iduronidase (hIDUA) As used herein, the terms "human alpha-L-iduronidase" or "hIDUA" are used interchangeably to refer to the human alpha-L-iduronidase enzyme. It will be understood that the Greek letter "alpha" and the symbol "α" are used interchangeably throughout this specification. As used herein, hIDUA refers to native (wild-type) hIDUA protein, and further to variant hIDUA proteins expressed from the nucleic acid sequences provided herein, or functional fragments thereof, which, when delivered in compositions or by methods provided herein, restore a desired function, alleviate symptoms, and improve symptoms associated with one or more of MPS1, Hurler, and / or Hurler-Scheie, and / or Scheie syndromes.

[0024] "Human alpha-L-iduronidase" or "hIDUA" can be, for example, a full-length protein (including a signal peptide and mature protein) as described herein, a mature protein, a variant protein, or a functional fragment thereof. As used herein, the term "functional hIDUA" refers to a full-length or fragment of an enzyme having the amino acid sequence of the full-length native (wild-type) protein (set forth in SEQ ID NO: 21 and UniProtKB Accession Number: P35475-1), a variant thereof (including those described herein), a mutant thereof with conservative amino acid substitutions, a fragment thereof, or any combination of a variant and a mutant thereof with conservative amino acid substitutions, and having at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, or at least about 70% of the biological activity level of native (wild-type) hIDUA. The biological activity level is about 70%, at least about 75%, at least about 80%, at least about 90%, or at least about the same, or greater than 100%. In certain embodiments, the functional hIDUA comprises the substrate binding region of native hIDUA (amino acids 305 and 306). Several naturally occurring functional polymorphisms (variants) of hIDUA have been described and can be included within the scope of the present invention. Such variants are described, for example, in WO 2014 / 151341, which is incorporated herein by reference, and for example, in UniProtKB / Swiss-Prot; uniprot.org / uniprot / P35475, which is also incorporated herein by reference.

[0025] Human alpha-L-iduronidase (SEQ ID NO: 21) (signal peptide - amino acids 1-27) [Table 1]

[0026] Native human IDUA coding sequence (SEQ ID NO: 20) (NCBI Reference Sequence: NM_000203.5); (Signal peptide - nucleotides 1 to 81) atgcgtcccctgcg

[0027] With respect to the numbering of full-length native hIDUA in SEQ ID NO:20, a signal peptide is present at amino acid positions 1-27, and the mature protein comprises amino acids 28-653. As used herein, "signal peptide" refers to a short peptide (usually about 16-35 amino acids) present at the N-terminus of a newly synthesized protein. Signal peptides, and in some cases, nucleic acid sequences encoding such peptides, are also referred to as signal sequences, targeting signals, localization signals, localization sequences, transit peptides, leader sequences, or leader peptides. In certain embodiments, hIDUA is the mature protein (lacking the signal peptide sequence).

[0028] As described herein, hIDUA can include the native signal peptide (i.e., amino acids 1-27 of SEQ ID NO: 21) or, alternatively, a heterologous signal peptide. In certain embodiments, hIDUA includes a heterologous signal peptide. In certain embodiments, such heterologous signal peptides are preferably human and can include, for example, the IL-2 signal peptide. Specific heterologous signal peptides operable in certain embodiments include amino acids 1-20 from chymotrypsinogen B2, the signal peptide of human alpha-1-antitrypsin, amino acids 1-25 from iduronate-2-sulfatase, and amino acids 1-23 from protease CI inhibitor. See, e.g., WO2018 / 046774. Other signal / leader peptides may be naturally found in immunoglobulins (e.g., IgG), cytokines (e.g., IL-2, IL12, IL18, etc.), insulin, albumin, β-glucuronidase, oncostatin, alkaline protease, or fibronectin secretory signal peptides, among others. See also, for example, signalpeptide.de / index.php?m=listspdb_mammalia. Such chimeric hIDUA may have a heterologous leader in place of the native signal peptide. Optionally, the N-terminal truncation of the hIDUA enzyme may lack only a portion of the signal peptide (e.g., a deletion of about 2 to about 25 amino acids, or any value therebetween), the entire signal peptide, or a longer fragment than the signal peptide (e.g., up to 70 amino acids based on the numbering of SEQ ID NO:21). Optionally, such enzymes may contain C-terminal truncations of about 5, 10, 15, or 20 amino acids in length.

[0029] In certain embodiments, hIDUA may be selected having a sequence at least 95% identical, at least 97% identical, or at least 99% identical to the full-length (amino acids 1-653) of SEQ ID NO:21. In certain embodiments, sequences are provided that are at least 95%, at least 97%, or at least 99% identical to the mature protein (amino acids 28-653) of SEQ ID NO:21. In certain embodiments, sequences having at least 95% to at least 99% identity to either the full-length (amino acids 1-653) or mature protein (amino acids 32-653) hIDUA are characterized by improved biological efficacy and a better safety profile than reference (i.e., native) hIDUA when tested in appropriate animal models. In certain embodiments, the hIDUA enzyme contains modifications at specified positions in the hIDUA amino acid sequence.

[0030] As used herein, "conservative amino acid substitution" or "conservative amino acid substitution" refers to the modification, replacement, or substitution of an amino acid with a different amino acid having similar biochemical properties (e.g., charge, hydrophobicity, and size) known by those skilled in the art. Also see, for example, FRENCH et al. What is a conservative substitution? Journal of Molecular Evolution, March 1983, Volume 19, Issue 2, pp 171-175 and YAMPOLSKY et al. The Exchangeability of Amino Acids in Proteins, Genetics. 2005 Aug;170(4):1459-1472 (each of which is incorporated herein by reference in its entirety).

[0031] In one aspect, provided herein are nucleic acid sequences, and, for example, expression cassettes and vectors comprising the nucleic acid sequences, that encode a functional hIDUA protein. In one embodiment, the nucleic acid sequence is the wild-type coding sequence reproduced in SEQ ID NO: 20. In further embodiments, the nucleic acid sequence is at least about 60%, at least about 65%, at least about 70%, at least about 75%, or at least about 80% identical to the wild-type hIDUA sequence of SEQ ID NO: 20 and encodes a functional hIDUA.

[0032] As used herein, "nucleic acid" refers to a polymeric form of nucleotides, including RNA, mRNA, cDNA, genomic DNA, peptide nucleic acid (PNA), and synthetic forms and mixed polymers of the above. Nucleotides refer to ribonucleotides, deoxynucleotides, or modified forms of either type of nucleotide (e.g., peptide nucleic acid oligomers). The term also includes single-stranded and double-stranded forms of DNA. Those skilled in the art will understand that functional variants of these nucleic acid molecules are described herein. Functional variants are nucleic acid sequences that can be directly translated using the standard genetic code to provide the same amino acid sequence as that translated from the parent nucleic acid molecule.

[0033] In certain embodiments, the nucleic acid molecules encoding functional hIDUA and other constructs described herein are useful for generating expression cassettes and vector genomes and can be engineered for expression in yeast cells, insect cells, or mammalian cells (e.g., human cells). Methods are known and have been previously described (e.g., WO 96 / 09378). A sequence is considered engineered if at least one non-preferred codon is replaced with a more preferred codon compared to the wild-type sequence. As used herein, a non-preferred codon is a codon that is used less frequently in an organism than another codon encoding the same amino acid, and a more preferred codon is a codon that is used more frequently in an organism than a non-preferred codon. The codon usage frequency for a particular organism can be found in a codon frequency table, for example, at www.kazusa.jp / codon. Preferably, more than one non-preferred codon, preferably most or all non-preferred codons, are replaced with a more preferred codon. Preferably, the codon most frequently used in the organism is used in the engineered sequence. Substitution with preferred codons generally results in higher expression. It will also be understood by those skilled in the art that, as a result of the degeneracy of the genetic code, many different nucleic acid molecules can encode the same polypeptide. It will also be understood that those skilled in the art may, using routine techniques, make nucleotide substitutions that do not affect the amino acid sequence encoded by a nucleic acid molecule to reflect the codon usage of any particular host organism in which the polypeptide is expressed. Thus, unless otherwise specified, a "nucleic acid sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. Nucleic acid sequences can be cloned using routine molecular biology techniques or generated de novo by DNA synthesis, which can be performed using routine procedures by service companies operating in the fields of DNA synthesis and / or molecular cloning (e.g., GeneArt, GenScript, Life Technologies, Eurofins).

[0034] In certain embodiments, the nucleic acids, expression cassettes, and vector genomes described herein contain a hIDUA coding sequence that is an engineered sequence. In certain embodiments, the engineered sequence is useful for improving production, transcription, expression, or safety in a subject. In certain embodiments, the engineered sequence is useful for increasing the efficacy of the resulting therapeutic composition or treatment. In further embodiments, the engineered sequence is useful for increasing the efficacy of the expressed functional hIDUA protein and for improving the efficacy of therapeutics that deliver functional hIDUA. This may allow for lower doses of therapeutic reagents. In certain embodiments, the engineered hIUDA coding sequence is characterized by improved translation compared to the wild-type hIUDA coding sequence.

[0035] By "engineered," it is meant that the nucleic acid sequence encoding the functional hIDUA enzyme described herein is assembled and placed on any suitable genetic element, e.g., naked DNA, phage, transposon, cosmid, episome, etc., to generate, for example, a non-viral delivery system (e.g., RNA-based system, naked DNA, etc.), or to generate a viral vector in a packaging host cell and / or to introduce the hIDUA sequence carried thereon into a host cell for delivery to a host cell of interest. In certain embodiments, the genetic element is a vector. In one embodiment, the genetic element is a plasmid. Methods used to generate such engineered constructs are known to those skilled in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

[0036] The terms "percent identity," "sequence identity," "percent sequence identity," or "percent identical" in the context of nucleic acid sequences refer to the residues in two sequences that are the same when aligned for correspondence. The length of sequence identity comparison can be over the entire length of the construct, the entire length of the gene coding sequence, or a fragment of at least about 500-1000 nucleotides. However, identity between smaller fragments, e.g., having at least about 9 nucleotides, usually at least about 20-24 nucleotides, at least about 28-32 nucleotides, at least about 36 or more nucleotides, may also be desired.

[0037] Percent identity can be readily determined for amino acid sequences spanning the entire length of a protein, polypeptide, about 100 amino acids, about 300 amino acids, or peptide fragments thereof, or the corresponding nucleic acid sequence coding sequence. Suitable amino acid fragments may be at least about 8 amino acids in length and may be up to about 50 amino acids in length. Generally, when referring to "identity," "homology," or "similarity" between two different sequences, the "identity," "homology," or "similarity" is determined with reference to "aligned" sequences. An "aligned" sequence or "alignment" refers to multiple nucleic acid or protein (amino acid) sequences, often including corrections for missing or additional bases or amino acids compared to a reference sequence.

[0038] Identity can be determined by preparing an alignment of sequences using various algorithms and / or computer programs known in the art or commercially available (e.g., BLAST, ExPASy; Clustal Omega; FASTA; e.g., using the Needleman-Wunsch algorithm, Smith-Waterman algorithm). The alignment can be performed using various publicly available or commercially available multiple sequence alignment programs. For example, "Clustal Sequence alignment programs such as "Omega," "Clustal X," "MAP," "PIMA," "MSA," "BLOCKMAKER," "MEME," and "Match-Box" programs are available for amino acid sequences. Generally, one of these programs is used with default settings, but those skilled in the art can change these settings as needed. Alternatively, those skilled in the art can use another algorithm or computer program, which provides at least the level of identity or alignment as provided by the referenced algorithm and program. See, for example, J.D. Thomson et al., Nucl. Acids. Res., " See "A comprehensive comparison of multiple sequence alignments", 27(13):2682-2690 (1999).

[0039] Identity or similarity with respect to sequences is defined herein as the percentage of amino acid residues in a candidate sequence that are identical (i.e., the same residues) or similar (i.e., amino acid residues from the same group based on common side chain properties, see below) to the peptide and polypeptide regions provided herein, after aligning the sequences to achieve the maximum percent sequence identity and introducing gaps as necessary. Percent identity (%) is a measure of the relationship between two polynucleotides or two polypeptides, as determined by comparing their nucleotide or amino acid sequences, respectively. Generally, the two sequences being compared are aligned to maximize the correlation between the sequences. The alignment of the two sequences is examined, and the number of positions that give exact amino acid or nucleotide correspondences between the two sequences is determined, divided by the total length of the alignment, and multiplied by 100 to obtain a percent identity figure. The percent identity figure may be determined over the entire length of the sequences to be compared, which is particularly appropriate for sequences of the same or very similar length and are highly homologous, or the percent identity figure may be determined over a shorter, defined length, which is more appropriate for sequences of unequal length or having a lower level of homology. Numerous algorithms, and computer programs based thereon, exist and are available for use in the literature and / or publicly or commercially available for performing alignments and percent identities. The choice of algorithm or program does not limit the invention.

[0040] An example of a suitable alignment program is, for example, the software CLUSTALW (Hall, TA 1999, BioEdit: a user-friendly biological sequence alignment editor and analysis program), which is based on Unix and then imported into the Bioedit program. Programs for Windows 95 / 98 / NT. Nucleic Acids. Symp. Ser. 41:95-98), Wisconsin Sequence Analysis Package, version 9.1 (Devereux J. et al., Nucleic Acids Res., 12:387-395, 1984, available from Genetics Computer Group, Madison, Wis., USA). The programs BESTFIT and GAP may be used to determine percent identity between two polynucleotide and two polypeptide sequences.

[0041] Other programs for determining identity and / or similarity between sequences include, for example, the BLAST family of programs, the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package, available from the National Center for Biotechnology Information (NCB), Bethesda, Md., USA, and accessible through the NCBI homepage at www.ncbi.nlm.nih.gov. When using the ALIGN program to compare amino acid sequences, a PAM120 residue weight table, a gap length penalty of 12, and a gap penalty of 4 can be used, as well as FASTA (Pearson WR and Lipman DJ, Proc. Natl. Acad. Sci. USA, 85:2444-2448, 1988, available as part of the Wisconsin Sequence Analysis Package). SeqWeb software (a web-based interface to the GCG Wisconsin package: the Gap program).

[0042] In certain embodiments, the hIDUA coding sequence is less than 80% identical to the native hIDUA sequence of SEQ ID NO: 20 and encodes the amino acid sequence of SEQ ID NO: 21. In further embodiments, the hIDUA coding sequence comprises a sequence that is less than 80% identical to nucleotides (nt) 88 to 1959 of SEQ ID NO: 20 and encodes amino acids 28 to 635 of SEQ ID NO: 21.

[0043] In certain embodiments, the hIDUA coding sequence is less than about 99%, less than about 98%, less than about 97%, less than about 96%, less than about 95%, less than about 94%, less than about 93%, less than about 92%, less than about 91%, less than about 90%, less than about 89%, less than about 88%, less than about 87%, less than about 86%, less than about 85%, less than about 84%, less than about 83%, less than about 82%, less than about 81%, less than about or shares less than 80%, less than about 79%, less than about 78%, less than about 77%, less than about 76%, less than about 75%, less than about 74%, less than about 73%, less than about 72%, less than about 71%, less than about 70%, less than about 69%, less than about 68%, less than about 67%, less than about 66%, less than about 65%, less than about 64%, less than about 63%, less than about 62%, less than about 61% identity with the native hIDUA coding sequence (SEQ ID NO: 20). In other embodiments, the hIDUA coding sequence shares about 99%, about 98%, about 97%, about 96%, about 95%, about 94%, about 93%, about 92%, about 91%, about 90%, about 89%, about 88%, about 87%, about 86%, about 85%, about 84%, about 83%, about 82%, about 81%, about 80%, about 79%, about 78%, about 77%, about 76%, about 75%, about 74%, about 73%, about 72%, about 71%, about 70%, about 69%, about 68%, about 67%, about 66%, about 65%, about 64%, about 63%, about 62%, about 61%, or less identity with the native hIDUA coding sequence (SEQ ID NO: 20). In certain embodiments, the hIDUA coding sequence is at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical to SEQ ID NO:20 and encodes a functional human alpha-L-iduronidase.In further embodiments, the hIDUA coding sequence is at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical to SEQ ID NO: 23, 24, 25, 26, or 27 and encodes a functional human alpha-L-iduronidase.

[0044] Identity may be with respect to the sequence encoding full-length hIDUA (e.g., nt 1 to nt 1959 of SEQ ID NO:20) or may be with respect to the sequence encoding mature hIDUA (e.g., nt 82 to nt 1959 of SEQ ID NO:20). In certain embodiments, full-length hIDUA includes the leader peptide sequence of human alpha-L-iduronidase (i.e., encoding amino acids 1 to about 27 of SEQ ID NO:21), which corresponds to about 1 to about 81 of SEQ ID NO:20. In another embodiment, the hIDUA gene encodes a functional synthetic human alpha-L-iduronidase enzyme, which is a synthetic peptide comprising a heterologous leader sequence fused to the secreted portion of the functional alpha-L-iduronidase enzyme (i.e., about amino acids 28 to about 653 of SEQ ID NO:21) or a functional variant thereof identified herein. In yet another embodiment, the hIDUA gene encodes a functional synthetic human alpha-L-iduronidase enzyme of SEQ ID NO:21, wherein the leader sequence is encoded by nucleotides 1-81 of SEQ ID NO:20, which encode amino acids 1-27 of SEQ ID NO:21, and wherein amino acids 28-653 are at least 85% identical to nucleotides 82-1959 of SEQ ID NO:20; 95%, or 99% identical to, or encoded by, a sequence at least 85%, 95%, or 99% identical to nucleotides 82 to 1959 of SEQ ID NO: 22. In certain embodiments, the hIDUA coding sequence comprises nt 1 to 1959 of SEQ ID NO: 20, or a sequence at least 85%, 90%, 95%, or 99% identical thereto that encodes full-length hIDUA. In certain embodiments, the hIDUA coding sequence comprises nt 82 to nt 1959 of SEQ ID NO: 20, or a sequence at least 85%, 90%, 95%, or 99% identical thereto that encodes functional hIDUA. In certain embodiments, the hIDUA coding sequence comprises nt 1 to 1959 of SEQ ID NO: 23, 24, 25, or 26, or a sequence at least 85%, 90%, 95%, or 99% identical thereto that encodes full-length hIDUA. In certain embodiments, the hIDUA coding sequence comprises nt 82 to nt 1959 of SEQ ID NO: 23, 24, 25, or 26, or a sequence at least 85%, 90%, 95%, or 99% identical thereto, encoding mature hIDUA (e.g., amino acids 27 to 653 of SEQ ID NO: 21).

[0045] In further embodiments, the hIDUA coding sequence comprises SEQ ID NO: 22, 23, 24, 25, or 26. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5]

[0046] As used herein, "desired function" refers to hIDUA enzyme activity that is at least about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% of that of a healthy control.

[0047] As used herein, the phrases "alleviate symptoms" and "ameliorate symptoms" and grammatical variations thereof refer to the reversal of symptoms associated with MPS I, Hurler, and / or Hurler-Scheie and / or Scheie syndrome, slowing or prevention of the progression of symptoms associated with MPS I, Hurler, and / or Hurler-Scheie and / or Scheie syndrome. In certain embodiments, alleviation or amelioration refers to about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95% reduction in the total number of symptoms in a patient after administration of the described compositions or use of the described methods compared to before administration or use. In another embodiment, alleviation or improvement refers to a reduction in the severity or progression of symptoms after administration of the described compositions or use of the described methods by about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 95% compared to before administration or use.

[0048] It is understood that the compositions in which functional hIDUA or hIDUA coding sequences are described herein are intended to apply to other compositions, regimens, aspects, embodiments, and methods described throughout this specification.

[0049] Expression cassette In certain embodiments, an expression cassette is provided herein having a nucleic acid sequence encoding a functional hIDUA and a regulatory sequence directing its expression. As used herein, "expression cassette" refers to a nucleic acid sequence comprising a sequence (promoter) encoding the hIDUA gene, and may also include other regulatory sequences therefor, which cassette may be delivered to a packaging host cell by a genetic element (e.g., a plasmid) and packaged into a viral vector capsid (e.g., a viral particle). Typically, such an expression cassette for producing a viral vector contains the hIDUA coding sequence described herein adjacent to a packaging signal of the viral genome and other expression control sequences, such as those described herein. In certain embodiments, an expression cassette is provided comprising a nucleic acid sequence encoding a functional gene product (e.g., hIDUA) operably linked to regulatory sequences directing its expression in a target cell and a miRNA target sequence in the 3' and / or 5' UTR. As described herein, miRNA target sequence is designed to be specifically recognized by miRNA present in cells where transgene expression is undesirable and / or where reduction of transgene expression level is desired.In certain embodiments, miRNA target sequence specifically reduces transgene expression in dorsal root ganglia.In certain embodiments, miRNA target sequence is located in 3'UTR, 5'UTR, and / or both 3'UTR and 5'UTR.

[0050] As used herein, the term "expression" or "gene expression" refers to the process by which information from a gene is used to synthesize a functional gene product. A gene product can be a protein, peptide, or nucleic acid polymer (such as RNA, DNA, or PNA).

[0051] As used herein, the term "regulatory sequence" or "expression control sequence" refers to nucleic acid sequences, such as initiator sequences, enhancer sequences, and promoter sequences, that induce, repress, or otherwise control the transcription of protein-encoding nucleic acid sequences to which they are operably linked.

[0052] As used herein, the term "operably linked" refers both to expression control sequences that are contiguous with a nucleic acid sequence encoding a gene product and / or that act in trans or at a distance to regulate its transcription and expression.

[0053] The "5'UTR" is located upstream of the start codon of the coding sequence of a gene product. , and is generally shorter than the 3' UTR. Generally, the 5' UTR is about 3 to about 200 nucleotides in length, but can optionally be longer.

[0054] The "3'UTR" is downstream of the coding sequence of a gene product and is generally longer than the 5'UTR. In certain embodiments, the 3'UTR is about 200 to about 800 nucleotides in length, but can optionally be longer or shorter.

[0055] The term "exogenous" when used to describe a nucleic acid sequence or protein means that the nucleic acid or protein does not naturally occur in the chromosome or at the location present in the host cell. An exogenous nucleic acid sequence also refers to a sequence that originates from and is inserted into the same host cell or subject, but exists in a non-native state (e.g., in a different copy number or under the control of different regulatory elements).

[0056] The term "heterologous" when used to describe a nucleic acid sequence or protein means that the nucleic acid or protein is derived from a different organism or a different species of the same organism than the host cell or subject in which it is expressed. When used with reference to a protein or nucleic acid of a plasmid, vector genome, expression cassette, or vector, the term "heterologous" indicates that the protein or nucleic acid is present with a sequence or subsequence that is different from that of the protein or nucleic acid in question and that is not found in the same relationship to each other in nature.

[0057] In one embodiment, the provided expression cassette is designed for expression and secretion in the central nervous system (CNS), including the cerebrospinal fluid and brain. In a particularly desirable embodiment, the expression cassette is useful for expression in both the CNS and liver, thereby enabling treatment of both the systemic and CNS-related effects of MPS1, Hurler, Hurler-Scheie, and Scheie syndromes. For example, the inventors have observed that certain constitutive promoters (e.g., CMV) do not drive expression at the desired level when delivered intrathecally, resulting in suboptimal hIDUA expression levels. However, the chicken beta-actin promoter drives expression well in both intrathecal and systemic delivery. Therefore, it is a particularly desirable promoter. Other promoters may be selected, but expression cassettes containing other promoters may not have all of the advantages of using the chicken beta-actin promoter. Various chicken beta-actin promoters have been described alone or in combination with various enhancer elements (e.g., CB7 is a chicken beta-actin promoter with a cytomegalovirus enhancer element, the CAG promoter, which contains the promoter, the first exon and first intron of chicken beta-actin, and the splice acceptor of the rabbit beta-globin gene) or the CBh promoter [SJ Gray et al, Hu Gene Ther, 2011 Sep;22(9):1143-1153].In other embodiments, suitable promoters include the elongation factor 1 alpha (EF1 alpha) promoter (see, e.g., Kim DW et al., Use of the human elongation factor 1 alpha promoter as a versatile and efficient expression system. Gene. 1990 Jul 16;91(2):217-23), the synapsin 1 promoter (see, e.g., Kugler S et al., Human synapsin 1 gene promoter confers highly neuron-specific long-term transgene expression from an adenoviral vector in the adult rat brain depending on the transduced area. Gene Ther. 2003). Feb;10(4):337-47), neuron-specific enolase (NSE ) promoter (e.g., Kim J et al., Involvement of cholesterol-rich lipid rafts in interleukin-6-induced neuroendocrine differentiation of LNCaP prostate cancer cells. Endocrinology. 2004 Feb;145(2):613-9. Epub 2003 Oct 16), or CB6 promoter (see, e.g., Large-Scale Production of Adeno-Associated Viral Vector Serotype-9 Carrying the Human Survival Motor Neuron Gene, Mol Biotechnol. 2016 Jan;58(1):30-6. doi:10.1007 / s12033-015-9899-5).

[0058] Examples of promoters that are tissue-specific include promoters specific for liver and other tissues (albumin, Miyatake et al., (1997) J. Virol., 71:5124-32; hepatitis B virus core promoter, Sandig et al., (1996) Gene Ther., 3:1002-9; alpha-fetoprotein (AFP), Arbuthnot et al., (1996) Hum. Gene Ther., 7:1503-14), bone osteocalcin (Stein et al., (1997) Mol. Biol. Rep., 24:185-96), bone sialoprotein (Chen et al., (1996) J. Bone Miner. Res., 11:654-64), lymphocytes (CD2, Hansal et al., (1996) J. Bone Miner. Res., 11:654-64), among others. Well-known examples of promoters include the neuronal promoters (Andersen et al., (1993) Cell. Mol. Neurobiol., 13:503-15), neurofilament light chain gene (Piccioli et al., (1991) Proc. Natl. Acad. Sci. USA, 88:5611-5), and neuronal-specific vgf gene (Piccioli et al., (1995) Neuron, 15:373-84). Alternatively, regulatable promoters may be selected. See, for example, WO2011 / 126808B2 (incorporated herein by reference).

[0059] In one embodiment, the expression cassette comprises one or more expression enhancers. In one embodiment, the expression cassette contains two or more expression enhancers. These enhancers may be the same or different. For example, the enhancer may include an alpha mic / bik enhancer or a CMV enhancer. This enhancer may be present in two copies located adjacent to each other. Alternatively, the duplicated enhancer copies may be separated by one or more sequences. In yet another embodiment, the expression cassette further contains an intron, such as a chicken beta-actin intron, a human beta-globin intron, and / or a commercially available Promega® intron. Other suitable introns include those known in the art and described, for example, in WO2011 / 126808.

[0060] Furthermore, the provided expression cassette contains an appropriate polyadenylation signal. In one embodiment, the polyA sequence is rabbit globulin polyA. See, for example, WO2014 / 151341. Alternatively, another polyA, such as human growth hormone (hGH) polyadenylation sequence, SV50 polyA, or synthetic polyA, may be used. Still other conventional regulatory elements may additionally or optionally be included in the expression cassette or vector genome.

[0061] In one embodiment, the regulatory sequence further comprises an enhancer. In another embodiment, the regulatory sequence contains two or more expression enhancers. These enhancers may be the same or different. For example, the enhancer may include an alpha mic / bik enhancer or a CMV enhancer. The enhancer may exist in two copies located adjacent to each other. Alternatively, the duplicated copies of the enhancer may be separated by one or more sequences.

[0062] In one embodiment, the regulatory sequence further comprises an intron. In a further embodiment, the intron is a chicken beta-actin intron. Other suitable introns include those known in the art, and may include the human beta-globin intron, and / or commercially available Promega® introns, and those described in WO2011 / 126808.

