Methods and products for generating single-stranded DNA polynucleotides

Abstract

The present invention provides methods for generating single-stranded DNA polynucleotides. In particular, the present invention provides methods that utilize DNA minicircles obtained from a parent minicircle plasmid as a template in an enzyme-mediated rolling circle amplification (RCA) reaction to form products that can be cleaved to yield a plurality of single-stranded DNA polynucleotides.

Description

Technical Field

[0001] The present invention relates to a method for generating single-stranded DNA polynucleotides. In particular, the present invention uses a DNA minicircle obtained from a parental minicircle plasmid as a template in an enzyme-related rolling circle amplification (RCA) reaction to form a plurality of single-stranded DNA polynucleotides (e.g., a library comprising a plurality of different single-stranded DNA polynucleotides). The present invention also provides the use of a parental minicircle plasmid in the production of a plurality of single-stranded DNA polynucleotides. Also provided are parental minicircle plasmids, kits for use in the method (e.g., kits comprising parental minicircle plasmids), and single-stranded DNA polynucleotides obtained by the method. Furthermore, the present invention provides a library comprising a mixture of single-stranded DNA polynucleotides obtained by the method (e.g., functionalized single-stranded DNA polynucleotides).

Background Art

[0002] Single-stranded DNA polynucleotides are useful in a wide range of applications due to their ability to hybridize, for example intermolecularly, with complementary sequences via Watson-Crick base pairing. Furthermore, single-stranded polynucleotides can hybridize to themselves (i.e., intramolecular complementarity) to form complex geometric arrangements and molecular assemblies, including secondary structures known as aptamers. Such aptamers can bind to biological targets with high affinity via non-covalent interactions, resulting in a variety of different functions.

[0003] Currently, single-stranded DNA polynucleotides can be generated using solid-phase synthesis, in which nucleotides are added stepwise to a growing chain attached to a solid support. However, this method can be severely limited with respect to the length and accuracy of the polynucleotide produced. The error rate in the production of polynucleotides by solid-phase synthesis is significantly higher than the error rate of polymerase enzymes observed in nature and increases dramatically with the length of the polynucleotide, so that commercially available polynucleotides of approximately 50 nucleotides in length typically have only 70% purity. This error rate makes the solid-phase synthesis method unsuitable for the production of long polynucleotides.

[0004] As an alternative to such solid-phase synthesis methods, the inventors have previously shown a method for the enzymatic production of "monoclonal stoichiometric" (MOSIC) single-stranded DNA oligonucleotides from sequence-verified templates (Non-Patent Document 1). In a representative example, this MOSIC method involves the design and preparation of a linear sequence containing one or more oligonucleotide sequences to be generated adjacent to a hairpin sequence, each containing a restriction enzyme site. Subsequently, the linear sequence is circularized into a double-stranded rolling circle amplification (RCA) template, nicked therein, and amplified by RCA to produce a partially single-stranded linear concatemer containing multiple copies of the single-stranded oligonucleotide to be generated. Finally, the RCA product is treated with a restriction enzyme that recognizes the restriction site in the above hairpin region and cleaves the concatemer to release multiple single-stranded oligonucleotides. When the linear sequence contains two or more oligonucleotide sequences, the cleavage reaction results in a mixture of the desired oligonucleotides. The ratio of oligonucleotides in the mixture is determined by the number of each oligonucleotide sequence in the original linear sequence.

[0005] The step of circularizing a linear array to generate a circular RCA template is generally performed by a conventional ligation reaction using a ligase enzyme. However, in the research leading to the present invention, the inventors have confirmed that in the conventional ligation reaction, the efficiency of generating a circularized RCA template decreases as the length of the linear molecule to be circularized increases. For example, intramolecular circularization of linear molecules having a length of about 1 kilobase (kb) or more using a conventional ligation reaction is very inefficient. When using such long linear templates, the ligation reaction results mainly in intermolecular ligation rather than intramolecular ligation, so that predominantly linear concatemers are generated rather than circularized DNA molecules. As a result, when the linear sequence used to generate the RCA template is long (e.g., having a length of about 1 kb or more), for example, when it is desired to generate long polynucleotides and / or a number of oligonucleotides having different sequences, this method must include an additional step of isolating circular DNA molecules from the linear concatemers after the ligation reaction and concentrating the circular DNA molecules so that they can be used as RCA templates. These additional steps make the process more time-consuming and thus more expensive. In some cases, it may not be suitable for generating sufficient circular DNA molecules to serve as templates for the RCA reaction.

[0006] In view of such problems, an alternative method for generating single-stranded polynucleotides, particularly an effective method for forming long polynucleotides (e.g., about 1 kb or more) and / or a number of oligonucleotides having different sequences, is desired.

[0007] In connection with gene therapy, it has been shown that excellent transfection rates and long-term expression of transgenes in host cells can be achieved by removing bacterial gene cassettes (e.g., origins of replication, antibiotic resistance genes, etc., which are mainly required for the growth of the plasmid itself) from recombinant plasmids containing the desired transgene (Non-Patent Document 2).

[0008] Therefore, to generate small plasmids known as DNA minicircles containing transgene expression cassettes, so-called minicircle systems were designed to utilize the bacterial machinery that both propagates the plasmid and excises the unwanted DNA fragments described above from the plasmid (Non-Patent Document 3, incorporated herein by reference). Thus, the initial plasmid can be considered the "parent minicircle plasmid" that gives rise to the DNA minicircle.

[0009] These minicircle systems generally involve the use of a recombinase enzyme (sometimes called an "integrase") that mediates a recombination reaction between two recombinase binding sites present on the parent minicircle plasmid. The parent minicircle plasmid is designed to contain a transgene expression cassette flanked (bordered) by recombinase binding sites. The recombination reaction between the two recombinase binding sites forms a DNA minicircle containing the intervening transgene. Thus, the DNA minicircle is effectively excised from the larger parent minicircle plasmid, discarding the unwanted bacterial gene cassette here. The DNA minicircle can be used to transfect cells and thus improve the efficiency of subsequent gene therapy.

Prior Art Documents

Non-Patent Documents

[0010]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Summary of the Invention

Means for Solving the Problems

[0011] The inventors have surprisingly confirmed that the minicircle system can be adapted to generate circularized RCA templates suitable for the efficient production of single-stranded DNA polynucleotides, especially long polynucleotides (e.g., about 1 kb or more). In this context, the inventors have developed parental minicircle plasmids known as pM1, pM2 and pM3 (SEQ ID NOs: 1, 27 and 28 respectively). These are found to be particularly useful for the formation of RCA templates for use in the MOSIC method for generating single-stranded DNA polynucleotides.

[0012] The formation of RCA templates for the production of single-stranded DNA polynucleotides using the minicircle system has many advantages over the original MOSIC method. The MOSIC method generally involves the production of a linear sequence containing the oligonucleotide sequence to be generated, which is inserted into a plasmid such that its sequence is confirmable (e.g., by sequencing) and amplifiable by growth in bacterial cells. The plasmid is then purified from the bacteria, and the sequence containing the oligonucleotide sequence to be generated is excised from the plasmid, purified, and then religated (this religation process generally includes additional steps of purification as described above) to form an RCA template.

[0013] By adapting the mini-circle system for use in the present method, the inventors were able to dramatically reduce the number of steps in this process. The DNA mini-circles that function as RCA templates in the MOSIC method can be isolated directly from bacterial cultures containing the parental mini-circle plasmid without the need for excision, purification, and religation. In particular, DNA mini-circles can also be generated in vitro from the parental mini-circle plasmid. In some embodiments, the parental mini-circle plasmid may be arranged or configured to allow excision of the DNA mini-circle following degradation of any intact parental mini-circle plasmid (i.e., a non-recombinant plasmid) and the backbone plasmid (i.e., the region of the parental mini-circle plasmid outside the recombinase binding sites). This ensures that only the excised DNA mini-circles can function as templates for RCA. In some embodiments, the RCA reaction may utilize primers complementary only to the region of the excised DNA mini-circle. Thus, in some embodiments, it is not necessary to separate the DNA mini-circle following excision from the parental mini-circle plasmid. Therefore, the present method reduces the need for additional purification steps and allows for the generation of RCA templates in even higher yields.

[0014] Thus, the inventors confirmed that the mini-circle approach enables the efficient generation of large circularized RCA templates, e.g., templates that are about 1 kb or longer in length. This is particularly advantageous for the generation of long (e.g., about 1 kb or longer) single-stranded DNA polynucleotides and / or for the generation of multiple oligonucleotides with different sequences in a single reaction.

[0015] Accordingly, most broadly, the present invention provides for the use of DNA minicircles obtained from parental minicircle plasmids in the generation of a plurality of single-stranded DNA polynucleotides, wherein the DNA minicircles contain a polynucleotide sequence of interest adjacent to a cleavage domain. The DNA minicircles are used in an RCA reaction to form an RCA product that can be cleaved to generate a plurality of single-stranded DNA polynucleotides.

[0016] In particular, the present invention provides for the use of a plurality of DNA minicircles obtained from a plurality of parental minicircle plasmids in the generation of a plurality of single-stranded DNA polynucleotides, wherein each DNA minicircle contains a polynucleotide sequence of interest adjacent to a cleavage domain. The DNA minicircles are used in an RCA reaction to form an RCA product that can be cleaved to generate a plurality of single-stranded DNA polynucleotides.

[0017] Viewed another way, the present invention provides for the use of parental minicircle plasmids in the generation of a plurality of single-stranded DNA polynucleotides, wherein the DNA minicircles obtained from the parental minicircle plasmids contain a polynucleotide sequence of interest adjacent to a cleavage domain.

[0018] In particular, the present invention provides for the use of a plurality of parental minicircle plasmids in the generation of a plurality of single-stranded DNA polynucleotides, wherein the plurality of DNA minicircles obtained from the parental minicircle plasmids each contain a polynucleotide sequence of interest adjacent to a cleavage domain.

[0019] Viewed another way, the present invention provides a method for generating a plurality of single-stranded DNA polynucleotides, the method comprising: (a) preparing a DNA minicircle obtained from a parental minicircle plasmid, wherein the DNA minicircle contains a polynucleotide sequence of interest adjacent to a cleavage domain; (b) Using the DNA minicircle of (a) as a template, performing a rolling circle amplification (RCA) reaction to generate an RCA product containing multiple copies of the polynucleotide sequence of interest adjacent to the cleavage domain; (c) Cleaving the RCA product with the cleavage domain to release the multiple single-stranded DNA polynucleotides.

[0020] Thus, in particular, the present invention provides a method for generating multiple single-stranded DNA polynucleotides, the method comprising: (a) Preparing a plurality of DNA minicircles obtained from a plurality of parental minicircle plasmids, each said DNA minicircle containing a polynucleotide sequence of interest adjacent to a cleavage domain; (b) Using the DNA minicircle of (a) as a template, performing a rolling circle amplification (RCA) reaction to generate a plurality of RCA products, each containing multiple copies of the polynucleotide sequence of interest adjacent to a cleavage domain; (c) Cleaving the RCA products with the cleavage domain to release the multiple single-stranded DNA polynucleotides.

[0021] The term "plasmid" refers to an extrachromosomal circular DNA molecule that can replicate autonomously in a host cell, such as a prokaryotic cell or a bacterial cell.

[0022] The term "parent minicircle plasmid" refers to a plasmid that can recombine in the presence (and under suitable conditions) of a site-specific recombinase enzyme to form two circular DNA molecules that are both smaller than the original plasmid. Generally, a parent minicircle plasmid includes a first domain containing a polynucleotide of interest, which is adjacent to a recombinase binding site at which the recombinase enzyme acts, and a second domain containing elements required for replication, propagation, and maintenance within the host cell of the plasmid, such as an origin of replication, a selection marker (e.g., an antibiotic resistance gene), etc. As described below, the parent minicircle plasmid may include additional elements, particularly in the second domain. Thus, recombination of the parent minicircle plasmid results in a first circular DNA molecule (circle), so-called "minicircle", containing the polynucleotide of interest, and a second circular DNA molecule (circle) containing elements required for replication, propagation, and maintenance within the host cell, i.e., the plasmid backbone. Accordingly, a parent minicircle plasmid can also be regarded as a "minicircle-producing plasmid" or a "minicircle plasmid", and these terms are used synonymously herein.

[0023] In the present invention, the polynucleotide of interest in the first domain of the parent minicircle plasmid includes a polynucleotide to be produced, which is adjacent to a cleavage domain. This sequence, which includes one or more desired polynucleotide sequences adjacent to the cleavage domain, is called a "pseudogene".

[0024] Therefore, the DNA minicircle prepared in step (a) of the method is produced from the parent minicircle plasmid by a recombination reaction. This recombination reaction is mediated by a recombinase enzyme, which recognizes the recombinase binding site in the parent minicircle plasmid, and between the binding sites there is a sequence containing a polynucleotide to be produced that is adjacent to a cleavage domain.

[0025] Therefore, in the method of the present invention, the step of preparing the DNA minicircle may include several stages. For example, in some embodiments, the present invention may include the step of obtaining the DNA minicircle from a parental minicircle plasmid.

[0026] The step of obtaining the DNA minicircle from the parental minicircle plasmid may be achieved by any suitable means. As described above, the DNA minicircle can be generated by contacting a recombinase enzyme capable of recombining the parental minicircle plasmid via a binding site with the parental minicircle plasmid under conditions suitable for the recombination reaction. Therefore, the recombination reaction may be carried out in vitro. However, in a preferred embodiment, the DNA minicircle is generated in vivo, for example, by growing the parental minicircle plasmid in a host cell (such as a bacterial cell) capable of expressing a site-specific recombinase enzyme that acts on the recombinase binding site in the parental minicircle plasmid. Therefore, in some embodiments, step (a) may include the step of preparing a host cell containing the parental minicircle plasmid, where the host cell is capable of expressing a site-specific recombinase enzyme that acts on the recombinase binding site of the parental minicircle plasmid. In particular, step (a) may include the step of preparing a plurality of host cells, each containing a plurality of copies of the parental minicircle plasmid, where the host cell is capable of expressing a site-specific recombinase enzyme that acts on the recombinase binding site of the parental minicircle plasmid.

[0027] In some embodiments, the method may include the step of amplifying the parental minicircle plasmid, e.g., the step of growing a host cell (e.g., a bacterial cell) containing the parental minicircle plasmid. In some embodiments, the method may include the step of inducing the expression of a recombinase enzyme in a host cell (e.g., a bacterial cell) that acts to recombine the parental minicircle plasmid to form a DNA minicircle. In another view, the expression of a site-specific recombinase in a host cell promotes the formation of DNA minicircles in the cell. Suitable conditions for growing bacteria can be selected by those skilled in the art because they are well known in the art depending on the particular bacterial host used.

[0028] The selection of a suitable host cell (e.g., a bacterial cell) will depend on the structure of the parental minicircle plasmid. As described above, the second domain of the parental minicircle plasmid may contain many additional elements with various functions.

[0029] For example, in some embodiments, the parental minicircle plasmid may contain a sequence encoding a recombinase enzyme used in the recombination reaction to form a DNA minicircle (e.g., pM2 and pM3). Alternatively, in some embodiments, the parental minicircle plasmid may not contain a sequence encoding a recombinase enzyme. Thus, in some embodiments, the parental minicircle plasmid is grown in a host cell (e.g., a bacterial cell) that contains a sequence encoding a recombinase enzyme that recognizes a recombinase binding site present in the parental minicircle plasmid in the genome or on a separate plasmid.

[0030] In some embodiments, the sequence encoding the recombinase enzyme is operably linked to an inducible promoter. The use of an inducible promoter ensures that the recombinase is not expressed (or minimally expressed) until a sufficient number of cells containing the parental minicircle plasmid have been grown to obtain a sufficient amount of DNA minicircles for use in the methods of the invention. Thus, the step of inducing expression of the recombinase enzyme in the host cell(s) may include contacting the cell(s) with a substance that directly or indirectly promotes (e.g., increases) the expression of the recombinase enzyme.

[0031] In some embodiments, the step of obtaining DNA minicircles from the parental minicircle plasmid includes contacting the parental minicircle plasmid with a recombinase enzyme in vitro (e.g., in a solution in a reaction vessel), and the recombinase enzyme can recombine the parental minicircle plasmid via a binding site. The step of contacting the parental minicircle plasmid with the recombinase enzyme is performed under conditions suitable for the recombination reaction.

[0032] When the step of obtaining DNA minicircles from the parental minicircle plasmid is performed in vitro, it may be preferred that the parental minicircle plasmid does not encode the recombinase enzyme. Thus, in some embodiments, the parental minicircle plasmid does not encode the recombinase enzyme.

[0033] One skilled in the art can readily determine which in vitro conditions (e.g., buffer, temperature, reactant concentration) are suitable for the recombination reaction, and these conditions will vary depending on the recombinase enzyme used in the reaction. In some embodiments, suitable conditions include those that result in a yield of at least about 30% of DNA minicircles from the parental minicircle plasmid, e.g., a yield of at least about 40%, 50%, 60% or 70% of DNA minicircles. Alternatively, the step of contacting the parental minicircle plasmid with a recombinase enzyme in vitro under suitable conditions results in the generation of DNA minicircles from at least about 30% of the parental minicircle plasmids in the in vitro reaction, e.g., at least about 40%, 50%, 60% or 70%.

[0034] The term "recombinase" or "recombinase enzyme" refers to an enzyme that catalyzes a site-specific DNA exchange reaction between target site sequences (often referred to as "binding sites") specific to each recombinase. Any suitable recombinase enzyme capable of participating in the recombination reaction using binding sites on the plasmid may be used in the methods of the invention. In some embodiments, the recombinase is a serine integrase, e.g., PhiC31 integrase or ParA resolvase. In some embodiments, the recombinase is a tyrosine integrase, e.g., Cre recombinase, bacteriophage λ integrase or FLP recombinase. Thus, suitable recombinase enzymes include PhiC31 integrase, ParA resolvase, Cre recombinase, bacteriophage λ integrase, Hin recombinase, Tre recombinase and FLP recombinase.

[0035] As used herein, the term "recombinase" includes all such modified derivatives, including not only naturally occurring enzymes but also derivatives of naturally occurring recombinase enzymes.

[0036] Particularly preferred recombinase enzymes for use in the present invention include PhiC31 integrase, ParA resolvase, FLP recombinase and derivatives thereof, such as sequence-modified derivatives, or mutants.

[0037] Sequence-modified derivatives or mutants of the recombinase enzyme include mutants that retain at least some of the functional activities of the wild-type sequence. The mutations can, for example, affect the activity profile of the enzyme under various reaction conditions such as temperature, substrate concentration, pH, etc., for example, increasing or decreasing the recombination rate. The mutations or sequence modifications can also affect the thermal stability of the enzyme.

