Isolated recombinant oncolytic poxvirus controllable by microRNA and its use

The recombinant oncolytic vaccinia virus, regulated by microRNA and targeting the E10R gene, addresses the lack of tumor specificity and safety in existing oncolytic vaccinia virus products by selectively replicating in tumor cells, thereby achieving effective tumor inhibition with reduced impact on normal cells.

JP7699838B2Active Publication Date: 2025-06-30HANGZHOU CONVERD CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
JP2022566097
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-04-30
Filing Date
2021-04-23
Publication Date
2025-06-30
Estimated Expiration
2041-04-23

AI Technical Summary

Technical Problem

Current oncolytic vaccinia virus products lack tumor specificity and safety, as wild-type viruses can infect normal cells, leading to unforeseen risks.

Method used

Development of an isolated recombinant oncolytic vaccinia virus regulated by microRNA, with a target sequence incorporated into the 3' UTR region of the E10R gene, ensuring higher tumor specificity and safety by limiting replication in normal cells.

Benefits of technology

The recombinant oncolytic vaccinia virus exhibits significant replication in tumor cells while minimizing replication in normal cells, achieving excellent tumor target specificity and safety, and effectively inhibiting tumor cell growth.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007699838000006
    Figure 0007699838000006
  • Figure 0007699838000007
    Figure 0007699838000007
  • Figure 0007699838000008
    Figure 0007699838000008
Patent Text Reader

Abstract

Provided are isolated recombinant oncolytic poxviruses that can be regulated and controlled by microRNAs, and uses thereof. The isolated recombinant oncolytic poxviruses can be regulated and controlled by microRNAs, and the expression level of the microRNAs is lower in mammalian tumor cells than in normal cells of the same mammal. A target sequence for the microRNA is integrated into the 3'UTR region of the E10R gene in the recombinant oncolytic poxvirus genome.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and, in particular, relates to an isolated recombinant oncolytic vaccinia virus that can be regulated by microRNA, a pharmaceutical composition, and its use for drugs for treating tumors and / or cancers.

Background Art

[0002] By the end of the 19th century, multiple viruses have been found to alleviate the progression of tumor development, indicating the potential of viruses in the field of tumor treatment. Vaccinia virus is a double-stranded DNA virus. Vaccinia virus has been attracting increasing attention in the field of tumor immunotherapy based on its good safety, stability, strong immune response, efficient tumor lysis effect and effective diffusion into tumors. Vaccinia virus targets tumors naturally, but wild-type viruses without genetic modification can still infect normal cells, thereby causing unforeseen risks. Some strains of oncolytic vaccinia virus, including Western Reserve, Wyeth, Copenhagen, Lister, etc., have been reported to be used to construct mutants. Among these mutants, the thymidine kinase (TK) gene of vaccinia virus is one of the most frequently used mutation regions. The TK gene is one of the important genes involved in the virus replication process. High expression of the TK gene in tumor tissues enables the replication of TK-deficient mutants in tumors, while the replication ability in normal tissues is limited. Second, the oncolytic effect of vaccinia virus in host cells is closely related to the activation of the epidermal growth factor receptor (EGFR) signaling pathway. VGF secreted after the infection of cells with vaccinia virus binds to EGFR on the surface of infected cells or adjacent non-infected cells, activates the EGFR / Ras signaling pathway, thereby creating a favorable environment for vaccinia virus to infect adjacent cells. Therefore, VGF-deficient vaccinia virus cannot activate the EGFR / Ras pathway in normal cells, while the EGFR signaling pathway in tumor cells is activated. Thus, the infection of VGF gene-deficient vaccinia virus with tumor cells is not affected, that is, the tumor specificity is relatively increased. However, in clinical use, the safety of systemic administration of VGF-deficient and / or TK-deficient oncolytic vaccinia virus is still a concern.

[0003] In 2005, the genetically modified oncolytic adenovirus H101 of Shanghai Sunway Biotech Co., Ltd. was approved by the China Food and Drug Administration (CFDA) for the treatment of head and neck tumors; in 2015, the genetically modified oncolytic herpes simplex virus T-Vec of Amgen was approved by the US FDA and the EU EMA for the treatment of advanced melanoma. However, at present, there is no oncolytic vaccinia virus product on the market.

[0004] Therefore, in the immunotherapy of tumors and / or cancers, there is still a need to develop products with improved drug efficacy, higher tumor specificity and safety by oncolytic viruses.

Summary of the Invention

[0005] To solve the problems of the prior art, the present invention provides an isolated recombinant oncolytic vaccinia virus, a pharmaceutical composition and its use in drugs for treating tumors and / or cancers.

[0006] In particular, the present invention (1) An isolated recombinant oncolytic vaccinia virus, wherein the recombinant oncolytic vaccinia virus is regulatable by a microRNA whose expression level in mammalian tumor cells is lower than its expression level in normal mammalian cells, and a target sequence of the microRNA is incorporated into the 3' UTR region of the E10R gene of the recombinant oncolytic vaccinia virus genome. (2) The microRNA is selected from the group consisting of miR-9, miR-15a, miR-16, miR-26a, miR-27b, miR-29b, miR-30a, miR-32, miR-33, miR-34, miR-95, miR-101, miR-122, miR-124, miR-125a, miR-125b, miR-126, miR-127, miR-128, miR-133b, miR-139, miR-140, miR-142, miR-143, miR-145, miR-181, miR-192, miR-195, miR-198, miR-199a, miR-199b, miR-200, miR-203, miR-204, miR-205, miR-218, miR-219, miR-220, miR-224, miR-345, and miR-375; preferably selected from the group consisting of miR-199a and miR-199b, the recombinant oncolytic vaccinia virus according to (1), (3) The recombinant oncolytic vaccinia virus is the recombinant oncolytic vaccinia virus according to (1), wherein the TK gene and / or the VGF gene is functionally defective. (4) The target sequence of the microRNA is repetitive and contains 2 to 8 repetitions, the recombinant oncolytic vaccinia virus according to (1). (5) The recombinant oncolytic vaccinia virus according to (3), wherein an exogenous IL-21 gene is integrated into the genome of the recombinant oncolytic vaccinia virus, and the IL-21 gene is expressible in tumor cells. (6) The TK gene is functionally defective by insertion of an exogenous nucleotide sequence into the TK gene locus, the recombinant oncolytic vaccinia virus according to (3). (7) The recombinant oncolytic vaccinia virus according to (5), wherein the exogenous IL-21 gene is inserted into the TK gene locus, thereby causing a functional deficiency of the TK gene. (8) The VGF gene is functionally defective by knockout or by insertion of an exogenous nucleotide sequence into the VGF gene locus, the recombinant oncolytic vaccinia virus according to (3). (9) The recombinant oncolytic vaccinia virus according to (1), wherein the recombinant oncolytic vaccinia virus is the WR strain or the Wyeth strain. (10) The recombinant oncolytic vaccinia virus according to (1), wherein an exogenous screening gene containing the gpt gene and / or the LacZ gene is further incorporated into the genome of the recombinant oncolytic vaccinia virus. (11) The recombinant oncolytic vaccinia virus according to (5), wherein the exogenous IL-21 gene is derived from a mouse or a human. (12) A pharmaceutical composition comprising the recombinant oncolytic vaccinia virus according to any one of (1) to (11) as an active ingredient and a pharmaceutically acceptable excipient. (13) The pharmaceutical composition according to (12), wherein the pharmaceutical composition contains the recombinant oncolytic vaccinia virus at a dose of 1×10 5 ~5×10 9 pfu. (14) The pharmaceutical composition according to (12), wherein the recombinant oncolytic vaccinia virus is administered intratumorally or intravenously. (15) A vector for preparing the recombinant oncolytic vaccinia virus according to any one of (1) to (11). (16) The vector according to (15), wherein the vector contains an exogenous IL-21 gene controlled by a promoter. (17) A host cell containing the vector according to (15) or (16). (18) Use of the recombinant oncolytic vaccinia virus according to any one of (1) to (11) in the manufacture of a drug for treating tumors and / or cancers. (19) The use according to (18), wherein the tumors and / or cancers include lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumor, colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer, and osteosarcoma. (20) A method for treating tumors and / or cancers, comprising administering the recombinant oncolytic vaccinia virus according to any one of (1) to (11) to a patient with a tumor and / or cancer. (21) The method according to (20), wherein the recombinant oncolytic vaccinia virus is administered at a dose of 1×10 5 to 5×10 9 pfu once a day for 1 to 6 consecutive days, or once every 2 days for 1 to 6 consecutive times. (22) The method according to (20), wherein the oncolytic virus is administered intratumorally or intravenously. (23) The tumors and / or cancers include lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumor, colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphatic cancer, leukemia, bone cancer, testicular cancer and osteosarcoma, according to the method of (20). To provide.

[0007] Compared with the prior art, the present invention has the following advantages and positive effects.