[0063] In one embodiment, the regulatory sequence further comprises a polyadenylation signal (polyA). In a further embodiment, the polyA is rabbit globin polyA. See, e.g., WO2014 / 151341. Alternatively, another polyA (e.g., human growth hormone (hGH) polyadenylation sequence, SV40 polyA, or synthetic polyA) can be included in the expression cassette.

[0064] In certain embodiments, the expression cassette is designed for expression in a human subject while reducing or eliminating DRG expression of the transgene product. In one embodiment, the expression cassette is designed for expression in the central nervous system (CNS), including the cerebrospinal fluid and the brain. In certain embodiments, the expression cassette is designed for expression or enhanced expression of a transgene in one or more cell types present in the CNS (excluding the dorsal root ganglion), including neurons (such as pyramidal cells, Purkinje cells, granule cells, spindle cells, and interneurons) and glial cells (such as astrocytes, oligodendrocytes, microglia, and ependymal cells). In certain embodiments, enhanced expression of the transgene is achieved in one or more cell types, with little or no expression of the transgene in other cell types of the CNS. In certain embodiments, the expression cassette is useful for expression in cells other than cells of the CNS.

[0065] As used herein, "miRNA" refers to microRNA, a small non-coding RNA molecule that regulates mRNA and terminates its translation into protein. miRNAs contain a "seed sequence," a region of nucleotides, that specifically binds to mRNA through complementary base pairing, resulting in the destruction or silencing of the mRNA. In certain embodiments, the seed sequence is located in the mature miRNA (5' to 3'), generally at positions 2-7 or 2-8 (from the 5' end of the sense (+) strand) of the miRNA, but may be longer. In certain embodiments, the length of the seed sequence is about 30% or more of the length of the miRNA sequence and can be at least 7 nucleotides to about 28 nucleotides in length, at least 8 nucleotides to about 28 nucleotides in length, 7 nucleotides to 28 nucleotides in length, 8 nucleotides to 18 nucleotides in length, 12 nucleotides to 28 nucleotides in length, about 20 nucleotides to about 26 nucleotides in length, about 22 nucleotides, about 24 nucleotides, or about 26 nucleotides in length.

[0066] As used herein, an "miRNA target sequence" is a sequence located on the DNA plus strand (5' to 3') that is at least partially complementary to an miRNA sequence, including the miRNA seed sequence. The miRNA target sequence is exogenous to the untranslated region of the encoded transgene product and is designed to be specifically targeted by the miRNA in cells where repression of transgene expression is desired. The term "miR183 cluster target sequence" refers to the miR183 cluster, including miR-183, -96, and -182 (described by Dambal, S. et al. Nucleic Acids Res 43:7173-7188, 2015, incorporated herein by reference). (alternatively referred to as a family) refers to a target sequence that responds to one or more members of the family. Without intending to be bound by theory, the messenger RNA (mRNA) of the transgene (encoding the gene product) is present in the cell type into which the expression cassette containing the miRNA is delivered, such that specific binding of the miRNA to the target sequence of the 3'UTR miRNA causes silencing and cleavage of the mRNA, thereby reducing or eliminating expression of the transgene only in cells that express the miRNA.

[0067] Typically, the miRNA target sequence is at least 7 to about 28 nucleotides in length, at least 8 to about 28 nucleotides in length, 7 to 28 nucleotides, 8 to 18 nucleotides in length, 12 to 28 nucleotides in length, about 20 to about 26 nucleotides, about 22 nucleotides, about 24 nucleotides, or about 26 nucleotides in length, and contains at least one contiguous region (e.g., 7 or 8 nucleotides) that is complementary to the miRNA seed sequence. In certain embodiments, the target sequence comprises a sequence that is exact (100%) complementary to the miRNA seed sequence, or a sequence that is partial complementary to the miRNA seed sequence, including some mismatches. In certain embodiments, the target sequence comprises at least 7 to 8 nucleotides that are 100% complementary to the miRNA seed sequence. In certain embodiments, the target sequence consists of a sequence that is 100% complementary to the miRNA seed sequence. In certain embodiments, the target sequence contains multiple copies (e.g., 2 or 3 copies) of a sequence that is 100% complementary to the seed sequence. In certain embodiments, the region of 100% complementarity comprises at least 30% of the length of the target sequence. In certain embodiments, the remainder of the target sequence has at least about 80% to about 99% complementarity to the miRNA. In certain embodiments, in expression cassettes comprising positive-strand DNA, the miRNA target sequence is the reverse complement of the miRNA.

[0068] In certain embodiments, the present invention provides an engineered expression cassette, comprising at least one copy of a miR target sequence operably linked to a transgene, the miR target sequence targeting one or more members of the miR-183 family or cluster, for suppressing transgene expression in DRG and / or reducing or eliminating DRG toxicity and / or axonopathy. In certain embodiments, the engineered expression cassette comprises multiple miRNA target sequences, such that the number of miRNA target sequences is sufficient to reduce or minimize transgene expression in DRG to reduce and / or eliminate DRG toxicity and / or axonopathy. The expression cassette can be delivered via any suitable carrier system, viral or non-viral vector, and via any route, but is particularly useful for intrathecal administration.

[0069] Surprisingly, compositions containing miR-183 targeting sequences described herein for suppressing expression in DRGs have been observed to provide enhanced transgene expression in one or more different cell types within the central nervous system (other than DRGs), including, but not limited to, neurons (e.g., including pyramidal cells, Purkinje cells, granule cells, spindle cells, and interneurons) or glial cells (e.g., including astrocytes, oligodendrocytes, microglia, and ependymal cells). While this observation was initially made following an intrathecal delivery route, this expression-enhancing effect is not limited to CNS delivery routes. Enhanced expression has also been observed following intravenous delivery and may be achieved using other routes, such as intravenous (e.g., particularly high-dose delivery), intramuscular (especially high-dose delivery), or other systemic delivery routes. In certain embodiments, compositions containing miR-183 targeting sequences described herein provide enhanced transgene expression in cardiac tissue. For example, in the study described below, a statistically significant reduction in transgene expression was observed in dorsal pathway ganglia carrying the mir183 target-containing vector compared to a control vector. Surprisingly, expression was enhanced in lumbar motor neurons and the cerebellum. In certain embodiments, reduction in pathology across the DRG and / or eight other regions may be achieved, including dorsal spinal cord axonopathy in the cervical, thoracic, and lumbar spine. and reduction in median, peroneal, and radial nerve axonopathy morbidity can be achieved.

[0070] In certain embodiments, one may wish to select miR-182 and / or miR-96 targeting sequences for expression cassettes containing transgenes that do not target the CNS, to avoid enhanced CNS expression of the transgene (while suppressing DRG expression). For example, an expression cassette containing a transgene for delivery to skeletal muscle or liver may wish to avoid any enhanced CNS expression, but prevent DRG toxicity and / or axonal damage that may be associated with the high doses that may be required.

[0071] In certain embodiments, the expression cassette contains at least one miRNA target sequence that is a miR-183 target sequence. TIFF0007697943000007.tif21162 (the sequence complementary to the miR-183 seed sequence is underlined). In certain embodiments, the expression cassette contains more than one copy (e.g., two or three copies) of a sequence 100% complementary to the miR-183 seed sequence. In certain embodiments, the miR-183 target sequence is about 7 nucleotides to about 28 nucleotides in length and includes at least one region that is at least 100% complementary to the miR-183 seed sequence. In certain embodiments, the miR-183 target sequence contains a sequence that is partially complementary to SEQ ID NO: 1 and therefore has one or more mismatches when aligned to SEQ ID NO: 1. In certain embodiments, the miR-183 target sequence comprises a sequence having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches when aligned to SEQ ID NO:1, and the mismatches can be non-contiguous. In certain embodiments, the miR-183 target sequence comprises a region of 100% complementarity and comprises at least 30% of the length of the miR-183 target sequence. In certain embodiments, the region of 100% complementarity comprises a sequence having 100% complementarity with the miR-183 seed sequence. In certain embodiments, the remainder of the miR-183 target sequence has at least about 80% to about 99% complementarity to miR-183. In certain embodiments, the expression cassette comprises a miR-183 target sequence comprising a truncated SEQ ID NO:1 (i.e., a sequence lacking at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at either or both the 5' or 3' end of SEQ ID NO:1). In certain embodiments, the expression cassette comprises a transgene and one miR-183 target sequence. In yet other embodiments, the expression cassette comprises at least two, at least three, at least four, at least five, at least six, or at least seven, or at least eight miR-183 target sequences. In certain embodiments, the expression cassette comprises eight miR-183 target sequences.

[0072] In certain embodiments, the expression cassette comprises a combination of miRNA target sequences. In certain embodiments, the combination of target sequences comprises different target sequences that have at least partial complementarity to the same miRNA (e.g., miR-183). In certain embodiments, the expression cassette comprises a combination of miRNA target sequences selected from the miR-183, miR-182, and / or miR-96 target sequences provided herein. In certain embodiments, the expression cassette comprises a transgene and two, three, or four miR-96 target sequences. In certain embodiments, the expression cassette comprises a transgene and two, three, four, five, six, seven, or eight miR-182 target sequences. In certain embodiments, the expression cassette comprises eight miR-182 target sequences. In certain embodiments, the expression cassette comprises at least one, at least two, at least three, or at least four miR-183 target sequences, and optionally at least one, at least two, or at least four miR-182 target sequences. In combination with at least three, or at least four, miR-182 target sequences, and / or optionally in combination with at least one, at least two, at least three, or at least four miR-96 target sequences.

[0073] It has been observed that compositions containing transgenes and miR-182 minimize or eliminate dorsal root ganglion toxicity and / or prevent axonal damage.However, although expression cassettes containing miR-182 target sequences are effective for this purpose, they have surprisingly not been observed to enhance CNS expression, as found in those complexed with miR-183 target sequences.Therefore, it may be desirable for these compositions to target genes outside the CNS.

[0074] In certain embodiments, provided herein is an expression cassette comprising one or more miR-183 family target sequences and lacking a transgene (i.e., the miR-183 family target sequences are not operably linked to sequences encoding a heterologous gene product).

[0075] In certain embodiments, the expression cassette contains at least one miRNA target sequence that is a target sequence for miR-182. In certain embodiments, the expression cassette contains the miR-182 target sequence and comprises AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 3). In certain embodiments, the expression cassette contains more than one copy (e.g., two or three copies) of a sequence that is 100% complementary to the miR-182 seed sequence. In certain embodiments, the miR-182 target sequence is about 7 nucleotides to about 28 nucleotides in length and includes at least one region that is at least 100% complementary to the miR-182 seed sequence. In certain embodiments, the miR-182 target sequence contains a sequence that is partially complementary to SEQ ID NO: 3 and therefore has one or more mismatches when aligned with SEQ ID NO: 3. In certain embodiments, the miR-183 target sequence comprises a sequence having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches when aligned with SEQ ID NO:3, and the mismatches can be non-contiguous. In certain embodiments, the miR-182 target sequence comprises a region of 100% complementarity and comprises at least 30% of the length of the miR-182 target sequence. In certain embodiments, the region of 100% complementarity comprises a sequence having 100% complementarity with the miR-182 seed sequence. In certain embodiments, the remainder of the miR-182 target sequence has at least about 80% to about 99% complementarity with miR-182. In certain embodiments, the expression cassette comprises the miR-182 target sequence and a truncated version of SEQ ID NO:3 (i.e., a sequence lacking at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides from either or both of the 5' or 3' ends of SEQ ID NO:3). In certain embodiments, the expression cassette comprises a transgene and one miR-182 target sequence, hi yet other embodiments, the expression cassette comprises at least two, three, or four miR-182 target sequences.

[0076] In certain embodiments, an expression cassette has two or more consecutive miRNA target sequences, which are contiguous and not separated by a spacer. In certain embodiments, two or more of the miRNA target sequences are separated by a spacer. In certain embodiments, the spacer is a non-coding sequence about 1 to about 12 nucleotides, or about 2 to about 10 nucleotides in length, or about 3 to about 10 nucleotides, about 4 to about 6 nucleotides in length, or 3, 4, 5, 6, 7, 8, 9, 10, or 11 nucleotides in length. Optionally, a single expression cassette may contain three or more miRNA target sequences, optionally with different spacer sequences between them. In certain embodiments, one or more spacers are independently selected from (i) GGAT (SEQ ID NO: 5), (ii) CACGTG (SEQ ID NO: 6), or (iii) GCATGC (SEQ ID NO: 7). In certain embodiments, a spacer is located 3' of the first miRNA target sequence and / or between the last miRNA target sequence. In certain embodiments, the spacers between the miRNA target sequences are the same.

[0077] In certain embodiments, the expression cassette comprises a transgene, one miR-183 target sequence, and one or more different miRNA target sequences. In certain embodiments, the expression cassette contains the miR-96 target sequence: mRNA and DNA positive strand (5' to 3'): AGCAAAAATGTGCTAGTGCCAAA (SEQ ID NO: 2), the miR-182 target sequence: mRNA and DNA positive strand (5' to 3'): and / or AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 3).

[0078] Although miR-145 has been associated with the brain in the literature, previous studies have shown that the miR-145 target sequence is ineffective at reducing transgene expression in the dorsal root ganglion. miR-145 target sequence: mRNA and DNA plus strand (5' to 3'): AGGGATTCCTGGGAAAACTGGAC (SEQ ID NO: 4).

[0079] As provided herein, an expression cassette contains a transgene that is operably linked to or under the control of a regulatory sequence that directs the expression of the transgene product in a target cell. In certain embodiments, an expression cassette contains a transgene that is operably linked to one or more miRNA target sequences provided herein. In certain embodiments, an expression cassette or is designed to contain multiple miRNA target sequences. The miRNA target sequences are integrated into the UTR of the transgene (i.e., 3' or downstream of the open reading frame of the gene).

[0080] The term "tandem repeat" is used herein to refer to the presence of two or more consecutive miRNA target sequences. These miRNA target sequences may be contiguous, i.e., located directly one after the other, with the 3' end of one sequence immediately upstream of the 5' end of the next sequence, without any intervening sequence, or vice versa. In another embodiment, two or more of the miRNA target sequences are separated by a short spacer sequence.

[0081] As used herein, a "spacer" refers to any selected nucleic acid sequence, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length, located between two or more consecutive miRNA target sequences. In certain embodiments, the spacer is 1 to 8 nucleotides, 2 to 7 nucleotides, 3 to 6 nucleotides, 4 nucleotides, 4 to 9 nucleotides, 3 to 7 nucleotides, or longer. Preferably, the spacer is a non-coding sequence. In certain embodiments, the spacer can be four (4) nucleotides. In certain embodiments, the spacer is GGAT. In certain embodiments, the spacer is six (6) nucleotides. In certain embodiments, the spacer is CACGTG or GCATGC.

[0082] In certain embodiments, the tandem repeat contains two, three, four, five, six, seven, eight, or more identical miRNA target sequences. In certain embodiments, the tandem repeat has up to eight miRNA target sequences, which may be the same for different sequences. In certain embodiments, the tandem repeat contains at least two different miRNA target sequences, at least three different miRNA target sequences, or at least four different miRNA target sequences, etc. In certain embodiments, the tandem repeat may contain two or three identical miRNA target sequences and a fourth different miRNA target sequence.

[0083] In certain embodiments, the expression cassette comprises at least two different sets of tandem There may be a repeat.For example, 3'UTR may contain a tandem repeat immediately downstream of the transgene, a UTR sequence, and two or more tandem repeats near the 3' end of the UTR.In another example, 5'UTR may contain one, two, or more miRNA target sequences.In another example, 3' may contain a tandem repeat, and 5'UTR may contain at least one miRNA target sequence.

[0084] In certain embodiments, the expression cassette contains two, three, four, or more tandem repeats, beginning within about 0 to 20 nucleotides of the transgene's stop codon. In other embodiments, the expression cassette contains miRNA tandem repeats at least 100 to about 4000 nucleotides from the transgene's stop codon.

[0085] As used herein, "vector genome" refers to a nucleic acid sequence packaged within a viral vector. In one example, a "vector genome" contains, at least from 5' to 3', a vector-specific sequence, a nucleic acid sequence encoding a functional gene product operably linked to regulatory control sequences that direct its expression in a target cell, an miRNA target sequence in the untranslated region, and a vector-specific sequence. For example, an AAV vector genome contains an inverted terminal repeat and an expression cassette, e.g., a nucleic acid sequence encoding a functional gene product operably linked to regulatory control sequences that direct its expression in a target cell, and an miRNA target sequence in the untranslated region. As described herein, the miRNA target sequence is designed to be specifically recognized by the miRNA sequence in cells where transgene expression is undesirable (e.g., dorsal root ganglia) and / or where reduced transgene expression levels are desired.

[0086] In certain embodiments, an rAAV is provided having a vector genome containing a hIDUA sequence as provided herein. In further embodiments, the vector genome comprises SEQ ID NO: 14 or SEQ ID NO: 16. Each vector genome comprises 5' and 3' ITRs. Additionally, each contains a promoter, an enhancer, a hIDUA gene, and a polyA.

[0087] It is to be understood that the expression cassettes described herein are intended to be applicable to other compositions, regimens, aspects, embodiments and methods described throughout the specification.

[0088] vector In one aspect, provided herein is a vector comprising a nucleic acid sequence encoding a functional hIUDA. In certain embodiments, the vector comprises an expression cassette described herein for delivery of the hIUDA coding sequence.

[0089] As used herein, a "vector" refers to a biological or chemical moiety containing a nucleic acid sequence that can be introduced into an appropriate target cell for replication or expression of the nucleic acid sequence. Examples of vectors include, but are not limited to, recombinant viruses, plasmids, lipoplexes, polymersomes, polyplexes, dendrimers, cell-penetrating peptide (CPP) conjugates, magnetic particles, or nanoparticles. In certain embodiments, a vector is a nucleic acid molecule into which an engineered nucleic acid encoding a functional hIUDA can be inserted and then introduced into an appropriate target cell. Such vectors preferably have one or more origins of replication and one or more sites into which recombinant DNA can be inserted. Vectors often have a means by which vector-containing cells can be selected from vector-free cells (e.g., they encode drug resistance genes). Common vectors include plasmids, viral genomes, and "artificial chromosomes." Conventional methods for generating, producing, characterizing, or quantifying vectors are available to those skilled in the art.

[0090] In certain embodiments, the vector is a non-viral plasmid and includes an expression cassette (e.g., "naked DNA," "naked plasmid DNA," RNA, and mRNA) described herein, and may be combined with various compositions and nanoparticles (e.g., micelles, liposomes, cationic lipid-nucleic acid compositions, polyglycan compositions, and other polymer, lipid, and / or cholesterol-based nucleic acid conjugates, as well as other constructs as described herein). See, e.g., X. Su et al., Mol. Pharmaceutics, 2011, 8(3), pp. 774-787; web publication: March 21, 2011; WO2013 / 182683; WO2010 / 053572; and WO2012 / 170930 (all of which are incorporated herein by reference).

[0091] In certain embodiments, the vectors described herein are "replication-defective viruses" or "viral vectors" refer to synthetic or artificial viral particles in which an expression cassette containing a nucleic acid sequence encoding hIDUA is packaged within a viral capsid or envelope, and any viral genomic sequences packaged within the viral capsid or envelope are replication-deficient (i.e., retain the ability to infect target cells but are unable to produce progeny virions). In one embodiment, the genome of the viral vector does not contain genes encoding enzymes required for replication (the genome can be engineered to be "gutless," containing only nucleic acid sequences encoding hIDUA flanked by signals required for amplification and packaging of the artificial genome), although these genes can be supplied during production. Thus, it is considered safe for use in gene therapy because replication and infection by progeny virions cannot occur except in the presence of viral enzymes required for replication.

[0092] As used herein, recombinant viral vector refers to any suitable viral vector. Examples provide exemplary recombinant adeno-associated viruses (rAAV). Other suitable viral vectors may include, for example, adenovirus, poxvirus, bocavirus, hybrid AAV / bocavirus, herpes simplex virus, or lentivirus. In a preferred embodiment, these recombinant viruses are replication-incompetent.

[0093] Expression cassette can be delivered by any suitable non-viral vector delivery system or by suitable viral vector.Suitable non-viral vector delivery system is known in the art (for example, Ramamoorth and Narvekar.J Clin Diagn Res.2015 Jan;9(1):GE01-GE06, incorporated herein by reference), and can be easily selected by those skilled in the art, and can include, for example, naked DNA, naked RNA, dendrimer, PLGA, polymethacrylate, inorganic particles, lipid particles, polymer-based vector or chitosan-based formulation.

[0094] In certain embodiments, a host cell is provided that contains a nucleic acid encoding a hIDUA sequence. In certain embodiments, the host cell contains a plasmid having a hIDUA coding sequence described herein.

[0095] As used herein, the term "host cell" can refer to a packaging cell line in which a vector (e.g., recombinant AAV) is produced. Host cells can be prokaryotic or eukaryotic cells (e.g., human, insect, or yeast) that contain exogenous or heterologous DNA introduced into the cell by any means (e.g., electroporation, calcium phosphate precipitation, microinjection, transformation, viral infection, transfection, liposome delivery, membrane fusion techniques, high-speed DNA-coated pellets, viral infection, and protoplast fusion). Examples of host cells include, but are not limited to, isolated AAVs. The cell may include a cell, cell culture, Escherichia coli cell, yeast cell, human cell, non-human cell, mammalian cell, non-mammalian cell, insect cell, HEK-293 cell, liver cell, kidney cell, cell of the central nervous system, neuron, glial cell, or stem cell.

[0096] In certain embodiments, the host cell contains an expression cassette for the production of hIDUA such that the protein is produced in vitro in sufficient quantities for isolation or purification. In certain embodiments, the host cell contains an expression cassette encoding hIDUA (e.g., including a functional fragment thereof). As provided herein, the hIDUA polypeptide can be included in a pharmaceutical composition administered to a subject as a therapeutic agent (i.e., enzyme replacement therapy).

[0097] As used herein, the term "target cell" refers to any target cell in which expression of functional hIDUA is desired. In certain embodiments, the term "target cell" is intended to refer to the cells of a subject being treated for MPS1, Hurler, Hurler-Scheie, and / or Scheie syndrome. Examples of target cells may include, but are not limited to, liver cells, kidney cells, smooth muscle cells, and neurons. In certain embodiments, the vector is delivered to the target cell ex vivo. In certain embodiments, the vector is delivered to the target cell in vivo.

[0098] It is to be understood that the compositions in the vectors described herein are intended to apply to other compositions, regimens, aspects, embodiments, and methods described throughout the specification.

[0099] Recombinant adeno-associated virus (AAV) vectors In one aspect, provided herein is a recombinant AAV (rAAV) comprising an AAV capsid and a vector genome packaged therein.

[0100] In one embodiment, the regulatory sequences are as described above. In one embodiment, the vector genome comprises an AAV 5' inverted terminal repeat (ITR), an expression cassette described herein, and an AAV 3' ITR. In one embodiment, vector genome refers to a nucleic acid sequence packaged into an rAAV capsid to form an rAAV vector. Such a nucleic acid sequence contains AAV inverted terminal repeats (ITRs) flanking the expression cassette. In one example, a "vector genome" contains, from 5' to 3', at least an AAV 5' ITR, a nucleic acid sequence encoding a functional gene product operably linked to regulatory control sequences that direct its expression in a target cell, an miRNA target sequence in the untranslated region, and an AAV 3' ITR. In a specific embodiment, the ITRs are from AAV2 and the capsid is from a different AAV. Alternatively, other ITRs may be used. As described herein, the miRNA target sequence is designed to be specifically recognized by the miRNA sequence in cells in which expression of the transgene is undesirable and / or in which reduced expression levels of the transgene are desired.

[0101] ITRs are genetic elements involved in genome replication and packaging during vector production and are the only viral cis-elements required to generate rAAV. In one embodiment, the ITRs are derived from an AAV other than the one providing the capsid. In a preferred embodiment, ITR sequences from AAV2, or their deleted versions (ΔITR), can be used for convenience and to accelerate regulatory approval. However, ITRs from other AAV sources may also be selected. If the ITRs are derived from AAV2 and the AAV capsid is derived from another AAV source, the resulting vector can be referred to as pseudotyped. Typically, an AAV vector genome contains the AAV 5' ITR, the NAGLU coding sequence and any regulatory sequences, and the AAV 3' ITR. However, other configurations of these elements may also be suitable. D sequences and terminal separators A shortened version of the 5'ITR, termed ΔITR, has been described in which positions (trs) are deleted. In other embodiments, the full-length AAV 5' and 3'ITRs are used.

[0102] As used herein, the term "AAV" refers to naturally occurring adeno-associated viruses, adeno-associated viruses available to those skilled in the art, and / or, in the context of the compositions and methods described herein, artificial AAVs. Adeno-associated virus (AAV) viral vectors are AAV DNase-resistant particles containing an AAV protein capsid, in which an expression cassette is packaged and flanked by AAV inverted terminal repeats (ITRs) for delivery to target cells. The AAV capsid is composed of 60 capsid protein subunits, VP1, VP2, and VP3, arranged in icosahedral symmetry in a ratio of approximately 1:1:10 to 1:1:20, depending on the AAV selected. Various AAVs may be selected as the source of capsids for the AAV viral vectors identified above. See, for example, US Patent Application Publication No. 2007 / 0036760A1, US Patent Application Publication No. 2009 / 0197338A1, EP1310571. Also see WO2003 / 042397 (AAV7 and other simian AAVs), U.S. Patent No. 7,790,449 and U.S. Patent No. 7,282,199 (AAV8), WO2005 / 033321 and U.S. Patent No. 7,906,111 (AAV9), and WO2006 / 110689, and WO2003 / 042397 (rh10). These documents also describe other AAVs that can be selected to generate AAVs (incorporated by reference). Among the well-characterized AAVs isolated or engineered from humans or non-human primates (NHPs), human AAV2 was the first AAV developed as a gene transfer vector, and it has been widely used for efficient gene transfer experiments in different target tissues and animal models.Unless otherwise specified, the AAV capsids, ITRs, and other selected AAV components described herein include, but are not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV8bp, AAVrh10, AAVhu37, AAV7M8, and AAVAnc80, AAVrh90 (PCT / US20 / 30273 filed April 28, 2020), AAVrh91 (2 The capsid protein can be readily selected from among any AAV, including those commonly identified as AAVs (PCT / US20 / 30266 filed April 28, 2020), AAVrh92, rh93, and rh91.93 (PCT / US20 / 30281 filed April 28, 2020), variants of any of the known or mentioned AAVs, or yet-to-be-discovered AAVs or variants thereof, or mixtures thereof. See, for example, WO2005 / 033321 (incorporated herein by reference). In one embodiment, the AAV capsid is an AAV9 capsid or a variant thereof. In certain embodiments, the capsid protein is designated by a number or a combination of numbers and letters following the term "AAV" in the name of the rAAV vector.

[0103] As used herein, the term "variant" with respect to AAV refers to any AAV sequence derived from a known AAV sequence, including AAV sequences with conservative amino acid substitutions and AAV sequences that share at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or more sequence identity across the amino acid or nucleic acid sequence. In another embodiment, the AAV capsid includes variants that may contain up to about 10% variation from any described or known AAV capsid sequence. That is, the AAV capsid shares about 90% identity to about 99.9% identity, about 95% to about 99% identity, or about 97% to about 98% identity with an AAV capsid provided herein and / or known in the art. In one embodiment, the AAV capsid shares at least 95% identity with an AAV capsid. When determining percent identity of an AAV capsid, comparison is made between the variable proteins (e.g., vp1, vp2, or vp3) and the It can be done either way.

[0104] ITRs or other AAV components can be easily isolated or engineered from AAV using techniques available to those skilled in the art. Such AAV can be isolated, engineered, or obtained from academic, commercial, or public sources (e.g., American Type Culture Collection, Manassas, VA). Alternatively, AAV sequences can be engineered through synthesis or other suitable means by reference to published sequences, such as those available in the literature or databases (e.g., GenBank, PubMed, etc.). AAV viruses can be engineered using conventional molecular biology techniques, allowing these particles to be optimized for cell-specific delivery of nucleic acid sequences, minimize immunogenicity, tailor stability and particle lifespan, efficient degradation, precise delivery to the nucleus, etc.