[0038] In some embodiments, the recombinase enzyme may be PhiC31 integrase (e.g., UniProtKB accession number Q9T221). This enzyme is a site-specific recombinase derived from the phiC31 bacteriophage, which recognizes the recombinase binding sites attB and attP (SEQ ID NOs: 4 and 5). Thus, in some embodiments, the parental minicircle plasmid contains a sequence encoding PhiC31 integrase. In some embodiments, the host cell genome contains a sequence encoding PhiC31 integrase, or the host cell contains a plasmid containing a sequence encoding PhiC31 integrase. In some embodiments, the sequence encoding PhiC31 integrase is operably linked to an inducible promoter.

[0039] In some embodiments, the recombinase enzyme is ParA resolvase (e.g., UniProtKB accession number P22996). This enzyme is a site-specific recombinase encoded on the IncP-alpha RP4 plasmid of Escherichia coli (E. coli), which recognizes the recombinase binding sites mrs_l and mrs_r (SEQ ID NOs: 29 and 30). Thus, in some embodiments, the parental minicircle plasmid contains a sequence encoding ParA resolvase (e.g., pM3, SEQ ID NO: 28). In some embodiments, the host cell genome contains a sequence encoding ParA resolvase, or the host cell contains a plasmid containing a sequence encoding ParA resolvase. In some embodiments, the sequence encoding ParA resolvase is operably linked to an inducible promoter.

[0040] In some embodiments, the recombinase enzyme is FLP recombinase (e.g., UniProtKB accession number P03870). This enzyme is a site-specific recombinase encoded by Saccharomyces cerevisiae (S. cerevisiae), which recognizes the recombinase binding sites FLPr and FLPl (SEQ ID NOs: 31 and 32). Thus, in some embodiments, the parental minicircle plasmid contains a sequence encoding FLP recombinase (e.g., pM2, SEQ ID NO: 27). In some embodiments, the host cell genome contains a sequence encoding FLP recombinase, or the host cell contains a plasmid containing a sequence encoding FLP recombinase. In some embodiments, the sequence encoding FLP recombinase is operably linked to an inducible promoter.

[0041] As described above, the parental minicircle plasmid may be grown in any suitable host cell. The host cell may be a prokaryotic (e.g., bacterial) or eukaryotic (e.g., yeast) cell that can preferably maintain plasmid replication at a high copy number. In preferred embodiments, the cell is a prokaryotic cell, such as a bacterial cell, e.g., E. coli.

[0042] In some embodiments, a suitable host cell (e.g., a bacterial cell) may have features that facilitate the production of DNA minicircles from the parental minicircle plasmid. For example, in some embodiments, the host cell may be able to express a suitable recombinase, i.e., a recombinase that can recognize the recombinase binding sites in the parental minicircle plasmid. In some embodiments, the nucleic acid encoding the recombinase is operably linked to an inducible promoter as described above. In a preferred embodiment, the gene encoding the recombinase is integrated into the host cell genome. However, the gene encoding the recombinase may be provided on a plasmid within the host cell.

[0043] In some embodiments, the host cell may be able to express an endonuclease (e.g., a homing endonuclease and / or a nickase) that has been found to be useful in the present method, e.g., an endonuclease that can recognize and cleave one or more cleavage domains in the parental minicircle plasmid. In some embodiments, the nucleic acid encoding the endonuclease is operably linked to an inducible promoter, e.g., the same inducible promoter system used to control the expression of the recombinase as described above. In a preferred embodiment, the gene encoding the endonuclease is integrated into the host cell genome.

[0044] The host cell may contain other features that facilitate the use of the parental minicircle plasmid system in the methods of the present invention. For example, the host cell may be able to express a polymerase enzyme, i.e., a DNA polymerase, that has been found to be useful in the present method as described in more detail below. The expression of the DNA polymerase may be under the control of an inducible promoter system. The inducible promoter system may be the same as or different from the system used to control the expression of other genes, e.g., recombinase and / or endonuclease, in the host cell.

[0045] It will be apparent that host cells capable of expressing enzymes found to be useful in the method of the present invention must be able to express such enzymes in an amount sufficient to achieve the desired function. This may be accomplished by any suitable means. For example, the coding sequence may be operably linked to a strong promoter and / or the host cell may contain multiple copies, e.g., 2, 3, 4, 5 or more copies of the coding sequence.

[0046] As described above, in some embodiments, the expression of enzymes in host cells, e.g., enzymes encoded by a parental minicircle plasmid, enzymes encoded by a separate plasmid, and / or enzymes in the host cell genome, may be controlled by an inducible expression system such that the expression of the enzyme can be readily controlled. Any suitable inducible expression system known in the art may be used, and the selection of a suitable expression system is within the knowledge of one of ordinary skill in the art. Of course, the inducible expression system must be compatible with the host cell and the parental minicircle plasmid. For example, in some embodiments, the inducible expression system may be an arabinose induction system (e.g., the L-arabinose-inducible araCBAD system). Thus, the host cell contains an arabinose transporter such that an inducer can be detected and expression can be induced. In some embodiments, the host cell is an E. coli strain, e.g., an E. coli strain containing the L-arabinose-inducible araCBAD system. In a preferred embodiment, the E. coli strain is ZYCY10P3S3T (see Kay et al., 2010, Nature Biotechnology 28(12), p. 1287-1289, which is incorporated herein by reference). In some embodiments, the E. coli strain is DH10B, Top10 or LMG194.

[0047] Once a parental minicircle plasmid containing a pseudogene has been generated, it will be apparent that a stock of the plasmid may be generated so that the plasmid can be used repeatedly to generate DNA minicircles for use in the claimed method. In other words, it is not necessary to form a fresh parental minicircle plasmid containing a pseudogene each time; rather, it is necessary to generate multiple single-stranded polynucleotide(s) encoded by the pseudogene.

[0048] Nevertheless, in some embodiments, the step of preparing the DNA minicircle may include the step of preparing a parental minicircle plasmid. Thus, in some embodiments, the method may, as a result, include, for example, the step of designing a pseudogene sequence in silico. Thus, the method may utilize a computer-implemented method for designing a pseudogene. Such methods are shown in the art, for example, by Ducarni et al., 2013, supra. The term "pseudogene" as used herein refers to a nucleotide sequence comprising one or more desired polynucleotide sequences adjacent to a cleavage domain. Alternatively, this sequence may be referred to herein as a "nucleic acid construct".

[0049] The pseudogene sequence designed in silico can be generated (e.g., synthesized) using commercially available gene synthesis methods or any other suitable means known in the art, such as assembly PCR. Thus, the method may include the step of generating a pseudogene.

[0050] Next, the pseudogene is introduced into the parental mini-circle plasmid such that the pseudogene can be amplified and subsequently converted into a DNA mini-circle. Thus, the method may include the step of inserting the pseudogene into the parental mini-circle plasmid. Insertion of the pseudogene into the parental mini-circle plasmid can be performed using any suitable means known in the art. For example, the pseudogene may be ligated to the parental mini-circle plasmid using a ligase enzyme as shown below. It will be understood in this context that at least one 5' end of the pseudogene is phosphorylated to enable ligation to occur. In embodiments where the step of generating the pseudogene results in a DNA molecule with unphosphorylated 5' ends, the method may include an additional step of phosphorylating the 5' end(s) of the pseudogene using a kinase enzyme such as, for example, T4 polynucleotide kinase. Of course, the pseudogene sequence must be introduced into the parental mini-circle plasmid such that it is located between the recombinase binding sites in order for the pseudogene sequence to be retained in the DNA mini-circle after the recombination reaction. Thus, the pseudogene is introduced into the parental mini-circle plasmid adjacent to the binding site, and the recombination reaction results in a DNA mini-circle containing the pseudogene. In this context, "adjacent" means that the recombinase binding site is in direct or indirect proximity to the pseudogene sequence.

[0051] The parental mini-circle plasmid containing the pseudogene sequence is then transformed into a suitable host cell (e.g., a bacterial cell) as described above. This allows, for example, the sequence of the pseudogene to be checked (e.g., by sequencing) and any errors in the sequence to be corrected by repeated sequencing and mutagenesis using any suitable method. Furthermore, the process of growing bacteria containing the parental mini-circle plasmid is a useful amplification step, which promotes the formation of a significant copy number of parental mini-circle plasmids and thus ultimately DNA mini-circles that will serve as templates for the RCA reaction.

[0052] In addition to amplification, the process of transfecting bacteria with a parental minicircle plasmid containing a pseudogene also enables the generation of a bacterial glycerol stock. Bacteria containing the desired pseudogene plasmid are prepared in glycerol, frozen, and can be stably stored for a long time.

[0053] Thus, in some embodiments, step (a) of the method comprises (i) cloning a linear DNA molecule comprising a polynucleotide sequence adjacent to a cleavage domain into a parental minicircle plasmid; (ii) transfecting the parental minicircle plasmid obtained in step (i) into a host cell (e.g., a bacterial cell); (iii) amplifying the parental minicircle plasmid (e.g., by growing a host cell containing the parental minicircle plasmid); (iv) performing a recombination reaction to generate a DNA minicircle comprising the polynucleotide sequence adjacent to the cleavage domain (e.g., by inducing expression of a recombinase enzyme in a host cell or contacting an isolated parental minicircle plasmid with a recombinase enzyme in vitro), and optionally, (v) isolating the DNA minicircle obtained in step (iv) and including.

[0054] As described above, if a parental minicircle plasmid containing a pseudogene has been previously generated, step (i) is not required to obtain a DNA minicircle. Similarly, if the parental minicircle plasmid has been previously transfected into a host cell, e.g., to generate a glycerol stock, step (ii) is not required to obtain a DNA minicircle. For example, to amplify the parental minicircle plasmid, the host cell may be directly grown from the glycerol stock.

[0055] Since step (iv) may be performed in vitro, the method may further include the step of isolating the parental minicircle plasmid from, for example, the host cells used to amplify the plasmid. Any means of isolating the plasmid from the host cells may be used for the isolation step, and suitable means are well known in the art.

[0056] The step of isolating the DNA minicircle can be achieved using any suitable means, which will depend on the level of purity required for the next step of the method of the invention, i.e., performing the RCA reaction, and the method by which the DNA minicircle was generated. For example, in embodiments where the DNA minicircle is generated in host cells, the step of isolating the DNA minicircle may include lysing the host cells to release the DNA minicircle. In some embodiments, the host cell lysate may be used directly in the RCA reaction. In some embodiments, the host cell lysate may be subjected to a purification step to obtain a concentrated or purified preparation containing the DNA minicircle.

[0057] In some embodiments, it may be necessary or advantageous to separate the DNA minicircle from other products of the recombination reaction, i.e., the plasmid backbone, and any unreacted (intact) parental minicircle plasmid. In some embodiments, it may be necessary or advantageous to separate the DNA minicircle from components (e.g., cleavage enzymes, recombinase enzymes) that may interfere with the next step of the method of the invention. Separation of the DNA minicircle from other components may be achieved using any suitable means.

[0058] In some embodiments, the separation may involve, for example, physical separation using electrophoresis or chromatography methods, followed by isolation of the DNA minicircle.

[0059] In some embodiments, the separation may involve the breakdown and / or denaturation of components. For example, as further described below, the parental minicircle plasmid may include a cleavage domain (e.g., a nickase cleavage domain) that enables the plasmid backbone and unreacted (unrecombined) parental minicircle plasmid to be degraded or cleaved (e.g., by a cleavage enzyme such as a nickase) after the recombination reaction so that they cannot function as an RCA template. Thus, in some embodiments, the separation of the DNA minicircle from other components (e.g., the plasmid backbone and unreacted (unrecombined) parental minicircle plasmid) may involve contacting the components with a cleavage enzyme under conditions that result in cleavage of the components. This contacting step may be performed in vivo (e.g., in a host cell by inducing the expression of the cleavage enzyme) or in vitro (e.g., by contacting the components, such as a host cell lysate or the product of an in vitro recombination reaction, with the cleavage enzyme). It will be apparent that the products of the degradation (e.g., cleavage) step may be further purified to isolate the DNA minicircle.

[0060] Thus, in some embodiments, the step of isolating the DNA minicircle includes separating or purifying the DNA minicircle from other components, particularly other nucleic acid components or molecules (e.g., the plasmid backbone and unreacted (unrecombined) parental minicircle plasmid). This isolation, separation, or purification may be performed by any suitable method known in the art.

[0061] In some embodiments, after the isolation step (e.g., the separation and purification step), the DNA minicircle may be substantially free of any contaminating components (e.g., nucleic acid components and / or degradation products) derived from the materials or components used in the step of obtaining or preparing the DNA minicircle. In some embodiments, the DNA minicircle is purified to a degree of purity of greater than about 50 or 60%, such as greater than about 95 or 99% when evaluated by w / w (dry weight), for example, greater than about 70, 80 or 90%. Such purity levels may include degradation products of the DNA minicircle.

[0062] It is not essential to separate the DNA minicircle from other components (e.g., plasmid backbone and unreacted (non-recombinant) parental minicircle plasmid) before performing other steps of the invention. As described below, the step of preparing an RCA primer that hybridizes only to the DNA minicircle can ensure that only the DNA minicircle functions as a template in the RCA reaction. Alternatively, if the plasmid backbone and unreacted (non-recombinant) parental minicircle plasmid are degraded (e.g., cleaved so that they cannot function as a template for RCA), it is not essential to separate the DNA minicircle from the degradation products (although separation may be preferred in some embodiments).

[0063] Thus, in some embodiments, it may be useful to prepare a concentrated preparation of DNA minicircles of low purity, containing, for example, less than about 50% of DNA minicircles, such as less than about 40%, less than 30%, less than 20%, less than 10%, 5% or less when evaluated by w / w (dry weight).

[0064] In another aspect, the invention provides a parental minicircle plasmid comprising a polynucleotide sequence (i.e., a pseudogene as defined herein) adjacent to a cleavage domain adjacent to a recombinase binding site. In some embodiments, the cleavage domain comprises, or consists of, a sequence capable of forming a hairpin structure as defined below. In some embodiments, the parental minicircle encodes a recombinase enzyme as defined above, e.g., PhiC31 integrase, ParA resolvase or FLP recombinase.

[0065] Thus, in some embodiments, the invention provides (a) (i) a polynucleotide sequence (i.e., a pseudogene as defined herein, e.g., comprising a hairpin cleavage domain) adjacent to a cleavage domain adjacent to a recombinase binding site, or (ii) a first domain comprising an insertion site for a polynucleotide sequence adjacent to a cleavage domain adjacent to a recombinase binding site, and (b) optionally, a second domain encoding a recombinase enzyme (i.e., a recombinase enzyme that recognizes the recombinase binding site of the first domain) under the control of an inducible promoter, e.g., an arabinose-inducible promoter and provides a parental minicircle plasmid.

[0066] In some embodiments, the parental minicircle plasmid of the invention encodes PhiC31 integrase and comprises a recombinase binding site for PhiC31 integrase. Thus, in some embodiments, the recombinase binding site comprises the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 5.

[0067] In some embodiments, the parental minicircle plasmid of the invention encodes ParA resolvase and comprises a recombinase binding site for ParA resolvase. Thus, in some embodiments, the recombinase binding site comprises the nucleotide sequences set forth in SEQ ID NO: 29 and SEQ ID NO: 30.

[0068] Thus, in some embodiments, the parental minicircle plasmid of the present invention comprises a nucleotide sequence shown in SEQ ID NO: 28 or a nucleotide sequence having at least 80% sequence identity with the sequence shown in SEQ ID NO: 28, and the plasmid comprises the above functional domains, such as insertion sites, binding sites, recombinase coding sequences, and one or more functional domains described in detail below, such as origin of replication, selection sequences, nickase cleavage domains, etc.

[0069] In some embodiments, the parental minicircle plasmid of the present invention encodes FLP recombinase and comprises a recombinase binding site for FLP recombinase. Thus, in some embodiments, the recombinase binding site comprises the nucleotide sequences shown in SEQ ID NO: 31 and SEQ ID NO: 32.

[0070] Thus, in some embodiments, the parental minicircle plasmid of the present invention comprises a nucleotide sequence shown in SEQ ID NO: 27 or a nucleotide sequence having at least 80% sequence identity with the sequence shown in SEQ ID NO: 27, and the plasmid comprises the above functional domains, such as insertion sites, binding sites, recombinase coding sequences, and one or more functional domains described in detail below, such as origin of replication, selection sequences, nickase cleavage domains, etc.

[0071] In another embodiment, the present invention provides a parental minicircle plasmid comprising the following (a) and (b). (a) (i) A polynucleotide sequence adjacent to a cleavage domain adjacent to a recombinase binding site (i.e., a pseudogene as defined herein, such as including a hairpin cleavage domain), or (ii) a first domain comprising an insertion site for a polynucleotide sequence adjacent to a cleavage domain adjacent to a recombinase binding site (b) A second domain comprising two or more nickase cleavage domains, wherein each strand of the plasmid DNA comprises at least one nickase cleavage domain (i.e., such that contacting the plasmid with a nickase capable of cleaving the cleavage domain results in cleavage of both strands of the plasmid), the second domain

[0072] In some embodiments, the second domain comprises 3, 4, 5, 6, 7, 8, 9, 10 or more, for example 15, 20 or 25 or more nickase cleavage domains, and each strand of the plasmid DNA comprises at least one nickase cleavage domain. In some embodiments, the second domain comprises 4 to 8, for example 6 nickase cleavage domains, and each strand of the plasmid DNA comprises at least one nickase cleavage domain. In some embodiments, the nickase cleavage domain is configured such that each strand is cleaved multiple times; for example, if the plasmid comprises 6 nickase cleavage domains, each strand is configured to be cleaved 3 times.

[0073] In some embodiments, at least one (e.g., 2, 3, or 4) nickase cleavage domains (cleavage domain recognition sequences) are proximal to one of the binding sites, e.g., within 150 nucleotides of one of the binding sites, such as within 120, 110, 100, 90, 80, 70, 60, 50, 40, or 30 nucleotides of one of the binding sites. For example, when the plasmid sequence is represented as a linear molecule (e.g., SEQ ID NO: 1), proximal refers to a sequence within 150 nucleotides (as defined above) of the beginning (5' end) of the first binding sequence (e.g., attB) or the end (3' end) of the second binding site sequence (e.g., attP). In some embodiments, the plasmid includes two nickase cleavage domains proximal to each binding site, i.e., two upstream of the first binding site (5' thereto) and two downstream of the second binding site (3' thereto). In some embodiments, the two nickase cleavage domains are within about 50 (e.g., about 40) nucleotides (e.g., upstream) of the binding site, and preferably, the domains are configured to allow cleavage of both strands. Additionally or alternatively, in some embodiments, the two nickase cleavage domains are within about 120 (e.g., about 110) nucleotides (e.g., downstream) of the binding site, and preferably, the domains are configured to allow cleavage of both strands.

[0074] Cleavage domains for any suitable nickase may be included in the plasmid. In some embodiments, the cleavage domain is for the nickase enzyme Nt.BspQI or Nb.BsrDI, or a combination thereof. In some embodiments, the cleavage domain for the nickase Nt.BspQI may have the sequence GCTCTTC (SEQ ID NO: 25). In some embodiments, the cleavage domain for the nickase Nb.BsrDI may have the sequence GCAATG (SEQ ID NO: 26).