[0008] The present invention proposes to select a specific essential gene, E10R, from the genome of oncolytic vaccinia virus through intensive research and experiments, and insert an exogenous nucleotide sequence into the 3'UTR region (3' untranslated region) of E10R. Here, the exogenous nucleotide sequence has a target sequence for a specific microRNA, and the expression level of the microRNA in tumor cells is lower than that in normal cells. Therefore, in normal cells infected with oncolytic vaccinia virus, highly expressed microRNA targets the corresponding mRNA of the 3'UTR region of E10R in oncolytic vaccinia virus, degrades the mRNA or inhibits its translation, and can block the expression of E10R by inhibiting the replication of oncolytic vaccinia virus. In contrast, oncolytic vaccinia virus infects tumor cells, and in tumor cells, microRNA is low-expressed or not expressed, so the expression of E10R is not inhibited, thereby maintaining the replication ability of oncolytic vaccinia virus. Therefore, due to the characteristic that the expression levels of specific microRNAs in normal tissues and in tumor tissues may be different in vivo, the present invention provides a novel recombinant oncolytic vaccinia virus with significant selectivity for tumor cells. The inventors have surprisingly found that the recombinant oncolytic vaccinia virus of the present invention replicates significantly more highly in various tumor cells compared to normal cells, thereby having excellent tumor specificity and safety and being able to significantly inhibit the growth of tumor cells.

[0009] Furthermore, in the present invention, the type of microRNA is further selected, and various microRNAs (preferably miR-199) are found to effectively achieve the object of the present invention, and the recombinant oncolytic vaccinia virus exhibits stronger tumor selectivity and safety.

[0010] The novel recombinant oncolytic vaccinia virus of the present invention may further contain an inactivated TK gene and / or VGF gene, thereby achieving further excellent tumor selectivity, and compared with existing oncolytic vaccinia viruses (for example, TK-deficient and / or VGF-deficient vaccinia viruses), replication in normal cells is significantly reduced, and the killing effect on normal cells is significantly reduced.

[0011] Furthermore, in the present invention, it is further possible to retain the gene of IL-21, which is an immune modifier, in the novel oncolytic vaccinia virus. Therefore, the obtained recombinant oncolytic vaccinia virus selectively replicates in tumor cells and expresses IL-21, which is an immune modifier. In this way, the present invention ensures that the novel oncolytic vaccinia virus fully plays its role of selectively replicating in tumor cells, killing tumor cells, and causing subsequent immune responses in the body, and at the same time, can fully exert the anti-tumor immune effect of exogenous IL-21. The present invention finds that by integrating the IL-21 gene into the oncolytic vaccinia virus, it is possible to synergistically combine the oncolytic killing effect of the oncolytic virus and the anti-tumor immune activation effect of IL-21.

[0012] Therefore, the present invention can provide a rich product with higher efficiency in cancer treatment, and a product with excellent effects, tumor target specificity and safety.

Brief Description of the Drawings

[0013]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

Mode for Carrying Out the Invention

[0014] The present invention will be further described with reference to the drawings in the following detailed description of preferred embodiments. This description should not be construed in a limiting sense, and various modifications or improvements can be appropriately made without departing from the gist of the present invention. Therefore, it will be apparent to those skilled in the art that such modifications or improvements fall within the scope of the present invention.

[0015] In the present invention, the terms "tumor", "cancer", "tumor cell" and "cancer cell" encompass the meanings generally understood in the art.

[0016] The term "oncolytic virus" or "oncolytic vaccinia virus" as used herein refers to a virus or vaccinia virus that selectively replicates in tumor cells and can lyse tumor cells.

[0017] The term "therapeutically effective dose" as used herein refers to the amount of a functional agent or pharmaceutical composition that exhibits a detectable therapeutic or inhibitory effect or is useful for producing an antitumor effect. These effects can be detected by assay methods known in the art.

[0018] The term "administer" or "administration" as used herein refers to providing a compound, complex or composition (including viruses and cells) to a subject.

[0019] The term "patient" as used herein refers to a human or non-human organism. Therefore, the methods and compositions described herein are applicable to both human diseases and animal diseases. In certain embodiments, the patient has a tumor. In some cases, the patient may be simultaneously affected by one or more types of cancer.

[0020] The term "synergistic effect" as used herein refers to an effect that occurs between two or more agents and produces an effect greater than the sum of their individual effects.

[0021] The term "pfu" or "plaque forming unit" as used herein refers to the number of plaque-forming viruses.

[0022] As used herein, the term "MOI" or "multiplicity of infection" refers to the ratio of the number of viruses to the number of cells, i.e., the number of virus particles used to initiate virus infection per cell. MOI = pfu / cell, i.e., number of cells × MOI = total PFU.

[0023] Strategies for controlling virus replication based on the use of endogenous microRNAs (miRNAs) have been widely used (see Yloesmaeki et al., Generation of a conditionally replicating adenovirus based on targeted destruction of E1A mRNA by a cell type-specific MicroRNA. J Virol 82: 11009-11015. 2008). miRNAs are small nucleic acid molecules of 20-24 bp and play important biological roles in the expression of target genes or the modification of proteins after translation by binding to the non-coding sequences of specific target genes (see Ambros et al., The functions of animal microRNAs. Nature 431: 350-355 2004).In cancer research, the expression of a series of small miRNA molecules has been found to change significantly during tumor progression (see Negrini et al., MicroRNAs in human cancer: from research to therapy. J Cell Sci 120: 1833-1840. 2007), and many targets of genes related to cancer, such as mTOR, c-Met, HIF-1α, and CD44, have been found to be regulated (see Fornari et al., miR-199a-3p regulates mTOR and c-Met to influence the doxorubicin sensitivity of human hepatocarcinoma cells. Cancer Res 70: 5184-5193. 2010; “Kim et al., MicroRNA miR-199a regulates the MET proto-oncogene and the downstream extracellular signal-regulated kinase 2 (ERK2). J Biol Chem 283:18158-18166. 2008; Jia et al., Lentivirus-Mediated Overexpression of MicroRNA-199a Inhibits Cell Proliferation of Human Hepatocellular Carcinoma. Cell Biochem Biophys, 62:237-44. 2011; Henry et al., miR-199a-3p targets CD44 and reduces proliferation of CD44 positive hepatocellular carcinoma cell lines. Biochem Biophys Res Commun 403:120-125. 2010).

[0024] In order to provide a novel recombinant oncolytic vaccinia virus having remarkable selectivity for tumor cells, the inventors selected a specific essential gene, E10R, from the genome of oncolytic vaccinia virus through intensive research and experimental exploration, and proposed inserting an exogenous nucleotide sequence containing a target sequence of a specific microRNA having a lower expression level in tumor cells than in normal cells into the 3'UTR region (3' untranslated region) of E10R. In this way, in normal cells infected with oncolytic vaccinia virus, the highly expressed microRNA targets the corresponding mRNA within the 3'UTR region of E10R of oncolytic vaccinia virus, degrades the mRNA or inhibits its translation, thereby inhibiting the expression of E10R by inhibiting the replication of oncolytic vaccinia virus. In contrast, in tumor cells infected with oncolytic vaccinia virus, since the microRNA is low-expressed or not expressed, the expression of E10R is not inhibited, thereby maintaining the replication ability of oncolytic vaccinia virus. Therefore, by utilizing the feature that the expression levels of specific microRNAs in normal tissues and in tumor tissues in vivo may be different, the present invention provides a novel recombinant oncolytic vaccinia virus having higher and more remarkable selectivity for tumor cells. The inventors surprisingly found that the recombinant oncolytic vaccinia virus of the present invention replicates significantly more highly in various tumor cells than in normal cells, thereby bringing about excellent tumor target specificity and safety and being able to significantly inhibit the growth of tumor cells. Furthermore, since the novel recombinant oncolytic vaccinia virus can replicate only in tumor cells lacking specific microRNAs, it realizes stronger tumor cell selectivity and can reduce the effect of the virus on normal tissues.

[0025] Based on the above concept, the present invention provides an isolated recombinant oncolytic vaccinia virus that can be regulated by a microRNA whose expression level in mammalian tumor cells is lower than that in normal cells of the same mammal, and a target sequence of the microRNA is incorporated into the 3'UTR region of the E10R gene of the recombinant oncolytic vaccinia virus genome.

[0026] The microRNA has a lower expression level in mammalian tumor cells than in normal cells of the same mammal, which means that the expression level of the microRNA in at least one type of tumor cell of a mammal is lower than that in at least one type of normal cell of the same mammal. Mammals include humans.

[0027] It has been found in the present invention that the replication of the recombinant oncolytic vaccinia virus in tumor cells is significantly higher than that in normal cells, and can significantly inhibit the growth of tumor cells.

[0028] MicroRNAs include those that are lowly expressed or not expressed in tumor cells known in the art, and also those that are determined by techniques known in the art to be lowly expressed or not expressed in tumor cells. The microRNA can be selected from the group consisting of miR-9, miR-15a, miR-16, miR-26a, miR-27b, miR-29b, miR-30a, miR-32, miR-33, miR-34, miR-95, miR-101, miR-122, miR-124, miR-125a, miR-125b, miR-126, miR-127, miR-128, miR-133b, miR-139, miR-140, miR-142, miR-143, miR-145, miR-181, miR-192, miR-195, miR-198, miR-199a, miR-199b, miR-200, miR-203, miR-204, miR-205, miR-218, miR-219, miR-220, miR-224, miR-345 and miR-375; preferably selected from the group consisting of miR-199a and miR-199b. Among these, miR-199 (including miR-199a and miR-199b) can most effectively achieve the object of the present invention, and the obtained recombinant oncolytic vaccinia virus exhibits stronger tumor selectivity and safety. In the present invention, the miRNA includes either a miRNA precursor or a mature miRNA, and refers to the mature miRNA unless otherwise specified.