[0105] As used herein, the terms "rAAV" and "artificial AAV" are used interchangeably and refer, without limitation, to an AAV comprising a capsid protein and a vector genome packaged therein, the vector genome comprising a nucleic acid heterologous to the AAV. In one embodiment, the capsid protein is a non-naturally occurring capsid. Such artificial capsids can be produced by any suitable technique using a selected AAV sequence (e.g., a fragment of the vp1 capsid protein) in combination with a heterologous sequence (which can be obtained from a different selected AAV, non-contiguous portions of the same AAV, a non-AAV viral source, or a non-viral source). Artificial AAVs can be, but are not limited to, pseudotyped AAV capsids, chimeric AAV capsids, recombinant AAV capsids, or "humanized" AAV capsids. Pseudotyped vectors in which the capsid of one AAV is replaced with a heterologous capsid protein are useful in the present invention. In one embodiment, AAV2 / 5 and AAV2 / 8 are exemplary pseudotype vectors.Selected genetic elements can be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion technology, high-speed DNA-coated pellet, virus infection, and protoplast fusion.The method used to create such constructs is known to those skilled in nucleic acid manipulation, and includes genetic engineering, recombinant engineering, and synthetic technology.See, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

[0106] As used herein, "AAV9 capsid" refers to an AAV9 having (a) the amino acid sequence of GenBank Accession No. AAS99264 (incorporated herein by reference) (the AAV vp1 capsid protein is reproduced in SEQ ID NO: 19), and / or (b) the amino acid sequence encoded by the nucleotide sequence of GenBank Accession No. AY530579.1:(nt1...2211) (reproduced in SEQ ID NO: 18). Some variations from this coding sequence are encompassed by the present invention, and may include sequences having about 99% identity to the reference amino acid sequences in GenBank Accession Nos. AAS99264 and US7906111 (also WO2005 / 033321) (i.e., less than about 1% variation from the reference sequence). Such AAVs can include, for example, naturally occurring isolates (e.g., hu68, hu31, or hu32), or variants of AAV9 with amino acid substitutions, deletions, or additions (e.g., including, but not limited to, amino acid substitutions selected from alternative residues "recruited" from corresponding positions in any other AAV capsid that aligns with the AAV9 capsid, such as those described in US9,102,949, US8,927,514, US2015 / 349911, WO2016 / 049230A11, US9,623,120, US9,585,971). However, in other embodiments, other variants of AAV9, or AAVs with at least about 95% identity to the above reference sequences, can be used. 9 capsid may be selected.See, for example, US Patent Application Publication No. 2015 / 0079038.Methods for generating capsids and therefore coding sequences, as well as methods for producing rAAV viral vectors are described.See, for example, Gao, et al., Proc.Natl.Acad.Sci.USA100(10), 6081-6086(2003) and US2013 / 0045186A1.

[0107] AAVhu68 differs from another phylogenetic group F virus, AAV9, by two encoded amino acids at positions 67 and 157 of vp1 (SEQ ID NO:9). In contrast, other phylogenetic group F AAVs (AAV9, hu31, hu31) have Ala at position 67 and Ala at position 157. Based on the numbering of SEQ ID NO:9, novel AAVhu68 capsids and / or engineered AAV capsids are provided that have a valine (Val or V) at position 157 and, optionally, a glutamic acid (Glu or E) at position 67. See also WO2018 / 160582 (including sequence listing), which is incorporated herein by reference in its entirety.

[0108] As used herein, the term "clade" in reference to a group of AAVs refers to a group of AAVs that are phylogenetically related to each other, as determined based on an alignment of AAV vp1 amino acid sequences using a neighbor-joining algorithm with a bootstrap value of at least 75% (out of at least 1000 replicates) and a Poisson-corrected distance measure of 0.05 or less. Neighbor-joining algorithms have been described in the literature. See, for example, M. Nei and S. Kumar, Molecular Evolution and Phylogenetics (Oxford University Press, New York (2000)). Computer programs are available that can be used to implement this algorithm. For example, the MEGA v2.1 program implements a modified Nei-Gojobori method. Using these techniques and computer programs, and the sequence of the AAV vp1 capsid protein, one of skill in the art can readily determine whether a selected AAV falls within one of the clades identified herein, another clade, or is outside these clades. For example, see G Gao, et al., J Virol 2004, which identifies clades A, B, C, D, E, and F and provides nucleic acid sequences of novel AAVs (GenBank accession numbers AY530553 to AY530629). Jun;78(10:6381-6388). See also WO2005 / 033321.

[0109] In certain embodiments, the AAVhu68 capsid is further characterized by one or more of the following: the AAVhu68 capsid protein is an AAVhu68 vp1 protein produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of 1 to 736 of SEQ ID NO:9; a vp1 protein produced from SEQ ID NO:9, or a vp1 protein produced from a nucleic acid sequence at least 70% identical to SEQ ID NO:8, which encodes the predicted amino acid sequence of 1 to 736 of SEQ ID NO:9; an AAVhu68 vp2 protein produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of at least about 138 to 736 of SEQ ID NO:9; a vp2 protein produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO:8, or a vp2 protein produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO:8, which encodes the predicted amino acid sequence of at least about 138 to 736 of SEQ ID NO:9; and / or an AAVhu68 vp2 protein produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of at least about 203 to 736 of SEQ ID NO:9. a vp3 protein produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO:8, or a vp3 protein produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO:8 that encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO:9; Contains the vp3 protein produced from a 70% identical nucleic acid sequence.

[0110] The vp1, vp2, and vp3 proteins of AAVhu68 are typically expressed as alternative splice variants encoded by the same nucleic acid sequence that encodes the full-length vp1 amino acid sequence (amino acids 1-736) of SEQ ID NO: 9. Optionally, the vp1 coding sequence is used alone to express the vp1, vp2, and vp3 proteins. Alternatively, this sequence can be co-expressed with one or more of a nucleic acid sequence encoding the AAVhu68 vp3 amino acid sequence of SEQ ID NO:9 (about aa 203-736) without the vp1 unique region (about aa 1 to about aa 137) and / or the vp2 unique region (about aa 1 to about aa 202), or a complementary strand thereof, the corresponding mRNA or tRNA (about nt 607 to about nt 2211 of SEQ ID NO:8), or a sequence at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO:8 encoding aa 203-736 of SEQ ID NO:9. Additionally or alternatively, the vp1 and / or vp2 coding sequences can be co-expressed with a nucleic acid sequence encoding the AAVhu68 vp2 amino acid sequence of SEQ ID NO:9 (about aa 1 to about aa 137) without the vp1 unique region (about aa 1 to about aa 137), or its complementary strand, the corresponding mRNA or tRNA (nt 412 to 22121 of SEQ ID NO:8), or a sequence at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO:8, which encodes about aa 138 to 736 of SEQ ID NO:9.

[0111] As described herein, rAAVhu68 has rAAVhu68 capsids produced in a production system expressing an AAVhu68 nucleic acid sequence encoding the vp1 amino acid sequence of SEQ ID NO:9 and, optionally, capsids derived from additional nucleic acid sequences (e.g., sequences encoding vp3 proteins without the vp1 and / or vp2 unique regions). rAAVhu68 resulting from production using a single nucleic acid sequence, vp1, produces a heterogeneous collection of vp1, vp2, and vp3 proteins. More specifically, AAVhu68 capsids contain subpopulations within the vp1, vp2, and vp3 proteins that have modifications from the predicted amino acid residues of SEQ ID NO:9. These subpopulations include at least deamidated asparagine (N or Asn) residues. For example, the asparagine in an asparagine-glycine pair is highly deamidated.

[0112] In one embodiment, the AAVhu68 vp1 nucleic acid sequence has the sequence of SEQ ID NO: 8, or a complementary strand thereto, e.g., the corresponding mRNA or tRNA. In certain embodiments, the vp2 and / or vp3 proteins can additionally or alternatively be expressed from a nucleic acid sequence different from vp1, e.g., to alter the ratio of vp proteins in a selected expression system. In certain embodiments, nucleic acid sequences encoding the AAVhu68 vp3 amino acid sequence of SEQ ID NO: 9 (about aa 203-736) or a complementary strand thereto, the corresponding mRNA or tRNA (about nt 607 to about nt 2211 of SEQ ID NO: 8) that lacks the vp1 unique region (about aa 1 to about aa 137) and / or the vp2 unique region (about aa 1 to about aa 202) are also provided. In certain embodiments, nucleic acid sequences encoding the AAVhu68 vp2 amino acid sequence of SEQ ID NO: 9 (about aa 138-736) without the vp1 unique region (about aa 1 to about aa 137), or the complementary strand thereof, the corresponding mRNA or tRNA (nt 412-2211 of SEQ ID NO: 8) are also provided.

[0113] However, other nucleic acid sequences that encode the amino acid sequence of SEQ ID NO:9 may be selected for use in producing rAAVhu68 capsids. In certain embodiments, the nucleic acid sequence is the nucleic acid sequence of SEQ ID NO:8, or at least 70% to 99% identical to SEQ ID NO:8, and encodes SEQ ID NO: 9. In certain embodiments, the nucleic acid sequence has a sequence at least 70% to 99%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 8, or to about nt 412 to about nt 2211 of SEQ ID NO: 8, and encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 9. In certain embodiments, the nucleic acid sequence has a nucleic acid sequence from about nt 607 to about nt 2211 of SEQ ID NO: 8, or a sequence at least 70% to 99%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identity to the nt of SEQ ID NO: 8, and encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 9.

[0114] In certain embodiments, AAVhu68 capsids are produced using at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% of the sequence encoding the nucleic acid sequence of SEQ ID NO: 8, or the vp1 amino acid sequence of SEQ ID NO: 9 including a modification described herein (e.g., a deamidated amino acid). In certain embodiments, the vp1 amino acid sequence is reproduced in SEQ ID NO: 9.

[0115] As used herein, when used in reference to the vp capsid protein, the term "heterologous" or any grammatical variation thereof refers to a collection of non-identical elements, for example, having vp1, vp2, or vp3 monomers (proteins) with different modified amino acid sequences. SEQ ID NO: 9 provides the encoded amino acid sequence of the AAVhu68 vp1 protein. The term "heterologous" used in reference to the vp1, vp2, and vp3 proteins (alternatively referred to as isoforms) refers to differences in the amino acid sequences of the vp1, vp2, and vp3 proteins within the capsid. AAV capsids contain subsets within the vp1, vp2, and vp3 proteins with modifications from predicted amino acid residues. These subsets contain at least certain deamidated asparagine (N or Asn) residues. For example, a particular subpopulation contains at least one, two, three, or four highly deamidated asparagine (N) positions in asparagine-glycine pairs, and optionally further contains other deamidated amino acids, where the deamidation results in an amino acid change and other optional modifications.

[0116] As used herein, unless otherwise specified, a "subpopulation" of vp proteins refers to a group of vp proteins that have at least one defined common characteristic and that consists of at least one group member and fewer than all members of a reference group.

[0117] For example, a "subpopulation" of vp1 proteins, unless otherwise specified, is at least one (1) vp1 protein and less than all vp1 proteins in an assembled AAV capsid. A "subpopulation" of vp3 proteins, unless otherwise specified, can be from one (1) vp3 protein to fewer than all vp3 proteins in an assembled AAV capsid. For example, vp1 proteins can be a subset of vp proteins, vp2 proteins can be a distinct subset of vp proteins, and vp3 can be a further subset of vp proteins in an assembled AAV capsid. In another example, vp1, vp2, and vp3 proteins can contain subsets with, for example, at least one, two, three, or four highly deamidated asparagines, e.g., different modifications at asparagine-glycine pairs.

[0118] Unless otherwise specified, highly deamidated amino acids are identical to the predicted amino acid sequence at the reference amino acid position. In comparison, this refers to at least 45% deamidation, at least 50% deamidation, at least 60% deamidation, at least 65% deamidation, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or up to about 100% deamidation at a reference amino acid position (e.g., at least 80% of the asparagine at amino acid 57 based on the numbering of SEQ ID NO:9 [AAVhu68] may be deamidated based on the total vp1 protein, or may be deamidated based on the total vp1, vp2, and vp3 proteins). Such percentages may be determined using 2D gels, mass spectrometry techniques, or other suitable techniques.

[0119] In the AAVhu68 capsid protein, four residues (N57, N329, N452, N512) routinely exhibit deamidation levels greater than 70% across various lots, and in most cases greater than 90%.

[0120] Additional asparagine residues (N94, N253, N270, N304, N409, N477, and Q599) also exhibit deamidation levels of up to approximately 20% across various lots. Deamidation levels were initially identified using trypsin digestion and verified with chymotrypsin digestion.

[0121] The AAVhu68 capsid contains subsets within the vp1, vp2, and vp3 proteins that have modifications from the predicted amino acid residues of SEQ ID NO: 9. These subsets include at least specific deamidated asparagine (N or Asn) residues. For example, specific subsets include at least one, two, three, or four highly deamidated asparagine (N) positions in the asparagine-glycine pair of SEQ ID NO: 9, and optionally further include other deamidated amino acids, where the deamidation results in an amino acid change and other optional modifications.

[0122] In certain embodiments, rAAVs are provided having an AAVrh91 capsid. A nucleic acid sequence encoding the AAVrh91 capsid is provided in SEQ ID NO: 27, and the encoded amino acid sequence is provided in SEQ ID NO: 28. Provided herein are rAAVs comprising at least one of vp1, vp2, and vp3 of AAVrh91 (SEQ ID NO: 28). Also provided herein are rAAVs comprising an AAV capsid encoded by at least one of vp1, vp2, and vp3 of AAVrh91 (SEQ ID NO: 27). In yet another embodiment, a nucleic acid sequence encoding the AAVrh91 amino acid sequence is provided in SEQ ID NO: 29, and the encoded amino acid sequence is provided in SEQ ID NO: 28. Also provided herein are rAAVs comprising an AAV capsid encoded by at least one of vp1, vp2, and vp3 of AAVrh91eng (SEQ ID NO: 29). In certain embodiments, vp1, vp2, and / or vp3 are full-length capsid proteins of AAVrh91 (SEQ ID NO: 28). In other embodiments, vp1, vp2, and / or vp3 have N-terminal and / or C-terminal truncations (e.g., truncations of about 1 to about 10 amino acids).

[0123] In certain embodiments, the rAAV comprises: (A) AAVrh91 capsids, (1) a heterologous collection of AAVrh91 vp1 proteins selected from vp1 proteins produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of 1-736 of SEQ ID NO:28, vp1 proteins produced from SEQ ID NO:27, or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO:27 encoding the predicted amino acid sequence of 1-736 of SEQ ID NO:28; vp2 proteins produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of at least about 138-736 amino acids of SEQ ID NO:28; and vp2 proteins produced from a sequence comprising at least nucleotides 412-2208 of SEQ ID NO:27. a heterologous collection of AAVrh91 vp2 proteins selected from: a vp2 protein produced from a nucleic acid sequence that encodes the predicted amino acid sequence of at least about 138-736 amino acids of SEQ ID NO:28; or a vp2 protein produced from a nucleic acid sequence that is at least 70% identical to at least nucleotides 412-2208 of SEQ ID NO:27, which encodes the predicted amino acid sequence of at least about 138-736 amino acids of SEQ ID NO:28; a vp3 protein produced from expression from a nucleic acid sequence that encodes the predicted amino acid sequence of at least about 203-736 amino acids of SEQ ID NO:28; a vp3 protein produced from a sequence that includes at least nucleotides 607-2208 of SEQ ID NO:27; or a vp3 protein produced from a nucleic acid sequence that encodes the predicted amino acid sequence of at least about 203-736 amino acids of SEQ ID NO:28, and / or (2) a heterogeneous collection of vp1 proteins that are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:28, a heterogeneous collection of vp2 proteins that are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO:28, and a heterogeneous collection of vp3 proteins that are the product of a nucleic acid sequence encoding at least about amino acids 203 to 736 of SEQ ID NO:28, wherein the vp1, vp2, and vp3 proteins are heterogeneous collections of asparagine-glycine pairs in SEQ ID NO:28. Provided is an rAAV comprising: (A) an AAVrh91 capsid containing a subpopulation having an amino acid modification comprising at least two highly deamidated asparagines (N), and optionally further comprising a subpopulation comprising other deamidated amino acids, wherein the deamidation comprises one or more of the amino acid changes; and (B) a vector genome in the AAVrh91 capsid, wherein the vector genome comprises a nucleic acid molecule comprising an AAV inverted terminal repeat sequence and a non-AAV nucleic acid sequence encoding a product operably linked to a sequence that directs expression of the product in a host cell.

[0124] In yet another embodiment, there is provided a recombinant adeno-associated virus, rAAV, comprising: (A) an AAVrh91 capsid, comprising: (1) a heterologous collection of AAVrh91 vp1 proteins selected from vp1 proteins produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of 1-736 of SEQ ID NO:28, vp1 proteins produced from SEQ ID NO:29, or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO:28 encoding the predicted amino acid sequence of 1-736 of SEQ ID NO:28; vp2 proteins produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of at least about 138-736 amino acids of SEQ ID NO:28, vp2 proteins produced from a sequence comprising at least nucleotides 412-2208 of SEQ ID NO:29, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO:29 encoding the predicted amino acid sequence of at least about 138-736 amino acids of SEQ ID NO:28; a heterologous collection of vp2 proteins, vp3 proteins produced from expression from a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 203-736 of SEQ ID NO:28, vp3 proteins produced from a sequence comprising at least nucleotides 607-2208 of SEQ ID NO:29, or vp3 proteins produced from a nucleic acid sequence that is at least 70% identical to at least nucleotides 607-2208 of SEQ ID NO:28 that encodes the predicted amino acid sequence of at least about amino acids 203-736 of SEQ ID NO:28.and / or (2) a heterogeneous collection of vp1 proteins that are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:28, a heterogeneous collection of vp2 proteins that are the product of a nucleic acid sequence encoding an amino acid sequence of at least about amino acids 138-736 of SEQ ID NO:28, and a heterogeneous collection of vp3 proteins that are the product of a nucleic acid sequence encoding at least about amino acids 203-736 of SEQ ID NO:28, wherein the vp1, vp2, and vp3 proteins contain a subpopulation having amino acid modifications comprising at least two highly deamidated asparagines (N) in the asparagine-glycine pair of SEQ ID NO:28, and optionally further subpopulations comprising other deamidated amino acids. and (B) an AAVrh91 capsid comprising one or more of the following: a nucleic acid molecule comprising an AAV inverted terminal repeat sequence; and a vector genome in the AAVrh91 capsid, the vector genome comprising a nucleic acid molecule comprising an AAV inverted terminal repeat sequence; and a non-AAV nucleic acid sequence encoding a product operably linked to a sequence that directs expression of the product in a host cell.

[0125] In certain embodiments, the provided rAAVs have vp1, vp2, and vp3 subsets of AAVrh91 with amino acid modifications including at least two highly deamidated asparagines (N) in the asparagine-glycine pair of SEQ ID NO: 28, and optionally further subsets including other deamidated amino acids, where deamidation results in an amino acid change. High levels of deamidation are observed at NG versus N57, N383, and / or N512, relative to the number of NEQ ID NO: 28. In certain embodiments, AAVrh91 may have other residues that are deamidated, e.g., typically less than 10%, and / or may have other modifications, including phosphorylation (e.g., if present, in a range of about 2 to about 30%, or about 2 to about 20%, or about 2 to about 10%) (e.g., at S149), or oxidation (e.g., at one or more of about W22, about M211, W247, M403, M435, M471, W478, W503, about M537, about M541, about M559, about M599, M635, and / or W695). Optionally, W may be oxidized to kynurenine. [Table 3]

[0126] In certain embodiments, the AAVrh91 capsid is modified at one or more of the positions identified in the table above, within the ranges provided below, as determined by mass spectrometry using the enzyme trypsin. In certain embodiments, one or more of the following positions, or the glycine following an N, are modified as described herein. Residue numbers are based on the AAVrh91 sequence provided herein. See SEQ ID NO:28.

[0127] In certain embodiments, the AAVrh91 capsid comprises a heterogeneous collection of vp1 proteins that are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:28, a heterogeneous collection of vp2 proteins that are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138-736 of SEQ ID NO:28, and a heterogeneous collection of vp3 proteins that are the product of a nucleic acid sequence encoding at least amino acids 203-736 of SEQ ID NO:28. and a heterologous collection of vp3 proteins that are the products of nucleic acid sequences that

[0128] In certain embodiments, the nucleic acid sequence encoding the AAVrh91 vp1 capsid protein is provided in SEQ ID NO:27. In other embodiments, a nucleic acid sequence having 70% to 99.9% identity to SEQ ID NO:27 may be selected to express the AAVrh91 capsid protein. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO:27. However, other nucleic acid sequences encoding the amino acid sequence of SEQ ID NO:28 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO:27, or a sequence at least 70% to 99.9%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to SEQ ID NO:27 and encodes SEQ ID NO:28. In certain embodiments, the nucleic acid sequence has a sequence at least 70% to 99.9%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 27, or to about nt 412 to about nt 2208 of SEQ ID NO: 27, and encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 28. In certain embodiments, the nucleic acid sequence has a sequence at least 70% to 99.9%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 27 from about nt 607 to about nt 2208 of SEQ ID NO: 27, and encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 28.

[0129] In certain embodiments, the nucleic acid sequence encoding the AAVrh91 vp1 capsid protein is provided in SEQ ID NO:29. In other embodiments, a nucleic acid sequence having 70% to 99.9% identity to SEQ ID NO:29 may be selected to express the AAVrh91 capsid protein. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO:29. However, other nucleic acid sequences encoding the amino acid sequence of SEQ ID NO:28 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO:29, or a sequence at least 70% to 99.9% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to SEQ ID NO:29 and encodes SEQ ID NO:28. In certain embodiments, the nucleic acid sequence has a sequence at least 70% to 99.9%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 29, or to about nt 412 to about nt 2208 of SEQ ID NO: 29, and encodes the vp2 capsid protein (about aa 138-736) of SEQ ID NO: 28. In certain embodiments, the nucleic acid sequence has a sequence at least 70% to 99.9%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 29, or to about nt 607 to about nt 2208 of SEQ ID NO: 29, and encodes the vp3 capsid protein (about aa 203-736) of SEQ ID NO: 28.

[0130] The present invention also encompasses nucleic acid sequences encoding the AAVrh91 capsid sequence (SEQ ID NO:28) or mutant AAVrh91 in which one or more residues have been altered to reduce deamidation or other modifications identified herein. Such nucleic acid sequences can be used in the production of mutant AAVrh91 capsids.

[0131] In certain embodiments, the rAAV described herein is a self-complementary AAV. The abbreviation "sc" refers to self-complementary. "Self-complementary AAV" refers to a construct in which the coding region carried by the recombinant AAV nucleic acid sequence is designed to form an intramolecular double-stranded DNA template. During infection, rather than waiting for cell-mediated synthesis of the second strand, the two complementary halves of the scAAV associate to form a single double-stranded DNA (dsDNA) unit capable of immediate replication and transcription. For example, D See M McCarty et al, "Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis," Gene Therapy, (August 2001), Vol. 8, Number 16, Pages 1248-1254. Self-complementary AAVs are described, for example, in U.S. Patent Nos. 6,596,535, 7,125,717, and 7,456,683, each of which is incorporated herein by reference in its entirety.

[0132] In certain embodiments, the rAAV described herein is nuclease-resistant. Such nucleases can be a single nuclease or a mixture of nucleases, which can be endonucleases or exonucleases. Nuclease-resistant rAAV indicates that the AAV capsid is fully assembled and protects these packaged genome sequences from degradation (digestion) during the nuclease incubation step designed to remove contaminating nucleic acids that may be present from the production process. In many cases, the rAAV described herein is DNase-resistant.

[0133] It is understood that the compositions in rAAV described herein are intended to apply to other compositions, regimens, aspects, embodiments, and methods described throughout this specification.

[0134] Production of rAAV.hIDUA viral particles The present invention provides for the production of the rAAV.hIDUA pharmaceutical compositions and formulations described herein. Methods for producing the gene therapy vectors described herein include methods well known in the art, such as the generation of plasmid DNA used to produce the gene therapy vector, vector generation, and vector purification.

[0135] The recombinant adeno-associated virus (AAV) described herein may be produced using known techniques. See, for example, WO2003 / 042397, WO2005 / 033321, WO2006 / 110689, and US7588772(B2). Such methods include culturing host cells containing a nucleic acid sequence encoding an AAV capsid, a functional rep gene, an expression cassette described herein flanked by AAV inverted terminal repeats (ITRs), and sufficient helper functions to enable packaging of the expression cassette into AAV capsid proteins. Also provided herein are host cells containing a nucleic acid sequence encoding an AAV capsid, a functional rep gene, a vector genome described, and sufficient helper functions to enable packaging of the vector genome into AAV capsid proteins. In one embodiment, the host cell is a HEK293 cell. These methods are described in further detail in WO2017 / 160360(A2), which is incorporated herein by reference.

[0136] In some embodiments, the gene therapy vector is an AAV vector, and the resulting plasmids include an AAV cis-plasmid encoding the AAV genome and gene of interest, an AAV trans-plasmid containing the AAV rep and cap genes, and an adenovirus-specific plasmid. The vector production process may include method steps such as initiating cell culture, passaging the cells, seeding the cells, transfecting the cells with plasmid DNA, changing the medium to serum-free medium after transfection, and harvesting the vector-containing cells and culture medium. The harvested vector-containing cells and culture medium are referred to herein as crude cell harvest.

[0137] The crude cell harvest is then subjected to process steps such as concentration of the vector harvest, diafiltration of the vector harvest, microfluidization of the vector harvest, nuclease digestion of the vector harvest, filtration of the microfluidized intermediate, crude purification by chromatography, crude purification by ultracentrifugation, buffer exchange by tangential flow filtration, and / or formulation and filtration to prepare bulk vector.

[0138] A two-step high salt affinity chromatography purification, followed by anion exchange resin chromatography, is used to purify the vector drug product and remove empty capsids. These methods are referred to as "Scalable Purification Methods." This method is described in further detail in WO 2017 / 160360, entitled "Separation of rAAV9 particles with packaged genome sequences from genome-deleted AAV9 intermediates," which is incorporated herein by reference. Briefly, a method for separating rAAV9 particles with packaged genome sequences from genome-deleted AAV9 intermediates involves subjecting a suspension containing recombinant AAV9 viral particles and AAV9 capsid intermediates to high-performance liquid chromatography. The AAV9 viral particles and AAV9 intermediates are bound to a strong anion exchange resin equilibrated at a pH of 10.2 and subjected to a salt gradient while monitoring the eluate for UV absorbance at about 260 and about 280. Although not optimal for rAAV9, the pH can range from about 10.0 to 10.4. In this method, AAV9 intact capsids are recovered from fractions that elute when the A260 / A280 ratio reaches an inflection point. In one example, for an affinity chromatography step, the diafiltered product may be applied to Capture Select™ Poros-AAV2 / 9 affinity resin (Life Technologies), which efficiently captures the AAV2 / 9 serotype. Under these ionic conditions, a significant percentage of residual cellular DNA and proteins flows through the column, and the AAV particles are efficiently captured.