[0075] In preferred embodiments, the plasmid may contain two, three or more different nickase cleavage domains. For example, in some embodiments, different nickases are used to cleave each strand, i.e., two or more nickase cleavage domains contain sequences recognized by different nickase enzymes, such as combinations of the enzymes described above. Thus, in some embodiments, cleavage may utilize a mixture of nickase enzymes. However, in some embodiments, all nickase cleavage domains are the same, i.e., substrates for the same nickase enzyme. This allows for the cleavage (i.e., degradation or destruction) of intact parental minicircle plasmids and backbone plasmids by a single nickase enzyme.

[0076] In some embodiments, the plasmid may contain at least one set of nickase cleavage domains that are adjacent to each other within 50 nucleotides or less of each other, such as 40, 30, 20, 15, 10 or 5 nucleotides or less. In some embodiments, the plasmid may contain 2, 3, 4, 5, 6, 7, 8, 9, 10 or more such sets of nickase cleavage domains. In some embodiments, the nickase cleavage domains within each set may be different from each other. In some embodiments, at least one set (e.g., 2 sets) of nickase cleavage domains meets the above requirements regarding proximity to the binding site, i.e., both cleavage domains within that set are in proximity to the binding site.

[0077] In some embodiments, the first domain of the parental minicircle plasmid contains a nickase cleavage domain, for example, located between the cleavage domain and the recombinase binding site, i.e., such that the recombinase binding site is indirectly adjacent to a polynucleotide sequence adjacent to the cleavage domain. In some embodiments, the nickase cleavage domain in the first domain is the same as at least one of the nickase cleavage domains in the second domain. In some embodiments, all nickase cleavage domains in the parental minicircle plasmid are the same.

[0078] The cleavage domain in the first domain of the minicircle plasmid may also be referred to as the "first domain cleavage domain", and the cleavage domain in the second domain of the minicircle plasmid may also be referred to as the "second domain cleavage domain". Thus, the first domain of the minicircle plasmid may include additional cleavage domains, such as nicking enzyme cleavage domains, in addition to the cleavage domain adjacent to the polynucleotide sequence, i.e., the sequence encoding the polynucleotide generated by the present method.

[0079] In some embodiments, the second domain of the parental minicircle plasmid may include one or more, such as 2, 3, 4, 5, 6, 7, 8, 9, 10 or more endonuclease (e.g., homing endonuclease) cleavage domains as defined above. The one or more endonuclease (e.g., homing endonuclease) cleavage domains may be in addition to or as an alternative to the nicking enzyme cleavage domain. In some embodiments, the endonuclease (e.g., homing endonuclease) cleavage domain is for I-SceI.

[0080] In some embodiments, the second domain of the parental minicircle plasmid may include a sequence encoding a recombinase as defined above.

[0081] In some embodiments, the second domain of the parental minicircle plasmid may include a sequence encoding an endonuclease (e.g., homing endonuclease) as defined above.

[0082] The "insertion site" in the first domain of the parental minicircle plasmid refers to the site where a polynucleotide sequence adjacent to the cleavage domain can be introduced, for example, a multiple cloning site or a polylinker containing multiple (e.g., 2 to 20, 2 to 15, or 2 to 10) unique restriction enzyme cleavage sites. In some embodiments, the insertion site may include the nickase cleavage domain as defined above. In some embodiments, when a nickase cleavage site is present, the nickase cleavage site may be provided as part of a pseudogene inserted into the parental minicircle plasmid.

[0083] The term "recombinase binding site" refers to a short (e.g., about 30 to 150 bp, such as about 40 to 60 bp) DNA sequence that is recognized by a recombinase enzyme and is located within a genome, e.g., a phage (phage binding site, attP) and a bacterial (bacterial binding site, attB) genome. A site-specific recombinase (SSR) recognizes and binds to a binding site that cleaves the DNA backbone, thereby rearranging DNA segments, exchanging the two DNA helices contained therein, and rejoining the DNA strands. The parental minicircle plasmid of the present invention may include any suitable recombinase binding site. In some preferred embodiments, the parental minicircle plasmid of the present invention includes a recombinase binding site for PhiC31 integrase. Thus, in some embodiments, the recombinase binding site includes the nucleotide sequences shown in SEQ ID NO: 4 and SEQ ID NO: 5. In some embodiments, the parental minicircle plasmid of the present invention includes a recombinase binding site for ParA resolvase. Thus, in some embodiments, the recombinase binding site includes the nucleotide sequences shown in SEQ ID NO: 29 and SEQ ID NO: 30. In some embodiments, the parental minicircle plasmid of the present invention includes a recombinase binding site for FLP recombinase. Thus, in some embodiments, the recombinase binding site includes the nucleotide sequences shown in SEQ ID NO: 31 and SEQ ID NO: 32.

[0084] Of course, the second domain of the parental minicircle plasmid also includes sequences required for the growth of the parental minicircle plasmid itself, such as, for example, an origin of replication. Such sequences are well known in the art, and any suitable sequence can be selected for use in the plasmid (e.g., the ColE1 sequence). In some embodiments, the second domain of the parental minicircle plasmid may include a sequence that allows for the selection of host cells containing the plasmid. Suitable sequences for this purpose are well known in the art, and any such suitable sequence can be used. In some embodiments, the second domain of the parental minicircle plasmid may include an antibiotic resistance gene. In some embodiments, the antibiotic resistance gene may be a kanamycin or ampicillin resistance gene.

[0085] Thus, in some embodiments, the parental minicircle plasmid of the present invention includes the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% sequence identity with the sequence shown in SEQ ID NO: 1, and the plasmid includes the above-described functional domains, such as, for example, an insertion site, a binding site, a nickase cleavage domain, an origin of replication, a selection sequence, and the like.

[0086] Nucleic acid sequence identity may be determined, for example, by FASTA Search using the GCG package with default values and variable PAM factors, and a gap insertion penalty set to 12.0 and a gap extension penalty set to 4.0 in a 6-nucleotide window. Preferably, the comparison may be made over the full-length sequence, but it may also be made over a smaller comparison window, such as, for example, 600, 500, 400, 300, 200, 100, or fewer than 50 consecutive nucleotides.

[0087] The term "operably linked" refers to a functional linkage between two or more elements. For example, an operable linkage between a polynucleotide encoding a protein (e.g., an enzyme such as a recombinase or endonuclease) and a control sequence (i.e., a promoter) is a functional linkage that enables the expression of the polynucleotide encoding the protein. The elements that are operably linked may or may not be adjacent.

[0088] Advantageously, the present invention can be used to generate polynucleotides containing any sequence. Accordingly, any suitable sequence may be used as the polynucleotide sequence in the DNA minicircles of the present invention. A suitable sequence means that the polynucleotide sequence domain must not prevent (i.e., inhibit or distort) the generation or cleavage of the RCA product. For example, in some embodiments, the polynucleotide sequence may be designed to avoid the formation of secondary structures that may inhibit the progression of the polymerase performing the RCA reaction or result in its elimination. Nevertheless, in some embodiments, the polynucleotide sequence may be an aptamer or may encode an aptamer.

[0089] Furthermore, the polynucleotide sequence may be designed not to specifically hybridize to the cleavage domain in the RCA product. Viewed another way, the cleavage domain adjacent to the polynucleotide sequence may be designed not to specifically hybridize to the polynucleotide sequence(s) in the RCA product.

[0090] In embodiments where the DNA minicircle contains multiple polynucleotide sequences, each sequence may be designed so as not to specifically hybridize with other polynucleotide sequences in the RCA product. However, in some embodiments, for example, it may be desirable to generate polynucleotides containing regions of complementarity, particularly to enable the polynucleotides to interact after being released from the RCA product. Thus, in some embodiments, the polynucleotide sequences are designed to promote the interaction (e.g., hybridization) of the polynucleotides produced by the method, as long as such interaction does not interfere with the production or cleavage of the RCA product, i.e., the production of the polynucleotides.

[0091] Thus, in some embodiments, the nucleic acid sequence of the polynucleotide sequence of the DNA minicircle has less than 80% sequence identity with the nucleic acid sequence in the cleavage domain and / or other polynucleotide sequences in the DNA minicircle. Preferably, the polynucleotide sequence of the DNA minicircle has less than 70%, 60%, 50% or 40% sequence identity with the nucleic acid sequence in the cleavage domain and / or other polynucleotide sequences in the DNA minicircle. The sequence identity can be determined by any suitable method known in the art, for example, using the BLAST alignment algorithm.

[0092] Thus, the term "polynucleotide sequence" is not particularly limited and refers to a single-stranded DNA polynucleotide of the present invention or a template sequence used to generate its complementary strand. In this regard, the DNA minicircle obtained from the parental minicircle plasmid is double-stranded, and thus contains both the repetitive sequence in the RCA product obtained in step (b) and its reverse complementary strand. Therefore, the present method includes a step of treating the DNA minicircle to prepare an RCA template. The treating step includes a step of cleaving a strand of the DNA minicircle that contains the sequence to be repeated in the RCA product. In some embodiments, the cleavage results in both the RCA template and a primer for the RCA reaction. In some embodiments, the cleaved strand may be separated from the uncleaved RCA template strand, for example, by denaturation and / or degradation of the cleaved strand. The denaturation and / or degradation may be achieved by any suitable means known in the art, such as heat, alkali. In order to prepare the RCA template, it may not be necessary to completely denature or degrade the cleaved strand of the DNA minicircle. For example, partial denaturation and / or degradation may be sufficient for the primer to hybridize.

[0093] The present invention can be used to generate single-stranded DNA polynucleotides of any desired length. As described above and as shown in the examples, the method can advantageously be used to generate single-stranded DNA polynucleotides having a length of about 1 kb or more. Viewed another way, the method is particularly advantageous when the pseudogene is about 1 kb or more in length. Since the pseudogene may contain two or more polynucleotide sequences adjacent to the cleavage domain, the method can similarly be applied to the generation of shorter polynucleotides. However, when the method is used to generate shorter polynucleotides, i.e., polynucleotides of about 0.5 kb or less, it is preferable that the pseudogene encodes two or more polynucleotide sequences to be generated.

[0094] Thus, in some embodiments, the DNA minicircles obtained from the parental minicircle plasmids are at least about 0.5 kb in length, e.g., at least about 0.6, 0.7, 0.8, 0.9, 1.0, 1.2, 1.5 kb in length. In some embodiments, the DNA minicircles obtained from the parental minicircle plasmids are at least about 2 kb in length, e.g., 3, 4, 5, 6, 7, 8, 9 or 10 kb in length. For example, the DNA minicircles obtained from the parental minicircle plasmids may be about 1 - 100 kb, e.g., about 1 - 50 kb, 2 - 45 kb, 3 - 40 kb, 4 - 35 kb or 5 - 30 kb. It will be apparent that the size of the DNA minicircles will depend on the size and number of the different polynucleotides generated by the methods defined below.

[0095] Thus, the polynucleotide sequences generated by the method can be between about 6 and about 50,000 nucleotides in length. Thus, in some embodiments, the method can be viewed as the generation of oligonucleotides. In this regard, the size boundaries of "polynucleotide" and "oligonucleotide" are not clearly defined in the art. For example, sequences less than 400 nucleotides may sometimes be referred to as oligonucleotides. Thus, the terms polynucleotide and oligonucleotide are used synonymously herein to refer to nucleotide sequences within the size ranges specified above. However, when the term "polynucleotide" is used, it generally refers to sequences containing more than 400 nucleotides. Thus, in some embodiments, the method and use can be viewed as generating multiple single-stranded DNA molecules.

[0096] In some embodiments, the polynucleotide sequence may be from about 50 to 50,000 nucleotides in length, including, for example, from about 100 to about 25,000 nucleotides in length, such as from about 100 to about 10,000 nucleotides in length, from about 100 to about 8,000 nucleotides in length, for example, from about 200 to about 7,500 nucleotides in length, for example, from about 300 to about 6,000 nucleotides in length, from about 400 to about 5,000 nucleotides in length, from about 500 to about 4,000 nucleotides in length, from about 500 to about 3,000 nucleotides in length, from about 500 to about 2,500 nucleotides in length, from about 600 to about 2,000 nucleotides in length, from about 600 to about 1,500 nucleotides in length, from about 750 to about 1,250 nucleotides in length, from about 1,000 to about 1,250 nucleotides in length, etc.

[0097] As described above, the present invention is particularly effective for the generation of longer polynucleotides, including, for example, polynucleotides of about 800 nucleotides or more, such as about 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000 nucleotides or more. For example, the polynucleotides generated by the present invention may include from about 1,000 to 50,000, 1,000 to 40,000, 1,000 to 30,000, 1,000 to 20,000, 1,000 to 10,000, 1,000 to 9,000, 1,000 to 8,000, 1,000 to 7,000, 1,000 to 6,000, 1,000 to 5,000 or 1,000 to 4,000 nucleotides, including, for example, about 2,500, 3,000, 3,500 nucleotides or more.

[0098] In some embodiments, the DNA minicircle comprises a plurality of polynucleotide sequences, each polynucleotide sequence being adjacent to a cleavage domain. The polynucleotide sequences may be the same as, different from, or a combination of each other. Thus, in some embodiments, the DNA minicircle may contain two or more copies, e.g., 2, 3, 4, 5 copies, of the same polynucleotide sequence as defined below. In some embodiments, the DNA minicircle may contain one copy each of a plurality of different polynucleotide sequences, e.g., 2, 3, 4, 5 different polynucleotide sequences as defined below. In some embodiments, the DNA minicircle may contain one or more copies of a plurality of different polynucleotide sequences. As further described below, the present invention may be used to form a plurality of polynucleotides according to a stoichiometry controlled based on the copy number of the polynucleotide sequences in the DNA minicircle.

[0099] It will be apparent that the plurality of polynucleotide sequences in the DNA minicircle may be present in any order. For example, multiple copies of the same polynucleotide sequence may be directly adjacent to each other in the DNA minicircle (separated only by the cleavage domain adjacent to the polynucleotide sequence). Alternatively, different polynucleotide sequences may be interspersed between multiple copies of the same polynucleotide sequence. The DNA minicircle (i.e., the pseudogene in the parental minicircle plasmid that gives rise to the DNA minicircle) may be designed to avoid or minimize interactions between repetitive sequences in the RCA product that may interfere with the generation or cleavage of the RCA product (e.g., the order of the plurality of polynucleotide sequences) as defined above.

[0100] As used herein, the term "plurality" means two or more, for example, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20 or 30 or more, such as 50, 100, 150, 200, 250 or more, depending on the context of the present invention. For example, a DNA minicircle may contain at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20 or 30 or more polynucleotide sequences, such as 2 to 100, 3 to 90, 4 to 80, 5 to 70, 6 to 60, 7 to 50, 8 to 40, 9 to 30 or 10 to 20 polynucleotide sequences. In some embodiments, the methods of the present invention can generate at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20 or 30 or more single-stranded DNA polynucleotides, such as 50, 100, 150, 200, 250 or more, i.e., polynucleotides having different sequences and / or structures. When a DNA minicircle contains a plurality of different polynucleotide sequences, it can be seen that each template will result in a plurality of different single-stranded DNA polynucleotides. Furthermore, since the RCA reaction can utilize a plurality of DNA minicircles, this reaction will result in a plurality of copies of each single-stranded DNA polynucleotide, for example, 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 copies or more.

[0101] The term "different" refers to a polynucleotide sequence or a single-stranded DNA polynucleotide containing one or more different nucleotides. Thus, different polynucleotide sequences may differ by one or more, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides, for example, 20, 30, 40, 50, 60, 70, 80, 90 or more nucleotides. The differences may be in the length and / or sequence of the polynucleotide sequence. Viewed another way, different polynucleotide sequences have less than 100% sequence identity with each other, such as less than 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 70%, 60%, 50% with each other.

[0102] Thus, the present invention can be used to simultaneously generate many different single-stranded DNA polynucleotides. In particular, by varying the sequence of the DNA minicircle, and in particular by controlling the copy number of each different polynucleotide sequence present, it is possible to control the stoichiometry of the single-stranded DNA polynucleotides ultimately produced by this method.

[0103] The term "cleavage domain", as used herein, generally refers to a domain within the parental minicircle plasmid and / or DNA minicircle (e.g., within or proximal to the cleavage domain) that promotes cleavage of the plasmid and / or minicircle, or that results in a domain within the RCA product capable of specifically cleaving to release single-stranded DNA polynucleotides. Thus, the cleavage domain in the parental minicircle plasmid and / or DNA minicircle may be capable of direct cleavage (e.g., an endonuclease recognition site that results in cleavage within or immediately adjacent to the cleavage domain when contacted with a suitable endonuclease under appropriate conditions), or may simply encode a cleavage domain that is functional only in the RCA product or under certain conditions, e.g., when contacted with a cofactor.

[0104] In a preferred embodiment, the cleavage domain in the second domain of the parental minicircle plasmid is capable of direct cleavage. That is, it induces single-stranded or double-stranded cleavage involving an endonuclease within or immediately adjacent to the cleavage domain. Similarly, the nickase cleavage domain in the first domain of the parental minicircle plasmid (i.e., within the DNA minicircle) is also capable of direct cleavage. That is, it induces single-stranded cleavage involving a nicking endonuclease within or immediately adjacent to the cleavage domain.

[0105] In some embodiments, the cleavage domain adjacent to the polynucleotide to be generated (i.e., the cleavage domain in the pseudogene) encodes a cleavage domain that is functional only in the RCA product or under certain conditions, such as when contacted with a cofactor.

[0106] "Cleavage" includes any means of breaking a covalent bond. Thus, in the context of the present invention, cleavage includes, for example, cleavage of a covalent bond in a nucleotide chain by cleavage of a phosphodiester bond (i.e., strand cleavage or strand scission).

[0107] Accordingly, in some embodiments, the cleavage domain may include a sequence recognized by one or more enzymes capable of cleaving a nucleic acid molecule, i.e., breaking a phosphodiester bond between two or more nucleotides. For example, the cleavage domain may include a restriction endonuclease (restriction enzyme) recognition sequence. Restriction enzymes cleave double-stranded or single-stranded DNA at a specific recognition nucleotide sequence known as a restriction site, and suitable enzymes are well known in the art. For example, to facilitate the design of polynucleotide sequence(s) in a DNA minicircle, it may be particularly advantageous to use a low-frequency cleavage restriction enzyme, i.e., an enzyme having a long recognition site (of at least 8 base pairs in length), to avoid including cleavage recognition sites that occur within the polynucleotide sequence(s).

[0108] In some embodiments, the cleavage domain (particularly the cleavage domain in a DNA minicircle, i.e., the cleavage domain adjacent to the polynucleotide) may comprise a sequence recognized by a type II restriction endonuclease, more preferably a type IIs restriction endonuclease. Any suitable cleavage domain and cleavage enzyme can be used in the present invention. In some embodiments, the cleavage enzyme that recognizes the cleavage domain adjacent to the polynucleotide sequence may be BseGI, BtsCI or their isoschizomers, such as BstF5I or FokI. Other representative enzymes that can be used include BsrDI, BtsI, BtsIMutI, MlyI or their isoschizomers.