[0029] In this specification, the names and numbers of the above-mentioned microRNAs are understood and well-known in the art (for example, mature miRNAs are referred to as miR, and highly homologous miRNAs have their numbers followed by a lowercase English letter. For example, miR-199a and miR-199b), each having a known specific nucleotide sequence, and the specific nucleotide sequence can be searched on the miRBase public database website (http: / / www.mirbase.org / ).

[0030] The mature miRNA (mature RNA) or the mature form of miRNA is generated by cleavage of the long primary transcript by a series of nucleases. The primary transcript (pri-miRNA) varies in length from several hundred bases to several thousand bases and has a 5'-end cap, a 3'-end polyA tail, and one to several hairpin stem-loop structures. The primary transcript is cleaved to generate a precursor miRNA of about 70 bases, i.e., pre-miRNA. The precursor miRNA (pre-miRNA) is further cleaved to form a single-stranded mature miRNA of about 22 bases in length. Generally, pri-miRNA, pre-miRNA, and mature miRNA may be present in cells. In this specification, miRNA includes either precursor miRNA or mature miRNA, and refers to mature miRNA unless otherwise specified.

[0031] Preferably, the target sequence of the microRNA is repetitive, preferably having 2 to 8, more preferably 3 to 4 repetitions. In some embodiments, the repetitive target sequences of the microRNA are separated by spacers of two or more nucleotides (e.g., gg, cc, and ggcc). The repetitive target sequences of the miRNA can be the reverse complement of the miRNA.

[0032] Preferably, the recombinant oncolytic vaccinia virus has a functionally defective TK gene and / or VGF gene. The oncolytic vaccinia virus constructed in this way achieves enhanced tumor cell selectivity and significantly reduces the replication ability in normal cells and the killing effect on normal cells compared to known oncolytic vaccinia viruses (e.g., TK / VGF double-deficient vaccinia virus).

[0033] As used herein, the term "functionally defective" when referring to a gene of an oncolytic virus means that the oncolytic virus is unable to perform the function that the gene inherently should have, i.e., the function is lost. This objective can be achieved, for example, by inserting an exogenous fragment into the gene or knocking out the gene.

[0034] Therefore, an exogenous nucleotide sequence can be inserted into the TK gene to functionally disrupt the TK gene. It is also possible to insert an exogenous nucleotide sequence into the VGF gene and / or knockout the VGF gene to functionally disrupt the VGF gene.

[0035] Preferably, an exogenous IL-21 gene is incorporated into the genome of a recombinant oncolytic vaccinia virus, and the IL-21 gene can be expressed in tumor cells.

[0036] IL-21 (i.e., interleukin 21) is a pleiotropic type I cytokine, mainly produced by T cells, regulates innate and adaptive immune responses, and plays an important role in the anti-tumor immune response. The effects of IL-21 on various immune cells and signal transduction have been reported in the literature (see Leonard, WJ & Wan, C. IL-21 Signaling in Immunity. F1000Research 5, 1-10 (2016)). The main types of immune cells include the following: 1) CD4 + T cells: promoting proliferation and cytokine production; T fh cells: promoting differentiation and improving central function development; T h17 cells: promoting differentiation and proliferation; T reg cells: inhibiting production and survival; 2) NKT cells: enhancing proliferation and cytotoxicity; 3) CD8 + T cells: improving cytotoxicity, proliferation and / or survival, anti-tumor effect; 4) NK cells: promoting cell maturation, proliferation, enhancing cell cytotoxic effect, and enhancing anti-tumor activity; 5) DC cells: inhibiting antigen presentation function and inducing apoptosis; 6) macrophages: enhancing phagocytosis; 7) B cells: promoting proliferation and / or promoting apoptosis, plasma cell differentiation and immunoglobulin production; 8) In addition, IL-21 activates various tumor-related signal channels including JAK / STAT, MARK / PI3K and other signal channels, and can regulate tumor progression. In tumor immunotherapy, NK cells and CD8 +Activation of T cell cytotoxicity is important, and numerous studies have fully demonstrated that IL-21 plays an important role in its progression. IL-21 promotes the maturation of NK cells, induces the production of IFN-γ, granzyme B, and perforin, induces NK cell-mediated antitumor cell cytotoxicity, and increases the lethality of NK cells by antibody-dependent cell cytotoxicity (ADCC) (see Spolski, R. & Leonard, WJ Interleukin-21: a double-edged sword with therapeutic potential. Nat. Rev. Drug Discov. 13, 379-395, 2014). Second, IL-21 induces the proliferation of CD8 + T cells, induces the generation of memory T cells, promotes the secretion of IFNγ / granzyme B, enhances tumor killing by CD8 + T cells, and contributes to the memory immune response against recurrent tumor cells. Importantly, unlike IL-2, IL-21 does not induce the expansion of T reg cells and further enhances the immune function response of CD8 + T cells (see Spolski, R. & Leonard, WJ Interleukin-21: a double-edged sword with therapeutic potential. Nat. Rev. Drug Discov. 13, 379-395, 2014). Based on the diverse effects of IL-21 on immune cells, it has been shown that IL-21 can "reactivate" various effector cells in the tumor microenvironment.

[0037] The present invention further enhances the antitumor effect of oncolytic vaccinia virus by inserting an IL-21 gene capable of regulating immunity into the genome of oncolytic vaccinia virus. In this way, the oncolytic virus can be selectively replicated in tumor cells to kill the tumor cells, and then the body's immune response can be further induced. On the other hand, the antitumor immune effect of exogenous IL-21 can be fully exerted. According to the present invention, it has been found that by incorporating the IL-21 gene into oncolytic vaccinia virus, a synergistic effect between the oncolytic killing effect of oncolytic virus and the antitumor immune activation effect of IL-21 can be produced.

[0038] Preferably, the exogenous IL-21 gene is inserted into the TK locus, so that the TK gene can be functionally deficient and the IL-21 gene can be expressed after infection of tumor cells.

[0039] Examples of the vaccinia virus that can be used in the present invention include the Wyeth strain or the WR strain, and an example of the WR strain is VSC20.

[0040] In a preferred embodiment, the recombinant oncolytic vaccinia virus is obtained by genetic modification of the VSC20 vaccinia virus, in which the LacZ gene is inserted into the C11R locus and lacks the VGF gene. The preparation method can be found in McCart, JA, et al. Systemic cancer therapy with a tumor-selective vaccinia virus mutant lacking thymidine kinase and vaccinia growth factor genes. Cancer Res (2001) 61: 8751-8757. The genetic modification includes inserting a repetitive target sequence of a specific microRNA, such as the target sequence of miR-199 (miR-199a-3p or miR-199b-3p), into the 3'UTR region of the E10R gene of the VSC20 vaccinia virus.

[0041] In one aspect, the present invention constructs a shuttle plasmid containing the left and right homologous arms of the E10R gene and the repetitive target sequences of specific microRNAs by genetic engineering, and then introduces the shuttle plasmid into the VSC20 vaccinia virus. A recombinant virus in which the repetitive target sequence of the specific microRNA is inserted into the 3'UTR region of the E10R gene is obtained by a recombination mechanism. A flowchart of a specific aspect of the construction of the shuttle plasmid is shown in Figure 1.

[0042] Genetic modification also includes inserting an exogenous sequence (e.g., the IL-21 gene) into the TK gene of the VSC20 vaccinia virus, thereby functionally deleting the TK gene. The specific method may be as described in Preparation Example 3 or 4, or may be as described in Chinese Patent Publication No. 109554353 (A) the entire content of which is incorporated herein by reference.

[0043] An exogenous screening gene can also be incorporated into the genome of the recombinant oncolytic vaccinia virus. Examples of the exogenous screening gene include the gpt (guanine phosphoribosyltransferase) gene, the LacZ gene, and the fluorescent protein gene (e.g., the red fluorescent protein gene). Preferably, the fluorescent protein gene is not included in order to avoid potential safety problems of the fluorescent protein expressed in patients.

[0044] The genome of the recombinant oncolytic vaccinia virus may not include an exogenous screening gene either.

[0045] In one aspect, the present invention controls the gpt gene using the vaccinia virus promoter p7.5 and controls the exogenous IL-21 gene using the synthetic vaccinia virus early / late promoter pSEL. In that case, the gpt and IL-21 genes are inserted into the TK gene region of the vaccinia virus VSC20 strain using in vitro intracellular recombination technology to construct an oncolytic virus. The two promoters activate the expression of their respective regulated genes in a back-to-back manner.

[0046] Preferably, the exogenous IL-21 gene is derived from a mouse or a human.

[0047] The recombinant oncolytic vaccinia virus of the present invention may be obtained by known methods related to the field of biotechnology.

[0048] Based on the recombinant oncolytic vaccinia virus developed by the present invention, the present invention also provides a pharmaceutical composition containing the recombinant oncolytic vaccinia virus according to the present invention and a pharmaceutically acceptable excipient as an active ingredient.

[0049] Preferably, the pharmaceutical composition contains a therapeutically effective amount of the recombinant oncolytic vaccinia virus. In certain embodiments, the active ingredient of the pharmaceutical composition is the recombinant oncolytic vaccinia virus according to the present invention at 1×10 5 ~5×10 9 pfu / day (e.g., 1×10 5 ~3×10 9 pfu / day, 1×10 5 ~1×10 8 pfu / day).

[0050] The oncolytic virus may be administered by administration methods commonly used in the art, such as intratumoral administration or intravenous administration.