[0139] Other methods for producing rAAV available to those skilled in the art can also be used. Suitable methods may include, but are not limited to, baculovirus expression systems or yeast-mediated production. See, for example, Robert M. Kotin, Large-scale recombinant adeno-associated virus production. Hum Mol Genet.2011 Apr 15;20(R1):R2-R6.Published online 2011 Apr 29.doi:10.1093 / hmg / ddr141、Aucoin MG et al.,Production of adeno-associated viral vectors in insect cells using triple infection:optimization of baculovirus concentration ratios.Biotechnol Bioeng.2006 Dec 20;95(6):1081-92、SAMI S.THAKUR,Production of Recombinant Adeno-associated viral vectors in yeast.Thesis presented to the Graduate School of the University of Florida,2012、Kondratov O et al.Direct Head-to-Head Evaluation of Recombinant Adeno-associated Viral Vectors Manufactured in Human versus Insect Cells,Mol Ther.2017 Aug 10.pii:S1 525-0016(17)30362-3.doi:10.1016 / j.ymthe.2017.08.003.[Epub ahead of print]、Mietzsch M et al,OneBac 2.0:Sf9 Cell Lines for Production of AAV1,AAV2,and AAV8 Vectors with Minimal Encapsidation of Foreign DNA.Hum Gene Ther Methods.2017 Feb;28(1):15-22.doi:10.1089 / hgtb.2016.164.、Li L et al.Production and characterization of novel recombinant adeno-associated virus replicative-form genomes:a eukaryotic source of DNA for gene transfer.PLoS One.2013 Aug 1;8(8):e69879.doi:10.1371 / journal.pone.0069879.Print 2013、Galibert L et al,Latest developments in the large-scale production of adeno-associated virus vectors in insect cells towards the treatment of neuromuscular diseases.J Invertebr Pathol.2011 Jul;107 Suppl:S80-93.doi:10.1016 / j.jip RM,Large-scale recombinant adeno-associated virus production.Hum Mol Genet.2011 Apr 15;20(R1):R2-6.doi:10.1093 / hmg / ddr141.Epub

[0140] Conventional methods for characterizing or quantifying rAAV are available to those skilled in the art. To calculate the content of empty and filled particles, the VP3 band volume for a selected sample (e.g., in the examples herein, a preparation purified on an iodixanol gradient, where the number of GC particles = the number of particles) is plotted against the number of loaded GC particles. The resulting linear equation (y = mx + c) is used to calculate the number of particles in the band volume of the test article peak. The number of particles (pt) per 20 μL loaded is then multiplied by 50 to obtain particles (pt) / mL. Pt / mL is divided by GC / mL to obtain the particle to genome copy ratio (pt / GC). Pt / mL - GC / mL gives empty pt / mL. Empty pt / mL is divided by pt / mL and then multiplied by 100 to obtain the percentage of empty particles. In general, methods for assaying AAV vector particles containing empty capsids and packaged genomes are known in the art. See, e.g., Grimm et al., Gene Therapy (1999) 6:1322-1330; Sommer et al., Molec. Ther. (2003) 7:122-128. To test for denatured capsids, the method involves subjecting the processed AAV stock to SDS-polyacrylamide gel electrophoresis in any gel capable of separating the three capsid proteins (e.g., a gradient gel containing 3-8% Tris-acetate in buffer), running the gel until the sample material is separated, and blotting the gel onto a nylon or nitrocellulose membrane (preferably nylon). An anti-AAV capsid antibody is then used as a primary antibody that binds to denatured capsid protein, preferably an anti-AAV capsid monoclonal antibody, most preferably a B1 anti-AAV-2 monoclonal antibody (Wobus et al., J. Viral. (2000) 74:9281-9293). A secondary antibody is then used that binds to the primary antibody and includes a means for detecting binding to the primary antibody, more preferably an anti-IgG antibody containing a detection molecule covalently attached to the antibody, most preferably a sheep anti-mouse IgG antibody covalently attached to horseradish peroxidase.To semi-quantitatively determine the binding between the primary and secondary antibodies, a method for detecting binding is used, preferably a radioisotope emitter. A detection method capable of detecting electromagnetic radiation or colorimetric changes, most preferably a chemiluminescent detection kit, is used. For example, in SDS-PAGE, samples from column fractions can be heated in SDS-PAGE loading buffer containing a reducing agent (e.g., DTT), and capsid proteins resolved in a precast gradient polyacrylamide gel (e.g., Novex). Silver staining can be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions, or other suitable staining methods, i.e., SYPRO Ruby or Coomassie staining. In one embodiment, the concentration of AAV vector genome (vg) in column fractions can be measured by quantitative real-time PCR (Q-PCR). The sample is diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA. After inactivation of the nuclease, the sample is further diluted and amplified using a TaqMan™ fluorogenic probe specific to the primers and the DNA sequence between the primers. The number of cycles required to reach a predetermined level of fluorescence (threshold cycle, Ct) is measured for each sample on an Applied Biosystems Prism 7700 sequence detection system. Plasmid DNA containing the same sequence as that contained in the AAV vector is used to generate a standard curve in a Q-PCR reaction. The cycle threshold (Ct) value obtained from the sample is used to determine the vector genome titer by normalizing it to the Ct value of the plasmid standard curve. An endpoint assay based on digital PCR can also be used.

[0141] In one embodiment, an optimized q-PCR method utilizing a broad-spectrum serine protease, such as proteinase K (e.g., commercially available from Qiagen), is used. More specifically, the optimized qPCR genomic titer assay is similar to the standard assay, except that after DNase I digestion, the sample is diluted with protease K buffer and treated with protease K, followed by heat inactivation. Suitably, the sample is diluted with a volume of protease K buffer equal to the sample size. The protease K buffer may be concentrated two-fold or more. Typically, the protease K treatment is about 0.2 mg / mL, but can vary from 0.1 mg / mL to about 1 mg / mL. The treatment step is generally carried out at about 55°C for about 15 minutes, but may be carried out at lower temperatures (e.g., about 37°C to about 50°C) for longer times (e.g., about 20 to about 30 minutes), or at higher temperatures (e.g., up to about 60°C) for shorter times (e.g., about 5 to 10 minutes). Similarly, heat inactivation is generally carried out at about 95°C for about 15 minutes, but may be carried out at lower temperatures (e.g., about 70 to about 90°C) and for longer times (e.g., about 20 to about 30 minutes). The sample is then diluted (e.g., 1000-fold) and subjected to TaqMan analysis as described for standard assays.

[0142] Additionally or alternatively, droplet digital PCR (ddPCR) can be used.For example, the method for measuring single-stranded and self-complementary AAV vector genome titer by ddPCR is described.For example, see M. Lock et al., Hu Gene Therapy Methods, Hum Gene Ther Methods.2014 Apr;25(2):115-25.doi:10.1089 / hgtb.2013.131.Epub 2014 Feb 14.

[0143] Methods for determining the ratio of capsid proteins vp1, vp2, and vp3 are also available. See, for example, Vamseedhar Rayaprolu et al., Comparative Analysis of Adeno-Associated Virus Capsid Stability and Dynamics, J Virol. 2013 Dec;87(24):13150-13160; Buller RM, Rose JA. 1978. Characterization of adenovirus-associated virus-induced polypeptide. s in KB cells. J. Virol. 25:331-338, and Rose See JA, Maizel JV, Inman JK, Shatkin AJ. 1971. Structural proteins of adenovirus-associated viruses. J. Virol. 8:766-770.

[0144] It is understood that the methods for production of rAAV described herein are intended to apply to other compositions, regimens, aspects, embodiments, and methods described throughout the specification.

[0145] Pharmaceutical Compositions and Formulations In certain embodiments, provided herein are pharmaceutical compositions comprising a vector (e.g., rAAV) described herein in a formulation buffer. In certain embodiments, the pharmaceutical composition is suitable for co-administration with a functional hIDUA protein (ERT) (e.g., Aldurazyme® (laronidase), Sanofi Genzyme). In one embodiment, provided are pharmaceutical compositions comprising a rAAV described herein in a formulation buffer. In certain embodiments, the rAAV is formulated at about 1 x 10 genome copies (GC) / mL to about 1 x 10 GC / mL. In further embodiments, the rAAV is formulated at about 3 x 10 GC / mL to about 3 x 10 GC / mL. In yet further embodiments, the rAAV is formulated at about 1 x 10 GC / mL to about 1 x 10 GC / mL. In one embodiment, the rAAV is formulated at at least about 1 x 10 GC / mL.

[0146] In certain embodiments, the pharmaceutical composition comprises an expression cassette having a hIDUA coding sequence in a non-viral vector system. This may include, for example, naked DNA, naked RNA, inorganic particles, lipid or lipid-like particles, chitosan-based formulations, and others known in the art. Such non-viral vector systems may include, for example, plasmids or non-viral genetic elements, or protein-based vectors.

[0147] In certain embodiments, the pharmaceutical composition comprises a non-replicating viral vector.Suitable viral vectors can include any suitable delivery vector, such as recombinant adenovirus, recombinant lentivirus, recombinant bocavirus, recombinant adeno-associated virus (AAV), or another recombinant parvovirus.In certain embodiments, the viral vector is recombinant AAV for delivering hIDUA to patients in need thereof.

[0148] In one embodiment, the pharmaceutical composition comprises a vector containing an expression cassette comprising a hIDUA coding sequence and a formulation buffer suitable for delivery via intracerebroventricular (ICV), intrathecal (IT), intracisternal, or intravenous (IV) injection. In one embodiment, the expression cassette comprising the hIDUA coding sequence is in a packaged recombinant AAV.

[0149] In one embodiment, a pharmaceutical composition comprises a functional hIDUA polypeptide or functional fragment thereof for delivery to a subject as enzyme replacement therapy (ERT). Such pharmaceutical compositions are typically administered intravenously, but in some circumstances may also be administered intradermally, intramuscularly, or orally. The composition may be administered for prophylactic treatment of individuals suffering from or at risk of MPS1, Hurler, Hurler-Scheie, and / or Scheie syndrome. In therapeutic applications, the pharmaceutical composition is administered to patients suffering from established disease in an amount sufficient to reduce the concentration of accumulated metabolites and / or prevent or inhibit further accumulation of metabolites. For individuals at risk for lysosomal enzyme deficiency, the pharmaceutical composition is administered prophylactically in an amount sufficient to prevent or inhibit accumulation of metabolites. Pharmaceutical compositions comprising the hIDUA protein described herein are administered in a therapeutically effective amount. Generally, the therapeutically effective amount may vary depending on the severity of the medical condition in the subject, as well as the age, general condition, and sex of the subject. Dosage may be determined by a physician. The dose can be determined by the patient's individual preference and adjusted as necessary to suit the observed therapeutic effect. In one aspect, provided herein is a pharmaceutical composition for ERT formulated to contain a unit dosage of hIDUA protein, or a functional fragment thereof.

[0150] In certain embodiments, the formulation further comprises a surfactant, preservative, excipient, and / or buffer dissolved in the aqueous suspension. In one embodiment, the buffer is PBS. In another embodiment, the buffer is artificial cerebrospinal fluid (aCSF), such as Elliott's buffer, or Harvard Apparatus Perfusion Solution (artificial CSF with final ionic concentrations (in mM): Na 150, K 3.0, Ca 1.4, Mg 0.8, P 1.0, Cl 155). A variety of suitable solutions are known, including solutions comprising one or more of buffered saline, a surfactant, and a physiologically compatible salt or mixture of salts (adjusted to an ionic strength of about 100 mM sodium chloride (NaCl) to about 250 mM sodium chloride equivalent), or physiologically compatible salts adjusted to equivalent ionic concentrations.

[0151] Preferably, the formulation is adjusted to a physiologically acceptable pH, such as pH 6-8, or pH 6.5-7.5, pH 7.0-7.7, or pH 7.2-7.8. Because the pH of cerebrospinal fluid is about 7.28 to about 7.32, a pH within this range may be desirable for intrathecal delivery, while a pH of 6.8 to about 7.2 may be desirable for intravenous delivery. However, other pH values ​​within the broadest range, and subranges thereof, may be selected for other delivery routes.

[0152] Suitable surfactants or surfactant combinations may be selected from non-toxic nonionic surfactants. In one embodiment, a primary hydroxyl-terminated bifunctional block copolymer surfactant is selected, such as Pluronic® F68 [BASF], also known as Poloxamer 188, which has a neutral pH and an average molecular weight of 8400. Other surfactants and other poloxamers, i.e., nonionic triblock copolymers consisting of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), SOLUTOL HS 15 (macrogol-15 hydroxystearate), LABRASOL (polyoxycapric acid glyceride), polyoxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol, and polyethylene glycol may be selected.

[0153] In one embodiment, the formulation contains a poloxamer. These copolymers are generally named using the letter "P" (for poloxamer) followed by a three-digit number, where the first two digits x 100 give the approximate molecular mass of the polyoxypropylene core, and the last digit x 10 gives the percentage of polyoxyethylene content. In one embodiment, poloxamer 188 is selected. The surfactant may be present in an amount up to about 0.0005% to about 0.001% of the suspension.

[0154] In one example, the formulation can contain a buffered saline solution, e.g., including one or more of sodium chloride, sodium bicarbonate, dextrose, magnesium sulfate (e.g., magnesium sulfate·7H2O), potassium chloride, calcium chloride (e.g., calcium chloride·2H2O), dibasic sodium phosphate, and mixtures thereof, in water. Preferably, for intrathecal delivery, the osmolality is within a range compatible with cerebrospinal fluid (e.g., about 275 to about 290); see, e.g., emedicine.medscape.com / article / 2093316-overview. Optionally, for intrathecal delivery, commercially available diluents can be used as suspending agents or in combination with other suspending agents and any other excipients. See, e.g., Elliotts B® Solution [Lukare Medical]. .

[0155] In certain embodiments, the formulation may contain one or more permeation enhancers. Examples of suitable permeation enhancers may include, for example, mannitol, sodium glycocholate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether, or EDTA.

[0156] In one embodiment, a frozen composition containing rAAV in a buffer solution as described herein is provided in a frozen form. Optionally, one or more surfactants (e.g., Pluronic F68), stabilizers, or preservatives are present in this composition. Suitably, for use, the composition is thawed and titrated to a desired dose with an appropriate diluent, such as sterile saline or buffered saline.

[0157] In certain embodiments, a kit is provided that includes a concentrated vector suspended in a formulation (optionally frozen), an optional dilution buffer, and a device and other components required for intrathecal administration. In another embodiment, the kit may additionally or alternatively include components for intravenous delivery. In one embodiment, the kit provides sufficient buffer to allow injection. Such a buffer may allow for approximately a 1:1 to 1:5 dilution of the concentrated vector, or greater. In other embodiments, larger or smaller volumes of buffer or sterile water are included to allow for dose titration and other adjustments by the treating physician. In yet other embodiments, the kit includes one or more components of a device.

[0158] In certain embodiments, provided herein is a pharmaceutical composition comprising a vector (e.g., rAAV) described herein and a pharmaceutically acceptable carrier. As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, etc. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients can also be incorporated into the composition. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc. can be used to introduce the compositions of the present invention into suitable host cells.

[0159] In particular, rAAV vectors can be formulated for delivery either encapsulated in lipid particles, liposomes, vesicles, nanospheres, or nanoparticles. In one embodiment, a therapeutically effective amount of the vector is included in the pharmaceutical composition. The choice of carrier does not limit the present invention. Other conventional pharmaceutically acceptable carriers, such as preservatives or chemical stabilizers, are also acceptable. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0160] The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an allergic or similar adverse reaction when administered to a host.

[0161] As used herein, the term "dosage" or "amount" can refer to the total dosage or amount delivered to a subject over the course of treatment, or the dosage or amount delivered in a single unit (or multiple units or split doses) administration.

[0162] In one embodiment, a viral vector (e.g., rAV) described herein is administered in a formulation buffer. Provided herein are pharmaceutical compositions comprising V). In certain embodiments, the compositions provide a pharmaceutical composition for a human patient containing any integer or fractional amount within the range, preferably 1.0 x 10 12 GC~1.0×10 14 Including GC, approximately 1.0 × 10 9 GC~approx. 1.0×10 16 Dosage units can be formulated to contain an amount of replication-defective virus in the range of GC (to treat an average subject weighing 70 kg). In one embodiment, the composition contains at least 1 x 10 per dose, including all integers or fractions within that range. 9 , 2 × 10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9, 7×10 9 , 8×10 9 , or 9×10 9 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or fractions within the range. 10 , 2 × 10 10 , 3×10 10 , 4×10 10 , 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 , or 9×10 10 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or fractions within the range. 11 , 2 × 10 11 , 3×10 11 , 4×10 11 , 5×10 11 , 6×10 11 , 7×10 11 , 8×10 11 , or 9×10 11 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or fractions within the range. 12 , 2 × 10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×10 12 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or fractions within the range. 13 , 2 × 10 13 , 3×10 13 , 4×10 13 , 5×10 13 , 6×10 13 , 7×10 13 , 8×10 13 , or 9×10 13In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or fractions within the range. 14 , 2 × 10 14 , 3×10 14 , 4×10 14 , 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , or 9×10 14 In another embodiment, the composition is formulated to contain at least 1 x 10 GC per dose, including all integers or fractions within the range. 15 , 2 × 10 15 , 3×10 15 , 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , or 9×10 15 In one embodiment, for human applications, the dose is 1 x 10 per dose, including all integers or fractions within the range. 10 ~Approx. 1×10 12 It can be in the range of GC.

[0163] In one embodiment, a pharmaceutical composition is provided comprising the rAAV described herein in a formulation buffer. In one embodiment, the rAAV is present in a concentration of about 1 x 10 9 Genome copies (GC) / mL ~ approx. 1 x 10 14 In a further embodiment, the rAAV is formulated at about 3 x 10 GC / mL. 9 GC / mL ~ approx. 3×10 13 In yet a further embodiment, the rAAV is formulated at about 1 x 10 GC / mL. 9 GC / mL ~ approx. 1×10 13 In one embodiment, the rAAV is formulated at a concentration of at least about 1 x 10 GC / mL. 11 In one embodiment, the pharmaceutical composition comprising the rAAV described herein is formulated at about 1 x 10 GC / mL per gram of brain mass. 9 GC ~ approximately 1 × 10 per gram of brain mass14 It is administered in the dose of GC.

[0164] In certain embodiments, the composition can be formulated in a suitable aqueous suspension medium (e.g., buffered saline) for delivery by any suitable route. The compositions provided herein are useful for systemic delivery of high-dose viral vectors. In the case of rAAV, a high dose is at least 1 × 10 13 GC, or at least 1 × 10 14 The miRNA sequences provided herein may be delivered via intravenous (IV) injection. However, for improved safety, the miRNA sequences provided herein may be included in expression cassettes and / or vector genomes delivered at other lower doses. The aqueous suspensions or pharmaceutical compositions described herein are designed to be delivered to a subject in need thereof by any suitable route or combination of different routes. In one embodiment, the pharmaceutical composition is formulated for delivery via intracerebroventricular (ICV), intrathecal (IT), or intracisternal injection. In one embodiment, the compositions described herein are designed for delivery to a subject in need thereof by intravenous (IV) injection. Alternatively, other routes of administration (e.g., In certain embodiments, the composition is delivered by two different routes essentially simultaneously.

[0165] As used herein, the terms "intrathecal delivery" or "intrathecal administration" refer to the route of administration of a drug via injection into the spinal canal, more specifically, by injection into the subarachnoid space to reach the cerebrospinal fluid (CSF). Intrathecal delivery may include lumbar puncture, intraventricular, suboccipital / intracisternal, and / or C1-2 puncture. For example, material may be introduced via lumbar puncture for diffusion throughout the subarachnoid space. In another example, injection may be intracisternal (cisterna magna). Intracisternal delivery may increase vector diffusion and / or reduce toxicity and inflammation caused by administration. See, e.g., Christian Hinderer et al., Widespread gene transfer in the central nervous system. of cynomolgus macaques following delivery of AAV9 into the cisterna magna, Mol Ther Methods Clin Dev. 2014;1:14051. Published online 2014 Dec 10. doi:10.1038 / mtm.2014.51

[0166] As used herein, the term "intracisternal delivery" or "intracisternal administration" refers to the route of administration of a drug directly into the cerebrospinal fluid within the cerebello-medullary cistern, more specifically, by suboccipital puncture, or by direct injection into the cisterna magna, or by a permanently placed tube.

[0167] It is to be understood that the pharmaceutical compositions and compositions in formulations described herein are intended to apply to other compositions, regimens, aspects, embodiments, and methods described throughout this specification.

[0168] Treatment method Provided herein are methods for treating MPS1, Hurler, Hurler-Scheie, and / or Scheie syndromes, comprising delivering a therapeutically effective amount of a described hIDUA. In particular, provided herein are methods for preventing, treating, and / or alleviating neurocognitive decline in patients diagnosed with MPS1, Hurler, Hurler-Scheie, and / or Scheie syndromes, comprising delivering a therapeutically effective amount of a described rAAV.hIDUA to a patient in need thereof. A therapeutically effective amount of a described rAAV.hIDUA vector may correct one or more of the symptoms identified in any one of the following paragraphs.

[0169] Methods for sequencing proteins, peptides, or polypeptides (e.g., immunoglobulins) are known to those skilled in the art. Once the protein sequence is known, there are web-based and commercially available computer programs and service-based companies that will reverse-translate the amino acid sequence into a nucleic acid coding sequence. See, for example, reverse-translated sequences by EMBOSS (available at www.ebi.ac.uk / Tools / st / ), Gene Infinity (available at geneinfinity.org / sms / sms_backtranslation.html), and ExPasy (available at expasy.org / tools / ). In one embodiment, the RNA and / or cDNA coding sequence is designed for optimal expression in human cells.

[0170] In certain embodiments, the compositions provided herein are intended to deliver a desired transgene product to a patient. These compositions are useful for delivering genes to the CNS, while suppressing transgene expression in dorsal root ganglion neurons. In certain embodiments, the compositions provided herein are useful in methods for modulating neurodegeneration and / or reducing secondary dorsal spinal cord axon degeneration after intrathecal or systemic gene therapy administration. Thus, while the compositions provided herein are particularly useful for delivering gene therapy to the CNS, they may also be useful for other delivery routes, including, for example, systemic IV delivery, where high doses of gene therapy can result in DRG transduction and toxicity. The method involves delivering a composition containing an expression cassette or vector genome containing a transgene and an miRNA target to a patient.

[0171] In certain embodiments, the method comprises delivering an expression cassette or vector genome comprising a miR-183 target sequence to suppress the expression level of a transgene in DRG. In certain embodiments, the method comprises delivering an expression cassette or vector genome useful for suppressing transgene expression in DRG, wherein the expression cassette or vector genome comprises at least two miR183 target sequences, at least three miR183 target sequences, at least four miR183 target sequences, at least five miR183 target sequences, at least six miR183 target sequences, at least seven miR183 target sequences, or at least eight miR183 target sequences. In certain embodiments, the method comprises delivering an expression cassette or vector genome useful for suppressing transgene expression in DRG, wherein the expression cassette or vector genome comprises eight miR183 target sequences. In certain embodiments, the method enhances expression in one or more cells present in the CNS selected from one or more of pyramidal neurons, Purkinje neurons, granule cells, spindle neurons, interneurons, astrocytes, oligodendrocytes, microglia, and / or ependymal cells.

[0172] In certain embodiments, methods useful for delivering and / or enhancing expression of a transgene in lower motor neurons of the retina, inner ear, and olfactory receptors are provided, comprising delivering an expression cassette or vector genome comprising a transgene operably linked to one or more miR-183 target sequences and / or multiple miR-183 target sequences. In certain embodiments, the cells or tissues may be one or more of the liver or heart.

[0173] In yet another embodiment, a method is provided that includes delivering an expression cassette or vector genome to cells present in the CNS, wherein the expression cassette or vector genome contains one or more miR-183 target sequences and lacks a transgene (i.e., a sequence encoding a heterologous gene product). In such an embodiment, delivery of miR-183 to cells of the CNS is achieved. In certain embodiments, delivery of an expression cassette or vector genome containing miR-183 sequences results in suppression of DRG expression and enhancement of gene expression in certain other cells present in the CNS.

[0174] In certain embodiments, the compositions provided herein are useful in methods for enhancing expression of a transgene in cells other than the CNS. In certain embodiments, the methods for enhancing expression in cells other than the CNS include delivering to a patient an expression cassette or vector genome comprising a miR-182 target sequence.

[0175] In one embodiment, the suspension has a pH of about 6.8 to about 7.32.

[0176] The appropriate volume and concentration for delivery of these doses can be determined by one skilled in the art. For example, a volume of about 1 μL to 150 mL may be selected, although higher volumes may be selected for adults. Typically, a suitable volume for infants is about 0.5 mL to about 10 mL, and for older infants, about 0.5 mL to about 15 mL may be selected. For infants, about 0.5 mL may be selected. A volume of about 5 mL to about 20 mL may be selected. For children, a volume of up to about 30 mL may be selected. For preteens and teens, a volume of up to about 50 mL may be selected. In yet other embodiments, patients may receive intrathecal administration at a selected volume of about 5 mL to about 15 mL, or about 7.5 mL to about 10 mL. Other suitable volumes and dosages may be determined. Dosages may be adjusted to balance therapeutic benefit against any side effects, and such dosages may vary depending on the therapeutic application for which the recombinant vector is utilized.

[0177] In one embodiment, a composition comprising an rAAV described herein has a concentration of about 1 x 10 per gram of brain mass. 9 GC ~ approximately 1 × 10 per gram of brain mass 14 In a specific embodiment, the rAAV is administered at a dose of about 1 x 10 GC / kg body weight. 9 GC ~ Approximately 1 x 10 per kg of body weight 13 It is administered systemically at the same dose as GC.

[0178] In certain embodiments, a subject is administered a therapeutically effective amount of a composition comprising a nucleic acid sequence encoding a hIDUA gene product and a miRNA target sequence, which delivers and expresses hIDUA in target cells and specifically non-targets DRG expression.

[0179] In certain embodiments, an AAV.alpha-L-iduronidase (AAV.IDUA) gene therapy vector comprises a vector genome comprising at least one, at least two, at least three, or at least four miR target sequences of the miRNA183 cluster (comprising miR-183, miR-182, and miR183 target sequences, or a combination thereof) operably linked to the coding sequence of the IDUA gene (see, e.g., nt 1943-3901 of SEQ ID NO: 14). In certain embodiments, the vector genome comprises multiple copies of the same miR target sequence, each separated by a spacer (which may be the same or different from one another). In another embodiment, the vector genome comprises three to six copies of the miR183 cluster target sequence, and optionally, one or more of the target sequences is at least about 80% to about 99% complementary to a miR-183 cluster member. In another embodiment, the vector comprises one, two, three, or four copies of the miR183 target sequence. Such vector genomes may optionally contain additional target sequences corresponding to members of the miR183 cluster. In certain embodiments, vector genomes contain a single miR target sequence of a miR183 cluster member. In certain embodiments, vector genomes contain two miR target sequences of a miR183 cluster member and, optionally, at least one spacer. In certain embodiments, vectors contain three miR target sequences of a miR183 cluster member and, optionally, at least two spacers. In certain embodiments, vector genomes contain two or more miR target sequences of the miR183 cluster that differ in sequence from each other. In certain embodiments, the vector genomes described herein are carried by non-AAV vectors.