[0109] As described above, it can be seen that the present method is useful in the generation of longer single-stranded polynucleotides, for example, having a length of at least about 800 nucleotides. Naturally, the longer the sequence, the higher the likelihood of containing a sequence recognized by an endonuclease, particularly a type IIs restriction endonuclease. Thus, in some embodiments, the cleavage domain adjacent to the polynucleotide may be a homing endonuclease cleavage domain as defined above. Thus, in some embodiments, the cleavage enzyme used in the cleavage step may be a homing endonuclease as defined above. In some embodiments, the cleavage domain adjacent to the polynucleotide may be a meganuclease cleavage domain. Thus, in some embodiments, the cleavage enzyme used in the cleavage step may be a meganuclease.

[0110] The term "meganuclease" refers to an endonuclease characterized by a large recognition site, for example, a double-stranded DNA sequence of 12 to 40 base pairs. Thus, many homing endonucleases such as I-SceI can be regarded as meganucleases. Chimeric meganucleases may be generated by fusing a nucleic acid-binding domain and an endonuclease cleavage domain derived from different proteins. For example, any protein domain capable of site-specific recognition (binding) of a DNA sequence as described above may be fused with a cleavage domain derived from an endonuclease that cleaves outside the sequence recognized by the endonuclease, for example, at a specific distance from the recognition sequence. Any suitable meganuclease known in the art may be used in the methods described herein, for example, in the step of cleaving an RCA product.

[0111] Thus, in some embodiments, the step of cleaving the product of the RCA reaction comprises contacting the RCA product with a cleavage enzyme under suitable conditions to selectively cleave the RCA product at the cleavage domain.

[0112] In some embodiments, the cleavage domain may be made functional (activated) in the RCA product by the addition of another component, i.e., the RCA product may be engineered to contain a functional cleavage domain, for example, an endonuclease recognition sequence. For example, this may be achieved by hybridizing an oligonucleotide (referred to herein as a "restriction oligonucleotide" or "cleavage oligonucleotide") to the cleavage domain of the RCA product to form a double strand. At least a portion of the formed double strand will contain an endonuclease recognition site, which can be cleaved to result in the release of single-stranded DNA polynucleotides. This may be particularly advantageous in embodiments where the nucleotides incorporated into the RCA product, particularly the cleavage domain (e.g., the functionalized nucleotides described below), may interfere with (e.g., reduce the efficiency of) the activity of the cleavage enzyme.

[0113] Thus, in some embodiments, the step of cleaving the product of the RCA reaction may include contacting the RCA product with a cleavage oligonucleotide and a cleavage enzyme. The cleavage oligonucleotide and the cleavage enzyme may be contacted with the RCA product simultaneously or sequentially.

[0114] In some embodiments, the cleavage domain may be cleaved by means other than a cleavage enzyme. For example, the cleavage domain may include a self-cleaving oligonucleotide sequence such as a DNAzyme nuclease. Suitable self-cleaving sequences are known in the art. In embodiments utilizing a self-cleaving sequence, the cleavage domain may be functional (active) only in the RCA product. Alternatively, since the self-cleaving sequence may be functional under certain conditions, the method may include the step of subjecting the RCA product to conditions that promote cleavage of the RCA product in the cleavage domain, i.e., contacting the RCA product with cofactors such as metal ions required for self-cleaving activity to activate the self-cleaving sequence. Alternatively, the step of cleaving the product of the RCA reaction may include the step of subjecting the RCA product to conditions that promote cleavage of the RCA product in the cleavage domain, i.e., contacting the RCA product with cofactors such as metal ions required for self-cleaving activity to activate the self-cleaving sequence.

[0115] In some embodiments, the cleavage domain comprises or consists of an array capable of forming a hairpin structure. The hairpin structure may also be known as a hairpin loop or a stem loop, and these terms are used synonymously herein. A hairpin is an intramolecular base pairing pattern that may occur in a single-stranded DNA or RNA molecule. Typically, two regions of the same strand that are complementary in the nucleotide sequence when read in opposite directions form base pairs (hybridize) to form a double-stranded stem (duplex) and an unpaired, i.e., single-stranded loop, resulting in a hairpin. The resulting structure can be depicted as a lollipop-shaped.

[0116] Thus, in some embodiments where the cleavage domain comprises or consists of an array capable of forming a hairpin structure, the cleavage domain comprises self-complementary sequences. As the RCA product extends, hybridization of these self-complementary regions results in a hairpin structure, and the duplex portion of the hairpin structure contains a sequence recognized by a cleavage enzyme. Thus, cleavage of the duplex portion of the hairpin structure in the RCA product releases single-stranded DNA polynucleotides and the hairpin structure (i.e., the oligonucleotide forming the hairpin structure).

[0117] As used herein, the terms "hybridization" or "hybridize" refer to the formation of a duplex between nucleotide sequences that are sufficiently complementary to form a duplex by Watson-Crick base pairing. Two nucleotide sequences are "complementary" to each other if their molecules share base pair composition homology. "Complementary" nucleotide sequences will bind specifically and form stable duplexes under appropriate hybridization conditions. For example, two sequences are complementary if a portion of the first sequence can bind to a portion of the second sequence in an antiparallel orientation, with the 3' end of each sequence binding to the 5' end of the other sequence, and then each A, T(U), G, and C of one sequence aligning with the T(U), A, C, and G of the other sequence, respectively. RNA sequences can include complementary G=U or U=G base pairs. Thus, two sequences need not have perfect homology to be "complementary" under the present invention. Typically, two sequences are sufficiently complementary if at least about 90% (preferably at least about 95%) of the nucleotides share base pair composition over the defined length of the molecule.

[0118] Upon cleavage of the RCA product, a single-stranded DNA polynucleotide is released. The released polynucleotide may consist of only its polynucleotide sequence (i.e., without additional nucleotides), or may include one or more additional nucleotides from the cleavage domain adjacent to its polynucleotide sequence at one or both ends. Thus, in some embodiments, the single-stranded DNA polynucleotide may include 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides from the cleavage domain at one or both ends. Preferably, the sequence of the DNA minicircle is designed such that when the RCA product is cleaved, the released polynucleotide does not include any additional nucleotides from the cleavage domain. Alternatively, the cleavage domain adjacent to the polynucleotide sequence(s) may be positioned in the DNA minicircle such that cleavage thereof in the RCA product releases a polynucleotide that does not include any additional nucleotides from the cleavage domain.

[0119] Since the cleavage enzyme may cleave the nucleic acid molecule at a position outside the cleavage enzyme recognition sequence, there may be one or more nucleotides present between the cleavage domain and the polynucleotide sequence. In another view, the cleavage domain may include a nucleotide sequence in addition to the cleavage enzyme recognition sequence to ensure that cleavage preferably releases a complete single-stranded DNA polynucleotide that does not include any additional nucleotides (e.g., nucleotides that form part of the cleavage domain).

[0120] Thus, the term "adjacent" in relation to the cleavage domain and the adjacent polynucleotide sequence refers to the cleavage domain that is directly or indirectly proximal to the polynucleotide sequence. In another view, the cleavage domain is located at either end of the polynucleotide sequence. That is, the cleavage domain is upstream and downstream (5' and 3' ends) of the polynucleotide sequence. In some embodiments, the cleavage site of the cleavage domain (e.g., the site where the cleavage enzyme cleaves the cleavage domain) directly contacts the end of the polynucleotide sequence to which it is adjacent. In some embodiments, the polynucleotide sequence and the cleavage domain sequence may overlap. That is, for example, if the cleavage site is an internal site within the cleavage domain, the end of the polynucleotide sequence may form part of the cleavage domain, i.e., the cleavage domain may form the end or part of the end of the polynucleotide sequence. Thus, in some embodiments, there may be one or more, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides present between the cleavage domain and the polynucleotide sequence (i.e., between the ends of the sequences). In some embodiments, the cleavage domain and the polynucleotide sequence may overlap by one or more, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides.

[0121] The size of the cleavage domain in the DNA minicircle is not particularly limited and will depend on the type of cleavage domain as described above. The polynucleotide sequence and the relative lengths of the cleavage domain are preferably designed or selected to be different from each other such that, when the RCA product is cleaved by the cleavage domain, the single-stranded DNA polynucleotide sequence can be easily purified. Thus, the cleavage domain(s) may be selected to be shorter than the polynucleotide sequence(s) in the DNA minicircle. If the DNA minicircle contains multiple polynucleotide sequences of different lengths, the cleavage domain(s) may be selected to be shorter than the shortest polynucleotide sequence in the DNA minicircle. Alternatively, the cleavage domain(s) may be selected to be longer than the polynucleotide sequence(s) in the DNA minicircle. If the DNA minicircle contains multiple polynucleotide sequences of different lengths, the cleavage domain(s) may be selected to be longer than the longest polynucleotide sequence in the DNA minicircle, although this is less preferred. In some embodiments, the lengths of the cleavage domain(s) and the polynucleotide sequence differ by at least 2 nucleotides, such as at least 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. When the method is used to generate longer polynucleotides, the lengths of the cleavage domain and the polynucleotide sequence will differ significantly, for example, by at least about 100, 150, 200, 250, 300 nucleotides.

[0122] In some embodiments, the cleavage domain may be about 4 to 50 nucleotides in length, for example, about 5 to 45, 6 to 40, 7 to 35, or 8 to 30 nucleotides in length. In some embodiments, the cleavage domain may range in length from about 10 to 25 nucleotides, including from about 12 to 22 or from about 14 to 20. However, it will be apparent that any suitable length of cleavage domain can be used in the present invention as long as the above functional requirements are met.

[0123] The cleavage domains adjacent to the polynucleotide sequences may be the same as or different from each other. It is advantageous for the cleavage domains adjacent to the polynucleotide sequences to be the same so that a single cleavage step is sufficient to release all single-stranded DNA polynucleotides. However, as described above, some cleavage enzymes may cleave nucleic acid molecules at positions outside the cleavage enzyme recognition sequence or may recognize two or more sequences (for example, when changes within the enzyme recognition sequence are allowed). Thus, it is not necessary for the entire sequence of the cleavage domain to be the same for the cleavage domains to be cleaved by the same enzyme. For example, in some embodiments, the step of cleaving the RCA product comprises contacting the RCA product with a single cleavage enzyme under conditions suitable for cleaving the cleavage domain in the RCA product.

[0124] The conditions suitable for cleaving the cleavage domain in the RCA product will depend on the means used to achieve cleavage. For example, if cleavage is achieved using a cleavage enzyme such as a restriction endonuclease or a homing endonuclease, the conditions will vary depending on the enzyme selected, and suitable conditions are well known in the art. For example, the cleavage step may be in accordance with the manufacturer's instructions. Similarly, if cleavage is achieved using a self-cleaving sequence such as a DNAzyme, conditions suitable for the particular sequence may be used. Examples of suitable ranges of conditions that can be used in the cleavage step are shown below.

[0125] For example, cleavage enzymes, such as restriction or homing endonucleases, specifically bind to their cleavage recognition sites and can selectively (e.g., specifically) cleave nucleic acids in various buffers with and without EDTA, such as phosphate buffered saline (PBS), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), HEPES buffered saline (HBS), and Tris buffered saline (TBS). Cleavage can occur over a wide range of temperatures, e.g., 0 to 70 °C, and in a pH range of about 3.0 to 10.0, e.g., 4.0 to 9.0, 5.0 to 8.0. Those skilled in the art will be able to readily determine other suitable conditions.

[0126] The method of the present invention includes the step of performing rolling circle amplification using a DNA minicircle as a template. Rolling circle amplification (RCA) is well known in the art and is described in Dean et al., 2001 (Rapid Amplification of Plasmid and Phage DNA Using Phi29 DNA Polymerase and Multiply-Primed Rolling Circle Amplification, Genome Research, 11, p. 1095-1099), the disclosure of which is incorporated herein by reference. Briefly, RCA relates to the synthesis of nucleic acid molecules using a circular single-stranded nucleic acid molecule, such as a circular or circular oligonucleotide, as a rolling circle template (RCA template) and a strand displacement polymerase to extend a primer hybridized to the template. The synthesis reaction, i.e., polymerization, is initiated by the addition of polymerase and nucleotides. Since the rolling circle template has no end, the resulting product is a long single-stranded nucleic acid molecule composed of tandem repeats complementary to the rolling circle template.

[0127] A typical RCA reaction mixture includes a DNA minicircle acting as a template and one or more primers utilized in the primer extension reaction. For example, RCA may be primed by a single primer to form a single concatemer product, or may be primed by multiple primers, each annealing to a different region of the circular template to generate multiple concatemer products per turn. The oligonucleotide primer to which the circular nucleic acid can be contacted is of sufficient length to effect hybridization with the DNA minicircle under annealing conditions. In some embodiments, the primer can be obtained by cleaving (e.g., nicking) a single strand of the double-stranded DNA minicircle obtained in step (a).

[0128] In addition to the above components, the reaction mixture used in the present invention generally contains a polymerase (e.g., phi29 DNA polymerase as defined below), one or more nucleotides, and other components required for the DNA polymerase reaction shown below. The desired polymerase activity may be provided by one or more different polymerase enzymes.

[0129] In some embodiments, the nucleotides present in the reaction mixture are conventional nucleotides. The term "conventional nucleotide" as used herein refers to deoxynucleotides containing one of the four bases found in DNA, adenine, guanine, cytosine, and thymine. Thus, the term "conventional nucleotide" includes, for example, dATP, dGTP, dCTP, and dTTP. Uracil is generally not found in DNA naturally, but dUTP can be readily used in place of, or in addition to, dTTP. Thus, in the context of the present invention, dUTP may sometimes be regarded as a "conventional" nucleotide. When the method is used to produce a standard (unmodified) single-stranded DNA polynucleotide, the reaction mixture will generally contain all four different types of dNTPs corresponding to the four naturally occurring bases present, i.e., dATP, dTTP, dCTP, and dGTP. However, as noted above, dUTP may be used in place of, or in addition to, dTTP. Further, in some embodiments, the reaction mixture may contain five dNTPs, i.e., dATP, dCTP, dGTP, dTTP, and dUTP. Of course, the reaction mixture need only contain nucleotides present in the polynucleotide(s) produced by the method, i.e., in some embodiments, the reaction mixture may contain three or fewer types of dNTPs. In the subject method, each dNTP will generally be present in an amount in the range of about 10 to 5000 μM, usually about 20 to 1000 μM. Each dNTP may be present in different amounts, or equal amounts of each dNTP may be used.

[0130] In some embodiments, the method can be used to generate a functionalized single-stranded DNA polynucleotide. Thus, in some embodiments, the RCA reaction may be performed in the presence of one or more functionalized nucleotides. That is, the reaction mixture may contain one or more functionalized nucleotides. The term "functionalized nucleotide" or "functionalized dNTP" refers to a nucleotide that includes a modification relative to an unmodified conventional nucleotide, and the modification results in the functionalized nucleotide and / or polynucleotide having additional or alternative properties or characteristics, i.e., relative to the corresponding conventional nucleotide. For example, the modification may render the nucleotide detectable, e.g., by incorporation of a label, or may render it capable of interacting and / or reacting with another component, i.e., a component with which the corresponding conventional nucleotide does not interact or react. In some embodiments, the modification may render the polynucleotide containing the nucleotide resistant to degradation, e.g., chemical and / or enzymatic degradation (e.g., nuclease degradation), or may alter the metabolism of the nucleotide.

[0131] Modified (e.g., functionalized) nucleotides have been used previously in enzymatic reactions for generating oligonucleotides, but only in the context of generating functionalized DNA by polymerase chain reaction (PCR) or primer extension (PE) reactions. These reactions require the use of specific primers that must be removed later, and not only must the modified nucleotides be incorporated by the polymerase, but in the case of PCR, the functionalized product must be recognized as a template. This can be problematic for some modifications, thus limiting the usefulness of these methods. Furthermore, the primers are synthesized by solid-phase methods and not sequence-verified, which leads to amplification of errors in newly synthesized DNA. Additionally, PCR-based methods predominantly yield double-stranded DNA products, so additional steps of elution and purification are required to obtain functionalized single-stranded oligonucleotides.

[0132] The inventors have discovered that functionalized nucleotides can be efficiently incorporated into RCA products by DNA polymerases having strand displacement activity, without preventing the formation of hairpin structures, or without preventing their stability or effective cleavage. Furthermore, the inventors have discovered that since functionalized nucleotides do not need to be recognized as templates for further amplification, functionalized nucleotides are available while maintaining the beneficial features associated with this method, which means that a larger number of functionalized residues can be incorporated.

[0133] Thus, the single-stranded DNA polynucleotide produced by the method of the present invention may be a functionalized polynucleotide, i.e., may contain a functionalized nucleotide. Thus, the terms "polynucleotide", "single-stranded polynucleotide", and "single-stranded DNA polynucleotide" as used herein with respect to polynucleotides produced by the method of the present invention may refer to polynucleotides containing only conventional nucleotides or polynucleotides containing functionalized nucleotides.

[0134] When functionalized nucleotides are used in combination with equivalent conventional nucleotides, the functionalized nucleotides may be randomly incorporated into the concatemers generated by the RCA reaction, so that cleavage of the concatemers results in multiple (e.g., a library) single-stranded functionalized DNA polynucleotides, i.e., it will be apparent that the functionalized nucleotides are incorporated at various positions in the polynucleotide. It will further be apparent that the diversity of the generated functionalized polynucleotides (i.e., the diversity of the library) may be increased by using DNA minicircles containing multiple polynucleotide sequences each adjacent to a cleavage domain. The polynucleotide sequences may differ in sequence and / or length. Additionally or alternatively, the diversity of the functionalized polynucleotides may be increased by using combinations of functionalized nucleotides in the RCA reaction. Even further diversity may be incorporated into the library of functionalized polynucleotides by modifying the polynucleotide after synthesis, e.g., by attaching a molecule or component to the functionalized nucleotides in the polynucleotide.

[0135] Thus, in some embodiments, one or more (or a proportion thereof) of the conventional nucleotides may be replaced with the corresponding functionalized nucleotides. For example, as described in more detail below, dATP may be replaced with dATP conjugated to a fluorophore. Thus, in some embodiments, the reaction mixture may contain three types of conventional nucleotides and one type of functionalized nucleotide.

[0136] The RCA reaction mixture may further comprise an aqueous buffer medium containing a source of monovalent ions, a source of divalent cations, and a buffer. Any convenient source of monovalent ions may be utilized, such as KCl, K acetate, NH4 acetate, K glutamate, NH4Cl, ammonium sulfate, etc. The divalent cation may be magnesium, manganese, zinc, etc., and the cation is generally magnesium. Any convenient source of magnesium cations, including MgCl2, Mg acetate, etc., may be utilized. The amount of Mg present in the buffer 2+ may range from 0.5 to 10 mM, but preferably ranges from about 3 to 6 mM, and ideally is about 5 mM. Representative buffers or salts that may be present in the buffer include Tris, Tricine, HEPES, MOPS, etc. The amount of buffer generally ranges from about 5 to 150 mM, usually from about 10 to 100 mM, more generally from about 20 to 50 mM, and in certain preferred embodiments, the buffer will be present in an amount sufficient to provide a pH in the range of about 6.0 to 9.5. Other agents that may be present in the buffer medium include chelating agents such as EDTA, EGTA, etc.