[0051] The pharmaceutical composition of the present invention may also contain other active ingredients known in the art, such as interleukin 2 (IL-2), IL-15, IL-17, IL-18, granulocyte macrophage colony-stimulating factor (GM-CSF), interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α), etc. Their dosages and administration routes may be made in their conventional manners. When other active ingredients are included, the recombinant oncolytic vaccinia virus should exist independently in the pharmaceutical composition without being mixed with other active ingredients. For example, the recombinant oncolytic vaccinia virus is individually packaged in a separate container.

[0052] It will be understood by those skilled in the art that the pharmaceutical composition of the present invention may further contain a suitable pharmaceutically acceptable excipient.

[0053] In some embodiments, the pharmaceutical composition of the present invention comprises one or more pharmaceutically acceptable carriers. The pharmaceutical formulation may be prepared by procedures known in the art. For example, compounds containing the active ingredient, etc., may be formulated using common excipients, diluents (e.g., phosphate buffers or physiological saline), tissue culture media, and carriers (e.g., autologous plasma or human serum albumin), and may be administered as a suspension. Other carriers include liposomes, micelles, nanocapsules, polymeric nanoparticles, solid lipid particles (see, for example, E. Koren and V. Torchilin, Life, 63:586 - 595, 2011). Details regarding the techniques for formulating the pharmaceutical compositions disclosed in this specification are well - described in the scientific and patent literature (see, for example, the latest edition of Remington's Pharmaceutical Sciences, Maack Publishing Co., Easton PA (Remington's)).

[0054] Another aspect of the present invention also provides a vector for preparing a recombinant oncolytic vaccinia virus according to the present invention.

[0055] The E10R gene within the vaccinia virus can be modified by a recombination mechanism using a vector. For example, in certain embodiments, as shown in Figure 4, the recombinant vector includes left and right homologous arms of the E10R gene, repeated target sequences of miR-199 (hsa-miR-199a-3p or hsa-miR-199b-3p), and an expression frame that initiates the expression of the exogenous screening gene mCherry / Zeocin. Preferably, the vector can cause a functionally defective TK gene by a recombination mechanism in the vaccinia virus. In another specific embodiment, as shown in Figure 6, the recombinant vector includes left and right homologous arms of the E10R gene, repeated target sequences of miR-199 (hsa-miR-199a-3p or hsa-miR-199b-3p), an expression frame that initiates the expression of the exogenous screening gene mCherry / Zeocin, and TK homologous fragments TK-L and TK-R. When the vaccinia virus is the WR strain, the sequence of the TK gene is the sequence of nucleotides 80724 - 81257 of the vaccinia virus gene numbered NC_006998 in GenBank of the NCBI (National Center for Biotechnology Information, URL: https: / / www.ncbi.nlm.nih.gov). The sequence of TK-L may be, for example, a sequence fragment of nucleotides 80724 - 80961, and the sequence of TK-R may be, for example, a sequence fragment of nucleotides 81033 - 81257. The insertion site of the repeated target sequence of miR-199 (hsa-miR-199a-3p or hsa-miR-199b-3p) may be, for example, nucleotide 56974 of the left homologous arm of the E10R gene. In another specific embodiment, as shown in Figure 8, the recombinant vector includes left and right homologous arms of the E10R gene, repeated target sequences of miR-199 (hsa-miR-199a-3p or hsa-miR-199b-3p), an expression frame that initiates the expression of the exogenous screening gene mCherry / Zeocin, TK homologous fragments TK-L, TK-R, and an expression frame that initiates the expression of the IL-21 gene and the exogenous screening gene gpt.By means of a vector, an IL-21 gene expression frame and a gpt gene expression frame can be inserted into the TK gene region of vaccinia virus by an intracellular recombination mechanism (for example, deleting the sequence fragment of 80962 - 81032 bp in the vaccinia virus gene numbered NC_006998 in GenBank). As a result, the recombinant vaccinia virus loses the function of the TK gene. The insertion site of the repeated target sequence of miR-199 (hsa-miR-199a-3p or hsa-miR-199b-3p) may be, for example, 56974 bp of the left homologous arm of the E10R gene.

[0056] Another aspect of the present invention also provides a host cell containing the vector of the present invention.

[0057] Another aspect of the present invention also provides the use of the recombinant oncolytic vaccinia virus according to the present invention in the manufacture of a drug for treating tumors and / or cancers.

[0058] Tumors and / or cancers include, but are not limited to, lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumors (eg, glioma), colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer and osteosarcoma.

[0059] Another aspect of the present invention also provides a method for treating tumors and / or cancers, which includes administering the recombinant oncolytic vaccinia virus according to the present invention to a patient with tumors and / or cancers.

[0060] Tumors and / or cancers include, but are not limited to, lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumors (eg, glioma), colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer and osteosarcoma.

[0061] In a preferred embodiment of the present invention, the dose of the recombinant oncolytic vaccinia virus administered is a therapeutically effective amount, which is administered once a day for 1 to 6 consecutive days; or once every 2 days for 1 to 6 consecutive times. The therapeutically effective amount is preferably 1×10 5 ~5×10 9 pfu / day (e.g., 1×10 5 ~3×10 9 pfu / day, 1×10 5 ~1×10 8 pfu / day).

[0062] If necessary, the recombinant oncolytic vaccinia virus of the present invention can also be used in combination with other drugs, such as interleukin-2 (IL-2), IL-15, IL-17, IL-18, granulocyte macrophage colony-stimulating factor (GM-CSF), interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α), etc., and their dosages and administration routes may be in their conventional manners.

[0063] Based on specific situations and needs, the method for treating tumors and / or cancers according to the present invention can be applied to a patient once or multiple times.

[0064] The oncolytic virus may be administered by an administration method generally used in the art, such as intratumoral administration or intravenous administration.

[0065] The present invention provides (A) a first pharmaceutical composition comprising the recombinant oncolytic vaccinia virus of the present invention in a first pharmaceutically acceptable carrier; and (B) a second pharmaceutical composition comprising NK cells in a second pharmaceutically acceptable carrier also provides a therapeutic agent.

[0066] In some embodiments, the first pharmaceutically acceptable carrier and the second pharmaceutically acceptable carrier are the same. In other embodiments, the first pharmaceutically acceptable carrier and the second pharmaceutically acceptable carrier are different.

[0067] In some cases, the therapeutic agent can also be understood as a drug combination.

[0068] The mechanisms by which oncolytic viruses kill tumor cells are generally similar. In various embodiments, the oncolytic virus is administered intratumorally or intravenously. When the oncolytic virus contacts the tumor cells, the oncolytic virus infects and invades the tumor cells. Since the oncolytic virus mainly replicates and proliferates in tumor cells and hardly replicates in normal cells, a large number of progeny oncolytic viruses can be produced in the infected tumor cells, thereby leading to the lysis and death of the tumor cells. When the tumor cells lyse, a number of tumor-associated antigens and progeny oncolytic viruses can be released. Subsequently, the immune system can be further activated in vivo by the antigens, whereby NK cells and T cells are stimulated in vivo to continue attacking the remaining tumor cells. During this time, the progeny oncolytic viruses can infect tumor cells that have not yet been infected.

[0069] NK cells are immune cells that can kill a wide range of tumor cells, and NK cells can distinguish between tumor cells and normal cells. When NK cells contact tumor cells, they recognize the tumor cells as abnormal cells and kill the tumor cells through multiple auxiliary methods, such as receptor recognition, target recognition by antibodies (ADCC), and the release of granzymes, perforin, and interferon that can indirectly kill tumor cells. In in vitro tests, it has been shown that healthy NK cells can kill up to 27 types of tumor cells throughout their lifespan.

[0070] NK cells also have antiviral functions. When a virus infects normal cells, the virus replicates in large quantities, the infected cells age, and the composition of the protein clusters on their cell membranes changes. During this process, NK cells can sensitively and effectively recognize the infected cells and kill them using the same method as that used to kill the tumor cells described above, thus inhibiting virus replication and proliferation. Subsequently, when the antigen is activated and immune factors, such as interferon, are involved, other types of immune cells continue to fight the virus.

[0071] In the present invention, the individual characteristics of oncolytic viruses and NK cells are considered, and therefore, they can be skillfully combined. When combined, the antiviral mechanism of NK cells is also applicable to tumor cells infected with oncolytic viruses, which complements the anti-tumor mechanism of NK cells. Furthermore, through combination therapy, it becomes possible to target tumor cells infected with oncolytic viruses with NK cells, and their tumor-killing effect is improved. Oncolytic viruses selectively replicate in cancer cells, not only killing cancer cells from the inside but also causing changes in the protein receptor clusters on the cell membrane, facilitating the recognition of cancer cells by NK cells, so that NK cells can attack cancer cells from the outside. Therefore, oncolytic viruses and NK cells synergistically kill cancer cells, achieving improved effectiveness. More preferably, the recombinant oncolytic vaccinia virus of the present invention also expresses exogenous IL-21, and the expressed exogenous IL-21 enhances the killing power of NK cells, and can further enhance the killing effect of NK cells. By using the recombinant oncolytic vaccinia virus described in the present invention in combination with NK cells, a surprising tumor-killing effect can be produced.

[0072] Preferably, the active ingredient of the first pharmaceutical composition is the recombinant oncolytic vaccinia virus according to the present invention, and the active ingredient of the second pharmaceutical composition is NK cells.