[0180] In one embodiment, the expression cassette is present in the vector genome at a concentration of about 1 x 10 per gram of brain mass, including all integer or fractional amounts within that range and endpoint. 9 GC ~ approximately 1 × 10 per gram of brain mass 13In another embodiment, the dosage is delivered in an amount of 1 x 10 genome copies (GC) per gram of brain mass. 10 GC ~ approximately 1 × 10 per gram of brain mass 13 In certain embodiments, the dose of vector administered to a patient is at least about 1.0 x 10 9 GC / g, approx. 1.5×10 9 GC / g, approx. 2.0×10 9 GC / g, approx. 2.5×10 9 GC / g, approx. 3.0×10 9 GC / g, approx. 3.5×10 9 GC / g, approx. 4.0×10 9 GC / g, approx. 4.5×10 9 GC / g, approx. 5.0×10 9 GC / g, approx. 5.5×10 9 GC / g, approx. 6.0×10 9 GC / g, approx. 6.5×10 9 GC / g, approx. 7.0×10 9 GC / g, approx. 7.5×10 9 GC / g, approx. 8.0×10 9 GC / g, approx. 8.5×10 9 GC / g, approx. 9.0×10 9 GC / g, approx. 9.5×10 9 GC / g, approx. 1.0× 10 10 GC / g, approx. 1.5×10 10 GC / g, approx. 2.0×10 10 GC / g, approx. 2.5×10 10 GC / g, approx. 3.0×10 10 GC / g, approx. 3.5×10 10 GC / g, approx. 4.0×10 10 GC / g, approx. 4.5×10 10 GC / g, approx. 5.0×10 10 GC / g, approx. 5.5×10 10 GC / g, approx. 6.0×10 10 GC / g, approx. 6.5×10 10 GC / g, approx. 7.0×10 10 GC / g, approx. 7.5×10 10 GC / g, approx. 8.0×10 10 GC / g, approx. 8.5×10 10 GC / g, approx. 9.0×1010 GC / g, about 9.5×10 10 GC / g, about 1.0×10 11 GC / g, about 1.5×10 11 GC / g, about 2.0×10 11 GC / g, about 2.5×10 11 GC / g, about 3.0×10 11 GC / g, about 3.5×10 11 GC / g, about 4.0×10 11 GC / g, about 4.5×10 11 GC / g, about 5.0×10 11 GC / g, about 5.5×10 11 GC / g, about 6.0×10 11 GC / g, about 6.5×10 11 GC / g, about 7.0×10 11 GC / g, about 7.5×10 11 GC / g, about 8.0×10 11 GC / g, about 8.5×10 11 GC / g, about 9.0×10 11 GC / g, about 9.5×10 11 GC / g, about 1.0×10 12 GC / g, about 1.5×10 12 GC / g, about 2.0×10 12 GC / g, about 2.5×10 12 GC / g, about 3.0×10 12 GC / g, about 3.5×10 12 GC / g, about 4.0×10 12 GC / g, about 4.5×10 12 GC / g, about 5.0×10 12 GC / g, about 5.5×10 12 GC / g, about 6.0×10 12 GC / g, about 6.5×10 12 GC / g, about 7.0×10 12 GC / g, about 7.5×10 12 GC / g, about 8.0×10 12 GC / g, about 8.5×10 12 GC / g, about 9.0×10 12 GC / g, about 9.5×10 12 GC / g, about 1.0×10 13 GC / g, about 1.5×10 13 GC / g, about 2.0×1013 GC / g, approx. 2.5×10 13 GC / g, approx. 3.0×10 13 GC / g, approx. 3.5×10 13 GC / g, approx. 4.0×10 13 GC / g, approx. 4.5×10 13 GC / g, approx. 5.0×10 13 GC / g, approx. 5.5×10 13 GC / g, approx. 6.0×10 13 GC / g, approx. 6.5×10 13 GC / g, approx. 7.0×10 13 GC / g, approx. 7.5×10 13 GC / g, approx. 8.0×10 13 GC / g, approx. 8.5×10 13 GC / g, approx. 9.0×10 13 GC / g, approx. 9.5×10 13 GC / g, or approximately 1.0 x 10 14 GC / g brain mass.

[0181] In certain embodiments, the miR target sequence-containing compositions provided herein minimize the dose, duration, and / or amount of immunosuppressive combination therapy required by a patient. Currently, immunosuppressive agents for such combination therapy include, but are not limited to, glucocorticoids, steroids, antimetabolites, T-cell inhibitors, macrolides (e.g., rapamycin or rapalogs), and cytostatic agents (including alkylating agents), antimetabolites, cytotoxic antibiotics, antibodies, and agents active against immunophilins. Immunosuppressants may include nitrogen mustards, nitrosoureas, platinum compounds, methotrexate, azathioprine, mercaptopurine, fluorouracil, dactinomycin, anthracyclines, mitomycin C, bleomycin, mithramycin, IL-2 receptor (CD25)-directed antibodies or CD3-directed antibodies, anti-IL-2 antibodies, cyclosporine, tacrolimus, sirolimus, IFN-β, IFN-γ, opioids, or TNF-α (tumor necrosis factor-α) binders. In certain embodiments, immunosuppressive therapy may be initiated 0, 1, 2, 7, or more days prior to gene therapy administration. Such therapy may involve the simultaneous administration of two or more drugs (e.g., prednisone, mycophenolate mofetil (MMF), and / or sirolimus (i.e., rapamycin)) on the same day. One or more of these drugs may be continued after gene therapy administration, at the same or adjusted doses. In certain embodiments, the miR target sequence-containing compositions provided herein eliminate the need for immunosuppressive therapy before, during, or after delivery of a gene therapy (e.g., rAAV) vector.

[0182] In one embodiment, a composition comprising an expression cassette described herein is administered once to a subject in need thereof. In a specific embodiment, the expression cassette is delivered via rAAV.

[0183] Candidates for treatment include pediatric and adult patients with MPS1 and / or symptoms associated with Hurler, Hurler-Scheie, and Scheie syndromes. MPS1 disorders span a spectrum of disease, ranging from early-onset (Hurler) to late-onset (Scheie) forms. Hurler syndrome is typically characterized by the absence of IDUA enzyme activity (0%), is diagnosed early, and is characterized by developmental delay in the first decade of life, hepatosplenomegaly, skeletal lesions, corneal opacities, joint lesions, hearing loss, cardiac involvement, and death. Hurler-Scheie patients have some IDUA enzyme activity (greater than 0%, but typically less than 2%) and have been observed to have fluctuating intellectual impact, respiratory disease, obstructive airway disease, cardiovascular disease, joint stiffness / constriction, skeletal abnormalities, decreased vision, and death in their teens and twenties. Patients with Scheie syndrome typically have at least 2% of "normal" IDUA enzyme activity and are diagnosed later in life. Such patients typically have normal intelligence but have hepatosplenomegaly, joint involvement, nerve entrapment, hearing loss, cardiac involvement, and a normal life span. See also Newborn Screening for Mucopolysaccharidosis Type 1 (MPS I): A Systematic Review of Evidence Report of Final Findings, Final Version 1.1, Prepared for: MATERNAL AND CHILD HEALTH BUREAU.

[0184] The compositions provided herein avoid the complications of long-term enzyme replacement therapy (ERT) associated with immune responses to the recombinant enzyme (ranging from mild to severe anaphylaxis), as well as lifelong peripheral complications such as local and systemic infections. In contrast to ERT, the compositions of the present invention do not require lifelong weekly injections. Without intending to be bound by theory, the therapeutic methods described herein are believed to be useful for at least correcting central nervous system phenotypes associated with MPS1 disorders by providing efficient, long-term gene transfer conferred by vectors with high transduction efficiency, providing continuous, high circulating IDUA levels that provide therapeutic efficacy outside the CNS compartment. Additionally, methods are provided herein for providing active tolerance and preventing antibody formation against the enzyme by various routes, including direct systemic delivery of the enzyme in protein form or in the form of rAAV.hIDUA prior to AAV-mediated delivery to the CNS.

[0185] In some embodiments, patients diagnosed with Hurler syndrome are treated according to the methods described herein. In some embodiments, patients diagnosed with Hurler-Scheie syndrome are treated according to the methods described herein. In some embodiments, patients diagnosed with Scheie syndrome are treated according to the methods described herein. In some embodiments, pediatric subjects with MPS I who have neurocognitive deficits are treated according to the methods described herein.

[0186] In certain embodiments, newborns (3 months of age or younger) are treated according to the methods described herein. In certain embodiments, infants 3 to 9 months of age are treated according to the methods described herein. In certain embodiments, children 9 to 36 months of age are treated according to the methods described herein. In certain embodiments, children 3 to 12 years of age are treated according to the methods described herein. In certain embodiments, children 12 to 18 years of age are treated according to the methods described herein. In certain embodiments, adults 18 years of age or older are treated according to the methods described herein.

[0187] In one embodiment, the patient may have Hurler syndrome and may be a male or female infant at least about 3 months to less than 12 months of age. In another embodiment, the patient may be a male or female Hurler-Scheie patient and may be at least about 6 years of age to a maximum of 18 years of age. In other embodiments, the subject may be older or younger, and may be male. It can be either male or female.

[0188] Suitably, patients selected for treatment may include those with one or more of the following characteristics: a documented diagnosis of MPS I confirmed by absent or reduced IDUA enzyme activity as measured in plasma, fibroblasts, or leukocytes, and, if not explained by any other neurological or psychiatric factors, documentation of an early neurocognitive deficit attributable to MPS I, defined as any of the following: - a score one standard deviation below the mean on an IQ test, or in one area of ​​neuropsychological function (language, memory, attention, or nonverbal abilities), or - medical history documentation of a decline of more than one standard deviation on consecutive tests. Alternatively, increased GAGs in urine or genetic testing may be used. Prior to treatment, subjects, e.g., infants, preferably undergo genotyping to identify MPS I patients, i.e., patients with mutations in the gene encoding hIDUA. Prior to treatment, MPS I patients can be evaluated for neutralizing antibodies (Nab) against the AAV serotype used to deliver the hIDUA gene. In certain embodiments, MPS1 patients with neutralizing antibody titers to AAV of 5 or less are treated according to any one or more of the methods described herein.

[0189] Prior to treatment, MPS1 patients can be assessed for neutralizing antibodies (NABs) against the capsid of the AAV vector used to deliver the hIDUA gene. Such NABs can interfere with transduction efficiency and reduce treatment efficacy. MPS1 patients with baseline serum NAB titers ≤ 1:5 are good candidates for treatment with rAAV.hIDUA gene therapy protocols. Treatment of MPS1 patients with serum NAB titers > 1:5 may require combination therapy, e.g., temporary combination therapy with immunosuppressants, before and / or during treatment with rAAV.hIDUA vector delivery. Optionally, immunosuppressive combination therapy may be used as a preventative measure without prior assessment of neutralizing antibodies against the AAV vector capsid and / or other components of the formulation. Prior immunosuppressive therapy may be desirable to prevent potential adverse immune responses to the hIDUA transgene product, particularly in patients with substantially no IDUA activity levels, and the transgene product may be considered "foreign." The results of nonclinical studies in mice, dogs, and NHPs described below are consistent with the development of an immune response and neuroinflammation to hIDUA. Although a similar response may not occur in human subjects, as a precautionary measure, immunosuppressive therapy is recommended for all recipients of rAAV.hIDUA.

[0190] Immunosuppressants for such combination therapy include, but are not limited to, glucocorticoids, steroids, antimetabolites, T-cell inhibitors, macrolides (e.g., rapamycin or rapalogs), and cytostatic agents (including alkylating agents), antimetabolites, cytotoxic antibiotics, antibodies, and substances active against immunophilins. Immunosuppressants may include nitrogen mustards, nitrosoureas, platinum compounds, methotrexate, azathioprine, mercaptopurine, fluorouracil, dactinomycin, anthracyclines, mitomycin C, bleomycin, mithramycin, IL-2 receptor (CD25)-directed antibodies or CD3-directed antibodies, anti-IL-2 antibodies, cyclosporine, tacrolimus, sirolimus, IFN-β, IFN-γ, opioids, or TNF-α (tumor necrosis factor-α) binding agents. In certain embodiments, immunosuppressive therapy may be initiated 0, 1, 2, 7, or more days prior to gene therapy administration. Such therapy may involve the simultaneous administration of two or more drugs (e.g., prednisone, mycophenolate mofetil (MMF) and / or sirolimus (i.e., rapamycin)) on the same day. One or more of these drugs may be continued after gene therapy administration, at the same or adjusted doses. Such therapy may be for about 1 week (7 days), about 60 days, or longer, as needed. In certain embodiments, a tacrolimus-free regimen is selected.

[0191] Nevertheless, in one embodiment, patients with one or more of the following characteristics may be excluded from treatment at the discretion of the patient's physician: o Review of baseline MRI studies will indicate contraindications for IC injection. o History of previous head / neck surgery, which poses a contraindication to IC injection. - Have any contraindications to CT (or contrast) or general anesthesia. - Any contraindication to MRI (or gadolinium). ○Having an estimated glomerular filtration rate (eGFR) < 30 mL / min / 1.73 m2 - Have a diagnosis of any neurocognitive deficit or neuropsychiatric condition not attributable to MPS I. - History of any hypersensitivity reaction to sirolimus, MMF, or prednisone. Any condition inappropriate for immunosuppressive therapy (e.g., absolute neutrophil count <1.3 x 10 3 / μL, platelet count <100×10 3 / μL, and hemoglobin <12 g / dL [men] or <10 g / dL [women]). -Having any contraindication to lumbar puncture - Undergoing HSCT. - Received IT laronidase within 6 months prior to treatment. Have received IT laronidase at any time and experienced a significant adverse event thought to be related to IT administration that could have placed the patient in a dangerous situation. Any history of lymphoma or another cancer other than squamous cell or basal cell carcinoma of the skin that has not been in complete remission for at least 3 months prior to treatment. Alanine aminotransferase (ALT) or aspartate aminotransferase (AST) >3 x upper limit of normal (ULN), or total bilirubin >1.5 x ULN, unless the patient has a previously known history of Gilbert's syndrome and a fractionated bilirubin showing conjugated bilirubin less than 35% of total bilirubin. History of a positive test for human immunodeficiency virus (HIV), a history of active or recurrent hepatitis B or C, or a positive screening test for hepatitis B, hepatitis C, or HIV. Pregnant, less than 6 weeks postpartum, breastfeeding, or planning to become pregnant (you or your partner) - History of alcohol or drug abuse within one year prior to treatment. o Have a serious or unstable medical or psychological condition that may compromise patient safety. Uncontrolled seizures.

[0192] In other embodiments, the treating physician may determine that the presence of one or more of these physical characteristics (medical history) should not interfere with treatment as provided herein.

[0193] It is to be understood that the compositions in the methods described herein are intended to apply to other compositions, regimens, aspects, embodiments, and methods described throughout the specification.

[0194] Dosage and Route of Administration Pharmaceutical compositions suitable for administration to a patient include a suspension of the rAAV.hIDUA vector in a formulation buffer comprising a physiologically compatible aqueous buffer, a surfactant, and optional excipients. In certain embodiments, the pharmaceutical compositions described herein are administered intrathecally. In other embodiments, the pharmaceutical compositions described herein are administered intracisternally. In other embodiments, the pharmaceutical compositions described herein are administered intravenously. In certain embodiments, The pharmaceutical composition is delivered via a peripheral vein by infusion over a period of 20 minutes (±5 minutes). However, this time may be adjusted as needed or desired. However, other administration routes may also be selected. Alternatively or additionally, administration routes may be combined if desired.

[0195] Although a single administration of rAAV is expected to be effective, administration may be repeated (e.g., quarterly, semiannually, annually, or other times as needed, particularly in the treatment of neonates). Optionally, an initial therapeutically effective dose may be delivered in divided infusion / injection sessions, taking into account the age and ability of the subject to tolerate the infusion / injection. However, repeated weekly injections of the full therapeutic dose are not required, which benefits the patient in terms of both comfort and therapeutic outcome.

[0196] In some embodiments, the rAAV suspension comprises at least 1 x 10 9The rAAV genome copy (GC) titer is GC / mL. In certain embodiments, the empty / filled particle ratio of rAAV in the rAAV suspension is 0.01-0.05 (95%-99% free of empty capsids). In some embodiments, MPS1 patients in need thereof receive at least about 4 x 10 8 GC / g brain mass ~ approx. 4x10 11 The mice are administered a dose of rAAV suspension of GC / g brain mass.

[0197] The following therapeutically effective fixed doses of rAAV.hIDUA can be administered to MPS1 patients in the indicated age groups: Newborn: approx. 3.8 x 10 12 ~Approx. 1.9×10 14 G.C., ○3 to 9 months: approx. 6 x 10 12 ~Approx. 3×10 14 G.C., ○9~36 months: Approx. 10 13 ~Approx. 5×10 14 G.C., ○3 to 12 years old: approx. 1.2 x 10 13 ~about 6×10 14 G.C., ○ 12 years old and over: approx. 1.4 x 10 13 ~Approx. 7.0×10 14 G.C., Adults aged 18 and over: approx. 1.4 x 10 13 ~Approx. 7.0×10 14 G.C.

[0198] In some embodiments, the dose administered to patients aged 12 years and older with an MPS I (including 18 years and older) is 1.4 x 10 13 Genome copies (GC) (1.1 × 10 10 In some embodiments, the dose administered to patients 12 years of age or older with an MPS I (including those 18 years of age or older) is 7×10 13 GC(5.6×10 10 In yet a further embodiment, the dose administered to a patient with an MPS I is at least about 4x10 8 GC / g brain mass ~ approx. 4x10 11GC / g brain mass. In certain embodiments, the dose administered to MPS1 newborns is about 1.4x10 11 ~Approx. 1.4x10 14 The dose administered to infants aged 3 to 9 months is approximately 2.4 x 10 11 ~about 2.4x10 14 The dose administered to MPS1 children aged 9–36 months is approximately 4×10 11 ~about 4x10 14 The dose administered to MPS1 children aged 3–12 years is approximately 4.8×10 11 ~about 4.8x10 14 The dose administered to children aged 12 years and older and adults is approximately 5.6x10 11 ~Approx. 5.6x10 14 This is the scope of GC.

[0199] Appropriate volumes and concentrations for delivery of these doses can be determined by one skilled in the art. For example, a volume of about 1 μL to 150 mL may be selected, although higher volumes may be selected for adults. Typically, a suitable volume for newborns is about 0.5 mL to about 10 mL, and for older infants, about 0.5 mL to about 15 mL. For toddlers, a volume of about 0.5 mL to about 20 mL may be selected. For children, a volume of up to about 30 mL may be selected. For preteens and teens, a volume of up to about 50 mL may be selected. In yet other embodiments, patients may receive intrathecal administration at a selected volume of about 5 mL to about 15 mL, or about 7.5 mL to about 10 mL. Other suitable volumes and dosages may be determined. The dosage may be adjusted to balance the therapeutic benefit against any side effects. Such dosages may vary depending on the therapeutic application for which the recombinant vector is employed.

[0200] In one embodiment for intrathecal delivery, the patient is an adult subject and the dose is about 1 x 10 8 GC~5×10 14 In another embodiment, the dose is about 3.8 x 10 12 ~Approx. 1.9×10 14In a further embodiment, the patient is an infant subject at least about 3 months and up to 12 months of age with Hurler syndrome, and the dose is at least 4 x 10 8 GC rAAV.hIDUA / g brain mass ~3 x 10 12 In another embodiment, the patient is a child with Hurler-Scheie syndrome, at least about 6 years of age and up to 18 years of age, and the dose is at least 4 x 10 8 GC rAAV.hIDUA / g brain mass ~3 x 10 12 Contains the equivalent of GC rAAV.hIDUA / g brain mass.

[0201] Efficacy Monitoring The effectiveness of therapy can be measured by (a) preventing neurocognitive decline in patients with MPS I, and (b) reducing disease biomarkers, such as GAG levels and / or enzyme activity in CSF, serum and / or urine, and / or liver and spleen volume.Neurocognition can be determined by measuring intelligence quotient (IQ), for example, as measured by the Bayley's Infantile Development Scale for Hurler subjects, or by the Wechsler Abbreviated Scale of Intelligence (WASI) for Hurler-Scheie subjects.Other appropriate measures of neurocognitive development and function can be utilized, such as, for example, using the Bayley Scales of Infant Development (BSID-III) to assess developmental quotient (DQ), using the Hopkins Verbal Learning Test, and / or using Tests of Variables of Attention (TOVA) to assess memory.Other neuropsychological functions, such as adaptive behavior scales, visual processing, fine motor skills, communication, social skills, daily living abilities, and emotional and behavioral health, can be monitored. Brain magnetic resonance imaging (MRI), diffusion tensor imaging (DTI) to obtain volumetric measurements and resting-state data, echographic median nerve cross-sectional area, improvement in spinal cord compression, safety, liver size, and spleen size will also be performed.

[0202] Optionally, other measures of efficacy may include assessment of biomarkers (e.g., polyamines described herein) and clinical outcomes. Urine is assessed for total GAG content, GAG relative to creatinine concentration, and MPSI-specific pGAG. Serum and / or plasma are assessed for IDUA activity, anti-IDUA antibodies, pGAG, and heparin cofactor II-thrombin complex concentrations, and inflammatory markers. CSF is assessed for IDUA activity, anti-IDUA antibodies, hexosaminidase (hex) activity, and pGAG (e.g., heparan sulfate and dermatan sulfate). The presence of neutralizing antibodies against the vector and binding antibodies against anti-IDUA antibodies may be assessed in CSF and serum. T cell responses to the vector capsid or hIDUA transgene product may be assessed by ELISPOT assay. Pharmacokinetics of IDUA expression and vector concentration in CSF, serum, and urine may also be monitored.

[0203] The combination of gene therapy delivery of rAAV.hIDUA to the CNS with systemic delivery of hIDUA is encompassed by the methods of the invention. Systemic delivery can be achieved using ERT (e.g., using Aldurazyme®) or using additional gene therapy with rAAV.hIDUA with liver tropism (e.g., rAAV.hIDUA with an AAV68 capsid).

[0204] Further measures of clinical efficacy related to systemic delivery include, for example, orthopedic measurements such as bone mineral density, bone mineral content, bone geometry and bone strength, bone mineral density measured by dual-energy X-ray absorptiometry (DXA), height (standing height / lying length for age Z-score), markers of bone turnover: serum osteocalcin (OCN) and bone-specific alkaline phosphatase (BSAP), measurements of carboxy-terminal telopeptide of type I collagen (ICTP) and carboxy-terminal telopeptide alpha 1 chain of type I collagen (CTX), flexibility and strength: including a 6-minute walk test, Biodex and Physical Therapy assessment (assessing knee and elbow strength for each participant using a Biodex III isokinetic strength testing system), Active Joint Range of Motion (ROM), Child Health Assessment Questionnaire / Health Assessment Questionnaire (CHAQ / HAQ) Disability Index Score, Electromyographic (EMG) and / or Oxygen Index to monitor an individual's cardiopulmonary exercise. May include utilization, peak oxygen uptake during exercise testing (VO2 peak), Apnea / Hypopnea Index (AHI), Forced Vital Capacity (FVC), and Left Ventricular Mass (LVM).

[0205] In certain embodiments, methods are provided for diagnosing and / or treating or monitoring the treatment of an MPS I in a patient, the methods involving obtaining a cerebrospinal fluid or plasma sample from a human patient suspected of having an MPS I as provided herein, detecting a spermine concentration level in the sample, diagnosing the patient with a mucopolysaccharidosis selected from MPS I in patients with spermine concentrations greater than 1 ng / mL, and delivering an effective amount of human alpha-L-iduronidase (hIDUA) to the diagnosed patient, e.g., using a device described herein, as provided herein.

[0206] In another embodiment, the method involves monitoring and adjusting MPS1 therapy. Such a method involves collecting a cerebrospinal fluid or plasma sample from a human patient undergoing therapy for MPS1, detecting spermine concentration levels in the sample by performing mass spectrometry, and adjusting the dosage level of a MPS1 therapeutic agent. For example, a "normal" human spermine concentration is about 1 ng / mL or less in cerebrospinal fluid. However, patients with untreated MPS1 may have spermine concentration levels of 2 ng / mL up to about 100 ng / mL. If the patient has levels approaching normal levels, the dosage of any concomitant ERT may be reduced. Conversely, if the patient has higher than desired spermine levels, the patient may be provided with a higher dose or additional therapy (e.g., ERT).

[0207] Spermine concentrations can be measured using an appropriate assay. See, for example, J. Sanchez-Lopez, et al., "Underivatives for polyamine analysis in plant samples by ion pair." liquid chromatography coupled with electrospray tandem mass spectrometry,”Plant Physiology and Biochemistry, 47(2009):592-598, available online 28 Feb 2009. MR Hakkinen et al., “Analysis of underivatized polyamines by reversed phase liquid chromatography with electrospray tandem mass spectrometry”, J Pharm Biomec Analysis, 44(2007):625-634. Quantitative isotope dilution liquid chromatography assay. - (LC) / mass spectrometry (MS) assay. Other suitable assays may also be used.

[0208] In some embodiments, the efficacy of a therapeutic agent described herein is measured by assessing neurocognition at 52 weeks post-administration in pediatric subjects with MPS I who have early neurocognitive deficits. In some embodiments, the efficacy of a therapeutic agent described herein is measured by assessing the relationship of CSF glycosaminoglycans (GAGs) to neurocognition in patients with MPS I. In some embodiments, the efficacy of a therapeutic agent described herein is measured by assessing the effect of the therapeutic agent on physical changes to the CNS in patients with MPS I, as measured by magnetic resonance imaging (MRI), e.g., volumetric analysis of gray and white matter and CSF ventricles. In some embodiments, the efficacy of a therapeutic agent described herein is measured by assessing the pharmacodynamic effect of the therapeutic agent on biomarkers (e.g., GAGs, HS) in the cerebrospinal fluid (CSF), serum, and urine of patients with MPS I. In some embodiments, the efficacy of a therapeutic agent described herein is measured by assessing the impact of the therapeutic agent on the quality of life (QOL) of patients with MPS I. In some embodiments, the efficacy of a therapeutic agent described herein is measured by assessing the impact of the therapeutic agent on motor function of patients with MPS I. In some embodiments, the efficacy of the therapeutic agents described herein is measured by assessing the effect of the therapeutic agent on growth and developmental milestones in patients with MPS1.

[0209] When expressed from the rAAV vectors described herein, an expression level of at least about 2% detected in CSF, serum, or other tissues can provide a therapeutic effect. However, higher expression levels can be achieved. Such expression levels can be from 2% to about 100% of normal functional human IDUA levels. In certain embodiments, higher than normal expression levels can be detected in CSF, serum, or other tissues.

[0210] In certain embodiments, the methods of treating, preventing, and / or alleviating MPS I and / or symptoms thereof described herein result in a significant increase in intelligence quotient (IQ) in treated patients as assessed by the Bayley's Infantile Development Scale for Hurler subjects. In certain embodiments, the methods of treating, preventing, and / or alleviating MPS I and / or symptoms thereof described herein result in a significant increase in neurocognitive IQ in treated patients as measured by the Wechsler Abbreviated Scale of Intelligence (WASI) for Hurler-Scheie subjects. In certain embodiments, the methods of treating, preventing, and / or alleviating MPS I and / or symptoms thereof described herein result in a significant increase in neurocognitive DQ in treated patients as assessed using the Bayley Scales of Infant Development.

[0211] In certain embodiments, the methods of treating, preventing, and / or alleviating MPS I and / or symptoms thereof described herein result in a significant increase in functional human IDUA levels. In certain embodiments, the methods of treating, preventing, and / or alleviating MPS I and / or symptoms thereof described herein result in a significant decrease in GAG levels as measured in a patient's serum, urine, and / or cerebrospinal fluid (CSF) samples.

[0212] Combination therapy The combination of gene therapy delivery of rAAV.hIDUA to the CNS with systemic delivery of hIDUA is encompassed by the methods of the invention. Systemic delivery can be achieved using ERT (e.g., using Aldurazyme®) or using additional gene therapy with rAAV.hIDUA.

[0213] In certain embodiments, intrathecal administration of rAAV.hIDUA is co-administered with a second AAV.hIDUA injection, e.g., directed to the liver. In such cases, the vectors can be the same. For example, the vectors can have the same capsid and / or the same vector genome sequence. Alternatively, the vectors can be different. For example, each of the vector stocks can be designed to have different regulatory sequences (e.g., each with a different tissue-specific promoter), e.g., a liver-specific promoter and a CNS-specific promoter. Additionally or alternatively, each of the vector stocks can have a different capsid. For example, a liver-directed vector stock can have a capsid selected from, among others, AAV8, AAVhu68, AAV9, AAVrh91, AAVrh64R1, AAVrh64R2, AAVrh8, AAVrh10, AAV3B, or AAVdj. In such a regimen, the dose of each vector stock is adjusted so that the total amount of vector delivered intrathecally is approximately 1 × 10 8 GC~×1×10 14 In other embodiments, the combined vector delivered by both routes may be adjusted to be within the range of 1×10 11 ~1×10 16 Alternatively, each vector may contain approximately 10 8 GC~about 10 12 Such doses may be administered at substantially the same time or at different times, for example, about 1 day to about 12 weeks apart, or about 3 days to about 30 days apart, or at other suitable times.