[0137] The DNA minicircle prepared in step (a) of the method is a double-stranded DNA molecule. Thus, the DNA minicircle must be processed in order to function as an RCA template. Accordingly, in some embodiments, step (b) of the method includes the step of cleaving a single strand of the DNA minicircle to obtain an RCA template.

[0138] In embodiments where a single strand of the double-stranded DNA minicircle is cleaved (e.g., nicked) to obtain an RCA template (and a primer for the RCA reaction), it may be useful to include a single-stranded binding protein in the RCA reaction mixture. For example, E. coli single-stranded DNA binding protein has been used to enhance the yield and specificity of primer extension reactions and PCR reactions. (U.S. Patent Nos. 5,449,603 and 5,534,407). The phage T4 gene 32 protein (a single-stranded DNA binding protein) has been shown to clearly improve the ability to amplify larger DNA fragments (Schwartz et al., Nucleic Acids Research, 18: p. 1079 (1990)), enhance the accuracy of DNA polymerase (Huang, DNA and Cell Biology, 15: p. 589-594 (1996)), and most importantly, prevent DNA polymerase from converting the template to, for example, already generated single-stranded DNA and synthesizing double-stranded DNA (Ducarni et al., Nucleic Acids Research, 42: p. 10596 (2014)). When utilized, such proteins will be used to achieve a concentration in the reaction mixture in the range of about 0.01 ng / μL to about 1 μg / μL, such as from about 0.1 ng / μL to about 100 ng / μL, including from about 1 ng / μL to about 10 ng / μL.

[0139] The RCA reaction ultimately produces a polynucleotide product that contains tandem repeats of the complementary sequence of the DNA minicircle. This product may sometimes be known as a concatemer, an RCA product, or an "RCP". Thus, the RCA product includes a linear sequence consisting of a polynucleotide sequence adjacent to the cleavage domain (or in particular the reverse complementary strand of the polynucleotide sequence of the DNA minicircle template).

[0140] As an alternative to using nickase to form primers for the RCA reaction, the RCA reaction mixture may include one or more oligonucleotide primers, which initiate the RCA polymerization reaction. The primers are of sufficient length to effect hybridization with the DNA minicircle under annealing conditions. The primers are generally at least 10 nucleotides in length, usually at least 12 nucleotides in length, more generally at least 14 nucleotides in length, and may be as long as 30 nucleotides or more, and the length of the primers generally ranges from 14 to 50 nucleotides in length, usually about 15 to 35 nucleotides in length.

[0141] The primer may anneal to any region within the DNA minicircle. In some embodiments, the DNA minicircle may include a specific domain (RCA primer binding site) to which the primer can hybridize. In a representative embodiment, the DNA minicircle may include a sequence that can function as an RCA primer binding site rather than a polynucleotide sequence between a cleavage domain adjacent to the polynucleotide sequence. The RCA primer binding site may be designed to be of a different length than the polynucleotide sequence, like the cleavage domain above, to ensure easy separation from the single-stranded DNA polynucleotide upon cleavage of the RCA product. In a DNA minicircle containing multiple polynucleotide sequences adjacent to the cleavage domain, it will be apparent that the RCA primer binding site may be between any two cleavage domains.

[0142] In a further representative embodiment, the DNA minicircle may include an RCA primer binding site (i.e., a junction sequence defined below) between the cleavage domain and the binding site. Thus, the first domain of the parental minicircle plasmid may include an RCA primer binding site. The RCA primer binding site may be arranged in direct or indirect proximity to the binding site such that the RCA primer binding site is retained in the DNA minicircle upon recombination of the parental minicircle plasmid.

[0143] As described above, the DNA minicircle is generated by recombination between two recombinase binding sites present in the parental minicircle plasmid. Since this recombination reaction involves the fusion of the binding sites, a so-called "junction sequence" is generated at the site of recombination. This junction sequence is present only in the DNA minicircle after a successful recombination reaction and is not present in the original parental minicircle plasmid or the backbone plasmid. This is particularly advantageous because it allows the RCA reaction to be carried out without the need to separate the DNA minicircle from the unrecombined (intact) parental minicircle plasmid or the backbone plasmid.

[0144] Thus, in some embodiments, the primer for the RCA reaction may be designed to hybridize to the DNA minicircle at the junction sequence, such that the primer can initiate the RCA reaction only upon formation of the DNA minicircle. That is, the primer binds (hybridizes) specifically and selectively to the DNA minicircle. Put another way, the RCA primer does not bind to the unrecombined (intact) parental minicircle plasmid or the backbone plasmid. Stated another way, the junction sequence may include or form part of the RCA primer binding site. A primer that can hybridize to the junction sequence in this manner may sometimes be referred to as a "bridge primer".

[0145] The junction portion will be determined by the sequence of the binding site in the parental minicircle plasmid and the corresponding recombinase used to generate the DNA minicircle. In some embodiments, the junction sequence comprises or consists of the nucleotide sequence shown in SEQ ID NO: 2.

[0146] Thus, in some embodiments, the RCA primer can specifically and selectively bind (hybridize) to a nucleotide sequence comprising a nucleotide sequence shown in SEQ ID NO: 2, having, for example, the characteristics of length and sequence identity defined elsewhere herein. In some embodiments, the RCA primer comprises a nucleotide sequence shown in SEQ ID NO: 3.

[0147] Thus, the DNA minicircle obtained from the parental minicircle plasmid contains a junction sequence formed by recombination of the binding sites. In some embodiments, the DNA minicircle contains or consists of a junction sequence comprising the nucleotide sequence shown in SEQ ID NO: 2.

[0148] Thus, it will also be appreciated that the present invention provides a DNA minicircle comprising a polynucleotide sequence to be generated adjacent to a cleavage domain (i.e., a pseudogene as defined herein) and a junction sequence, particularly a junction sequence comprising or consisting of the nucleotide sequence shown in SEQ ID NO: 2.

[0149] The term "annealing conditions" refers to the conditions under which two nucleic acid molecules containing complementary nucleotide sequences specifically hybridize to each other. Various parameters, including temperature, salt concentration, nucleic acid concentration, composition and length, and buffer composition, affect hybridization. Those skilled in the art can usually readily determine the annealing conditions suitable for a particular primer / template combination for the RCA reaction.

[0150] As described above, the DNA minicircle is double-stranded, and the method includes the step of cleaving one strand of the DNA minicircle to prepare an RCA template before the RCA reaction is carried out. The step of cleaving one strand of the DNA minicircle can be replaced by the step of preparing a primer for initiating the RCA reaction, that is, it will be apparent that the cleaved strand functions as an RCA primer. Thus, viewed another way, step (b) includes the step of cleaving one strand of the DNA minicircle to prepare an RCA template and a primer, that is, the introduction of a single-strand cleavage into the DNA minicircle creates a 3' end that can serve as a primer for the RCA reaction. However, in some embodiments, for example, in order to increase the number of RCA products obtained per round, in addition to cleaving one strand of the double-stranded DNA minicircle, it may be advantageous to supply one or more RCA primers to the reaction mixture.

[0151] In some embodiments, the step of cleaving one strand of the DNA minicircle to prepare an RCA template includes the step of cleaving one strand of the DNA minicircle with a cleavage enzyme. The cleavage of this one strand of the DNA minicircle results in a single-strand break (nick).

[0152] In some embodiments, it may be advantageous to cleave one strand of the DNA minicircle multiple times at positions close to each other to facilitate the binding of the 3' end generated by the cleavage to DNA polymerase. Thus, one strand of the DNA minicircle may be cleaved two or more times at positions close to each other, that is, two or more nicks may be generated. Preferably, the nicks are formed within 20 nucleotides of each other, more preferably within 10 nucleotides of each other, more preferably within 5 nucleotides of each other, for example, within 1, 2, 3, 4, or 5 nucleotides of each other.

[0153] In some embodiments, the cleavage enzyme used to cleave a single strand of double-stranded DNA minicircle is a nickase. A nickase is an endonuclease that cleaves only one strand of a DNA duplex. Some nickases bind to and recognize specific nucleotide recognition sequences and thereby introduce single-strand nicks only at specific sites on the DNA molecule. Many naturally occurring nickases have been discovered. Nickases are described in U.S. Patent No. 6,867,028, which is hereby incorporated by reference in its entirety, and any suitable nickase can be used in the methods of the present invention. In some embodiments, the cleavage enzyme (nickase) may be Nb.BsrDI, Nt.BspQI, or a combination thereof.

[0154] In some embodiments that utilize a nickase enzyme, to prevent unwanted cleavage of the RCA product, the nickase enzyme may be removed from the assay or inactivated after cleavage of the DNA minicircle.

[0155] As described above, in some embodiments, the parental minicircle plasmid from which the DNA minicircle is generated may be arranged such that a second domain of the plasmid, i.e., the plasmid backbone, contains one or more nickase recognition sequences on each strand. Thus, in such embodiments, addition of the nickase to the reaction mixture results not only in cleavage of a single strand of the DNA minicircle to form a primer for the RCA reaction, but also in cleavage of the backbone of the parental minicircle plasmid remaining after the recombination reaction and any un-recombined (intact) parental minicircle plasmids that may be present in the mixture, thereby preventing unwanted contamination and reducing the need for subsequent purification steps. In some embodiments, the parental minicircle plasmid may contain multiple nickase recognition sites on each strand.

[0156] A cleavage enzyme (e.g., a nickase) that cleaves a single strand of a DNA minicircle can cleave at any site within the DNA minicircle. In some embodiments, the DNA minicircle may include a specific domain (a single-strand cleavage site or domain, e.g., a nickase site) at which the cleavage enzyme can act. In representative embodiments, the DNA minicircle may include, between cleavage domains or between a cleavage domain and a junction sequence, a sequence that can function as a single-strand cleavage site or domain rather than a polynucleotide sequence. The fact that the sequence recognized by the cleavage enzyme (a single-strand cleavage site or domain) is not within a polynucleotide sequence ensures that the polynucleotide generated from the 5' end of the RCA product is not reliably truncated. The single-strand cleavage site or domain may be designed to have a length different from that of a polynucleotide sequence, such as the above-described cleavage domain and RCA primer binding site, in order to ensure easy separation from the single-stranded DNA polynucleotide upon cleavage of the RCA product. Thus, in some embodiments, the RCA primer binding site also functions as a single-strand cleavage site or domain, and vice versa.

[0157] Any DNA polymerase having at least some strand displacement activity may be used in the RCA reaction of the present invention. The strand displacement activity enables the polymerase to remove the primer sequence and the extension product and continue to "go around" the template once it has extended around the DNA minicircle. In embodiments where the nicked strand of the DNA minicircle provides a primer for RCA extension, the strand displacement activity enables the polymerase to reliably remove the nicked strand. Suitable DNA polymerase enzymes having at least some strand displacement activity include phi29 DNA polymerase, Escherichia coli DNA polymerase I, Bsu DNA polymerase (large fragment), Bst DNA polymerase (large fragment), and Klenow fragment. As used herein, the term "DNA polymerase" includes all such modified derivatives, including not only naturally occurring enzymes but also derivatives of naturally occurring DNA polymerase enzymes. For example, in some embodiments, the DNA polymerase may be modified to remove 5'→3' exonuclease activity.

[0158] Particularly preferred DNA polymerase enzymes for use in the present invention include phi29 DNA polymerase, Bst DNA polymerase, and derivatives thereof, such as sequence-modified derivatives or mutants.

[0159] Examples of sequence-modified derivatives or mutants of DNA polymerase enzymes include mutants that retain at least some functional activity of the wild-type sequence, such as DNA polymerase activity and at least some strand displacement activity. The mutations may affect the activity profile of the enzyme under various reaction conditions, such as temperature, template concentration, primer concentration, etc., for example, the rate of polymerization may increase or decrease. The mutations or sequence modifications may also affect the exonuclease activity and / or thermal stability of the enzyme.

[0160] As described above, the RCA reaction of the present method may be performed using conventional nucleotides, functionalized nucleotides, or a mixture of conventional nucleotides and functionalized nucleotides.

[0161] The terms "functionalized single-stranded DNA polynucleotide", "single-stranded functionalized DNA polynucleotide", and "functionalized DNA polynucleotide" are used interchangeably herein and refer to a single-stranded DNA polynucleotide that includes at least one functionalized nucleotide. Thus, a functionalized DNA polynucleotide has additional or alternative properties or characteristics compared to the corresponding polynucleotide that includes only conventional nucleotides. For example, the incorporation of one or more functionalized nucleotides may render the polynucleotide detectable, e.g., by the incorporation of a label, or may enable the polynucleotide to interact and / or react with a component that the corresponding polynucleotide that includes only conventional nucleotides does not interact or react with. In some embodiments, the modification may render the polynucleotide resistant to degradation, e.g., chemical and / or enzymatic degradation (e.g., nuclease degradation), or may alter the metabolism of the polynucleotide. In some embodiments, the modification may improve the stability of the oligonucleotide, e.g., the stability of the duplex formed by the oligonucleotide such as the thermal stability (e.g., melting point) of the duplex. In some embodiments, the incorporation of one or more functionalized nucleotides may enable the polynucleotide to form secondary or tertiary structures that are not formed by the corresponding polynucleotide that includes only conventional nucleotides.

[0162] Thus, of course, the term "single-stranded" as related to a functionalized single-stranded oligonucleotide refers to an oligonucleotide that is single-stranded under denaturing conditions, e.g., after application of heat or a suitable chemical denaturant, i.e., an oligonucleotide having only one continuous backbone (single-stranded). As described above, this does not prevent the functionalized single-stranded oligonucleotide from forming secondary or tertiary structures. For example, a functionalized single-stranded oligonucleotide may contain regions of self-complementarity, such that one region of the functionalized single-stranded oligonucleotide hybridized to a complementary region elsewhere in the same oligonucleotide may be involved in forming a hairpin or stem-loop structure.

[0163] Functionalization of conventional nucleotides may also be achieved by alteration or modification to the structure of any part of the nucleotide. Thus, a functionalized nucleotide may include modifications, e.g., chemical modifications, to the nucleobase, sugar or groups involved in the internucleoside linkage. In some preferred embodiments, a functionalized nucleotide may include modifications, e.g., chemical modifications, to the nucleobase.

[0164] Modifications at various positions are described in more detail below, and it is contemplated that any particular position described below may be modified by any of the functional groups described below.

[0165] For example, substitution of the C5 position of pyrimidines (i.e., cytosine, thymine and uracil) with a small rigid hydrophobic group can improve the base stacking interactions of an oligonucleotide containing the functionalized nucleotide containing the substituted pyrimidine, and / or can stabilize the duplex formed thereby. The small rigid hydrophobic group may be an alkynyl group, e.g., methyl, ethynyl, propynyl, or a halogen group, e.g., fluoro, chloro or bromo. Thus, in some embodiments, the functionalized nucleotide includes a pyrimidine having a substitution, e.g., an alkynyl group or halogen as defined herein, at the C5 position.

[0166] In some embodiments, the modification that enables the nucleotide to be detectable may involve the incorporation of a label into the nucleotide. Any label is found to be useful in the present invention and may be a molecule that directly or indirectly provides a signal. For example, a label that directly provides a signal may be a fluorescent molecule, i.e., the functionalized nucleotide may be a fluorescently labeled nucleotide. A label that indirectly provides a signal may be, for example, a biotin molecule, i.e., the labeled nucleotide may be a biotin-labeled nucleotide, which requires the addition of streptavidin bound to an enzyme that can act on a chemical substrate to bring about a further step to provide a signal, for example, a detectable signal, such as a visible color change. In some embodiments, the label is incorporated into (bound to) the nucleobase.

[0167] Thus, in some embodiments, the functionalized nucleotide contains a biotin group bound to the nucleobase. In some embodiments, the biotin group may be indirectly bound to the nucleobase, for example, via a linker or a linking domain, and suitable linkers can be readily selected from those well known in the art. For example, the linker may be selected to facilitate the interaction between biotin and streptavidin, i.e., to minimize or prevent steric hindrance. In some embodiments, the biotin group is bound to the pyrimidine at the C5 position. In representative embodiments, the biotin-containing functionalized nucleotide may be biotin-16-aminoallyl-2'-dUTP, biotin-16-aminoallyl-2'-dTTP, or biotin-16-aminoallyl-2'-dCTP.

[0168] In some embodiments, the nucleotide may be labeled with a sterol group, i.e., the nucleotide may contain a sterol group. In some embodiments, the nucleotide may be labeled with or contain a cholesterol group.

[0169] A directly detectable label is one that can be detected directly without using additional reagents, while an indirectly detectable label is one that can be detected by using one or more additional reagents. For example, the label is an element of a signal generation system consisting of two or more components. In many embodiments, the label is a directly detectable label, and examples of directly detectable labels for the target include, but are not limited to, fluorescent labels, colored labels, radioisotope labels, chemiluminescent labels, etc. Any spectrophotometrically or optically detectable label may be used. In other embodiments, the label may provide a signal indirectly, i.e., the addition of additional components may be required to form a signal. For example, the label may be able to bind to a molecule that binds to a molecule that gives a signal.

[0170] In some embodiments, the functionalized nucleotide is a fluorescently labeled nucleotide. Although a fluorescent label requires excitation to produce a detectable signal, since the source of excitation is obtained from the instrument / device used to detect the signal, the fluorescent label can be regarded as a label that directly gives a signal.

[0171] Fluorescent molecules that can be used to label nucleotides are well known in the art. Fluorophores have been associated with excitation and emission spectra in the range from UV to near-IR wavelengths. Thus, fluorophores may have excitation and / or emission wavelengths in the UV, visible, or IR spectral ranges.

[0172] The fluorophore may be a protein, peptide, small organic compound, synthetic oligomer, or synthetic polymer. In some embodiments, the fluorophore is a small organic compound, e.g., an organic compound having a molecular weight of 5000 Da or less. Thus, in some embodiments, the fluorophore has a molecular weight of 4000 Da or less, e.g., 3500 Da, 3000 Da, 2500 Da, 2250 Da, 2000 Da, 1900 Da, 1800 Da, 1700 Da, 1600 Da, 1500 Da or less.

[0173] Thus, the fluorophore can be a xanthene derivative (e.g., fluorescein, rhodamine, Oregon Green, eosin, Texas Red), a cyanine derivative (e.g., cyanine, indocarbocyanine, oxacarbocyanine, thiacarbocyanine, merocyanine), a squaraine derivative (e.g., ring-substituted squaraine, Seta, SeTau), a naphthalene derivative (e.g., dansyl or prodan derivative), a coumarin derivative, an oxadiazole derivative (e.g., pyridyloxazole, nitrobenzoxadiazole, and benzoxadiazole), an anthracene derivative (e.g., anthraquinones including DRAQ5, DRAQ7, and CyTRAK Orange), a pyrene derivative (e.g., cascade blue), an oxazine derivative (e.g., Nile Red, Nile Blue, cresyl violet, oxazine 170), an acridine derivative (e.g., proflavine, acridine orange, acridine yellow), an arylmethine derivative (e.g., auramine, crystal violet, malachite green), or a tetrapyrrole derivative (e.g., porphyrin, phthalocyanine, bilirubin).