[0073] Preferably, the first pharmaceutical composition and the second pharmaceutical composition exist independently of each other and are not mixed with each other in the therapeutic agent.

[0074] In the present invention, the NK cells can be selected from autologous NK cells and allogeneic NK cells; preferably, the NK cells are autologous NK cells obtained by in vitro proliferation or allogeneic NK cells obtained by in vitro proliferation. Large-scale in vitro proliferation culture techniques for NK cells are known and substantially mature (see, for example, Somanchi SS, Lee DA. Ex Vivo Expansion of Human NK Cells Using K562 Engineered to Express Membrane Bound IL21 Methods Mol Biol. 2016; 1441: 175-93. or Phan MT, Lee SH, Kim SK, Cho D. Expansion of NK Cells Using Genetically Engineered K562 Feeder Cells. Methods Mol Biol. 2016; 1441: 167-74.). From clinical data, it has been confirmed that autologous NK cells, semi-allogeneic NK cells (belonging to allogeneic NK cells), and NK cells prepared from umbilical cord blood have no toxic side effects, no long-term dependence, and are safe and effective when recycled into the human body.

[0075] The purity of NK cells that can be used for treatment may be as follows: the purity of autologous NK cells may be 85% or more, and the purity of allogeneic NK cells may be 90% or more; the impurity cells may be NK-T and / or γδT cells. Preferably, the NK cell activity (survival rate) is 90% or more, and the killing activity of NK cells is 80% or more.

[0076] Regarding the combination treatment scheme of the present invention, the present invention further explores and optimizes the respective dosages of the oncolytic virus and NK cells, which are crucial. Preferably, the first pharmaceutical composition contains 1×10 5 ~5×10 9containing pfu / day (e.g., 1×10 5 ~3×10 9 pfu / day of recombinant oncolytic virus, 1×10 5 ~1×10 8 pfu / day of recombinant oncolytic vaccinia virus), the second pharmaceutical composition contains NK cells at 1×10 7 ~1×10 10 cells / day (preferably, the second pharmaceutical composition contains NK cells at 1×10 8 ~5×10 9 cells / day; more preferably, the second pharmaceutical composition contains NK cells at 1×10 9 ~4×10 9 cells / day; even more preferably, the second pharmaceutical composition contains NK cells at 1×10 9 ~3×10 9 cells / day). Preferably, the active ingredient of the therapeutic agent is 1×10 5 ~5×10 9 pfu / day of recombinant oncolytic vaccinia virus (e.g., 1×10 5 ~3×10 9 pfu / day of recombinant oncolytic vaccinia virus, 1×10 5 ~1×10 8 pfu / day of recombinant oncolytic vaccinia virus) and 1×10 7 ~1×10 10 cells / day of NK cells (e.g., 1×10 8 ~5×10 9 cells / day, 1×10 9 ~4×10 9 cells / day, 1×10 9 ~3×10 9 cells / day).

[0077] The recombinant oncolytic vaccinia virus may be administered by an administration method generally used in the art, such as intratumoral administration or intravenous administration.

[0078] The NK cells may be administered, for example, intravenously, using an administration method generally used in the art.

[0079] Those skilled in the art will understand that the therapeutic agent of the present invention may further contain a suitable pharmaceutically acceptable excipient.

[0080] The therapeutic agent of the present invention may also contain other active ingredients known in the art, such as interleukin-2 (IL-2), IL-15, IL-17, IL-18, granulocyte macrophage colony-stimulating factor (GM-CSF), interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α), and the like.

[0081] In some embodiments, the therapeutic agent of the present invention comprises one or more pharmaceutically acceptable carriers. The pharmaceutical preparation may be prepared by methods known in the art. For example, the active ingredient (e.g., compound) may be formulated using common excipients, diluents (e.g., phosphate buffers or physiological saline), tissue culture media, and carriers (e.g., autologous plasma or human serum albumin), and may be administered as a suspension. Other carriers may include liposomes, micelles, nanocapsules, polymeric nanoparticles, solid lipid particles (see, for example, E. Koren and V. Torchilin, Life, 63: 586-595, 2011). Methods for formulating the therapeutic agent of the present invention can be found in scientific and patent literature. See, for example, the latest edition of Remington's Pharmaceutical Sciences, Maack Publishing Company, Easton PA (Remington's).

[0082] The therapeutic agent of the present invention can be used to treat various tumors and / or cancers, including but not limited to lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumors (e.g., glioma), colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer, and osteosarcoma.

[0083] The administration method of the therapeutic agent of the present invention is as follows: First, administer recombinant oncolytic vaccinia virus to the tumor and / or cancer patient, and 18 to 72 hours after the administration of the recombinant oncolytic vaccinia virus (for example, 20 to 70 hours later, 22 to 48 hours later, 24 to 48 hours later, 30 to 48 hours later), administer NK cells to the tumor and / or cancer patient. The phrase "administer NK cells to the tumor and / or cancer patient 18 to 72 hours after the administration of the recombinant oncolytic vaccinia virus (for example, 20 to 70 hours later, 22 to 48 hours later, 24 to 48 hours later, 30 to 48 hours later)" means that the interval between the first administration of NK cells and the first administration of the recombinant oncolytic vaccinia virus is 18 to 72 hours (for example, 20 to 70 hours, 22 to 48 hours, 24 to 48 hours, 30 to 48 hours), or the interval between the first administration of NK cells and the most recent administration of the recombinant oncolytic vaccinia virus is 18 to 72 hours (for example, 20 to 70 hours, 22 to 48 hours, 24 to 48 hours, 30 to 48 hours). Preferably, the interval between the first administration of NK cells and the most recent administration of the recombinant oncolytic vaccinia virus is 18 to 72 hours (for example, 20 to 70 hours, 22 to 48 hours, 24 to 48 hours, 30 to 48 hours). More preferably, the interval between the first administration of NK cells and the most recent administration of the recombinant oncolytic vaccinia virus is 24 to 48 hours.

[0084] In a preferred embodiment of the present invention, the recombinant oncolytic vaccinia virus is administered at a therapeutically effective amount once a day for 1 to 6 consecutive days; NK cells are administered at 1×10 7 ~1×10 10 cells / day (for example, 1×10 8 ~5×10 9 cells / day, 1×10 9 ~4×10 9 cells / day, 1×10 9 ~3×10 9 cells / day) once a day for 1 to 6 consecutive days. In another preferred embodiment of the present invention, the dosage of the recombinant oncolytic vaccinia virus is a therapeutically effective amount administered once every two days for 2 to 6 consecutive days; the dosage of NK cells is 1×10 7 ~1×10 10 cells / day (for example, 1×10 8 ~5×109 cells / day, 1×10 9 ~4×10 9 cells / day, 1×10 9 ~3×10 9 cells / day), administered once every two days for 2 to 6 consecutive days. As long as NK cells are administered to the tumor and / or cancer patient 18 to 72 hours after the administration of the recombinant oncolytic vaccinia virus, any one of the above-described embodiments, or other embodiments can be used in accordance with the present invention. The recombinant oncolytic vaccinia virus and NK cells may be administered alternately (e.g., administering the recombinant oncolytic vaccinia virus on day 1, administering NK cells on day 2, administering the recombinant oncolytic vaccinia virus on day 3, administering NK cells on day 4, etc.); sequentially (e.g., administering the recombinant oncolytic vaccinia virus on day 1, administering the recombinant oncolytic vaccinia virus and NK cells in order on day 2, administering the recombinant oncolytic vaccinia virus and NK cells in order on day 3, and administering the recombinant oncolytic vaccinia virus and NK cells in order on day 4, etc.); or other dosing regimens (e.g., first, administering the recombinant oncolytic vaccinia virus once a day for 1 to 6 consecutive days, and after a 18 to 72-hour interval, administering NK cells once a day for 1 to 6 consecutive days) may be used. Preferably, the recombinant oncolytic vaccinia virus is first administered, and NK cells are administered 18 to 72 hours after all administrations of the recombinant oncolytic vaccinia virus dosing are completed. In a preferred embodiment of the present invention, first, a recombinant oncolytic vaccinia virus is administered to a tumor and / or cancer patient, and the recombinant oncolytic vaccinia virus is administered only once at a therapeutically effective dose; 18 to 72 hours after the administration of the recombinant oncolytic vaccinia virus, NK cells are administered to the tumor and / or cancer patient, and the NK cells are 1×10 7 cells / day to 1×10 10 / day (e.g., 1×10 8 ~5×10 9 cells / day, 1×10 9 ~4×10 9 cells / day, 1×10 9 ~3×10 9administered only once per day (cells / day). The therapeutically effective amount of the recombinant oncolytic vaccinia virus is preferably 1×10 5 ~5×10 9 pfu / day (e.g., 1×10 5 ~3×10 9 pfu / day, 1×10 5 ~1×10 8 pfu / day).

[0085] The present invention also provides the use of the therapeutic agent of the present invention in the manufacture of a drug for treating tumors and / or cancers.

[0086] Tumors and / or cancers include, but are not limited to, lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumors (e.g., glioma), colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer, and osteosarcoma.

[0087] According to another aspect of the present invention, there is provided a kit of combination drugs having a synergistic effect for treating tumors and / or cancers, comprising a first container containing the recombinant oncolytic vaccinia virus of the present invention and a second container containing the NK cells of the present invention, wherein the first container and the second container are separated. The kit further includes instructions specifying the timing and route of administration. Preferably, the kit consists of independent containers each containing the recombinant oncolytic vaccinia virus of the present invention and the NK cells of the present invention, respectively, and instructions specifying the timing and route of administration.