[0214] In some embodiments, patients are co-administered rAAV.hIDUA via liver-directed and intrathecal injection. In some embodiments, a method for treatment comprises (a) administering to a patient having symptoms associated with MPS I and / or Hurler, Hurler-Scheie, and Scheie syndromes a sufficient amount of hIDUA enzyme or liver-directed rAAV-hIDUA to induce transgene-specific tolerance, and (b) administering rAAV.hIDUA to the patient's CNS, wherein the rAAV-hIDUA directs expression of therapeutic levels of hIDUA in the patient.

[0215] In further embodiments, methods are provided for treating human patients with symptoms associated with MPS I and / or Hurler, Hurler-Scheie, and Scheie syndromes, involving tolerizing the patient with a sufficient amount of hIDUA enzyme or liver-directed rAAV-hIDUA to induce transgene-specific tolerance, followed by CNS-mediated rAAV-mediated delivery of hIDUA to the patient. In certain embodiments, the patient is administered rAAV.hIDUA by liver-directed injection to tolerize the patient to hIDUA, e.g., if the patient is under 4 weeks of age (neonatal stage) or an infant, and subsequently administered rAAV.hIDUA by intrathecal injection to develop therapeutic concentrations of hIDUA in the CNS if the patient is an infant, child, and / or adult.

[0216] In one example, a patient with MPS I is tolerized by delivering hIDUA to the patient within about two weeks of birth, e.g., within about 0 to about 14 days, or within about 1 to about 12 days, or about 3 to about 10 days, or about 5 to about 8 days, i.e., when the patient is a newborn. In other embodiments, older infants may be selected. The tolerizing dose of hIDUA may be delivered by rAAV. However, in another embodiment, the dose is delivered by direct delivery of the enzyme (enzyme replacement therapy). Methods for producing recombinant hIDUA in Chinese hamster ovary (CHO) cells and soluble rhIDUA in tobacco cells [LH Fu, et al, Plant Science (Impact Factor: 3.61). 12 / 2009; 177(6): 668-675] or plant seeds [X He et al, Plant Biotechnol J. 2013 Dec; 11(9): 1034-1043] have been described in the literature.

[0217] Additionally, recombinant hIDUA is commercially produced as Aldurazyme® (laronidase), and a fusion protein of an anti-human insulin receptor monoclonal antibody and alpha-L-iduronidase [AGT-181, ArmaGen, Inc.] may be useful. Although not currently preferred, the enzyme may be delivered via "naked" DNA, RNA, or another suitable vector. In one embodiment, the enzyme is delivered intravenously and / or intrathecally to the patient. In another embodiment, another route of administration is used (e.g., intramuscularly, subcutaneously, etc.). In one embodiment, MPS1 patients selected for tolerization are unable to express any detectable amounts of hIDUA before initiating the tolerization dose. When recombinant human IDUA enzyme is delivered, intrathecal rhIDUA injections may consist of about 0.58 mg / kg body weight or about 0.25 mg to about 2 mg total rhIDUA per injection (e.g., intravenously or intrathecally). For example, 3 cc of enzyme (e.g., approximately 1.74 mg of Aldurazyme® (laronidase)) was diluted with 6 cc of Elliotts B® solution for a total injection of 9 cc. Alternatively, higher or lower doses are selected. Similarly, if expressed from a vector, lower expressed protein levels can be delivered. In one embodiment, the amount of hIDUA delivered for tolerization is less than the therapeutically effective amount. However, other doses may be selected.

[0218] Typically, the therapeutic dose is delivered to the subject after administration of the tolerizing dose, e.g., within about 3 days to about 6 months after the tolerizing dose, more preferably within about 7 days to about 1 month after the tolerizing dose, although other time points within these ranges may be selected, as may longer or shorter waiting periods.

[0219] Alternatively, immunosuppressive therapy may be administered in addition to the vector before, during, and / or after vector administration. Immunosuppressive therapy may include prednisolone, mycophenolate mofetil (MMF), and tacrolimus or sirolimus, as described above. The tacrolimus-free regimens described below may be preferred.

[0220] kit In certain embodiments, kits are provided that include a concentrated expression cassette (e.g., a viral or non-viral vector) suspended in a formulation (optionally frozen), an optional dilution buffer, and devices and components required for intrathecal, intraventricular, or intracisternal administration. In another embodiment, the kit may additionally or alternatively include components for intravenous delivery. In one embodiment, the kit provides sufficient buffer to allow injection. Such a buffer may allow for approximately a 1:1 to 1:5 dilution of the concentrated vector, or greater. In other embodiments, larger or smaller volumes of buffer or sterile water are included to allow for dose titration and other adjustments by the treating physician. In yet other embodiments, the kit includes one or more components of the device. Suitable dilution buffers, such as saline, phosphate-buffered saline (PBS), or glycerol / PBS, are available.

[0221] It is to be understood that the compositions in the kits described herein are intended to apply to the other compositions, regimens, aspects, embodiments, and methods described throughout this specification.

[0222] device In one aspect, the compositions provided herein can be administered intrathecally via, for example, the methods and / or devices described in WO2017 / 136500, which is incorporated herein by reference in its entirety. In summary, the method includes the steps of advancing a spinal needle into a patient's cisterna magna, connecting a length of flexible tubing to the proximal hub of the spinal needle and connecting the outlet port of a valve to the proximal end of the flexible tubing, and dispensing the valve during the advancing and connecting steps. After pumping, the tube is allowed to self-prime with the patient's cerebrospinal fluid, and then a step of connecting a first container containing a quantity of isotonic solution to the flush inlet port of the valve, and then a step of connecting a second container containing a quantity of pharmaceutical composition to the vector inlet port of the valve. After connecting the first and second containers to the valve, a passage for fluid flow is opened between the vector inlet port and the outlet port of the valve, and the pharmaceutical composition is injected into the patient through the spinal needle. After injection of the pharmaceutical composition, a passage for fluid flow is opened through the flush inlet port and the outlet port of the valve, and an isotonic solution is injected into the spinal needle to flush the pharmaceutical composition into the patient. This method and device can each optionally be used for intrathecal delivery of the compositions provided herein. Alternatively, other methods and devices can be used for such intrathecal delivery.

[0223] It is to be understood that the compositions in the devices described herein are intended to apply to the other compositions, regimens, aspects, embodiments, and methods described throughout this specification. [Example]

[0224] The present invention will now be described with reference to the following examples, which are provided for illustrative purposes only and should in no way be construed as limiting the invention to these examples, but rather as encompassing any and all variations that become evident as a result of the teachings provided herein.

[0225] Example 1: Materials and Methods: animal All animal procedures were approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania. Rhesus macaques (Macaca mulatta) were procured from Covance Research Products, Inc. and Primgen / Prelabs Primates. Animals were kept under the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC) International-accredited Nonhuman Primate Research Program. The animals were housed in stainless steel squeeze-back cages at the University of Pennsylvania Gene Therapy Program facility. They received various enrichments, including food, visual and auditory stimulation, handling, and social interaction. C56BL / 6J mice (stock #000664) were purchased from the Jackson Laboratory. Animals were housed in standard cages, 2–5 per cage, with enrichment (Nestlets) in an AAALAC-accredited mouse barrier vivarium at the University of Pennsylvania Gene Therapy Program. Cages, water bottles, and bedding in the barrier facility were autoclaved, and cages were changed weekly. An automated 12-hour light-dark cycle was maintained. Each dark period began at 19:00 (±30 min). Irradiated laboratory rodent chow was provided ad libitum.

[0226] Animals were visually monitored daily by animal care and / or veterinary staff for any conditions requiring possible intervention. This included monitoring the animals' general appearance for signs of toxicity, distress, and / or behavioral changes. At selected study time points, animals were also monitored for additional parameters, including, but not limited to, vital signs, and blood was collected for clinical pathology. All animals enrolled in the described studies had neurological evaluations up to monthly. Neurological examinations included cage-side assessments of mental status, posture, proprioception, and gait, as well as cranial nerves, motor strength, and The tests included restrained assessment of muscle tone and reflexes. Animals were observed daily by animal husbandry staff for signs of pain or discomfort, including changes in behavior or significant changes in appetite. Any clinical abnormalities were reported to the study veterinarian and study director, and none were suspected to be related to the administration of the test substance.

[0227] vector The AAV9.PHP.B transfection plasmid (pAAV2 / PHP.B) was generated using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, catalog number 210515) according to the manufacturer's instructions, using pAAV2 / 9 as a template. The AAV vector was produced and titrated as previously described (37). Briefly, HEK293 cells were transfected in triplicate, and the culture supernatant was collected, concentrated, and purified on an iodixanol gradient. The purified vector was titrated by droplet digital PCR using primers targeting the rabbit beta-globin poly(A) sequence, as previously described (38). An engineered sequence encoding human alpha-L-iduronidase (hIDUA) was cloned under the CB7 promoter. MicroRNA sequences were obtained from the public database mirbase.org (Hsa-mir-183 MI0000273, Hsa-mir-182 MI0000272, Hsa-mir-96 MI0000098, Hsa-mir-145 MI0000461). Four tandem repeats of targets of DRG-enriched miRs were cloned into the 3' untranslated region (UTR) of green fluorescent protein (GFP) or hIDUA cis plasmids.

[0228] In vivo studies and histology mouse Mice were treated with 1 × 10 in 0.1 mL of PBS (vehicle) with or without DRG-miR targets. 12 Genome copies (GC, 5 × 10 13 GC / kg) of AAV-PHP.B, or 4 × 10 12 GC(2×10 14Mice received an AAV9 vector encoding enhanced GFP (1000 mg / kg) via the lateral tail vein and were euthanized by CO2 inhalation 21 days after injection. Tissues, including the brain, were rapidly harvested and immersion-fixed in 10% neutral-buffered formalin for approximately 24 hours, briefly washed in phosphate-buffered saline (PBS), and sequentially equilibrated at 4°C with 15% and 30% sucrose in PBS. Tissues were then frozen in embedding medium at optimal cutting temperature and cryosectioned for direct GFP visualization (brains were sectioned at 30 μm, and other tissues were sectioned at 8 μm thickness). Images were acquired using a Nikon Eclipse Ti-E fluorescence microscope. GFP expression in DRGs was analyzed by immunohistochemistry (IHC). Spinal columns containing DRGs were fixed in formalin for 24 hours, decalcified in 10% ethylenediaminetetraacetic acid (pH 7.5) until soft, and embedded in paraffin according to standard protocols. Sections were deparaffinized through an ethanol and xylene series, boiled in 10 mM citrate buffer (pH 6.0) for 6 minutes for antigen retrieval, and sequentially blocked with 2% HO (15 minutes), avidin / biotin blocking reagent (15 minutes each, Vector Laboratories), and blocking buffer (1% donkey serum + 0.2% Triton in PBS, 10 minutes). They were then incubated with primary antibody diluted in blocking buffer (37°C for 1 hour) and biotinylated secondary antibody (1:500 dilution, Jackson ImmunoResearch) for 45 minutes. A rabbit antibody against GFP was used as the primary antibody (NB600-308, Novus Biologicals, 1:500 dilution). The Vectastain Elite ABC kit (Vector Laboratories), using DAB as a substrate, allowed visualization of bound antibodies as a brown precipitate.

[0229] Non-human primates (NHPs) NHPs are 3.5 x 10 13 AAVhu68.GFP vector for GC, or 1 x 10 13GCs received the AAVhu68.hIDUA vector in a total volume of 1 mL of sterile artificial CSF (vehicle) injected into the cisterna magna under fluoroscopic guidance, as previously described (40). Periodic blood draws and cerebrospinal fluid (CSF) taps were performed for safety readouts. Serum chemistry, hematology, coagulation, and CSF analysis were performed at a contract facility, Antech. The study was performed by the National Institute of Neurosciences, Inc. Animals were euthanized with an intravenous pentobarbital overdose and necropsied. Tissues were then collected for comprehensive histopathological examination. Recovered tissues were immediately fixed in formalin and embedded in paraffin. For histopathological examination, tissue sections were stained with hematoxylin and eosin according to standard protocols. IHC for GFP expression was performed as described in the mouse study, but using a different antibody against GFP (goat antibody NB100-1770, Novus Biologicals, 1:500 dilution, overnight incubation at 4°C). Immunostaining for hIDUA was performed using a sheep antibody against hIDUA (AF4119, R&D Systems, 1:200 dilution) according to the protocol described above for IHC. Additionally, sections were stained for hIDUA by immunofluorescence (IF) using the same primary antibody. For IF, sections were deparaffinized and processed for antigen retrieval as described above, then blocked with 1% donkey serum + 0.2% Triton in PBS for 25 minutes, followed by sequential incubation with primary antibody diluted in blocking buffer (1:50 dilution, 2 hours at room temperature) and FITC-labeled secondary antibody (1:100 dilution, Jackson ImmunoResearch) for 45 minutes. DAPI was used for nuclear counterstaining, and sections were mounted in Fluoromount G.

[0230] In situ hybridization (ISH) was performed using a probe specific for RNA transcribed from the vector genome that does not bind to endogenous monkey IDUA RNA. Z-shaped probe pairs were synthesized by Life Technologies, and ISH was performed on paraffin sections using the Life Technologies ViewRNA ISH Tissue Assay kit according to the manufacturer's protocol. The formation of a Fast Red precipitate, indicating a positive signal, was imaged by fluorescence microscopy using a rhodamine filter set. Tissue sections with IDUA IHC were scanned for quantification using an Aperio Versa slide scanner (Leica Biosystems).

[0231] Histopathology and morphometry Pathological scoring A board-certified veterinary pathologist blinded to the vector group established severity grades, defined as follows: 0. absence of lesions, 1. minimal (<10%), 2. mild (10-25%), 3. moderate (25-50%), 4. marked (50-95%), and 5. severe (>95%). Dorsal axonopathy scores were established for each animal from at least three cervical, three thoracic, and three lumbar sections. DRG severity grades were established from at least three cervical, three thoracic, and three lumbar sections. Median nerve scores, the sum of the axonopathy and fibrosis severity grades, with a maximum possible score of 10, were established for the distal and proximal portions of the left and right nerves. To quantify transgene expression, a board-certified veterinary pathologist counted cells immunostained with anti-GFP or anti-hIDUA antibodies by comparing the signal with that from control slides obtained from untreated animals. The total number of positive cells per 20x magnification field was manually counted using ImageJ or the Aperio Image Scope cell counting tool in at least five fields per structure and per animal.

[0232] ISH quantification Cytoplasmic ISH signals were quantified for DRG neurons that showed nuclear signals (containing the vector genome) within a given section. Stained slides were scanned and analyzed for DRGs. Screenshots were taken to cover the entire area of ​​the ISH channel. Using the Fiji version of ImageJ, images showing only the ISH channel were thresholded with identical settings and synchronized (using the Window Synchronization tool) with corresponding images showing the ISH and DAPI channels. The percentage of area occupied by the ISH signal in the cytoplasmic region shown in the thresholded image was then determined with the "Measure" tool.

[0233] Vector biodistribution NHP tissue DNA was extracted with a QIAamp DNA Mini kit (Qiagen catalog no. 51306), and vector genomes were quantified by qRT-PCR using Taqman reagents (Applied Biosystems, Life Technologies) and primers / probes targeting the rBG polyadenylation sequence of the vector.

[0234] immunology Peripheral blood T cell responses to hIDUA were measured by interferon-gamma enzyme-linked immunosorbent spot assay according to previously published methods using a peptide library specific for the hIDUA transgene. The criterion for a positive response was 10 6 The response was >55 spot-forming units per lymphocyte and 3-fold higher than the unstimulated medium negative control. In addition, T cell responses were assayed in lymphocytes extracted from spleen, liver, and deep cervical lymph nodes after necropsy on study day 90. Antibodies to hIDUA were measured in serum (1:1,000 sample dilution).

[0235] Cytokine / Chemokine Analysis: CSF samples were collected and stored at -80°C until analysis. CSF samples were analyzed using a Milliplex MAP kit containing the following analytes: sCD137, eotaxin, sFasL, FGF-2, fractalkine, granzyme A, granzyme B, IL-1α, IL-2, IL-4, IL-6, IL-16, IL-17A, IL-17E / IL-25, IL-21, IL-22, IL-23, IL-28A, IL-31, IL-33, IP-10, MIP-3α, perforin, and TNFβ. CSF samples were assessed in duplicate and analyzed on a FLEXMAP 3D instrument using Luminex xPONENT 4.2 and Bio-Plex Manager software 6.1. Only samples with a %CV of less than 20% were included in the analysis.

[0236] In vitro studies miR183 expression The MIR183 human microRNA expression plasmid was modified from Origene's MI0000273 vector by deleting the KpnI-PstI fragment encoding GFP and a partial internal ribosome entry site. We confirmed the absence of GFP expression from the modified vector by transient transfection and anti-GFP immunoblotting. HEK293 cells were transiently transfected with a GFP cis plasmid carrying a microRNA-binding site located in the 3'-UTR of the GFP expression cassette via polyethyleneimine-mediated transfection. 72 hours after transfection, cells were lysed in 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 0.5% Triton X-100 containing protease inhibitors. A total of 13 μg of cell lysate was used for anti-GFP immunoblotting, followed by electrochemiluminescence-based signal detection and quantification. Experiments were performed in triplicate for statistical analysis.

[0237] miR183 quantification (RT-PCR) Human DRG and spinal cord tissues were supplied by Anabios, Inc. Lumbar DRG and spinal cord were originally obtained from a consenting 25-year-old Caucasian male with no history of neuropathic pain. The tissues were obtained from three NHP rhesus monkeys (organ donors) and immediately stored in RNALater (Ambion). NHP rhesus macaque tissues from three animals were obtained from a previous study and stored in a -80°C freezer. The MiRNeasy Mini Kit was used for total RNA isolation (Qiagen), and the extracted RNA was reverse-transcribed with a TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) according to the protocol instructions. qRT-PCR was performed to determine the abundance of miR183 in different tissues using a TaqMan MicroRNA Assay Kit with primers specific for hsa-miR-183-5p (Assay ID 002269) and RNU6B (Assay ID 00193) (Applied Biosystems Inc.) according to the manufacturer's instructions. Each qRT-PCR assay was performed in triplicate using cDNA derived from 100 ng of total RNA and analyzed by the comparative threshold cycle (Ct) method. -ΔΔCt Using the method, the average expression of miR183 was normalized with RNU6B as an endogenous control gene.

[0238] statistical analysis Statistical differences between the control group (no miR target vector) and the test group (miR target vector) were assessed using the nonparametric two-sided Wilcoxon rank-sum test at an alpha level of 0.05 (R version 4.0.0), except for cytokine analysis, which was performed using the nonparametric Kruskal-Wallis test for each cytokine and time point to test for differences between groups (alpha = 0.05, R version 4.0.0). For GFP expression in mice, statistical differences between groups were assessed using a parametric one-way analysis of variance followed by Tukey's multiple comparison test at an alpha level of 0.05. Datasets passed the Shapiro-Wilk normality test (GraphPad Prism version 7.05).

[0239] Example 2: MicroRNA-mediated inhibition of transgene expression reduces AAV vector-induced dorsal root ganglion toxicity Delivery of adeno-associated virus (AAV) vectors to the central nervous system (CNS) of non-human primates (NHPs) via blood or cerebrospinal fluid is associated with dorsal root ganglion (DRG) toxicity. Conventional immunosuppressive regimens cannot prevent this toxicity, likely due to the high transduction rate, which in turn can cause cellular stress due to excessive transgene product abundance in target cells. The present inventors developed an approach to eliminate DRG toxicity by introducing a sequence targeting miR183 into the vector genome within the 3' untranslated region of the corresponding transgene mRNA.

[0240] AAV vectors cause DRG degeneration in NHPs Based on our experience with DRG toxicity in NHPs, we developed a system to quantify the severity of toxicity. We evaluated cell bodies located along the spinal cord in the DRG, axons within peripheral nerves, and axons ascending in the dorsal white matter tract (Figure 1A). The primary lesion is considered to be degeneration of sensory neuron cell bodies located in the DRG. Microscopic evaluation highlights the extent of DRG lesions. Early neurodegeneration consists of otherwise normal neuronal cell bodies surrounded by proliferating satellite cells, microglial cells, and infiltrating mononuclear cells (Figure 2A). Later stages of neurodegeneration and neurophagy involve small, irregular, or acutely angled neuronal cell bodies with diffuse cytoplasmic hyperoxia and loss of nuclei (Figure 1B, Figure 2C, and Figure 2E). Cells that highly express the transgene protein are more likely to undergo degeneration, as demonstrated by immunostaining for the transgene product in animals administered intravenously with an AAV vector expressing green fluorescent protein (GFP, Figure 1B). Secondary to the death of cell bodies, there is axonopathy (degeneration of distal and proximal axons). The dorsal white matter tracts of the spinal cord contain swollen axons, as well as myelomacrophages and axonal debris consistent with axonal degeneration. The specimens show dilated myelin sheaths with or without vasoconstriction (Figure 1B, Figure 2B, Figure 2D, and Figure 2F). Figure 1C shows examples of various DRG toxicity and severity of spinal cord axonopathy. Grades are based on the percentage of affected tissue in high-power histopathological examination: 1 minimal (<10%), 2 mild (10-25%), 3 moderate (25-50%), 4 marked (50-95%), and 5 severe (>95%).

[0241] The total adolescent / adult NHP series included 219 monkeys across 27 studies, including previously published toxicology studies and the two NHP experiments described below, as well as several unpublished studies, with AAV vectors administered into the CSF via ICM or lumbar puncture (LP). This series included five capsids, 20 transgenes, five promoters (CAG, CB7, UBC, hSyn, and MeP426), and 1 × 10 transgenes. 12 GC~3×10 14 These included doses of GC, gradient- or column-purified vectors, three formulations (phosphate-buffered saline and two different artificial CSFs), and cynomolgus and macaque monkeys at various developmental stages. DRG toxicity and axonal damage were observed in all experimental groups. Pathology peaked approximately 1 month after injection and did not progress for up to 6 months (the longest period evaluated in adult macaques). In most cases, pathology was mild to moderate, and NHPs did not exhibit clinical signs suggestive of neuropathic pain. However, ICM injection of high doses of GFP-expressing vectors can cause severe pathology associated with ataxia.

[0242] miRNAs specifically expressed in DRG neurons can ablate AAV transgene expression. When considering ways to mitigate DRG toxicity, several mechanisms were evaluated. In a previous study, we analyzed the role of destructive adaptive immune responses against transduced DRGs by immunosuppressing NHPs intravenously administered AAV9 vectors expressing human alpha-L-iduronidase (hIDUA) or human iduronate-2-sulfatase. Treatment with mycophenolate mofetil (MMF) and rapamycin blunted the adaptive immune response to the vector and transgene product but had no effect on DRG toxicity or axonal damage.

[0243] Our engineered model posits that overexpression of the transgene product in highly transduced DRG neurons leads to neuronal injury and degeneration of cell bodies and associated axons, followed by a reactive inflammatory response (Figure 3A). To investigate this hypothesis, we designed a strategy to specifically ablate transgene expression. We used approaches previously deployed to restrict lentiviral vector expression in hematopoietic-derived cells or to detarget liver, heart, or muscle after AAV-mediated gene transfer. This approach involved cloning a miRNA target, expressed only in DRG neurons, into the 3' untranslated region of the transgene (Figure 3B). Any mRNA expressed from the vector would be disrupted by endogenously expressed miRNAs.

[0244] Screening existing miRNA databases and the literature revealed that the miRNA183 cluster was a good candidate for this strategy (miRBase tracker for miR183: MI0000273). This cluster contains three miRNAs (96, 182, and 183), all expressed from a polycistronic pri-miRNA. Under normal conditions, expression of this complex is largely restricted to neurons of the olfactory epithelium, ear, retina, and DRG, as demonstrated in zebrafish, mouse, rat, and human tissues. We validated this sensory neuron-specific expression pattern from three NHPs and one human donor by quantitative real-time PCR (qRT-PCR). We found that miR183 was at least 10-fold more abundant in NHPs and human DRG than in the spinal cord, and that in NHPs, it was most abundant in the DRG. We found that miRNAs with higher abundance in the cerebral cortex (1000-fold lower than in DRG), followed by the heart, spleen, skeletal muscle, cerebellum, liver, and medulla (Figures 4A and 4B). Outside of sensory neurons, the cluster can be upregulated in several pathological conditions, including cancer and autoimmune diseases. Our initial screen included the less well-characterized miRNA145, expressed in rat DRG. The target sequences of the miRNAs in all of these complexes are conserved between mouse, monkey, and human (see miRBase trackers below for miR183: MI0000273, MI0003084, MI0000225; for miR182: MI0000272, MI0000224, MI0002815; for miR96: MI0000098, MI0000583, MI0003085; and for miR145: MI0000461, MI0000169, MI0002558).

[0245] To evaluate the activity and specificity of the miRNA strategy, we used an in vitro assay. An AAV cis plasmid was constructed to contain four repeat concatemers of the target miRNA sequence in the 3' untranslated region of the expression cassette. The AAV cis plasmid was cotransfected with a plasmid expressing miR183. Expression of the transgene, GFP, was reduced in the presence of miR183 only when it contained the cognate recognition sequence (Figure 5A, p=0.0027).

[0246] The in vivo activity and specificity of potential miRNA targets within AAV vectors were screened in C57Bl / 6J mice. We evaluated GFP-expressing vectors with and without miRNA targets from two members of the miRNA183 complex (miR182 and miR183) and miR145. We first tested another member of the 183 complex, miR96, but ruled it out due to reduced expression of the GFP-miR96 transgene in the mouse cortex compared with miR183 (p=0.03) and miR145 (p=0.03) (Figures 6A and 6C). Animals received a high-dose intravenous (IV) injection of AAV9 targeted to the DRG and a high-dose injection of AAV-PHP.B targeted to the CNS. Animals were necropsied on day 21 and analyzed for GFP expression in DRG by immunohistochemistry (IHC) and direct fluorescence microscopy in the brain and liver (AAV-PHP.B) or liver, heart, and muscle (AAV9). GFP expression in DRG neurons was substantially reduced with vectors containing miR183 targets (p = 0.00007) and miR182 targets (p = 0.00003), but not miR145 targets (Figures 5B and 5C). Expression in the liver, heart, muscle, or brain cortex was not reduced with vectors containing miR183 targets, and expression was enhanced in the brain cortex (p = 0.03) and heart (p = 0.04) compared with the control GFP vector (Figure 5D, Figures 6A-6C). Because vector-induced DRG toxicity was observed only in NHPs in this mouse experiment, the impact of miR183 target-mediated transgene suppression on pathology could not be assessed. The reason for this difference is unclear.

[0247] The vector genome of ITR.CB7.CI.eGFP.miR145 (4 copies).rBG.ITR is provided in SEQ ID NO: 10, the vector genome of ITR.CB7.CI.GFP.miR182 (4 copies).rBG.ITR is provided in SEQ ID NO: 11, the vector genome of ITR.CB7.CI.GFP.miRNA96 (4 copies).rBG.ITR is provided in SEQ ID NO: 12, and the vector genome of ITR.CB7.CI.GFP.miR183 (4 copies).rBG.ITR is provided in SEQ ID NO: 13.