[0174] Specific examples of fluorophores or fluorophore series found to be useful in the present invention include Alexa Fluor (e.g., Alexa Fluor488, Alexa Fluor647, etc.), Atto, cyanine (Cy), indocyanine, sulfocyanine, DyLight, Abberior STAR, Chromeo, Oregon Green, fluorescein, Texas Red, rhodamine, silicon rhodamine (SiR), squaraine, FluoProbes, tetrapyrrole, Bodipy, HiLyte, Quasar, CAL fluor, coumarin, Seta, CF, Tracy, IRDye, CruzFluor, Tide Fluor, Oyster, iFluor, Chromis, and brilliant violet, as well as their fluorescent derivatives or analogs.

[0175] In some embodiments, the functionalized nucleotide comprises a cyanine fluorescent label such as Cy3. In some specific embodiments, the functionalized nucleotide is dATP labeled with Cy3, for example, 7-propylgylamino-7-deaza-ATP-Cy3.

[0176] In some embodiments, the functionalized nucleotide comprises an atto fluorescent label, for example, atto-488. In some specific embodiments, the functionalized nucleotide is dATP labeled with atto-488, for example, 7-propylgylamino-7-deaza-ATP-Atto-488.

[0177] In some embodiments, the modification that can make the nucleotide reactive involves the incorporation of a reactive group, for example, another chemical group, such as a chemical group on a molecule or component that binds to a functionalized DNA polynucleotide, such as a label defined herein, to form a covalent bond. Possible reactive groups include nucleophilic functional groups (alkyne, alkenyl, amine, alcohol, thiol, hydrazide, azide), electrophilic functional groups (aldehyde, ester, vinyl ketone, epoxide, isocyanate, maleimide), functional groups capable of cycloaddition reactions, functional groups capable of forming disulfide bonds, or functional groups capable of binding to metals. Specific examples include ethyne (acetylene), propyne, 1-butyne, 2-butyne azide, vinyl (ethenyl), propenyl, 1-butenyl, primary and secondary amines, hydroxamic acid, N-hydroxysuccinimidyl ester, N-hydroxysuccinimidyl carbonate, oxycarbonyl imidazole, nitrophenyl ester, trifluoroethyl ester, glycidyl ether, vinyl sulfone, azide, and maleimide.

[0178] In some embodiments, the modification that can make a nucleotide reactive involves the incorporation of a reactive group that can react with another chemical group, such as a chemical group on a molecule or component that is bound to a functionalized DNA polynucleotide by click chemistry. As used herein, the term "click chemistry" generally refers to modular, broad - scope, high - yield reactions that form only harmless by - products, such as those that can be removed by non - chromatographic methods, and are stereospecific (not necessarily enantioselective). See, for example, Angewandte Chemie Internatinal Edition, 2001, 40(11): p. 2004 - 2021, which is incorporated herein by reference in its entirety. In some cases, click chemistry may refer to a pair of functional groups that can selectively react with each other under mild aqueous conditions. Thus, click chemistry groups are suitable for the attachment of additional functional groups to the polynucleotides of the method. Common click chemistry reactions include azide - alkyne cycloaddition, alkyne - nitrone cycloaddition, alkene - tetrazine reaction, and alkene - tetrazole reaction. Thus, the functionalized nucleotide may contain an azide group, an alkyne group, an alkene group, a nitrone group, a tetrazine group, or a tetrazole group.

[0179] As a specific example of a click chemistry reaction, the Huisgen 1,3-dipolar cycloaddition of azide and alkyne, i.e., the copper-catalyzed reaction of an azide with an alkyne to form a 5-membered heteroatomic ring called 1,2,3-triazole, is possible. This reaction may also be known as Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC), Cu(I) click chemistry, or Cu+ click chemistry. As a catalyst for click chemistry, a Cu(I) salt, or a Cu(I) salt generated in situ by reducing a Cu(II) reagent to a Cu(I) reagent using a reducing reagent (Pharmaceutical Research, 2008, 25(10): p. 2216-2230) is possible. Known Cu(II) reagents for click chemistry include, but are not limited to, the Cu(II)(TBTA) complex and the Cu(II)(THPTA) complex. TBTA, which is also known as tris-(benzyltriazolylmethyl)amine, tris-[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine, can be a stabilizing ligand for a Cu(I) salt. THPTA, which is tris-(hydroxypropyltriazolylmethyl)amine, can be another example of a stabilizer for Cu(I). Other conditions for constructing a 1,2,3-triazole ring from azide and alkyne (e.g., cycloalkynes such as cyclooctyne or cyclononyne) can also be achieved using copper-free click chemistry, such as by strain-promoted azide-alkyne click chemistry reaction (SPAAC: Strain-promoted Azide-Alkyne Click chemistry, see, for example, Chemical Communications, 2011, 47: p. 6257-6259 and Nature, 2015, 519(7544): p. 486-90, each of which is hereby incorporated by reference in its entirety).

[0180] In some embodiments, the functionalized nucleotide comprises a modification at the 2-position of the deoxyribose sugar, such as substituting a reactive group, e.g., hydrogen, with a fluoro, chloro, bromo, or azide group, on the sugar moiety. In some embodiments, the functionalized nucleotide is a 2'-azido-dNTP, such as 2'-azido-dATP.

[0181] In some embodiments, the functionalized nucleotide comprises a reactive group selected, in particular, from an alkyne, alkenyl, thio, or halogen group on the nucleobase. As described above, the functionalized nucleotide may comprise a pyrimidine with a substitution at the C5 position. In some embodiments, the alkyne group is ethynyl, e.g., the functionalized nucleotide is an ethynyl-dNTP such as 5'-ethynyl-dUTP. Alternatively, the alkyne group may be a propynyl group, e.g., the functionalized nucleotide is a propynyl dNTP such as 5'-propynyl-dUTP. In some embodiments, the alkenyl group is vinyl (ethenyl), e.g., the functionalized nucleotide is a vinyl-dNTP such as 5'-vinyl-dUTP. In some embodiments, the functionalized nucleotide is a thio-dNTP such as 4'-thio-dTTP. In some embodiments, the halogen group is bromine, e.g., the functionalized nucleotide is a bromo-dNTP such as 5'-bromo-dUTP. Incorporation of a halogen group into the functionalized oligonucleotide can be used in an aromatic nucleophilic substitution reaction or where UV is involved, e.g., to facilitate crosslinking with proteins. Thus, in some embodiments, the functionalized oligonucleotide produced by the method may be further modified to contain an aromatic group or may be bound to other molecules, e.g., proteins or peptides, by crosslinking involving UV.

[0182] In some embodiments, the functionalized nucleotide may include a group that can interact with another component, for example, interact via a non-covalent bond. For example, the nucleotide may be modified to incorporate a part or component of a related binding pair, and the related binding pair is, for example, an affinity binding partner (e.g., biotin or hapten) that can bind to its binding partner, i.e., the related binding partner (e.g., streptavidin or antibody). Such functionalized nucleotides are found to be useful, for example, in the generation of functionalized DNA polynucleotides that may be immobilized on a solid support.

[0183] In some embodiments, the functionalized nucleotide comprises a modification that renders a polynucleotide containing the nucleotide resistant to degradation, e.g., chemical and / or enzymatic degradation (e.g., nuclease degradation). In some embodiments, the nucleotide comprises a modification to the sugar moiety, such as substituting hydrogen with a fluoro, chloro, O-methyl or O-ethyl group, e.g., a modification at the 2-position of the deoxyribose sugar. Thus, in some embodiments, the functionalized nucleotide is a 2'-fluoro-dNTP, e.g., 2-fluoro-UTP. In some embodiments, the functionalized nucleotide comprises an O-Me group, e.g., 2'-O-methyl-ATP. In some embodiments, the nucleotide comprises a modification to the phosphate group that forms the internucleoside linkage, such as substituting oxygen with sulfur, e.g., the nucleotide comprises a phosphorothioate group. Thus, in some embodiments, the functionalized nucleotide is a nucleotide thiotriphosphate, e.g., 2-deoxythymidine-5'-O-(1-thiotriphosphate), 2-deoxycytidine-5'-O-(1-thiotriphosphate), 2-deoxyuridine-5'-O-(1-thiotriphosphate), 2-deoxyadenosine-5'-O-(1-thiotriphosphate) or 2-deoxyguanosine-5'-O-(1-thiotriphosphate). In some embodiments, the functionalized nucleotide comprises a modification to the nucleobase, such as an amino, methyl, ethyl or propynyl modification, e.g., 2-amino-dATP, 5-methyl-dCTP, C-5 propynyl-dCTP or C-5 propynyl-dUTP.

[0184] In some embodiments, the functionalized nucleotides include modifications that affect the thermal stability of the oligonucleotide. In some embodiments, the nucleotide includes a locked ribose sugar, i.e., it includes an additional covalent bond between the 2'-oxygen and the 4'-carbon of the pentose ring. In some embodiments, the nucleotide is a locked nucleic acid (LNA) nucleotide, i.e., an LNA-NTP such as LNA-ATP. The locked ribose conformation increases the melting point of the oligonucleotide containing the LNA nucleotide to enhance base stacking.

[0185] Thus, in some embodiments, the functionalized nucleotides that can be used in the present invention include the following: nucleotides containing (intrinsic) alkyne or azide groups, fluorescently labeled nucleotides, nucleotides containing a sterol group, nucleotides containing a polyether group, nucleotides containing a metal complex, nucleotides containing a vinyl group, nucleotides containing a thiol group, thiolated nucleotides, nucleotides modified to increase nuclease resistance, nucleotides containing chemical groups that can participate in click chemistry, nucleotides that affect (e.g., increase) the thermal stability of the oligonucleotide (e.g., LNA nucleotides), or combinations thereof. Incorporation of these functionalized nucleotides into the single-stranded polynucleotides of the present invention may result in various useful functions. For example, a single-stranded polynucleotide containing a fluorophore can be used as a sequence-specific fluorescent probe. Inclusion of a thiolated nucleotide in a single-stranded polynucleotide labels the polynucleotide with a thiol-reactive molecule and enables its use as a probe for molecular detection of such thiol-reactive molecules.

[0186] In some embodiments, the functionalized nucleotides that can be used in the present invention do not include nucleotides containing a digoxigenin group. In other words, in some embodiments, the functionalized nucleotides are not digoxigenin-labeled nucleotides. In particular, in some embodiments, the functionalized nucleotides are not digoxigenin-11-dUTP.

[0187] In a preferred embodiment, the functionalized dNTP is a nucleotide containing a modified nucleobase containing an alkyne group or a vinyl group, e.g., a nucleotide containing a pyrimidine having an alkyne (e.g., ethynyl) group or a vinyl group at the C5 position, such as an alkyne or vinyl group-containing nucleotide. In another preferred embodiment, the functionalized dNTP is a nucleotide containing an azide group, e.g., a nucleotide containing a modified sugar containing an azide group (e.g., a nucleotide containing an azide group at the 2-position of deoxyribose sugar).

[0188] The reaction mixture for the RCA reaction must contain a combination of components capable of forming an RCA product from the template DNA minicircle. For example, the nucleotides present in the reaction mixture (e.g., a mixture of conventional nucleotides and functionalized nucleotides) must be able to hybridize with their respective nucleotides in the DNA minicircle (RCA template) to enable rolling circle amplification. The relative amounts of the functionalized nucleotides and conventional nucleotides present in the reaction mixture may vary depending on the identity of the functionalized nucleotides and the polymerase. Further, the relative amounts of each nucleotide present in the reaction mixture may be used to control the incorporation of the functionalized nucleotides into the RCA product. For example, increasing the concentration of the functionalized nucleotides (or decreasing the proportion of conventional nucleotides) can increase the proportion of functionalized nucleotides in the RCA product (e.g., when the functionalized nucleotides are used in combination with the corresponding conventional nucleotides). Conversely, decreasing the concentration of the functionalized nucleotides (or increasing the proportion of conventional nucleotides) can lower the proportion of functionalized nucleotides in the RCA product.

[0189] Thus, the functionalized nucleotides may be used in addition to or entirely in place of conventional nucleotides that hybridize to the same DNA base (nucleotide) in the template DNA. In some embodiments, the reaction mixture may contain only one type of functionalized nucleotide. In some embodiments, combinations of different functionalized nucleotides may be used in the same reaction. In some embodiments, all of the functionalized nucleotides in the reaction mixture contain the same type of functional group, such as an alkyne group. In some embodiments, the functionalized nucleotides in the reaction mixture contain different types of functional groups. By way of example, different types of functionalized nucleotides, such as a dATP nucleotide functionalized with a fluorophore and a second dATP nucleotide functionalized with a sterol group, may be capable of hybridizing to the same DNA base (nucleotide). In another representative example, different types of functionalized nucleotides, such as a dATP nucleotide functionalized with a fluorophore and a dTTP nucleotide functionalized with a sterol group (or a fluorophore different from the fluorophore on the dATP nucleotide), may be capable of hybridizing to different DNA bases (nucleotides). Thus, any combination of functionalized nucleotides and conventional nucleotides can be used in the present invention. In a preferred embodiment, the RCA reaction mixture contains only one type of functionalized nucleotide.

[0190] The amount of functionalized nucleotide present in the reaction mixture can be estimated as a relative percentage of all nucleotides capable of hybridizing to a particular DNA base (nucleotide). Alternatively, this value can be considered as the percentage of functionalized nucleotide substituting for the corresponding conventional nucleotide. For example, using equal amounts of conventional dATP and dATP modified with a fluorophore could be represented as 50% of all dATP nucleotides being modified (functionalized), or a 50% substitution of the conventional dATP nucleotide with the functionalized dATP nucleotide.

[0191] The relative amount of the functionalized nucleotide in the RCA reaction mixture may be varied to control the frequency of the functionalized nucleotide in the final single-stranded polynucleotide. In some embodiments, the functionalized nucleotide may be up to about 5%, such as about 1%, 2%, 3%, 4% or 5% of all nucleotides that can hybridize to a particular DNA base (nucleotide). Alternatively, in some embodiments, the functionalized nucleotide may be an even higher percentage, such as 25%, 50%, 75% or 100% of all nucleotides that can bind to a particular DNA base (nucleotide).

[0192] The relative amount of the functionalized nucleotide present may be varied for a number of reasons. For example, some functionalized nucleotides, such as dATP modified with Cy3, are not commercially available at high concentrations. Further, as shown in the examples, we have found that including functionalized nucleotides can sometimes affect the yield of the functionalized single-stranded DNA polynucleotide produced by the present invention. For example, the use of a high relative amount of functionalized nucleotides may inhibit the activity of the DNA polymerase involved in the RCA reaction (e.g., reduce the efficiency with which the RCA product is synthesized), or may inhibit the activity of the cleavage enzyme involved in the cleavage of the RCA product and the release of the single-stranded functionalized DNA polynucleotide (e.g., reduce the efficiency with which the RCA product is cleaved). Thus, the step of hybridizing a restriction (cleavage) oligonucleotide to the cleavage domain of the RCA product to form a double-stranded molecule containing a restriction endonuclease recognition site may be particularly advantageous in embodiments where the functionalized nucleotide is incorporated into the RCA product, particularly the cleavage domain, as the functionalized nucleotide may sometimes interfere with (e.g., reduce the efficiency of) the activity of the cleavage enzyme.

[0193] However, in particular, the inventors have surprisingly found that even when using a high relative amount of functionalized nucleotides, e.g., up to 75%, e.g., up to about 70%, 65%, 60%, 55% or 50%, a high yield of functionalized single-stranded DNA polynucleotides can be achieved. In some embodiments, it may also be possible to use more than 75% of functionalized nucleotides, e.g., about 80%, 85%, 90%, 95% or 100%. In particular, the inventors have unexpectedly discovered that functionalized nucleotides containing an alkyne or vinyl group on the nucleobase are particularly useful in the present invention because they can be efficiently incorporated into the RCA product. Further, as described below, in some embodiments, more amount of cleavage enzyme may be required compared to the amount required to cleave the corresponding RCA product containing only conventional nucleotides, but the RCA product will be easily cleaved to obtain the functionalized single-stranded DNA polynucleotide.

[0194] Similarly, the inventors have discovered that in the RCA reaction, functionalized nucleotides containing an O-methyl group on the deoxyribose sugar can completely substitute for conventional nucleotides and still result in an RCA product. Further, the inventors have surprisingly confirmed that the incorporation of these nucleotides into the RCA product does not affect the formation of the cleavage domain (e.g., hairpin cleavage domain) or its enzymatic cleavage (e.g., by a restriction endonuclease).

[0195] Thus, the relative amount of functionalized nucleotides present in the reaction mixture may be adjusted to optimize the yield of the desired functionalized single-stranded polynucleotide or to optimize the formation of the RCA product. Such modifications are within the knowledge of those skilled in the art based on the methods described in the examples below. Thus, in some embodiments, the relative amount of functionalized nucleotides in the reaction mixture may be about 1-5%, 1-10%, 1-25%, 5-25%, 10-25%, 25-50%, 25-75%, 25-100%, 50-75%, 50-100%, or 75-100%.

[0196] In addition to the relative amounts of the functionalized nucleotides in the reaction mixture, the absolute amounts of the nucleotides (both conventional nucleotides and functionalized nucleotides) may also be adjusted to optimize the yield of the desired functionalized single-stranded polynucleotide or to optimize the formation of the RCA product. Such modifications are within the purview of one of ordinary skill in the art based on the methods described in the examples below.

[0197] After the formation of the RCA product in step (b), the method includes the step of cleaving the RCA product with a cleavage domain to release a single-stranded DNA polynucleotide. As noted above, the step of cleaving the RCA product may be accomplished by contacting the RCA product with a cleavage enzyme under suitable conditions to selectively cleave the RCA product at the cleavage domain.

[0198] The term "release" is used in this context to refer to cleaving the RCA product at the cleavage domain adjacent to the polynucleotide sequence so as to sever or separate the polynucleotide from the cleavage domain. It is desirable for the release of a given polynucleotide to involve cleavage at both cleavage domains adjacent to the polynucleotide sequence.

[0199] To form a single-stranded DNA polynucleotide, it is not necessary for cleavage to occur at all cleavage domains in the RCA product. Cleavage at some of the cleavage domains will result in the release of a portion of the single-stranded DNA polynucleotide. Thus, in some embodiments, the step of cleaving the RCA product results in cleavage of at least about 30% of the cleavage domains in the RCA product, such as at least about 35%, 40%, 45%, 50%, 60%, 70% or 80%. In some embodiments, the step of cleaving the RCA product results in cleavage of at least about 90% of the cleavage domains in the RCA product, such as 95% or more.