[0088] Tumors and / or cancers include, but are not limited to, lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumors (e.g., glioma), colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer, and osteosarcoma.

[0089] Preferably, the first container containing the recombinant oncolytic vaccinia virus of the present invention contains a therapeutically effective amount of the recombinant oncolytic vaccinia virus, and the second container containing NK cells contains 1×10 7 ~1×10 10 cells / day (e.g., 1×10 8 ~5×10 9 cells / day, 1×10 9 ~4×10 9 cells / day, 1×10 9 ~3×10 9 cells / day) of NK cells sufficient to provide. The therapeutically effective amount of the recombinant oncolytic vaccinia virus is preferably 1×10 5 ~5×10 9 pfu / day (e.g., 1×10 5 ~3×10 9 pfu / day, 1×10 5 ~1×10 8 pfu / day).

[0090] Preferably, the first container containing the recombinant oncolytic vaccinia virus contains 1×10 5 ~1×10 8 pfu / day of the recombinant oncolytic vaccinia virus, and the second container containing NK cells contains 1×10 9 ~3×10 9 cells / day of NK cells.

[0091] In the present invention, the NK cells can be selected from autologous NK cells and allogeneic NK cells; preferably, the NK cells are autologous NK cells obtained by in vitro expansion or allogeneic NK cells obtained by in vitro expansion.

[0092] The recombinant oncolytic vaccinia virus may be administered using an administration method commonly used in the art, such as intratumoral administration or intravenous administration.

[0093] The NK cells may be administered, for example, intravenously, using an administration method commonly used in the art.

[0094] Tumors and / or cancers include, but are not limited to, lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumors (e.g., glioma), colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer, and osteosarcoma.

[0095] Another aspect of the present invention is a method for treating tumors and / or cancers, comprising: 1) administering the recombinant oncolytic vaccinia virus according to the present invention to a patient with tumors and / or cancers; 2) administering the NK cells according to the present invention to a patient with tumors and / or cancers 18 to 72 hours (e.g., 20 to 70 hours, 22 to 48 hours, 24 to 48 hours, 30 to 48 hours) after the administration of the recombinant oncolytic vaccinia virus. A method sequentially comprising the above steps is also provided.

[0096] The phrase "administering the NK cells according to the present invention to a patient with tumors and / or cancers 18 to 72 hours (e.g., 20 to 70 hours, 22 to 48 hours, 24 to 48 hours, 30 to 48 hours) after the administration of the recombinant oncolytic vaccinia virus" means that the interval between the first administration of NK cells and the first administration of the recombinant oncolytic vaccinia virus is 18 to 72 hours (e.g., 20 to 70 hours, 22 to 48 hours, 24 to 48 hours, 30 to 48 hours), or the interval between the first administration of NK cells and the most recent administration of the recombinant oncolytic vaccinia virus is 18 to 72 hours (e.g., 20 to 70 hours, 22 to 48 hours, 24 to 48 hours, 30 to 48 hours). Preferably, the interval between the first administration of NK cells and the most recent administration of the recombinant oncolytic vaccinia virus is 18 to 72 hours (e.g., 20 to 70 hours, 22 to 48 hours, 24 to 48 hours, 30 to 48 hours). More preferably, the interval between the first administration of NK cells and the most recent administration of the recombinant oncolytic vaccinia virus is 24 to 48 hours.

[0097] Tumors and / or cancers include, but are not limited to, lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumors (e.g., glioma), colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer, and osteosarcoma.

[0098] Oncolytic viruses can selectively replicate in tumor or cancer cells and reach a peak after a certain period. The inventors have found that after the replication period, oncolytic viruses in tumor cells can promote the killing of tumor cells by NK cells. Therefore, by the order and interval of administration of the recombinant oncolytic vaccinia virus and NK cells proposed by the present invention, a double-peak overlap of the peaks of the two effects is achieved.

[0099] The present invention further explores and optimizes the respective dosages of the recombinant oncolytic vaccinia virus and NK cells. Their cooperation in the above administration order and interval is extremely important, thereby determining the anti-tumor efficacy of the recombinant oncolytic vaccinia virus, the anti-tumor efficacy of NK cells, and the best synergistic killing of the above two tumor cells.

[0100] In a preferred embodiment of the present invention, the recombinant oncolytic vaccinia virus is administered once a day for 1 to 6 consecutive days at a therapeutically effective dose; and NK cells are administered at 1×10 7 ~1×10 10 cells / day (e.g., 1×10 8 ~5×10 9 cells / day, 1×10 9 ~4×10 9 cells / day, 1×10 9 ~3×10 9 cells / day) once a day for 1 to 6 consecutive days. In another preferred embodiment of the present invention, the recombinant oncolytic vaccinia virus is administered once every two days for 2 to 6 consecutive days at a therapeutically effective dose; and NK cells are administered at 1×10 7 ~1×10 10 cells / day (e.g., 1×10 8 ~5×10 9 cells / day9 ~4×10 9 cells / day, 1×10 9 ~3×10 9 cells / day), once every two days, continuously for 2 - 6 days. As long as NK cells are administered to the tumor and / or cancer patient 18 - 72 hours after the administration of the recombinant oncolytic vaccinia virus, any one of the above-described modes, or other modes, can be used according to the present invention. The recombinant oncolytic vaccinia virus and NK cells can be administered alternately (for example, administering the recombinant oncolytic vaccinia virus on day 1, administering NK cells on day 2, administering the recombinant oncolytic vaccinia virus on day 3, administering NK cells on day 4, etc.); administered sequentially (for example, administering the recombinant oncolytic vaccinia virus on day 1, administering the recombinant oncolytic vaccinia virus and NK cells in order on day 2, administering the recombinant oncolytic vaccinia virus and NK cells in order on day 3, and administering the recombinant oncolytic vaccinia virus and NK cells in order on day 4, etc.); or administered according to other dosing regimens (for example, first, administering the recombinant oncolytic vaccinia virus once a day, continuously for 1 - 6 days, and after a 18 - 72 - hour interval, administering NK cells once a day, continuously for 1 - 6 days). Preferably, first administer the recombinant oncolytic vaccinia virus, and administer NK cells 18 - 72 hours after all administrations of the recombinant oncolytic vaccinia virus dosing are completed. In a preferred embodiment of the present invention, first, administer the recombinant oncolytic vaccinia virus to the tumor and / or cancer patient, and administer the recombinant oncolytic vaccinia virus only once at a therapeutically effective dose; 18 - 72 hours after the administration of the recombinant oncolytic vaccinia virus, administer NK cells to the tumor and / or cancer patient, and administer NK cells at 1×10 7 ~1×10 10 cells / day (e.g., 1×10 8 ~5×10 9 cells / day, 1×10 9 ~4×10 9 cells / day, 1×10 9 ~3×10 9 cells / day), and administer only once. The therapeutically effective amount of the recombinant oncolytic vaccinia virus is preferably 1×10 5~5×10 9 pfu / day (e.g., 1×10 5 ~3×10 9 pfu / day, 1×10 5 ~1×10 8 pfu / day).

[0101] Based on specific circumstances and needs, the method for treating tumors and / or cancers according to the present invention can be applied to a patient once or multiple times.

[0102] In the present invention, NK cells can be selected from autologous NK cells and allogeneic NK cells; preferably, the NK cells are autologous NK cells obtained by in vitro proliferation or allogeneic NK cells obtained by in vitro proliferation.

[0103] Tumors and / or cancers include lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumors (e.g., glioma), colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer, and osteosarcoma.

[0104] The recombinant oncolytic vaccinia virus may be administered by administration methods commonly used in the art, such as intratumoral administration or intravenous administration.

[0105] NK cells may be administered, for example, intravenously using administration methods commonly used in the art.

[0106] The present invention will be further described or illustrated below by way of examples, but these examples do not limit the scope of protection of the present invention.

Examples

[0107] Unless otherwise specified, the experimental methods used in the following examples are carried out using conventional experimental procedures, operations, materials, and conditions in the field of biotechnology.

[0108] Unless otherwise specified, the concentration (%) of each drug indicates the ratio by volume [%(v / v)].

[0109] Biological materials: 1. Purchase CV1 African green monkey kidney cells (medium: 10% FBS + MEM + 1% P / S) from ATCC. Purchase MRC-5 normal human embryonic lung fibroblasts (medium: 10% FBS + DMEM + 1% P / S) from Chinese Academy of Sciences Shanghai Cell Bank. Purchase HEK-293 and HEK-293T human fetal-derived kidney cells (medium: 10% FBS + DMEM + 1% P / S) from Agilent Technologies and Chinese Academy of Sciences Shanghai Cell Bank, respectively. Purchase HUVEC human normal umbilical vein endothelial cells (medium: 10% FBS + H-004B + 1% P / S) from Allcells Biotechnology (Shanghai) Co., Ltd.