[0248] Limited transgene expression by miR183 reduces DRG toxicity in NHPs. Based on the promising data from the promoter, we evaluated the GFP-miR183-targeted expression cassette in NHPs. The mice were injected ICM with either AAVhu68 vector (n = 2, 1 male, 1 female, 5 and 8 years old, respectively) or GFPmiR183 (n = 4 female, age range 5-6 years) (3.5 × 10 13Half of the animals were necropsied on day 14 for GFP expression. The remaining animals were necropsied on day 60 to assess expression and DRG toxicity. Animals tolerated the ICM-administered vector without clinical sequelae, and there was no evidence of neuropathic pain in any of the animals enrolled in this study after vector administration. We observed a statistically significant reduction in GFP expression in DRG using the miR183 target-containing vector compared to the control vector (p=0.0054), whereas expression was enhanced in lumbar motor neurons (p=0.0273) and cerebellum (p=0.0044) and remained unchanged in the cortex, heart, and liver (Figures 7A and 7B). This was associated with reduced pathology across nine regions (DRG and dorsal spinal cord axonopathy in the cervical, thoracic, and lumbar spinal cord, as well as axonopathy of the median, peroneal, and radial nerves). When the vector did not contain the miR183 target, pathology was present in all regions and was evenly distributed between grade 4, grade 2, and grade 1. The greatest degree of pathology with the miR183 vector was grade 2, present in only 11% of regions. The remaining regions contained either grade 1 pathology (72%) or no pathology (17%, Figure 7C).

[0249] We further evaluated the miR183 target sequence in NHPs using a vector expressing hIDUA, the enzyme defective in patients with mucopolysaccharidosis type 1. This human transgene study was the first published report highlighting DRG toxicity in NHPs. The experiment included three groups: Group 1 - control vector alone without the miR183 target (AAVhu68.CB7.CI.hIDUAcoV1.rBG) (n = 3, 2 females, 1 male, age 2.5 years), group 2 - control vector without the miR183 target in animals treated with steroids (prednisolone 1 mg / kg / day from day -7 to day 30, then tapered progressively, n = 3, 3 males, age 2.5-3.5 years), and group 3 - vector containing the miR183 target (AAVhu68.CB7.CI.hIDUAcoV1.4×miR183.rBG) (n = 3, 2 males, 1 female, age 2.25-2.5 years). All vector genomes contained a chimeric CI consisting of the hIDUA coding sequence under the control of the chicken β-actin promoter and CMV enhancer element (referred to as the CB7 promoter), a chicken β-actin splice donor (973 bp, GenBank: X00182.1), and a rabbit β-globin splice acceptor element, and a rabbit β-globin polyadenylation signal (rBG, 127 bp, GenBank: V00882.1). The vector genome of ITR.CB7.CI.hIDUAcoV1.rBG.ITR is provided in SEQ ID NO: 14. The vector genome of ITR.CB7.CI.hIDUAcoV1.4xmiRNA183.rBG.ITR is provided in SEQ ID NO: 16. All animals received the AAVhu68 vector (1 × 10 13 Mice were given ICM injections of GC and autopsied at day 90 to assess transgene expression and DRG-associated toxicity.

[0250] Animals from all groups tolerated the ICM vector without any vector-related clinical or clinical pathological abnormalities (Tables 1 and 2). CSF pleocytosis was very low, limited to one animal in Group 2 and one in Group 3 (Table 3). Both T cell responses (measured by ELISPOT) and antibodies to hIDUA were detected in all three groups (Figures 8A-8D). CSF levels of fractalkine and MIP-3a spiked 24 hours after vector administration, increasing from undetectable to over 100 pg / mL in two animals from Group 1 and three animals from Group 3, whereas these analytes were undetectable at 24 hours but increased on days 21 and 35 in CSF from Group 2 (prophylactic steroids). Undetectable or trace amounts (<15 pg / mL) of cytokines and chemokines were detected 21 and 35 days after injection (overexpression induction). In the CSF of animals from group 3 (hIDUA.miR183) during the first 24 h of 24 h (when acute stress is expected), whereas in all animals from group 1, several analytes (fractalkine, MIP-3a, IL16, perforin, and IL17) were above 100 pg / mL (Figure 9).

[0251] Using immunofluorescence and in situ hybridization (ISH), high hIDUA expression was observed in the DRG in Groups 1 and 2, which used a control vector (containing no miR183 target) (Figures 10 and 11A). Low to moderate hIDUA expression was detected in other CNS compartments, including spinal lower motor neurons and neurons in the cerebellum and cortex (Figures 10 and 11A). Incorporation of the miR183 target into the vector (AAVhu68.hIDUA-miR183 / Group 3) eliminated hIDUA protein expression in DRG neurons (p=0.000003) without reducing expression in the CNS (spinal cord, cerebellum, and cortex), as highlighted by immunofluorescence (Figure 10, top row, Figure 11A) and immunohistochemistry (Figures 10, 11A). At the mRNA level (Figure 10, bottom row), cytoplasmic ISH signal in transduced DRG neurons was reduced from 42% of the area in animals receiving AAVu68.hIDUA to 7% in animals receiving AAVhu68.hIDUA-miR183 (Figure 11A), representing an 83% reduction. The reduction in hIDUA expression in the DRG was not due to reduced gene transfer, as vector biodistribution throughout the CNS and DRG was essentially the same across all groups (Figure 12). Steroids moderately reduced expression in the DRG (p = 0.0001) and increased expression in lower motor neurons (p = 0.0024) compared with the control vector (Figure 10 and Figure 11A). As expected, administration of the control vector (Group 1) caused relatively milder DRG, dorsal column, and peripheral nerve pathology compared with the GFP-expressing vector. However, no pathology was observed in the DRG (p = 0.0583), dorsal columns (p < 0.0001), or peripheral (median) nerves (p = 0.0137) of animals transduced with the miR183 target-containing vector (Group 3, Figure 6B). Combination treatment with steroids (Group 2) did not reduce the toxicity of the parental vector (not containing the miR183 target) (Figure 6B), but instead was associated with a trend toward worsening toxicity in the peripheral nerves (p = 0.0256) and dorsal columns (p = 0.066). [Table 4] [Table 5] [Table 6] [Table 7] [Table 8] [Table 9-1] [Table 9-2] [Table 10] [Table 11] [Table 12]

[0252] AAV-induced DRG toxicity in NHP occurs via neuronal apoptosis. To investigate the mechanism of neuronal degeneration in DRG, a vector with miR183 was used. Several histological sections from animals injected with and without vector were subjected to IHC for markers of cellular apoptosis and the unfolded protein response (UPR). Initial studies focused on activation of caspase-3, a downstream marker of apoptosis. DRGs from animals that showed neurodegeneration based on hemotoxylin and eosin assessment showed positive IHC staining for activated caspase-3 along with cellular infiltration (Figures 13A-C). DRGs from animals not injected with AAV and DRGs from the spleen served as negative and positive controls, respectively (Figures 13E and 13F). Caspase-3-positive neurons in the DRG were more abundant in sections from animals injected with AAVhu68.GFP (20 caspase-3-positive DRG neurons) compared with three animals injected with AAV.hIDUA (11, 0, and 1 positive DRG neurons). In each case, inclusion of the miRNA183 target sequence reduced the number of cells with activated caspase-3 (3 and 0 positive neurons with GFP.miR183, n = 2 animals, and 0 with hIDUA.miR183, n = 3 animals; Figures 13C-13D). Apoptosis induced by adaptive or innate immunity in what is referred to as the extrinsic pathway was investigated by assessing upregulation of caspase-8 by IHC. Only sections with caspase-3-positive neurons were processed. Degenerating neuronal cell bodies across all vector groups were negative for activated caspase-8, whereas infiltrating cells were strongly positive for caspase-8, serving as an internal positive control (Figures 15A-15E). The same sections were also assessed for activated caspase-9, a common marker of the intrinsic pathway of apoptosis. This apoptotic mechanism is mediated through increased mitochondrial membrane permeability and the release of cytochrome C resulting from the activation of caspase-9. IHC demonstrated caspase-9 in one degenerating neuronal cell body in the DRG in animals that received AAVhu68.eGFP (Figure 16A). However, caspase-9 was not observed in animals that received AAVhu68.eGFP.miRNA and exhibited neurodegeneration (Figure 16C).There were no positive caspase-9 neurons from animals that received the AAVhu68.hIDUA vector, with or without miR183, although this may have been a function of the reduced incidence of lesions observed with these vectors compared to AAVhu68.eGFP, thereby reducing the likelihood of finding neurons at the appropriate stage of degeneration on histological sections (Figures 16B and 16D).

[0253] To support the proposed mechanism of toxicity due to transgene protein overexpression, IHC for activating transcription factor 6 (ATF6) was performed in one animal per group. The UPR triggers ATF6 activation in the Golgi apparatus, generating cytoplasmic fragments that translocate to the nucleus and activate transcription of ER-associated binding elements. UPR-mediated apoptosis occurs via the intrinsic pathway. IHC for ATF6 was multifocal positive in the cytoplasm of neurons and satellite cells in the DRG of animals receiving AAVhu68.eGFP (>40 positive cells), AAVhu.68.hIDUA (>40 positive cells), and AAVhu68.eGFP.miR183 (18 positive cells), corresponding to the severity of the lesions (Figures 14A-C). In contrast, animals receiving AAVhu68.hIDUA.miR183 and untreated, non-AAV-injected control NHPs were diffusely negative for ATF6 (Figures 14D and 14E). Consistent with overall findings, animals receiving the miR183-carrying vector showed a reduced positive ATF6 signal, indicating reduced cellular stress.

[0254] DRG toxicity is likely to occur in any gene therapy that relies on high systemic doses of vectors or direct delivery of vectors into the CSF. This safety concern is limited to primates and is usually asymptomatic. However, DRG toxicity has the potential to cause substantial morbidity, such as ataxia due to proprioceptive deficits. The Food and Drug Administration recently suspended an intrathecal AAV9 clinical trial for late-onset SMA, in part due to DRG toxicity in NHPs, thus highlighting how this risk may limit the development of AAV therapy.

[0255] Originally, it was hypothesized that this toxicity was caused by destructive T cell immunity against DRG-transduced neurons, directed against the foreign capsid or transgene epitopes. However, potent immunosuppressive regimens such as MMF and rapamycin did not prevent toxicity in toxicological studies, and steroids did not prevent it in this study. The time course of delayed, but not progressive, DRG degeneration did not support the idea that adaptive immunity plays a role. If cytotoxic T cells were involved, we would have observed degeneration of DRG and other transgene-expressing cell types, as well as mononuclear cell infiltration that began early and progressed over time.

[0256] High levels of DRG transduction may generate cellular stress, leading to degeneration in highly transduced DRG neurons. Histological analysis showed that degeneration was limited to DRG neurons expressing the most transgene protein. Neuronal degeneration was also associated with activation of caspase-3 and caspase-9, suggesting that apoptosis is triggered by an intracellular stressor, as opposed to being mediated by T cells. The reduction of DRG degeneration by cell-specific ablation of transgene expression via miRNA183 suggests that overexpression of transgene-derived mRNA or protein, rather than capsid or vector DNA, drives this process. Increased ATF6 staining in neurons and satellite cells from animals receiving a vector lacking the miR target compared with controls using miR targets or untreated animals is indicative of the UPR, although the mechanism of induction may differ between non-secreted (GFP) and secreted (IDUA) transgenes.

[0257] The delayed, though not self-limiting, time course of DRG neurodegeneration is consistent with the idea that non-immunotoxicity is restricted to a highly transduced subset of cells. It is unclear whether DRG toxicity and axonal damage are reversible. No resolution of pathology has been observed after 6 months of follow-up in adult animals. The only study in which DRG toxicity was not observed in NHPs after ICM injection was when vector was administered to 1-month-old macaques and autopsied 4 years later. It is possible that infant primates are resistant to DRG toxicity, or their DRG neurons have regenerative potential, or that the lesions regress over this long period. Our findings support the notion that DRG toxicity is caused by transgene overexpression, a type of neurotoxicity previously reported in the CNS of NHPs after direct intracerebral administration of AAV expressing hexosaminidase, a lysosomal enzyme defective in Tay-Sachs disease. Therefore, the severity of DRG toxicity should be influenced by the dose, promoter strength, and nature of the transgene. However, the present inventors have yet to discover a CNS-tropic AAV that can achieve an effective dose of vector in adult primates in the absence of DRG toxicity.

[0258] In primates, the reason why sensory neurons are among the most efficiently transduced cells is unclear. DRG neurons are located outside the CNS and possess porous, fenestrated capillaries, allowing them easy access by systemically administered vectors. Systemic vectors can also access DRG neurons via retrograde transport after uptake from peripheral axons. The anatomical structure of the sensory compartment, located in the intrathecal (intrathecal) space, may facilitate high transduction of vectors delivered to the CSF. Axons of dorsal root DRG neurons are exposed to CSF, providing easy access to vectors after ICM / LP administration. The open access of the intrathecal space to the DRG extracellular fluid should allow direct contact of ICM / LP vectors with DRG neurons and other cells. Selective suppression of transgene expression in DRG neurons by including miR183 targeting sequences facilitated the analysis of transgene expression in other DRG-associated cells that should not be affected by this miRNA. ISH revealed transgene mRNA in surrounding glial satellite cells This may suggest direct transduction. The functional significance of the presence of transgene mRNA in glial cells is unknown.

[0259] Selective inhibition of vector transgene expression should reduce and potentially eliminate DRG toxicity. The key to achieving this involves designing a strategy to specifically extinguish expression in DRG neurons without affecting expression elsewhere. Currently, this specificity cannot be achieved through capsid modification or tissue-specific promoters. By including miR183 targets in the vector, the desired result of reducing / eliminating DRG toxicity was achieved without affecting vector production, efficacy, or biodistribution. However, because miR183 and RISC are likely to be saturated by high GC numbers, the dose window may be narrow. Quantification of ISH in our study suggests that an 80% reduction in mRNA levels in transduced DRG neurons is sufficient to suppress toxicity. Careful dose-ranging studies combined with minimally effective dose studies in animal models are essential to establish the feasibility of our approach for any given transgene. The hIDUA NHP study included a group that received a non-miR183-targeting vector along with concomitant steroids (a standard approach to mitigate immune-mediated toxicity in AAV trials). DRG toxicity was not reduced in the steroid-treated group. This experiment demonstrates the limitations of prophylactic steroids in AAV gene therapy.

[0260] The modularity of this approach to reducing DRG toxicity suggests that it could be used with any AAV vector considered for CNS-directed gene therapy. It is possible that miR183 targeting within the vector could divert miR183 molecules from their normal targets, potentially disrupting cellular physiology. Evidence for this would be toxicity limited to heavily transduced cells expressing miR183 (DRG). We have not observed toxicity in NHPs treated with AAV miR183 target-containing vectors. The redundancy of the miR183 cluster, which shares common targets for miR183, 182, and 96, may reduce this theoretical risk, as suggested by the complete cluster versus single miRNA knockout model. Furthermore, other cell types known to express miR183 (olfactory epithelium, retina, inner ear, activated immune cells) would not be efficiently transduced during ICM or systemic AAV delivery. Given the concerns raised by regulatory agencies about DRG toxicity, it would be prudent to incorporate miRNA183 detargeting strategies into CNS gene therapy programs. The main limitation of this strategy is mitigating DRG toxicity in diseases such as Charcot-Marie-Tooth neuropathies, where DRG transduction is necessary to achieve therapeutic benefit.

[0261] In summary, we have developed an approach to reduce AAV-induced DRG toxicity in NHPs that can be tested across a wide range of AAV vectors in various therapeutic applications.

[0262] Example 3: Comparison of the effects of engineered sequences encoding HIDUA and miR183 target sequences on HIDUA activity and expression. 1x10 for delivery of engineered sequences encoding human IDUA (SEQ ID NOS: 22-26) compared to the non-optimized native cDNA in wild-type male mice. 11GCs were injected IV with AAVhu68. hIDUAcoV1 (SEQ ID NO: 22) showed the fastest and highest enzyme levels in serum, with levels remaining stable at day 21 (Figure 17A), suggesting the absence of significant levels of anti-drug antibodies. hIDUAcoV1 was evaluated in further studies, in part due to its rapid onset (day of serum) and high level of activity in the brain (Figure 17B).

[0263] MPSI (IDUA-deficient) mice were transfected with 1 × 10 vectors encoding hIDUACov1 with or without the miR183 target (4× repeats). 11 GCs were injected intravenously with AAVhu68. Mice were euthanized 30 or 90 days after injection (Figures 18A and 18B). IDUA activity was greater than wild-type after ICV treatment with AAVhu68 encoding hIDUAcov1 or hIDUAcov1-miR183 (Figures 18C-18C). Mean levels increased with the 4x miR183 targeting vector, indicating that when the miR183 targeting construct was included, efficacy was greater than or equal to miR183. Tissues were processed to assess storage reduction using LAMP1 immunofluorescence as a marker of therapeutic efficacy. LAMP1 fluorescence increased in KO mice treated with vehicle control and decreased in the cortex after AAV treatment with both forms of hIDUA-encoding vectors, with or without the miR183 targeting (Figures 18E and 18F). Therapeutic efficacy was higher in young mice compared with older mice.

[0264] Example 4: In vitro evaluation of expression constructs carrying miR183 cluster targeting sequences The activity and specificity of constructs with miRNA target sequences are evaluated using in vitro assays. As described in Example 2 above, HEK293 cells (or another suitable cell line) are co-transfected with a cis-plasmid carrying a GFP transgene and a plasmid expressing one or more miRNAs, such as miR-182 and miR-183. The cis-plasmids are designed with various numbers of corresponding target miRNA sequences in the 3'UTR of the expression cassette, and alternative spacer sequences are introduced. 72 hours after transfection, GFP expression is quantified to determine relative expression levels.

[0265] For example, constructs carrying one, two, three, or four copies, or even up to eight copies, of the target miR183 sequence are tested. Individual target sequences are either directly linked or separated by spacer sequences, such as those provided in SEQ ID NOS: 5-7. Based on the results of in vitro studies, suitable combinations of sequences (including several repeats) and spacers that reduce or eliminate GFP expression are identified. Candidates from this study are then screened in vivo by delivering AAV vectors (e.g., AAV9 or AAV-PHP.B) carrying expression constructs with the same or similar arrangement of target miRNA sequences and spacer sequences. For example, an exemplary in vivo mouse study to assess expression levels in the CNS, including detargeting of the DRG (i.e., reducing GFP expression), is provided in Example 2.

[0266] Similar studies are also carried out using the constructs that have 1, 2, 3, or 4, or up to 8 copies of the target sequence for miR182, with or without various spacer sequences.In addition, constructs that have the combination and different arrangement of the recognition sequences of miR182 and miR183 are produced.Then, the constructs that have only the miR182 target sequence and the combination of miR182 and miR183 target sequence that show favorable reduced expression level in vitro are evaluated in vivo, for example, after administration of AAV vector, to determine the toxicity and the level of transgene expression (the degree of detargeting) in the cells of CNS and DRG.

[0267] Alternatively, constructs are generated that contain 1, 2, 3, or 4, or up to 8 copies of a combination of miR182 target sequences and / or other miR183 cluster target sequences (i.e., target sequences corresponding to miR-183, miR-96, or miR-182). Constructs carrying the combined miR182-miR183 cluster target sequences are tested in vitro using a GFP expression assay as described in Example 2 above. As described above, the tested expression cassettes have various numbers of miRNA target sequences, separated or not separated by spacer sequences. The combination of miR182 target sequences and other miR183 cluster target sequences is then added to the constructs. The activity of specific constructs is then evaluated in vivo by generating AAV vectors that are administered intravenously at high doses. As described above, AAV vector transgene expression is evaluated in various cells and tissues, including DRG, particularly liver tissue.

[0268] Furthermore, the effect of one, two, three, four, or up to eight copies of the miR182 target sequence on transgene expression is evaluated. As described above, experimental constructs for in vitro testing are generated, and the miR182 target sequence is introduced into the 3'UTR of the expression cassette. When multiple miR182 sequences are introduced, the sequences may be contiguous, or alternatively, may be separated by any of a variety of intervening spacer sequences. AAV vectors carrying expression cassettes containing any combination of miR182 target sequences and spacer sequences (if applicable) are generated and tested in vivo. In particular, for expression cassettes with miR182 target sequences, transgene expression is evaluated in muscle tissue after high-dose IV administration of the AAV vector.

[0269] Example 5: Delivery of rAAV with miR targeting sequences operably linked to a transgene does not increase expression of miR183 cluster-regulated genes. The human CACNA2D1 and CACNA2D2 genes (members of which encode voltage-gated calcium channels) are predicted targets of the miR183 cluster (miR183 / 96 / 182), and a significant inverse correlation has been observed between all three miRNAs and CACNA2D1 and CACNA2D2 expression in DRG from human donors. See, for example, Peng at al, “mirR-183 cluster scales mechanical pain sensitivity by regulating See "basal and neuropathic pain genes." Science. 2017 Jun 16;356(6343):1168-1171. doi:10.1126 / science.aam7671. Epub 2017 Jun 1. It has been reported that miR183 downregulates CACNA2D expression. However, if a "sponge effect" is present, increased expression of CACNA2D would be expected, which would contribute to the animal's increased sensitivity to pain and pressure.

[0270] Stock rAAV containing a vector genome containing eGFP with or without the 4x miR183 target sequence, or a vector genome containing hIDUA with or without the 4x miR183 target sequence, was cultured at 2.5x10 in rat-DRG medium. 12 The miR183 ...

[0271] The expression levels and potential sponge effects of miR183 on the target genes CACNA2D1 and CACNA2D2 were determined using primers specific for rat CACNA2D1 (Assay ID Rn01442580) and CACNA2D2 (Assay ID: Rn00457825). Figure 20 shows the expression levels and potential sponge effects of miR183 on the target genes CACNA2D1 and CACNA2D2 at low concentrations (5 × 10 5 ) or high concentration (2.5 × 10 8 Figure 1 shows the results of AAV transduction (AAV9) of various vectors carrying the eGFP transgene with or without four copies of the miR183 detargeting sequence. Low and high doses without miR183 were transduced into the aAV9-eGFP vector at a multiplicity of infection (MOI) of 100 (for low-dose AAV9-eGFP) or 10 (for high-dose AAV9-eGFP). The cells were tested with or without adenovirus type 5 (Ad5) helper cotransfection. All DRG neurons were transduced, and no visible signs of toxicity were observed. No GFP expression was observed in DRG neurons, but some expression was observed in fibroblast-like cells. This confirms the suppression of GFP transcription by the (4x) miR183 target expression cassette.

[0272] miR183 sponge effect study in NHPs DRG (lumbar region) and brain (frontal cortex) tissues were obtained from non-human primate (NHP) rhesus macaques (19-04) treated with AAV-IDUA or AAV.hIDUA.4Xmir183 vectors (n = 3 / group). The miRNeasy Mini Kit was used for total RNA isolation (Qiagen, Germantown, MD), and the extracted RNA was then reverse transcribed using the TaqMan™ MicroRNA Reverse Transcription Kit (Applied Biosystems) according to the protocol instructions. Quantitative real-time polymerase chain reaction (qPCR) was performed to determine the abundance of miR183 in different tissues using a TaqMan MicroRNA Assay Kit with primers specific for hsa-miR-183-5p (Assay ID 002269) and RNU6B (Assay ID 00193) (Applied Biosystems Inc., Foster City, CA, USA) according to the manufacturer's instructions. Similarly, the abundance of two of miR183's direct targets, CACNA2D1 and CACNA2D2, was measured using a TaqMan Gene Expression Assay kit with primers specific for CACNA2D1 (Assay ID Hs00984840) and CACNA2D2 (Assay ID: Hs01021049), respectively. Each qPCR assay was performed in triplicate using cDNA derived from 100 ng of total RNA from biological replicates and analyzed by the comparative threshold cycle (Ct) method. The average expression level of miR183 was normalized to RNU6B as an endogenous control gene and analyzed by the 2 -ΔΔCtMean levels of CACNA2D1 and CACNA2D2 were normalized to GAPDH using the method (Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 2008;3(6):1101-8). See Figure 19A (drg) and Figure 19B (cortex). There was no increase in expression of miR183 cluster-regulated genes (CACNA2D1 or CACNA2D2) when comparing AAV-IDUA or AAV-IDUA-miR183 animals in either DRG (high miR183 abundance) or frontal cortex (low miR183 abundance).

[0273] Neonatal rat dorsal root ganglion (DRG) neuron cell culture Rat DRG neurons (Lonza Walkersville, Inc.) were thawed and added to 7 mL of the recommended medium (PNGM BulletKit: Primary Neuron Basal Medium containing 2 mM L-glutamine, 50 μg / ml gentamicin / 37 ng / ml amphotericin, and 2% NSF-1). Approximately 5.0 × 10 5 Eight milliliters of medium containing 100 DRG neurons was divided among eight wells of a 24-well tissue culture plate coated with poly-D-lysine (30 μg / ml, Sigma) immediately before adding the cells. The cells were incubated for 4 hours in a 37°C, 5% CO2 incubator, after which the medium was removed and replaced with fresh, prewarmed medium. To inhibit Schwann cell proliferation, mitotic inhibitors (5 μl of 17.5 μg / mL uridine and 5 μl of 7.5 μg / mL 5-fluoro-2-deoxyuridine per mL of medium) were added after the first 4 hours of incubation. The cells were incubated at 37°C, 5% CO2, with a complete medium change on day 5 and a 50% medium change every three days thereafter. After 6 days of initial culture, rat DRG neurons were transduced with AAV vectors as described above.

[0274] Figure 21 shows the effect of miR183 sponge effect study in rat DRG cells. The miR183 level in rat DRG cells was reduced when the cells were transduced with AAV9-eGFP-mir183. AAV9-eGFPmiR183- shows target engagement for GFP-miR183 mRNA.

[0275] Figures 22A-C show the effects of known miR183-regulated transcripts in rat DRG cells. Figure 22A shows the relative expression of CACANA2D1 in rat DRG cells after delivery of mock vector, AAV-GFP, or AAV-GFP-miR183 vector. Figure 22B shows the relative expression of CACANA2D2 in rat DRG cells after delivery of mock vector, AAV-GFP, or AAV-GFP-miR183 vector. Figure 22C shows the expression of ATF3 in rat DRG cells after delivery of mock vector, AAV-GFP, or AAV-GFP-miR183 vector. There was no change in the relative expression of mRNA levels of these three known miR183-regulated transcripts. No differences were observed compared to untransduced mock wells and GFP-miR183-transduced wells. These data indicate the absence of a sponge effect in these cells. It is possible that either the remaining levels of miR183 are sufficient or that other members of the cluster (miR96 and / or miR182) are able to compensate for the reduced availability of miR183.

[0276] Example 6: Meta-analysis of DRG morbidity Administration of adeno-associated virus (AAV) vectors into non-human primates (NHPs) via blood or cerebrospinal fluid (CSF) can induce dorsal root ganglion (DRG) pathology. This pathology is mostly minimal to moderate, clinically asymptomatic in affected animals, and characterized by histopathological analysis of mononuclear cell infiltration, neurodegeneration, and secondary axonal lesions in central and peripheral axons. Data from 33 nonclinical studies in 256 NHPs were collated to perform a meta-analysis of the severity of DRG pathology across different administration routes, doses, time courses, study conduct, animal age, sex, capsids, promoters, capsid purification methods, and transgenes. DRG pathology was observed in 83% of NHPs administered AAV via the CSF and in 32% of NHPs administered via the intravenous (IV) route. We demonstrated that dose and age at the time of injection significantly affected severity, while sex did not. DRG pathology was absent at acute time points (i.e., ≤14 days), similar up to 1–5 months post-injection, and less severe at 6 months. The vector purification method had no effect, and all capsids and promoters we tested caused some DRG pathology. The data presented here from five different capsids, five different promoters, and 20 different transgenes suggest that DRG pathology is nearly universal after AAV gene therapy in preclinical studies using NHPs. None of the animals receiving the therapeutic transgenes showed any clinical signs. Incorporation of sensitive techniques such as nerve conduction velocity can reveal modifications in a small number of animals that correlate with the severity of peripheral axonopathy. Monitoring sensory neuropathy in human CNS studies and high-dose IV studies seems prudent to determine whether clinically significant DRG pathology occurs.