[0200] Viewed another way, in some embodiments, the step of cleaving the RCA product results in the release of at least about 30%, such as at least about 35%, 40%, 45%, 50%, 60%, 70% or 80% of the single-stranded DNA polynucleotides contained in the RCA product. In some embodiments, the step of cleaving the RCA product results in the release of at least about 90%, such as 95% or more, of the single-stranded DNA polynucleotides contained in the RCA product.

[0201] Once the single-stranded DNA polynucleotides are released, it may be desirable to isolate, separate or purify the single-stranded DNA polynucleotides from the cleavage reaction mixture (e.g., reaction components and / or degradation products, such as cleavage domains, uncleaved RCA products, etc.) for use in other applications.

[0202] Thus, in some embodiments, the methods of the invention further comprise the step of isolating, separating or purifying the single-stranded DNA polynucleotides. This isolation, separation or purification may be performed by any suitable method known in the art.

[0203] In some embodiments, after the isolation, separation or purification step, the single-stranded DNA polynucleotides preferably are substantially free of any contaminating components (e.g., reaction components and / or degradation products, such as cleavage domains, uncleaved RCA products, etc.) derived from the isolation procedure or materials or components used in its preparation. In some embodiments, the single-stranded DNA polynucleotides are purified to a degree of purity of greater than about 50 or 60%, such as greater than about 70, 80 or 90%, such as greater than about 95 or 99%, when evaluated w / w (dry weight). Such purity levels may include degradation products of the single-stranded DNA polynucleotides.

[0204] In some embodiments, it may be useful to prepare a concentrated preparation of single-stranded DNA polynucleotides of low purity, for example, containing less than about 50%, such as less than about 40 or 30%, of the subject single-stranded polynucleotides.

[0205] As described above, the present invention may result in a mixture (e.g., a library) of single-stranded DNA polynucleotides, for example, when the pseudogenes contain different polynucleotide sequences and / or when the RCA reaction incorporates functionalized nucleotides into the RCA product. Thus, in some embodiments, it may be desirable to further separate the mixture of single-stranded DNA polynucleotides, for example, by size, to obtain a particular single-stranded DNA polynucleotide (i.e., to isolate a particular single-stranded DNA polynucleotide) or to form a subgroup or sub-library of single-stranded DNA polynucleotides. Any suitable means for separating the mixture of single-stranded polynucleotides may be utilized to isolate a particular single-stranded DNA polynucleotide or a subgroup or sub-library of single-stranded DNA polynucleotides.

[0206] Thus, in some embodiments, the method includes a further step of separating single-stranded DNA polynucleotides from a mixture of single-stranded DNA polynucleotides (e.g., a library of single-stranded functionalized DNA polynucleotides) obtained by the above-described method to isolate a particular single-stranded DNA polynucleotide or a subgroup of single-stranded DNA polynucleotides.

[0207] For example, the products of the cleavage reaction may be separated by size using gel electrophoresis using an agarose gel or a polyacrylamide gel. Thereafter, the desired polynucleotide may be isolated from the gel and further purified, if necessary, by methods known in the art. Other methods for purifying, isolating or separating the polynucleotides of the present invention utilize chromatography (e.g., HPLC, size exclusion, ion exchange, affinity, hydrophobic interaction, reverse phase) or capillary electrophoresis.

[0208] As described above, the functionalized polynucleotides generated by the above method may include a reactive group that can react with another chemical group, for example, by click chemistry, with a chemical group on a molecule or component bound to the functionalized polynucleotide. For example, binding an additional molecule or component (which may itself contain a functional group or be considered a functional group) to a single-stranded functionalized DNA polynucleotide may be particularly useful for incorporating large or bulky groups, such as groups that may inhibit or reduce the efficiency of the method if present in the functionalized nucleotides used in the RCA reaction. Thus, it is possible to generate functionalized polynucleotides that include molecules or components that would not be directly incorporated by polymerase during the RCA reaction or would be incorporated only with low efficiency or yield. Additionally or alternatively, subjecting the functionalized polynucleotides obtained by the method to further binding steps can increase the structural diversity present in the functionalized polynucleotide library.

[0209] Thus, in some embodiments, the method further includes the step of binding a molecule or component to the functionalized polynucleotide(s) via a functional (e.g., reactive) group in the polynucleotide, such as by click chemistry. In some preferred embodiments, the molecule or component is bound to the functionalized polynucleotide via an alkyne, vinyl, or azide group (i.e., an alkyne, vinyl, or azide group in the functionalized nucleotide incorporated into the RCA product in the methods defined herein).

[0210] The term "binding" in the context of the present invention regarding the ligation or attachment of a molecule or component to a functionalized polynucleotide (e.g., an alkyne, vinyl, or azide group in the functionalized polynucleotide) refers to the attachment of the molecule or component to the polynucleotide by a covalent bond. In particular, this attachment may occur by a click chemistry reaction.

[0211] Examples of specific click chemistry reactions that can be used to bind the single-stranded functionalized DNA polynucleotides of the invention, which contain one or more alkyne groups, to additional molecules or components include azide-alkyne cycloaddition. To achieve the desired bond, the polynucleotide containing the alkyne group may be incubated for an appropriate time with a molecule or component containing an azide group (e.g., a label such as a fluorophore). The azide-alkyne cycloaddition reaction generally uses a copper catalyst, particularly a copper(I) catalyst. In some embodiments, the polynucleotide and the azide-containing molecule or component may be incubated in the presence of copper sulfate. A reducing agent may also be used to form the active copper(I) catalyst. The reducing agent may be, for example, sodium ascorbate.

[0212] A further representative example regarding the binding of additional molecules or components to the single-stranded functionalized DNA polynucleotides of the invention, which contain one or more vinyl groups, may be to utilize the alkene-tetrazine reaction. This reaction has the advantage of being copper-free. Furthermore, it is completely orthogonal to the above-mentioned alkyne-azide click chemistry reaction. Thus, a single-stranded functionalized DNA polynucleotide containing both an alkyne group and a vinyl group could independently participate in two click chemistry reactions to bind two different additional molecules or components to the same polynucleotide.

[0213] Thus, in some embodiments, the invention can be understood to provide a two-step method for generating single-stranded functionalized DNA polynucleotides, including a first step of incorporating functionalized nucleotides (e.g., containing reactive groups such as groups capable of participating in click chemistry reactions, such as alkyne, vinyl, or azide groups) into the polynucleotide using the methods described herein, and a second step of binding additional molecules or components to the single-stranded polynucleotide via the functional groups in the functionalized nucleotides.

[0214] It will be apparent that any desirable molecule or component (i.e., element) may be bound to a functional group in the single-stranded polynucleotide produced by the method. Such a molecule or component simply requires the presence of a group (e.g., a reactive group) that can react with the functional group in the polynucleotide to form a covalent bond. In some embodiments, the molecule or component may be a nucleic acid molecule, protein, peptide, small organic compound (e.g., a sterol such as cholesterol), fluorophore, metal-ligand complex, polysaccharide, nanoparticle, nanotube, polymer, cell, organelle, vesicle, virus, virus-like particle, or any combination thereof.

[0215] The cell may be a prokaryotic cell or a eukaryotic cell. In some embodiments, the cell is a prokaryotic cell, e.g., a bacterial cell.

[0216] In some embodiments, the functionalized polynucleotide may be bound or fused to a compound or molecule having a therapeutic or prophylactic effect, e.g., an antibacterial, antiviral, vaccine, antitumor agent, e.g., a radioactive compound or isotope, cytokine, toxin, oligonucleotide, nucleic acid encoding a gene, or a nucleic acid vaccine.

[0217] In some embodiments, the functionalized polynucleotide (e.g., an aptamer) may be bound or fused to a label, e.g., a radiolabel, fluorescent label, luminescent label, chromophore label, and a substance and enzyme that form a detectable substrate, e.g., horseradish peroxidase, luciferase, or alkaline phosphatase. This detection can be utilized in a number of assays where antibodies are conventionally used, including Western blotting / immunoblotting, histochemistry, enzyme-linked immunosorbent assay (ELISA), or flow cytometry (FACS) methods. Labels for magnetic resonance imaging, positron emission tomography probes, and boron-10 for neutron capture therapy may also be bound to the functionalized polynucleotides described herein.

[0218] In some embodiments, the molecule or component may be selected from the group consisting of a fluorophore, a sterol (e.g., cholesterol), a polyether, a metal complex, a thiol-containing molecule, a molecule containing a group that enhances nuclease resistance, and a molecule containing a group that can participate in a click chemistry reaction.

[0219] It will be apparent that when a molecule or component bound to a functionalized polynucleotide interacts with another molecule, such interaction can be a covalent or non-covalent interaction. For example, a peptide bound to a polynucleotide may interact non-covalently with its associated binding partner, such as an antibody. In a further example, a molecule containing a group that can participate in a click chemistry reaction may react with a reactive group of the molecule or component to bind to another molecule or component as defined above to form a covalent complex.

[0220] In another aspect, the present invention provides (i) a DNA minicircle obtained from a parental minicircle plasmid, the DNA minicircle comprising a polynucleotide sequence adjacent to a cleavage domain (e.g., the DNA minicircle as defined above), or (ii) a parental minicircle plasmid as defined above, and (iii) one or more additional components for use in the method of the present invention, optionally, the one or more additional components are (a) one or more cleavage enzymes that cleave the cleavage domain of (i), and / or (b) a functionalized dNTP as defined herein, and provides a kit, particularly a kit for use in generating single-stranded DNA polynucleotides.

[0221] In some embodiments, the kit may include a DNA polymerase enzyme capable of performing rolling circle amplification as defined herein, i.e., a DNA polymerase enzyme that includes at least some strand displacement activity. For example, the kit may include phi29 polymerase or a derivative thereof.

[0222] In some embodiments, the kit may include a recombinase enzyme capable of recombining a parental minicircle plasmid to form a DNA minicircle as defined herein.

[0223] In some embodiments, the kit may include nucleotides in the form of dNTPs.

[0224] In some embodiments, the kit may include a host cell as defined above, for example, to propagate the parental minicircle plasmid and / or to generate a DNA minicircle.

[0225] The polynucleotide sequences, cleavage domains, DNA minicircles, recombinase binding sites of the parental minicircle plasmids, host cells, cleavage enzymes, and dNTPs of the kit are as described above.

[0226] In another aspect, the invention provides a single-stranded DNA polynucleotide obtained by the method described herein, for example, a plurality of single-stranded DNA polynucleotides obtained by the method described herein. In some embodiments, the single-stranded DNA polynucleotide obtained by the method described herein is a functionalized single-stranded DNA polynucleotide.

[0227] In yet another aspect, the invention provides a library comprising a plurality of different single-stranded DNA polynucleotides (preferably, functionalized single-stranded DNA polynucleotides), i.e., a mixture of single-stranded DNA polynucleotides (preferably, functionalized single-stranded DNA polynucleotides) obtained by the method described herein.

[0228] Now, with reference to the above figures, the present invention will be described in more detail in the following non-limiting examples.

Brief Description of the Drawings

[0229]

Figure 1

[0230]

Figure 2

[0231]

Figure 3

[0232]

Figure 4

[0233]

Figure 5

[0234]

Figure 6

[0235]

Figure 7

[0236]

Figure 8

[0237]

Figure 9

[0238]

Figure 10

[0239]

Figure 11

[0240]

Figure 12

[0241]

Figure 13

[0242]

Figure 14

[0243]

Figure 15

[0244]

Figure 16

[0245]

Figure 17

[0246]

Figure 18

[0247]

Figure 19

[0248]

Figure 20

Example

[0249] Example 1 Efficiency of circularization of long pseudogenes using T4 ligase To examine the circularization efficiency of two long pseudogenes using T4 ligase, the MOSIC approach (Ducarni et al., Nature Methods, 2013) was used. Here, the longest pseudogene, referred to as CRC2 (SEQ ID NO: 8), was designed for the generation of a 1969-base-long single-stranded DNA polynucleotide (the total length of the excised pseudogene was 2041 base pairs). A shorter pseudogene, referred to as ActEVEN (SEQ ID NO: 6), was designed for the generation of a pool of 11 single-stranded oligonucleotides between 76 and 81 bases in length (the total length of the excised pseudogene was 1159 base pairs).

[0250] The linearized pseudogene (final concentration 5 ng / μl) was mixed with T4 ligase (0.25 U / μl) in 1× Rapid Ligation Buffer at 22 °C for 30 minutes, followed by an inactivation step at 65 °C for 10 minutes. As a control, the same reaction mixture was prepared without T4 ligase. All reaction mixtures were loaded onto a 1.5% agarose gel containing ethidium bromide (1 μg / ml) and electrophoresed at 150 V for 90 minutes, and the images were acquired by UV transillumination (UVITEC). The agarose gel (Figure 3) showed that the circularization of the long linear pseudogene by T4 ligase was inefficient and that the ligation reaction promoted the formation of concatemers rather than a single circular DNA molecule. For the shorter pseudogene, ActEVEN (SEQ ID NO: 6), a faint band corresponding to a single circular DNA molecule was visible, but for the longer DNA pseudogene, CRC2, only concatemers were visible.

[0251] Example 2 Formation of minicircles from pseudogenes cloned into the pM1 plasmid Three pseudogenes were designed and synthesized as previously described (Ducarni et al., Nature Methods, 2013). Each pseudogene was designed for the generation of single-stranded DNA polynucleotides of the following different lengths: CRC1 (SEQ ID NO: 7) for a single polynucleotide 1316 bases long; CRC2 (SEQ ID NO: 8) for a single polynucleotide 1969 bases long; and an oligomix for a pool of eight oligonucleotides with lengths between 81 and 91 bases long.

[0252] All pseudogenes were cloned into pM1 (SEQ ID NO: 1) using XbaI and BamHI restriction sites located between the attachment sites attB and attP of the parental plasmid. The sequence verification of the parental plasmid containing the pseudogene was performed and used to transform Escherichia coli (ZYCY10P3S2T). The transformed bacterial culture was grown overnight to propagate the plasmid, and then the recombination process was induced upon induction with arabinose (up to a final concentration of 0.01%), and an additional 6-hour incubation was required to complete the process. Minicircles (MCs) were recovered by standard plasmid prep and loaded onto a 1.5% agarose gel (1 μg / ml, Sigma Aldrich) containing ethidium bromide for analytical control (Figure 4). All recombination reactions produced a mixture of circular products, which included circular monomer minicircles (MC monomers) and multiply ligated minicircles (MC polymers), all of which were suitable substrates (DNA minicircles) for use in the methods described herein.

[0253] Example 3 Formation of oligonucleotide pools from a single minicircle template The products of the recombination reaction with the oligomix minicircles of Example 2 were nicked enzymatically using Nb.BsrDI and Nt.BspQI to obtain 3'OH and initiate the RCA reaction. The RCA reaction was carried out overnight using phi29 DNA polymerase. The amplified product was then digested with BtsCI (0.5 U / μl) to release the desired oligonucleotide sequence, and the digestion product was electrophoresed on a 10% denaturing polyacrylamide gel stained in SybrGold 1× (Figure 5). The same results were achieved when starting the generation from gel-extracted minicircle monomers.

[0254] Example 4 Formation of long single-stranded DNA polynucleotides using minicircle templates The products of the recombination reactions with the CRC1 and CRC2 minicircles of Example 2 were used as templates for the generation of single-stranded DNA polynucleotides. Both recombination products were enzymatically nicked (Nb.BsrDI and Nt.BspQI) to obtain 3’OH and initiate the RCA reaction. The RCA reaction was carried out overnight using phi29 DNA polymerase. The amplified products were then digested with BtsCI (0.5 U / μl) to release the desired DNA polynucleotide sequence, and the digestion products were electrophoresed on a 2% agarose gel containing ethidium bromide (1 μg / ml, Sigma Aldrich) for analytical control (Figure 6).

[0255] Example 5 Enzymatic generation of single-stranded oligonucleotides containing fluorescent nucleotides A 378-nucleotide-long single-stranded fluorescent oligonucleotide (SEQ ID NO: 9) was enzymatically generated using phi29 DNA polymerase. This was done by incorporation of two different functionalized dATP nucleobases, one containing the fluorophore Cy3 (7-propynylamino-7-deaza-ATP-Cy3) and one containing the fluorophore ATTO-488 (7-propynylamino-7-deaza-ATP-ATTO-488).

[0256] A double-stranded circular DNA template containing SEQ ID NO:9 and a hairpin cleavage domain was prepared as described in Ducarni et al., Nature Methods, 2013, pp. 647-652. The template (1 ng / μL) was nicked with Nb.BsrDI and Nt.BspQI (0.25 U / μl), and rolling circle amplification reactions (0.1-0.25 ng / μL template DNA, phi29 DNA polymerase 0.25 U / μl, 0.1 μg T4 gene 32) were performed several times in each reaction with different ratios of native dATP and functionalized dATP (i.e., different relative amounts of functionalized dATP, 2%, 3% or 5%). The resulting RCA products were diluted 5-fold with deionized water and 1× digestion buffer (50 mM potassium acetate, 20 mM Tris acetate, 10 mM magnesium acetate, 100 μg / ml BSA, pH 7.9, 25 °C), then digested overnight at 50 °C with BtsCI restriction enzyme (0.5 U / μL), and the digestion products were electrophoresed on an agarose gel. Imaging was performed by UV visualization after ethidium bromide staining using two fluorophores and their corresponding emission wavelengths.

[0257] The resulting images are shown in FIGS. 7A and B for ATTO-488 and Cy3, respectively. It can be seen that increasing the percentage of dATP-ATTO-488 nucleotides resulted in higher fluorescence oligonucleotides. However, when 5% of the dATP nucleotides were dATP-ATTO-488, the total amount of RCA product decreased by approximately 60%.

[0258] Surprisingly, in contrast to the use of dATP-ATTO-488, the percentage of dATP-Cy3 nucleotides present did not seem to affect the efficiency of phi29 DNA polymerase, and single-stranded DNA products were visible even when 5% dATP-Cy3 was used in the RCA mixture (FIG. 7B). Furthermore, the incorporation of modified nucleotides did not prevent or reduce the efficiency of the BtsCI restriction enzyme and thus the release of the designed hairpin containing the cleavage domain.

[0259] Sequence number 9: CCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTG

[0260] Example 6 Enzymatic generation of single-stranded oligonucleotides having an internal alkyne group, i.e., nucleotides containing an alkyne group in the nucleobase A single-stranded oligonucleotide (sequence number 10) 420 nucleotides in length containing nucleotides with an alkyne group was enzymatically generated using phi29 DNA polymerase.

[0261] A double-stranded circular DNA template containing sequence number 10 and a hairpin cleavage domain was prepared as described by Ducarne et al., 2013, Nature Methods, pp. 647 - 652. The conditions described in Example 1 were used, but the relative amount of 5'-ethynyl-dUTP (5'-EdUTP) was increased, i.e., dTTP was replaced with 5'-EdUTP so that the relative amount of 5'-EdUTP was 0% (control reaction), 25%, 50%, 75% or 100%, creating a nick in the template for the RCA reaction. After amplification, the RCA product was digested with the BtsCI restriction enzyme and loaded onto an agarose gel as described in Example 5.