[0110] 2. Tumor cells: The sources of tumor cell lines and media are shown in Table A

[0111]

Table A

[0112] 3. Virus: The VSC20 vaccinia virus, which is a skeletal vector, is a vaccinia virus lacking the VGF gene, and the preparation method can be found in McCart, JA, et al. Systemic cancer therapy with a tumor-selective vaccinia virus mutant lacking thymidine kinase and vaccinia growth factor genes. Cancer Res (2001) 61: 8751-8757. The DDvv-hIL21 virus has been genetically modified, and the modification includes regulating the expression of the exogenous human IL21 gene using the synthetic vaccinia virus early / late promoter pSEL, and inserting the human IL21 gene into the TK gene region of the vaccinia virus VSC20 strain using intracellular recombination technology, thereby constructing the double-deleted oncolytic vaccinia virus DDvv-hIL21 (see Chinese Patent Application Publication No. 109554353(A)).

[0113] The oncolytic vaccinia virus DDVV-RFP as a control virus belongs to the oncolytic vaccinia virus WR strain (see, for example, X Song, et al. T-cell Engager-armed Oncolytic Vaccinia Virus Significantly Enhances Antitumor Therapy. Molecular Therapy. (2014); 221, 102-111). This virus is functionally deficient in both the TK gene and the VGF gene and retains the exogenous red fluorescent protein (RFP) gene. The RFP gene only serves a screening / reporting role, and the antitumor function of the oncolytic vaccinia virus DDvv-RFP is substantially equivalent to that of the oncolytic vaccinia virus with functionally deficient TK and VGF genes. Also, the oncolytic vaccinia virus DDvv-RFP is obtained by genetically modifying the VSC20 vaccinia virus using prior art in the art. The VSC20 vaccinia virus is a vaccinia virus lacking the VGF gene. The method for preparing the VSC20 vaccinia virus is described in McCart, JA, et al. Systemic cancer therapy with a tumor-selective vaccinia virus mutant lacking thymidine kinase and vaccinia growth factor genes. Cancer Res (2001) 61: 8751-8757. The genetic modification involves using the synthetic vaccinia virus early / late promoter pSEL to regulate the expression of the exogenous RFP gene, and inserting the RFP gene into the TK gene region of the vaccinia virus VSC20 strain using in vitro intracellular recombination technology, thereby constructing the oncolytic vaccinia virus DDVV-RFP.

[0114] 4. C57BL / 6 mice and BalBc-nude mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. Severe immunodeficient NCG mice were purchased from Jiangsu GemPharmatech Co., Ltd.

[0115] 5. Culture plates: 6-well cell culture plates, 24-well cell culture plates, and 96-well cell culture plates were purchased from Corning Co., Ltd.

[0116] 6. Preparation of gpt drug: 10 mg / mL mycophenolic acid (400×), 10 mg / mL 40× xanthine (40×), and 10 mg / mL hypoxanthine (670×) were prepared using 0.1 N NaOH respectively and stored at -20°C in the dark. The 1× dilution standard solution was prepared by adding 100 μL of 400× mycophenolic acid, 40 μL of 40× xanthine, and 60 μL of 670× hypoxanthine to 40 mL of DMEM, mixing well, and filtering through a 0.22 μm filter, and stored at 4°C until use.

[0117] 7. Composition of PBS: 8 mM Na2HPO4, 136 mM NaCl, 2 mM KH2PO4, 2.6 mM KCl, pH 7.2 - 7.4.

[0118] 8. Composition of virus purification solution: 60% (w / v), 50% (w / v), 40% (w / v), 30% (w / v) sucrose solutions.

[0119] Cell counting method: MTT assay: 10 μL of MTT solution (5 mg / mL) was added to each well containing cells, then the cells were incubated in an incubator at 37°C for 4 - 6 hours, the medium was discarded, 150 μL of DMSO was added to each well, and then shaken at low speed for 10 minutes using a shaker to completely dissolve the crystalline substance, and the absorbance value (OD at 490 nm 490) was measured with a microplate reader. Inhibition rate calculation formula: Cell growth inhibition rate (IR%) = 1 - (OD of the tested product 490 - OD of the blank 490 ) / (OD of the negative control 490 - OD of the blank 490 ) × 100%

[0120] Abbreviations: miR199T: Target sequence of miR199 (hsa - miR - 199a - 3p or hsa - miR - 199b - 3p) FBS: Fetal bovine serum P / S: Penicillin - streptomycin mCherry / Zeocin: Red fluorescent protein / bleomycin DMSO: Dimethyl sulfoxide.

[0121] Preparation Example 1 Construction of pZB - E10R - miR199T plasmid To construct the pZB - E10R - miR199T shuttle plasmid carrying four repeated miR199T sequences, first, the 4×miR199T repeated fragment was synthesized by gene synthesis, GG was ligated to each fragment, and it was inserted into the 3’UTR region locus of the E10R gene of vaccinia virus (the insertion site is 56974bp of the left homologous arm of the E10R gene). Then, the mCherry / Zeocin gene driven by the mH5 promoter, whose 5’ end and 3’ end both contain LoxP sequences in the same direction, was inserted. The DNA sequence of miR199T (SEQ ID NO: 1) is as follows: 5’ - acagtagtctgcacattggtta - 3’ (the miRBase database accession number of the corresponding miRNA mature form is MIMAT0000232 (hsa - miR - 199a - 3p) or MIMAT0004563 (hsa - miR - 199b - 3p)).

[0122] Briefly, pZB-E10R-miR199T was obtained by homologous recombination using enzymatic cleavage, pcDNA3.1(+)-E10R-mCherry / Zeocin containing the left and right homologous arms of the vaccinia virus gene E10R and the mCherry / Zeocin gene, plasmid pUC-57-miR199T containing four repeats of miR199T (constructed and synthesized by Beijing Tsingke Biotechnology Co., Ltd.), and plasmid pCB (obtained according to Yourong FANG et al, Construction of Recombinant Vaccinia Virus Vector with Zeocin and GFP Double Screening Labels, Journal of international epidemiology and infectious diseases, 2012. 39 (3): 148-152.) (as shown in Figure 1).

[0123] The specific operations are as follows.

[0124] PCR can be carried out with appropriate adjustments according to the actual situation under the temperature and cycle conditions of conventional methods belonging to the prior art in this technical field.

[0125] 1) Construction of pcDNA3.1(+)-E10R-mCherry / Zeocin plasmid: The vaccinia virus Dvv-VSC20 genome (the virus source is described in McCart, JA, et al. Systemic cancer therapy with a tumor-selective vaccinia virus mutant lacking thymidine kinase and vaccinia growth factor genes. Cancer Res (2001) 61: 8751-8757.) was used as a template for PCR amplification (primer sequences; L-armE10: AGTCCTCGAGCTAATATTGAGAAATTCATC (SEQ ID NO: 2); E10R1: CTGCACATTGGTTATTAAGAAGCATAGTCTGGAACATCATATGGATATAAAGGGTTAACCTTTGTC (SEQ ID NO: 3)), and a fragment F1, which is the E10R gene and the left homologous arm, was obtained. Fragment F1 was used as a template for PCR amplification (primer sequences; L-armE10: AGTCCTCGAGCTAATATTGAGAAATTCATC (SEQ ID NO: 2); E10R2: TGGTTAGGACAGTAGTCTGCACATTGGTTAGGACAGTAGTCTGCACATTGGTTATTAAG (SEQ ID NO: 4)), and a left homologous arm fragment F2 of E10R was obtained.The pCBmCZ-tTFNGR plasmid (obtained according to Yourong FANG et al, Construction of Recombinant Vaccinia Virus Vector with Zeocin and GFP Double Screening Labels, Journal of international epidemiology and infectious diseases, 2012. 39 (3): 148-152.) was used as a template for PCR amplification (primer sequences: 199H5: ATGTGCAGACTACTGTCCTAACCAATGTGCAGACTACTGTCCAAAAATTGAAAATAAATAC (SEQ ID NO: 5); Zeo-rev, GATCAAGATCTTTAGTCCTGCTCCTCGGCCAC (SEQ ID NO: 6)), and fragment F3 with the mH5 promoter and mCherry / Zeocin was obtained. The vaccinia virus Dvv-VSC20 genome was used as a template for PCR amplification (primer sequences: E11UP: GATCAAGATCTTTATAAACTTAACCCATTATAAAAC (SEQ ID NO: 7); R-arm, AGTCGGATCCTTGACAGTCTTGAACAATTATAC (SEQ ID NO: 8)), and F4 containing the right homologous arm of E10R of the vaccinia virus was obtained. Fragments F2 and F3 were phosphorylated and ligated by T4 DNA ligase (Thermo, E10011). The ligated fragment was used as a template for PCR amplification (primer sequences: L-armE10, AGTCCTCGAGCTAATATTGAGAAATTCATC (SEQ ID NO: 2); Zeo-rev, GATCAAGATCTTTAGTCCTGCTCCTCGGCCAC (SEQ ID NO: 6)), and fusion fragment F5 containing the left homologous arm of E10R and the mCherry / Zeocin sequence was obtained. Fragments F4 and F5 were digested with restriction endonuclease BglII (Thermo, ER0082) respectively, and then ligated by T4 DNA ligase to obtain the E10R-mCherry / Zeocin fragment containing the left and right homologous arms of E10R and the mCherry / Zeocin sequence.The E10R-mCherry / Zeocin fragment and plasmid pCDNA3.1(+) (Invitrogen) were digested with restriction endonucleases BamHI (Thermo, FD0054) and XhoI (Thermo, FD0694), respectively, and then ligated with T4 DNA ligase and introduced into E. coli DH5a (TIANGEN, CB101) for transformation. A single colony was selected to obtain the pcDNA3.1(+)-E10R-mCherry / Zeocin plasmid, which was confirmed by sequencing.