[0277] material and method: Data Availability Statement Aggregated data are presented with experimental details provided, excluding specific transgenes, which are proprietary to the sponsors who funded the research.

[0278] animal This meta-analysis included 237 rhesus monkeys and 19 crabeaters from 33 studies. All animal procedures were approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania. Rhesus macaques (Macaca mulatta) or cynomolgus macaques (Macaca fascicularis) were procured or donated by Covance Research Products, Inc. (Alice, TX), Primgen / Prelabs Primates (Hines, IL), and MD Anderson (Bastrop, TX). Animals were collected from the University of Animals were housed in stainless steel squeeze-back cages at the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC) International-accredited Nonhuman Primate Research Program facility at the University of Pennsylvania, either at the Children's Hospital of Philadelphia, Pennsylvania, or at the Children's Hospital of Philadelphia. Animals received a variety of enrichments, including feeding, visual and auditory stimulation, handling, and social interaction.

[0279] Administration of test or subject matter For CSF administration, NHPs received vector diluted in sterile artificial CSF (vehicle) injected into the cisterna magna under fluoroscopic guidance, as previously described (N. Katz, et al., Hum Gene Ther Methods 29, 212-219, 2018). In anesthetized animals, lumbar puncture was performed under fluoroscopic guidance. After inserting a spinal needle into the L4-5 or L5-6 space, placement was confirmed by CSF return and / or by injecting up to 1 mL of contrast agent (iohexol 180). For intravenous administration, a catheter was placed in the saphenous vein, and the vector was diluted in sterile 1x Dulbecco's phosphate-buffered saline.

[0280] Nerve conduction velocity testing Animals were sedated with a combination of ketamine and dexmedetomidine and placed on the operating table in a lateral or supine position, with body temperature maintained with a heat pack. The stimulator probe was positioned over the median nerve, with the cathode closest to the recording site. Two needle electrodes were inserted subcutaneously at the level of the distal phalanx (reference electrode) and the proximal phalanx (recording electrode), while a ground electrode was placed proximal to the stimulator probe (cathode). The pediatric stimulator delivered incremental stimuli until a peak amplitude response was reached. Up to 10 maximal stimuli were averaged and reported for the median nerve. The distance (cm) from the recording site to the stimulator cathode was measured and used to calculate conduction velocity. Both conduction velocity and mean sensory nerve action potential (SNAP) amplitude were reported.

[0281] vector For these studies, AAV vectors were generated and titrated as previously described (M. Lock et al. Hum Gene Ther 21, 1259-1271, 2010; M. Lock, et al. Hum Gene Ther Methods 25, 115-125, 2014). Briefly, HEK293 cells were triply transfected, and culture supernatants were collected, concentrated, and purified on an iodixanol gradient. For GLP-compliant toxicity studies, vectors were also produced by triple transfection of HEK293 cells and purified by affinity chromatography using POROS™ CaptureSelect™ AAV9 resin (Thermo Fisher Scientific, Waltham, MA) as previously described (J. Hordeaux, et al. Mol Ther Methods Clin Dev 10, 79-88, 2018).

[0282] histopathology In most studies, board-certified veterinary pathologists, blinded to the test article / treatment group, established severity scores: 0 for absence of lesions, 1 for minimal (<10%), 2 for mild (10–25%), 3 for moderate (25–50%), 4 for marked (50–95%), and 5 for severe (>95%). These scores were based on microscopic evaluation of hematoxylin and eosin (H&E)-stained tissue, with percentages representing the percentage of tissue affected by lesions in the mean high-power field. In all GLP and some non-GLP clinical studies, peer review was completed by an external board-certified veterinary pathologist. Severity scores for DRG degeneration and spinal cord dorsal axonopathy were established from cervical, thoracic, and lumbar segments. However, the number of sections evaluated varied across studies. In some studies, if multiple tissue sections for a given segment were present on a slide, scores were assigned to individual sections of the DRG and spinal cord. These were averaged for a single representative score. We consider spinal cord axonopathy to be a better indicator of DRG pathology because it represents a cross-section of axons coming from all DRGs. Throughout this document, we define DRG pathology as histopathological findings of the DRG cell bodies and spinal cord, or the spinal cord alone. The grade of peripheral nerve axonopathy was established based on evaluation of the median (proximal and / or distal), radial, ulnar, sciatic (proximal and / or distal), peroneal, tibial, and / or sternal nerves. When evaluation was performed on the proximal and distal median nerves, the proximal segment corresponded to the portion of the nerve from the brachial plexus to the elbow, and the distal segment corresponded to the portion of the nerve from the elbow to the palm. Periaxonal (i.e., endoneurial) fibrosis in peripheral nerves, if present, was assigned a severity score. In studies where peripheral nerves were evaluated bilaterally, axonopathy and periaxonal scores were averaged for each nerve.

[0283] Data Extraction Raw data, including pathological scores and all relevant study information, were extracted from study files and compiled into a single Excel spreadsheet. Two individuals independently extracted scores based on predetermined search criteria, sorted them, generated graphs, and performed statistics. In the event of discrepancies between extracted outputs, a consensus was reached for equally accountable quality control.

[0284] statistics For each parameter (i.e., age at injection, capsid, route of administration, time course, promoter, sex, vector purification method, and dose), comparisons of pathological scores between pairs of groups for each DRG or SC segment (i.e., cervical, thoracic, and lumbar) were performed using the Wilcoxon rank-sum test with the function "wilcox.test" in the R program (version 3.5.0, https: / / cran.r-project.org). A combined p-value was then calculated from the three comparisons for overall DRG or SC intergroup comparisons using the Fisher method with the function "sumlog" in the "metap" package in R. Statistical significance was assessed at the 0.05 level for the combined p-value.

[0285] result DRG morbidity assessment We have developed a method for accurately assessing and scoring lesions to DRG neurons based on neuroanatomical and systemic assessment of the neurons and their corresponding axons. Primary sensory neuron cell bodies are ovoid swellings at the base of each dorsal spinal root within the subarachnoid space located within the DRG. DRG neurons are pseudounipolar, with one peripheral branch extending into the peripheral nerve and one central branch ascending dorsally within the spinal cord white matter tract (Figure 1). 23). It has been our experience that neurodegeneration does not uniformly affect DRGs, meaning that multiple DRGs must be collected from the cervical, thoracic, and lumbar regions to provide a representative sample. Pathology in the DRG manifests as a mononuclear cell infiltration with mononuclear inflammatory cells and proliferating resident satellite cells, with neurodegeneration becoming evident at later stages (Figure 23, A1, circled). Neuronal cell body damage is followed by axonal degeneration (i.e., axonopathy) along DRG axonal processes in the nerve roots (Figure 23, B1), the ascending dorsal pathways of the spinal cord (Figure 23, C1), and peripheral nerves (Figure 23, D1). Typical histopathological findings with normal counterparts are shown in Figure 23, A1–D2, along with high-magnification images of various stages of DRG pathology. Early in the degenerative process, neuronal cell bodies appear relatively normal, containing only proliferating satellite cells along with microglial cells and infiltrating mononuclear cells (neurophagocytic cells) (Figure 23, Panel E). As the lesion progresses, neuronal cell bodies show evidence of degeneration characterized by small, irregularly shaped or acutely shaped cells with fading or absent nuclei and cytoplasmic hyperoxia (Figure 23, Panel F, vertical arrows). End-stage neuronal cell body degeneration (Figure 23, Panel G, circles) is accompanied by their complete disappearance by satellite cells, microglial cells, and mononuclear cells (Figure 23, Panel G, stars). The severity of histological findings in the DRG and corresponding axons is graded based on the percentage of affected neurons or axons relative to the average high-power field. The scale is 0 for absence of lesions, 1 for minimal (<10%), 2 for mild (10-25%), 3 for moderate (25-50%), 4 for marked (50-95%), and 5 for severe (>95%). The DRG exhibits mosaicism, with normal neuronal abundance and only a few neurons showing degeneration on a given section. We consider spinal cord axonopathy to be a better indicator of DRG pathology because it represents a cross-section of axons originating from all DRGs. Throughout this document, we define DRG pathology as histopathological findings of the DRG cell bodies and spinal cord, or the spinal cord alone.

[0286] Study and population characteristics The inventors of the present application are Gene Therapy Program Data from 33 studies involving 256 animals injected with AAV vectors or vehicle control were compiled at Penn. A summary of these studies is shown in the table below. [Table 13]

[0287] Effect of study characteristics on severity of DRG morbidity DRG morbidity was observed in 83% (170 / 205) of NHPs receiving AAV ICM or LP, 32% (8 / 25) of NHPs receiving IV, 100% (4 / 4) of those receiving combined ICM+IV, and 0% of those receiving intramuscular (IM). Pathologists graded DRG lesions based on severity scores in the DRG and corresponding axons in the spinal cord and peripheral nerves. Scores were obtained for each DRG and spinal cord region (cervical, thoracic, and lumbar). Because severity in the DRG was lower than that in the spinal cord, pathology scores from several DRGs were collated because each spinal cord region groups the totality of axons originating from the DRG (Figure 23). Study design parameters that significantly affected morbidity severity were route of administration (ROA), dose, and necropsy time point (Figures 24A-C). Adherence to GLP practices for nonclinical laboratory testing (as set out in Title 21 of the Code of Federal Regulations, 58 CFR) did not affect the severity of morbidity (Figure 24D). All ROAs except IM caused significant morbidity in both the DRG and spinal cord when compared to vehicle controls (p=0.04 DRG and spinal cord, IV vs. vehicle, p<0.001 DRG and p<0.0001 spinal cord, all other routes vs. vehicle). IC M, LP, and ICM / IV were all similar and significantly worse than IV (IV vs. ICM p<0.0001, IV vs. LP p=0.02, IV vs. ICM / IV). p=0.0006—Figure 24A). IM (not shown) did not cause morbidity (all scores 0) and was similar to vehicle controls. For all following analyses, only animals administered intra-CSF (i.e., ICM or LP) were considered. The two lower dose ranges (<3E+12GC and 3E+12 to 1E+13GC) were similar, whereas the highest dose range (>1E+13GC) resulted in significantly worse pathological scores than both the lowest dose range (p=0.009, spinal cord) and the middle dose range (p=0.001 DRG, p=0.05 spinal cord, Figure 24B). Post-injection time points (i.e., when necropsies were performed and tissues analyzed) showed similar morbidity severity between 21 and 60 days, 90 days, and 120 and 169 days. No morbidity was seen at early time points (i.e., day 14), and long-term follow-up of over 180 days showed a significant reduction in severity compared to all other time points (p<0.0001 spinal cord, p<0.0001 DRG D90, p<0.001 DRG other time points).

[0288] Effect of animal characteristics on the severity of DRG pathology Age at the time of vector administration significantly affected the severity of pathology. Juvenile animals had less severe DRG degeneration (p = 0.003) compared with adults, but similar spinal cord axonopathy (Figure 25A). Four animals treated as infants had no signs of DRG or spinal cord pathology, as previously reported (J. Hordeaux et al. Hum Gene Ther 30, 957-966, 2019). This result should be interpreted with caution due to the small n and possible influence of the study endpoint (4 years after injection). As shown in Figures 24A-24D, the duration of the study had an effect on the severity of pathology, and it is unclear whether age at injection and / or the duration of the study confirm the absence of pathology. Additionally, and importantly, gender did not affect SC or DRG pathology (Figure 24B).

[0289] Effect of vector characteristics on the severity of DRG morbidity DRG neurodegeneration was present with all capsids, although there were some differences in severity between serotypes (Figure 26A). Such variation, limited to the DRG and not seen in the spinal cord score, may be meaningless because the DRG represents a mosaic that is more susceptible to sampling artifacts than spinal cord sections. AAV1 was significantly worse than AAVhu68 (p = 0.01 spinal cord, p = 0.0004 DRG), and AAV1 than AAV9 (p = 0.007 spinal cord and DRG - Figure 26A). The ubiquitous promoters CAG, CB7, and UbC were all similar to each other, whereas CAG caused worse axonopathy than hSyn (p = 0.028), and MeP426 worse than CB7 (p = 0.001), UbC (p = 0.002), and hSyn (p = 0.0003, Figure 26B). Twenty different transgenes were tested, and all but one caused DRG pathology (Figure 26C). The severity of pathology varied greatly between transgenes (mean spinal cord axonopathy scores ranging from 0.5 to 2.7). The severity of pathology was 20-25% lower with non-secreted transgenes compared to secreted transgenes (Figure 26D; for DRG, secreted mean = 0.61, non-secreted mean = 0.47, p = 0.05; for SC, secreted mean = 1.17, non-secreted mean = 0.94, p = 0.02). Furthermore, the purification method (i.e., iodixanol in the non-GLP study and column chromatography in the GLP study) did not affect the presence or severity of DRG pathology (Figure 26D).

[0290] Regional severity and clinical manifestations of DRG pathology Regional differences in pathology were evaluated for the cervical, thoracic, and lumbar spine. The trigeminal ganglion (TRG) also exhibited similar characteristics to the DRG, which is located at the base of the skull inside the subarachnoid space. Sensory ganglia with signs were analyzed to identify them. Figure 27 shows the distribution and mean of the actual pathology scores in each region. TRG pathology was similar (not significantly) to cervical and lumbar DRGs, but thoracic DRGs had lower severity scores (p = 0.007). All SC region scores were significantly worse than their corresponding DRG scores (p < 0.0001), indicating consistent SC-matched axons from several DRGs, which contain more lesions. The majority of sections had normal or low (grade 1) severity scores, with grade 4 scores rarely reported and grade 5 scores very rarely reported (grade 5 corresponds to more than 95% of the tissue surface affected by the lesion in the mean high-power field) (Figure 27). A neurological examination was performed, including cage-side assessment of mental status, posture, and gait, as well as restrained assessment of cranial nerves, proprioception, motor strength, sensory function, and reflexes. Of 204 animals administered AAV ICM or LP, only three developed overt pathology with clinical signs of ataxia and / or tremor. All three received vectors encoded GFP at doses exceeding 1E+13GC, and pathology manifested 21 days after injection. Nerve conduction velocity in the median nerve was recorded in 56 animals. Two developed significant bilateral sensory amplitude reduction 28 days after injection that persisted until necropsy. This correlated with significant axonopathy (grade 4 severity) and endoneurial fibrosis of the median nerve, but without obvious clinical sequelae. Most animals had low-grade axonopathy and fibrosis in the peripheral nerves (Figures 28A and 28B).

[0291] Consideration DRG pathology and secondary axonal damage were minimal in most of our NHP studies and can be difficult to detect with the untrained eye. In our first GLP toxicity study evaluating ICM AAV administration (J. Hordeaux, et al. Mol Ther Methods Clin Dev 10, 79-88, 2018), the CRO who performed the initial pathology assessment missed lesions that were only detected by a peer-reviewed pathologist experienced in neuropathology. Because neurodegeneration is sparse and DRGs are a mosaic of mostly normal neurons and few degenerative events on a given section, we found that collecting multiple DRGs (at least three per spinal cord region is recommended) is necessary for robust histological analysis. A simpler method of detecting and quantifying DRG neuronal damage involves assessing secondary consequences of pathology within the cell body by assessing axonal degeneration in the spinal cord. This is easier to detect and represents a cross-sectional view of ascending fibers originating from multiple DRGs.

[0292] By collecting and carefully analyzing the correct tissues, we found some evidence of DRG pathology in 83% of NHPs receiving AAV ICM and 32% of NHPs receiving AAV IV. The IV dose showing pathology was as low as 1E+13GC / kg, a dose currently being evaluated in clinics for several hemophilia trials (B.S. Doshi and V.R. Ther Adv Hematol 9, 273-293, 2018). The production and purification method did not affect pathology. All capsids and all promoters we tested showed some level of DRG pathology, suggesting that modifying the capsid or promoter is not a viable solution. With regard to the design of preclinical studies and clinical translation, we found that dose and age at injection significantly affected severity, while gender did not. The aspect of our study that has the greatest impact on the severity of pathology is the transgene, which is consistent with our hypothesis that overexpression of the transgene drives the early events leading to degeneration. For most transgenes, we were unable to identify a no-observed-adverse-effect level (NOAEL) above the minimal effective dose (MED).

[0293] The time course is such that acute time points (i.e., ≤14 days) show no histopathology, while longer time points show no histopathology. Shorter studies (i.e., >180 days) tend to show less severe morbidity, suggesting a lack of progression over time and possible partial remission, an important consideration for study design. Our experience with health authorities includes incorporating two necropsy time points: one after the onset of morbidity (i.e., approximately 1 month) and one to demonstrate no worsening of morbidity (i.e., 4–6 months). Four NHP infants administered at 1 month of age included in our meta-analysis were notable for the absence of DRG and SC axonal pathology, despite good transgene expression levels when the animals were necropsied nearly 4 years after injection (J. Hordeaux et al. Hum Gene Ther 30, 957–966, 2019). This observation may suggest a better safety profile when administered to infants, or that acute morbidity does not progress and actually resolves. There were no early autopsies in this study.

[0294] None of the animals receiving the therapeutic transgene (i.e., not a reporter gene such as GFP) showed clinical findings. In a later study, we incorporated routine monitoring of sensory neuron pathology using nerve conduction velocity measurements. We found NCV abnormalities in two animals associated with more severe peripheral axonopathy and fibrosis (i.e., grade 4 severity) without evidence of clinical sequelae.

[0295] In summary, we have shown that DRG morbidity is a consistent finding in nearly all NHP studies, both when AAV vectors are delivered to the intrathecal space and, in many studies, when higher doses are administered systemically. Our meta-analysis reveals a surprising lack of significant clinical sequelae. Careful analysis of other nonclinical studies in other species has failed to show evidence of DRG morbidity, with the exception of neonatal pigs, suggesting that NHPs are the best model for assessing this potential morbidity. Monitoring sensory neuropathy in human CNS studies and high-dose IV studies appears prudent to determine whether clinically significant DRG morbidity occurs.

[0296] Example 7: Development of AAVrh91-mediated MPS1 gene therapy Preclinical studies will be conducted to evaluate the effect on safety and efficacy of DRG detargeting miRNA target sites for MPS1 transgene delivery. As described in Example 2, a strategy to suppress transgene expression in the DRG by cloning four tandem repeats of miR183, a DRG-enriched miR target, in the 3'UTR region of the expression cassette was effective in eliminating GFP expression in the DRG while conferring some enhancement of transgene expression elsewhere (brain, liver, heart). When tested in NHPs, the four tandem repeats reduced expression in the DRG, and 1x10 mice receiving AAVhu68.hIDUA-4xmiR183 were significantly more sensitive than animals injected with AAVhu68.hIDUA at the same dose. 13 An 80% reduction in mRNA ISH signal was observed in transduced DRGs from GC ICM-injected NHPs. This reduction was sufficient to completely prevent DRG pathology and secondary axonal damage. The studies described below utilize capsids with improved tropism and biodistribution in the CNS, AAVrh91 (AAV1 variant), and / or delivery using Ommaya reservoirs for CNS-targeted administration, as is common for clinical drug administration and sampling.

[0297] Non-clinical research studies NHP Pilot Study - Comparison of NextGen DRG and Capsid This study is designed to obtain preliminary data on safety, pharmacology, and vector biodistribution following intracisternal administration (ICM) to rhesus monkeys. Research design: Vector: 1.AAVhu68.hIDUA coV1 2.AAVrh91.hIDUA coV1 3.AAVrh91.hIDUA coV1.4xmiR183 4.AAVrh91.hIDUA coV1.4xmiR182 Number of animals: 15 (n=3 / group) Administration route: ICM ●Dose: 3x10 13 GC ●Survival period: 90 days

[0298] In-life analyses will include daily cageside observations, standardized neurological assessments, periodic bleeding for serum chemistry panel, complete blood count, coagulation panel, complement activation, liver function tests, periodic CSF taps for CSF chemistry, and cell counts. Serum and PBMCs will be collected to investigate humoral and cellular immune responses to the capsid and transgene.

[0299] After completing the survival phase of the study 90 days after vector administration, a full necropsy will be performed with tissues collected for comprehensive histopathological examination (by a peer-reviewed, board-certified veterinary pathologist), analysis of vector biodistribution by quantitative PCR, and quantification of hIDUA expression. Lymphocytes will be collected from the blood, spleen, liver, and deep cervical lymph nodes, and CTLs in these organs will be examined at necropsy. Vectors carrying miR targeting sequences are expected to best reduce and / or eliminate DRG degeneration and associated axonopathy while exhibiting optimal biodistribution in key tissues.

[0300] NHP Pilot Study - AAVrh91 Vector with ICV Reservoir A study will be conducted to evaluate the safety, pharmacology, and vector biodistribution following administration of AAV.GFP via an intraventricular reservoir / catheter system implanted in rhesus monkeys. Following this study, vectors will be selected for evaluation via this route of administration. Research design: Number of animals: 3 Administration route: ICV ●Dose: 3x10 13 GC ●Survival period: 90 days

[0301] Survival analyses will include daily cageside observations, standardized neurological assessments, periodic bleeding for serum chemistry panels, complete blood counts, coagulation panels, complement activation, liver function tests, periodic CSF taps for CSF chemistry, and cell counts. Serum and PBMCs will be collected to investigate humoral and cellular immune responses to the capsid and transgene.

[0302] Following completion of the survival phase of the study 90 days after vector administration, a full necropsy will be performed with tissues collected for comprehensive histopathological examination (by a peer-reviewed, board-certified veterinary pathologist), analysis of vector biodistribution by quantitative PCR, and quantification of hIDUA expression. Lymphocytes will be collected from the blood, spleen, liver, and deep cervical lymph nodes to e...

Claims

**Claim 1** A recombinant adeno-associated virus (rAAV) comprising an AAV capsid packaging a vector genome therein, wherein the vector genome comprises a coding sequence for functional human alpha-L-iduronidase (hIDUA) comprising at least amino acids 28 to 653 of SEQ ID NO: 21, and a regulatory sequence directing the expression of the hIDUA in a cell, and the coding sequence comprises a) nucleotides 82 to 1959 of SEQ ID NO: 22, or a sequence at least 95% identical thereto, b) nucleotides 82 to 1959 of SEQ ID NO: 23, or a sequence at least 95% identical thereto, c) nucleotides 82 to 1959 of SEQ ID NO: 24, or a sequence at least 95% identical thereto, d) nucleotides 82 to 1959 of SEQ ID NO: 25, or a sequence at least 95% identical thereto, or e) nucleotides 82 to 1959 of SEQ ID NO: 26, or a sequence at least 95% identical thereto, and the vector genome comprises at least two dorsal root ganglion (drg)-specific miRNA target sequences each specific for miR-183 or miR-182 and operably linked to the 3' end of the coding sequence, rAAV. **Claim 2** The rAAV according to claim 1, wherein the capsid is an AAV9, AAVhu68, or AAVrh91 capsid. **Claim 3** An expression cassette comprising a nucleic acid sequence encoding functional human alpha-L-iduronidase (hIDUA) and a regulatory sequence directing the expression of the hIDUA in a cell containing the expression cassette, and the coding sequence comprises a) nucleotides 82 to 1959 of SEQ ID NO: 22, or a sequence at least 95% identical thereto, b) nucleotides 82 to 1959 of SEQ ID NO: 23, or a sequence at least 95% identical thereto, c) nucleotides 82 to 1959 of SEQ ID NO: 24, or a sequence at least 95% identical thereto, d) nucleotides 82 to 1959 of SEQ ID NO: 25, or a sequence at least 95% identical thereto, or e) nucleotides 82 to 1959 of SEQ ID NO: 26, or a sequence at least 95% identical thereto. The vector genome contains at least two dorsal root ganglion (drg)-specific miRNA target sequences, each specific to miR-183 or miR-182 and operably linked to the 3' end of the coding sequence. Expression cassette. Claim 4 The rAAV according to any one of claims 1 or 2 or the expression cassette according to claim 3, wherein the hIDUA contains a natural hIDUA signal peptide. Claim 5 The rAAV according to any one of claims 1, 2 or 4 or the expression cassette according to claim 3 or 4, wherein the hIDUA contains amino acids 1 to 653 of SEQ ID NO:

21. Claim 6 The coding sequence is a) nucleotides 1 to 1959 of SEQ ID NO: 22 or a sequence at least 95% identical thereto, b) nucleotides 1 to 1959 of SEQ ID NO: 23 or a sequence at least 95% identical thereto, c) nucleotides 1 to 1959 of SEQ ID NO: 24 or a sequence at least 95% identical thereto, d) nucleotides 1 to 1959 of SEQ ID NO: 25 or a sequence at least 95% identical thereto, or e) nucleotides 1 to 1959 of SEQ ID NO: 26 or a sequence at least 95% identical thereto, the rAAV according to any one of claims 1, 2, 4 or 5 or the expression cassette according to any one of claims 3 to 5. Claim 7 The rAAV according to any one of claims 1 or 2 or the expression cassette according to claim 3, wherein the hIDUA contains a heterologous signal peptide. Claim 8 The rAAV according to any one of claims 1, 2 or 4 to 7 or the expression cassette according to any one of claims 3 to 7, wherein the regulatory sequence contains a tissue-specific promoter. Claim 9 The at least two miRNA target sequences are a) AGTGAAATTCTACCAGTGCCATA (SEQ ID NO: 1), and / or b) AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 3). The rAAV according to any one of claims 1, 2 or 4 to 8 or the expression cassette according to any one of claims 3 to 8. **Claim 10**: The rAAV according to any one of claims 1, 2, or 4-9, or the expression cassette according to any one of claims 3-9, wherein at least three or at least four miRNA target sequences, each specific for miR-183 or miR-182, are present and operably linked to the 3'-end of the coding sequence. **Claim 11** The expression cassette according to any one of claims 3-10, wherein the expression cassette is carried by a non-viral vector or a viral vector. **Claim 12**: (i) The non-viral vector is naked DNA, naked RNA, inorganic particles, lipid particles, a polymer-based vector, or a chitosan-based formulation, or (ii) The viral vector is a recombinant parvovirus, recombinant lentivirus, recombinant retrovirus, or recombinant adenovirus, the expression cassette according to claim 11. **Claim 13** A recombinant nucleic acid comprising a sequence encoding functional hIDUA, wherein the coding sequence is nucleotides 82-1959 or nucleotides 1-1959 of SEQ ID NO: 22, 23, 24, 25, or 26, or a sequence at least 95% identical to SEQ ID NO: 22, 23, 24, 25, or 26, and at least two drg-specific miRNA target sequences, each specific for miR-183 or miR-182 and operably linked to the 3'-end of the coding sequence. **Claim 14** The recombinant nucleic acid according to claim 13, wherein the recombinant nucleic acid is a plasmid. **Claim 15** A host cell comprising the rAAV according to any one of claims 1, 2, or 4-10, the expression cassette according to any one of claims 3-10, or the recombinant nucleic acid according to any one of claims 13 or 14. **Claim 16** A pharmaceutical composition comprising the rAAV according to any one of claims 1, 2, or 4-10, the expression cassette according to any one of claims 3-10, or the recombinant nucleic acid according to claim 13 or 14, and a pharmaceutically acceptable carrier. **Claim 17** The rAAV according to any one of claims 1, 2, or 4-10, or the pharmaceutical composition according to claim 16, for use in the treatment of mucopolysaccharidosis type I (MPS I), Hurler syndrome, Hurler-Scheie syndrome, and / or Scheie syndrome. **Claim 18** The pharmaceutical composition for use according to claim 17, further comprising performing the treatment in combination therapy.

Images