[0262] The results in Figure 8A surprisingly show that even when the dTTP nucleotides reaching 100% were replaced with alkyne-functionalized dUTP, the RCA yield only decreased by 15 - 20%. Therefore, Figure 8A also shows that the RCA product was successfully and efficiently cleaved by BtsCI. The incorporation of alkyne-functionalized dUTP nucleotides was supported by the fact that low mobility of the functionalized oligonucleotides was observed.

[0263] Additional experiments were conducted by replacing phi29 DNA polymerase with Bst DNA polymerase. Gel electrophoresis showed no change in the amplification yield up to 50% functionalized dUTP, and the final product shifted compared to that with 25% modified dUTP, which supports the incorporation of modified nucleotides with a higher molecular weight than their corresponding natural nucleotides (dTTP) (Figure 8B).

[0264] SEQ ID NO: 10: ATTGAAGCATGCGGCGTGCATAATTCTCTTACTGTCATGCCATGCGTAAGATACCACCACACCCGCATTCGCCATTCAGGCGGCCGCCACCGCGGTGGAGCTCCAGCTGCTGTTTCCTGTGTAGAGTTGGTAGCTCTTGATCCGGTCATATTTGTTCCCTTTAGATCCGCCTCCATCTACAGGGCGCGTCCCCGCGCTTAATGCGCGGCCTAACTACGGCTACACTAGAAGGACTTACCTTCGGAAAAGAAATTGTTATCCGCTCACAAAAGCCAGAGTATTTAAGCTCCCTCGTGCGCTCTCCTGTTCCGGGTTATTGTCTCATCGGCGACCGAGTTGCTCTTGCTTATCAGACCCTGCCGCTTACAAGTGGTCGCCAGTCTATTAACAGCACTCAATACGGGATAATTTTTCAATATT

[0265] Example 7 Click chemistry reaction for attaching an azide-fluorophore to single-stranded nucleotides containing an internal alkyne group The successful incorporation of the functionalized 5-ethynyl-dUTP nucleotide into the oligonucleotide generated in Example 6 was further demonstrated by performing a click chemistry reaction.

[0266] Functionalized oligonucleotides from reactions using 75% alkyne-functionalized dUTP nucleotides were incubated with Cy3-azide (50 μM). The click chemistry solution also contained copper sulfate (50 μM), sodium ascorbate (50 mM), and THPTA (250 μM) as catalysts. As a negative control, oligonucleotides generated from the same template by the same method but using conventional dNTPs were also incubated with Cy3-azide. Additionally, functionalized oligonucleotides containing an endogenous alkyne group were incubated in the absence of Cy3-azide. Reaction mixtures from the three reactions were electrophoresed on an agarose gel and imaged (Figure 9). Fluorescent single-stranded oligonucleotides of the expected length were observed only for the reaction containing the functionalized oligonucleotide and fluorophore-azide. Furthermore, no visible DNA degradation due to the presence of copper sulfate was observed.

[0267] Example 8 Enzymatic generation of single-stranded oligonucleotides containing endonuclease-resistant nucleotides 2'-Fluoro-2'-deoxyuridine-5'-triphosphate (2'F-dUTP) or 2'-deoxythymidine-5'-O-(1-thiotriphosphate) (phosphorothioate dTTP) have been previously used to modify DNA and RNA oligonucleotides for biomedical and therapeutic applications due to their ability to confer nuclease stability. These modified nucleotides were incorporated into single-stranded DNA oligonucleotides by RCA using the experimental scheme described above. The percentage of conventional dTTP nucleotides was increased from 0 to 100% and replaced with the functionalized nucleotide. Next, the tandem repeat RCA products were digested with the BtsCI restriction enzyme to yield individual 420-base single-stranded functionalized oligonucleotides (SEQ ID NO: 10).

[0268] In this experiment conducted using 2’F-dUTP-functionalized nucleotides, similar RCA yields were observed with functionalized nucleotides from 0% to 75%, and a dramatic decrease in yield was observed when using 100% functionalized nucleotides (Figure 10A).

[0269] In the phosphorothioate dTTP experiment, as the amount of functionalized nucleotide increased, the RCA yield gradually decreased. When using 75% functionalized nucleotides, it decreased by up to approximately 65% compared to the yield using only conventional nucleotides (Figure 10B).

[0270] However, an overly exposed agarose gel showed how much single-stranded functionalized oligonucleotides were generated even when using 100% functionalized nucleobases. See the right panels in Figures 10A and B.

[0271] In additional experiments added one by one or in combination, other phosphorothioate dNTPs (designated as Alpha S-dNTP) were tested (Figure 10C). Even in the last case where 75% of all conventional nucleotides were replaced with their corresponding alpha S-functionalized nucleotides, an RCA product was synthesized and enzymatically cleaved to obtain visible oligonucleotides on an agarose gel.

[0272] The endonuclease resistance of the functionalized oligonucleotides was examined compared to control oligonucleotides generated using only conventional nucleotides. A control 420 nt-long oligonucleotide generated using only conventional nucleotides, a 2’-F-dUTP-functionalized oligonucleotide, and a phosphorothioate dTTP-functionalized oligonucleotide (both generated using 75% relative amounts of functionalized nucleotides) were incubated with increasing concentrations of DNaseI (Figures 11A - C). The control oligonucleotide was completely digested with 18 mU / ml of DNaseI, but both enzymatically generated 2’-F-dUTP and phosphorothioate dTTP-functionalized DNA oligonucleotides were still visible on the agarose gel after incubation with the same concentration of endonuclease.

[0273] Example 9 Enzymatic generation of single-stranded oligonucleotides containing nucleotides having a vinyl group Single-stranded DNA oligonucleotides (SEQ ID NOs: 11-21) with a length of 76-81 bases, functionalized with the thymidine analog 5-vinyl-2'-deoxyuridine-5'-triphosphate (5-vinyl-dUTP), were enzymatically generated by RCA reaction according to the above experimental scheme. All oligonucleotides were encoded by a single pseudogene (SEQ ID NO: 24). By incorporating such functionalized nucleotides into single-stranded oligonucleotides, copper-free click chemistry reactions can be used to attach tetrazine-like molecules to the oligonucleotides. This alkene-tetrazine reaction can be completely orthogonal to the previously performed alkyne-azide click chemistry reaction.

[0274] Increasing the amount of functionalized nucleotides in the RCA reaction mixture relative to the conventional nucleotide dTTP leads to successful incorporation of 5-vinyl-dUTP into single-stranded RCA products and successful digestion of hairpin structures. However, the activity levels of both phi29 DNA polymerase and type II endonuclease used to cleave the RCA products were lower than in the absence of functionalized nucleotides. Thus, this resulted in higher molecular weight bands with undigested hairpin structures when the functionalized nucleotides completely replaced the conventional dTTP nucleotides (Figure 12).

[0275] [Table 1]

[0276] Example 10 Enzymatic generation of single-stranded oligonucleotides containing thiolated nucleotides Single-stranded DNA oligonucleotides functionalized with thiolated dTTP (4-thiothymidine-5'-triphosphate) were enzymatically generated by RCA reaction using the above reaction scheme and template (SEQ ID NOs: 11-21). All oligonucleotides were encoded by a single pseudogene (SEQ ID NO: 24).

[0277] The incorporation of thiolated nucleotides into single-stranded oligonucleotides by phi29 DNA polymerase incorporation was very successful up to 75% substitution of the corresponding conventional nucleotide (dTTP), i.e., up to 75% relative amount of functionalized nucleotides of the amount of functionalized nucleotides (Figure 13).

[0278] The RCA products were digested with the above type II restriction enzymes, but a 10-fold higher enzyme concentration than that used for RCA products containing only conventional nucleotides was required for complete digestion of the functionalized RCA products. When the conventional dTTP nucleotides were completely replaced with functionalized thiolated nucleotides, no single-stranded oligonucleotides were observed after treatment with the type II restriction enzyme, but only a very slight accumulation of undigested RCA products was observed in that well, suggesting that the activity of the polymerase was also affected.

[0279] Example 11 Enzymatic generation of single-stranded oligonucleotides containing azide nucleotides A 420-nucleotide-long single-stranded oligonucleotide (SEQ ID NO: 10) (Figure 15A) containing increasing percentages of functionalized 2'-azido-dATP nucleotides substituting the corresponding conventional dATP nucleotides was enzymatically generated using phi29 DNA polymerase (Figure 15B) and Bst DNA polymerase (Figure 15C).

[0280] The high density of azide groups in the newly synthesized DNA strand enables postsynthetic functionalization with alkyne molecules by either Cu(I)-catalyzed Huisgen cycloaddition ("click" chemistry) or strain-promoted [3+2] cycloaddition of azide and cycloalkyne, e.g., cyclooctyne or cyclononyne.

[0281] Two different polymerases with strand displacement activity, phi29 DNA polymerase or Bst DNA polymerase, were used in the amplification step. Both polymerases were able to incorporate functionalized nucleotides into the amplification products, which were then digested and electrophoresed on an agarose gel.

[0282] DNA products generated using phi29 DNA polymerase were visible in the gel up to 75% modified nucleotides (Figure 15B), while Bst DNA polymerase products were visible up to 100% (Figure 15C), but (even in the lanes corresponding to 0% 2'-azido dATP) Bst amplification buffer salts caused smear effects. The functionalized nucleotides were successfully incorporated and did not significantly affect the formation of hairpin structures that enable cleavage of the amplification products.

[0283] Example 12 Enzymatic generation of single-stranded oligonucleotides containing biotinylated nucleotides A 420-nucleotide-long single-stranded oligonucleotide (SEQ ID NO: 10) containing increasing percentages (25% - 100%) of functionalized biotin-16-aminoallyl-2'-dUTP (Figure 16A) replacing the corresponding conventional nucleotide dTTP was enzymatically generated using phi29 DNA polymerase (Figure 16B).

[0284] The incorporation of biotinylated nucleotides had only a slight effect on the DNA amplification reaction and, surprisingly, did not prevent the formation of hairpin structures that enable cleavage of the RCA products, despite the potential for steric hindrance due to the large-sized functionalized nucleotides. The incorporation of multiple internal biotins into the polynucleotide enables binding to streptavidin-functionalized molecules.

[0285] Example 13 Enzymatic generation of single-stranded oligonucleotides containing 5-modified pyrimidines; 5-bromo-2'-deoxyuridine-5'-triphosphate and 5-propynyl-2'-deoxycytidine-5'-triphosphate Increasing percentages (25% - 100%) of unnatural 5-modified pyrimidines that replace the corresponding conventional nucleotides dTTP and dCTP; a 420-nucleotide-long single-stranded oligonucleotide (SEQ ID NO: 10) containing 5-bromo-2'-deoxyuridine-5'-triphosphate (Figure 17A) and 5-propynyl-2'-deoxycytidine-5'-triphosphate (Figure 17B) was enzymatically generated using phi29 DNA polymerase (Figures 17C and 17D) and Bst DNA polymerase (Figures 17E and 17F). Surprisingly, both functionalized nucleotides were successfully incorporated into the newly synthesized DNA sequence without affecting the formation of hairpin structures in the RCA product, thus enabling the cleavage reaction to occur.

[0286] Example 14 Enzymatic generation of single-stranded oligonucleotides containing 2'-O-methyl-ATP A 420-nucleotide-long single-stranded oligonucleotide (SEQ ID NO: 10) containing increasing percentages (25% - 100%) of 2'-O-methyl-ATP (Figure 18A) that replaces the corresponding conventional nucleotide dATP was enzymatically generated using phi29 DNA polymerase (Figure 18B). The amplification product was still visible even when 100% of the functionalized nucleotides were present. This result was contrary to previous studies showing that known native polymerases could not efficiently accept these modified substrates (Romesberg, Journal of the American Chemical Society, 2004, 10.1021 / ja038525p).

[0287] Furthermore, high-molecular-weight undigested DNA bands were not visible in the gel, indicating that the presence of the functionalized nucleotides did not affect the formation of hairpin structures and their digestion by restriction enzymes. This was a surprising result considering the nuclease resistance imparted to the DNA molecule by the O-methyl group.

[0288] Example 15 Enzymatic generation of single-stranded oligonucleotides containing LNA-adenosine-5'-triphosphate A 420-nucleotide-long single-stranded oligonucleotide (SEQ ID NO: 10) containing an increasing percentage (25% - 100%) of LNA-adenosine-5'-triphosphate (Figure 19A) that replaces the corresponding conventional nucleotide dATP was enzymatically generated using phi29 DNA polymerase (Figure 19B) and Bst DNA polymerase (Figure 19C).

[0289] The LNA monomer structurally mimics RNA, but even with 100% functionalized nucleotides, the efficiency of both polymerases, phi29 DNA polymerase and Bst DNA polymerase, was not significantly affected. Furthermore, the functionalized nucleotides did not prevent the formation of hairpin structures that allow digestion of the amplification products.

[0290] Example 16 Formation of single-stranded DNA from minicircles generated using ParA resolvase and FLP recombinase A pseudogene was designed for the generation of the above single-stranded DNA polynucleotide, CRC1 (SEQ ID NO: 7).

[0291] Using the restriction sites located between the recombinase binding sites FLPr and FLPl (pM2) and msr_l and msr_r (pM3) of each parental plasmid, the pseudogenes were cloned into pM2 (SEQ ID NO: 27) and pM3 (SEQ ID NO: 28). pM2 and pM3 encode FLP recombinase and ParA resolvase, respectively, under the control of the arabinose-inducible promoter. The sequence verification of the parental plasmids containing the pseudogenes was performed and used to transform Escherichia coli (DH10B). After growing the transformed bacterial cultures overnight to propagate the plasmids, the recombination process was induced upon induction with arabinose (up to a final concentration of 0.02%), and an additional 4-hour incubation was required to complete the process. The minicircles (MCs) were recovered by standard plasmid preps and loaded onto a 2% agarose gel containing ethidium bromide (1 μg / ml, Sigma Aldrich) for analytical control (for pM3 and pM2, Figures 20, 1b, and 2b, respectively). The isolated minicircles were used for the enzymatic generation of the above ssDNA. Figures 20 (1c and 2c) show that the minicircles function as templates for RCA, followed by cleavage of the RCA products to yield ssDNA of the correct size.

Claims

**Claim 1** A method for generating a plurality of single-stranded DNA polynucleotides, the method comprising the following steps (a), (b), and (c); (a) preparing a DNA minicircle obtained from a parental minicircle plasmid, wherein the DNA minicircle encodes a single-stranded DNA polynucleotide to be generated and comprises a polynucleotide sequence adjacent to a cleavage domain, the step of preparing; The parental minicircle plasmid contains recombinase binding sites, and there is the polynucleotide sequence adjacent to the cleavage domain between these recombinase binding sites, Step (a) includes step (i) or (ii), (i) preparing a host cell containing the parental minicircle plasmid, wherein the host cell can express a site-specific recombinase enzyme that acts on the recombinase binding site of the parental minicircle plasmid, the step (ii) contacting the parental minicircle plasmid in vitro with a site-specific recombinase enzyme that acts on the recombinase binding site of the parental minicircle plasmid; (b) performing a rolling circle amplification (RCA) reaction using the DNA minicircle of (a) as a template to generate an RCA product containing multiple copies of the polynucleotide sequence adjacent to the cleavage domain, the step of generating; (c) cleaving the RCA product with the cleavage domain to release the plurality of single-stranded DNA polynucleotides, the step of releasing. **Claim 2** The method according to claim 1, wherein the site-specific recombinase enzyme is encoded by the genome of the host cell. **Claim 3** The method according to claim 2, wherein the site-specific recombinase enzyme encoded by the genome of the host cell is under the control of an inducible promoter. **Claim 4** The method according to claim 1, wherein the site-specific recombinase enzyme is encoded by a plasmid in the host cell. **Claim 5** The method according to claim 4, wherein the site-specific recombinase enzyme encoded by the plasmid in the host cell is under the control of an inducible promoter. **Claim 6** The method according to any one of claims 1 to 5, further comprising the step of inducing expression of the site-specific recombinase enzyme in the host cell to promote the formation of the DNA minicircle in the cell.

7. The method according to claim 6, further comprising the step of isolating the DNA minicircle from the host cell.

8. The method according to any one of claims 1 to 7, wherein step (b) comprises the step of cleaving a single strand of the DNA minicircle to prepare a template for the RCA reaction.

9. The method according to any one of claims 1 to 8, wherein step (b) comprises the step of hybridizing a primer to the DNA minicircle.

10. The method according to claim 9, wherein the primer hybridizes to a sequence in the DNA minicircle formed by recombination of the parental minicircle plasmid.

11. The method according to any one of claims 1 to 10, wherein the cleavage domain is in direct contact with the polynucleotide sequence.

12. The method according to any one of claims 1 to 11, wherein the cleavage domain comprises a sequence recognized by a cleavage enzyme.

13. The method according to any one of claims 1 to 12, wherein the cleavage domain comprises or consists of a sequence capable of forming a hairpin structure.

14. The method according to claim 13, wherein the double-stranded portion of the hairpin structure comprises a sequence recognized by a cleavage enzyme.

15. The method according to any one of claims 12 to 14, wherein the cleavage enzyme is a type II restriction endonuclease or a homing endonuclease.

16. The method according to any one of claims 1 to 15, wherein the cleavage domain adjacent to the polynucleotide sequence is cleaved by the same enzyme.

17. The method according to any one of claims 1 to 16, wherein the DNA minicircle comprises a plurality of polynucleotide sequences, and each polynucleotide sequence is adjacent to a cleavage domain.

18. The method according to claim 17, wherein the polynucleotide sequences are different.

19. The method according to any one of claims 1 to 18, wherein the RCA reaction is carried out in the presence of one or more functionalized nucleotides (dNTPs).

20. The method according to any one of claims 1 to 19, further comprising the step of isolating or purifying the plurality of single-stranded DNA polynucleotides.

21. Use of a DNA minicircle obtained from a parental minicircle plasmid in the generation of a plurality of single-stranded DNA polynucleotides, wherein the DNA minicircle encodes a single-stranded DNA polynucleotide to be generated and comprises a polynucleotide sequence adjacent to a cleavage domain, the parental minicircle plasmid comprises recombinase binding sites, and there is a polynucleotide sequence adjacent to the cleavage domain between these recombinase binding sites, the DNA minicircle is obtained by the following step (iii) or (iv); (iii) inducing the expression of a site-specific recombinase enzyme acting on the recombinase binding site of the parental minicircle plasmid in a host cell containing the parental minicircle plasmid, (iv) contacting the parental minicircle plasmid in vitro with a site-specific recombinase enzyme acting on the recombinase binding site of the parental minicircle plasmid.

22. The use according to claim 21, wherein the cleavage domain is as defined in any one of claims 11 to 16 and / or the DNA minicircle is as defined in claim 17.

Images