[0126] 2) Construction of the pZB-1 plasmid: The pCB plasmid was used as a template for PCR amplification (primer sequences; zP12-F: CCGCTCGAGGCTGGCGTTTTTCCATAGG (SEQ ID NO: 33); zP12-R: CGCggatccCGGTCTGGTTATAGGTACATTGAG (SEQ ID NO: 34)) to obtain a linearized L-pCB fragment. pcDNA3.1(+)-E10R-mCherry / Zeocin and L-pCB were double-digested with restriction endonucleases BamHI and XhoI to obtain L-E10R-E11L / D and L-pCB / D fragments, which were then ligated with T4 DNA ligase and finally introduced into E. coli DH5a for transformation. A single colony was selected to obtain the pZB-1 plasmid, which was confirmed by sequencing.

[0127] 3) Construction of the pZB-2 plasmid: Using the pZB-1 plasmid as a template for PCR amplification (primer sequences; zP13-F: CCCAAGCTTTTAGTCCTGCTCCTCGGCC (SEQ ID NO: 9); zP11m-R: ATAACTTCGTATAGCATACATTATACGAAGTTATCTTTATAAACTTAACCCATTATAAAAC (SEQ ID NO: 10)), an L-pZB-1 fragment (4815 bp) with the LoxP sequence ATAACTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO: 11) inserted at the 3' end of mCherry / Zeocin was obtained. The obtained L-pZB-1 fragment was self-ligated with T4 DNA ligase, introduced into E. coli DH5α for transformation, a single colony was selected to obtain the pZB-2 plasmid, and it was confirmed by sequencing.

[0128] 4) Construction of pZB-E10R-miR199T plasmid: Using the pZB-2 plasmid as a template for PCR amplification (primer sequences; zP11-F: CGCGTATTTGGGATCAGATG (SEQ ID NO: 12); zP11-R: CAAAGGTTCTTGAGGGTTGTG (SEQ ID NO: 13)), a fragment (4689 bp) with L-E10R-E11L-LoxP was obtained. pUC-57-miR199T was double-digested with restriction endonucleases KpnI (Thermo, FD0524) and SacI (Thermo, FD1133) to obtain the L-miR199T fragment: CAATTTAACACAACCCTCAAGAACCTTTGTATTTATTTTCAATTTTTATAACTTCGTATAATGTATGCTATACGAAGTTATGGACAGTAGTCTGCACATTGGTTAGGACAGTAGTCTGCACATTGGTTAGGACAGTAGTCTGCACATTGGTTAGGACAGTAGTCTGCACATTGGTTATTAAGAAGCATAGTCTGGAACATCATATGGATATAAAGGGTTAACCTTTGTCACATCGATCGCGTATTTGGGATCAGATGGTAC (SEQ ID NO: 35). This was ligated with the fragment (4689 bp) with L-E10R-E11L-LoxP by a one-step cloning method (TreliefTM sosoo cloning kit ver.2, Beijing Tsingke Biotechnology Co., Ltd., TSV-S2), introduced into E. coli DH5α for transformation, and a single colony was selected to obtain the pZB-E10R-miR199T plasmid. The plasmid was verified by digestion with BamH I and Sma I (Thermo, FD0663) (Figure 2). Accuracy was confirmed by sequencing using primers Z10, Z11, Z14, and Z15 (Beijing Tsingke Biotechnology Co., Ltd.) (the primer sequences are shown in Table 1).

[0129]

Table 1

[0130] Preparation Example 2 Packaging and Identification of VSC20-mT / mCherry Virus 1) Recombination of Oncolytic Vaccinia Virus: a) CV1 cells were seeded in a 6-well plate at 4×10 5 cells / well, and the cell density was allowed to reach 80% - 90% the next day. The MEM in the 6-well plate was discarded. 1 mL of serum-free and antibiotic-free MEM medium containing 8×10 3 pfu of Dvv-VSC20 virus was added to each well to achieve an infection concentration of 0.02 MOI. After incubation at 37°C for 2 hours, the medium was removed and replaced with MEM medium supplemented with 2% FBS + 1% P / S. A plasmid / Lipo3000 (Lipofectamine OR 3000 transfection reagent 300 μL, Invitrogen™, L3000-015) mixed solution (Solution A: 2 μg of pZB-E10R-miR199T plasmid and 4 μL of P3000 reagent (Invitrogen™, L3000-015) were added to 300 μL of Opti-MEM I, mixed well, and incubated at room temperature for 5 minutes; Solution B: 10 μL of Lipo3000 was added to 300 μL of Opti-MEM I, mixed well, and incubated at room temperature for 5 minutes; Solution A and Solution B were mixed and incubated at room temperature for 15 minutes) was added, and the culture was continued in an incubator (37°C, 5% CO2). b) When complete degeneration of the cells was observed microscopically 24 - 48 hours later, the supernatant and cells were collected, and the cells were lysed by repeating freeze / thaw 3 times. The virus was collected by centrifugation at 300 g for 5 minutes and named the P0 generation. c) 200 μL of the virus was applied to virus genome extraction using the TIANamp Virus DNA / RNA Kit (TIANGEN, DP315). PCR using primers zP19 / zP20 confirmed the successful recombination of VSC20-mT / mCherry.

[0131] 2) Screening of Single Clones of Recombinant Oncolytic Vaccinia Virus: a) CV1 cells were placed in five 100-mm Petri dishes and allowed to reach a cell density of 80% - 90% the next day. The MEM medium was discarded and step-diluted P0 virus (10 -1 ~10 -5 serial dilution) at 3 mL each was added to each Petri dish. The Petri dishes were placed in an incubator at 37 °C and 5% CO2 for 2 hours and cross-mixed every 30 minutes. After an additional 2-hour incubation, the medium was discarded and 10 mL of 2% (w / v) agarose gel (MEM medium containing 2% FBS) was added. After solidification, it was placed in the incubator and continued to be cultured at 37 °C and 5% CO2. b) Approximately 48 hours later, single plaques with red fluorescence were selected and placed in 200 μL of sterile PBS, and freeze-thawing was repeated three times to release the virus. 100 μL of the virus solution was taken from each plaque and placed in a 24-well plate. CV1 cells (with a cell density reaching 80%) were used for growth. Approximately 48 hours later, when the cells were completely degenerated, the virus was collected and named P1-X (X is numbers 1, 2, 3, 4..., representing different virus clones). 200 μL of the virus solution from each plaque was used to extract the viral genome using the TIANamp Virus DNA / RNA Kit, and then PCR was performed for identification. The remaining virus solution was stored at -80 °C. The above screening was repeated four times to obtain the P5 generation virus. Primers zP19 and zP20 (the primer sequences are shown in Table 1) were used for PCR to obtain a 2310-bp band. This suggests that a single clone of the VSC20-mT / mCherry recombinant virus was confirmed (Figure 3). The accuracy of the sequence was confirmed by Z11, Z15, zP19, and zP20 sequencing (the primer sequences are shown in Table 1). The VSC20-mT / mCherry virus vector has a functionally defective VGF gene, and four repeated miR199T sequences and the mCherry red marker gene for screening are inserted into the 3' UTR region of the E10R gene (Figure 4).

[0132] Preparation Example 3 Packaging and Identification of MiTDvv-mCherry-Backbone Virus 1) Recombination of oncolytic vaccinia virus: CV1 cells were seeded into a 6-well plate at 4×10 5 cells / well, and the cell density was adjusted to reach 80% - 90% the next day. The MEM medium in the 6-well plate was discarded, and 1 mL of serum-free and antibiotic-free MEM medium containing 8×10 3 pfu of VSC20-mT / mCherry virus was added to each well to achieve an infection concentration of 0.02 MOI. After incubation at 37°C for 2 hours, the medium was discarded and replaced with MEM medium supplemented with 2% FBS + 1% P / S, and 300 μL of the pCB plasmid / Lipo3000 mixed solution (prepared in the same manner as in Preparation Example 2) was added. When complete cell degeneration was observed under the microscope 24 - 48 hours later, the supernatant and cells were collected, freeze-thawing was repeated 3 times, centrifuged at 300 g for 5 minutes, and the virus released into the supernatant was collected and named the P0 generation virus. The viral genome was extracted using the TIANamp Virus DNA / RNA Kit (TIANGEN, DP315). PCR using primers P5 / P18 confirmed the successful recombination of the MiTDvv-mCherry virus.

[0133] 2) gpt drug screening: CV1 cells were cultured using a 60 mm Petri dish. When the CV1 cells reached 80%, 1 mL of virus dilution (containing 150 μL of P0 generation virus) diluted with MEM was added. Two hours after infection, 0.5×gpt was added for screening. Cell degeneration was observed, and the virus was collected and named the P1 generation. The above steps were repeated twice to obtain the P3 generation virus.

[0134] 3) Screening of a single clone of recombinant oncolytic vaccinia virus: The specific operation is the same as that in Preparation Example 2. Four hours after infection of CV1 cells with serially diluted P3 virus, 10 mL of 2% (w / v) agarose gel was added to fix and culture the virus for about 48 hours, and single plaques with red fluorescence were selected for identification by PCR. According to the results of PCR, positive clones were selected for repeated screening in the P4 - P5 generations, and a single clone of the MiTDvv-mCherry virus was obtained. By identification with PCR, it was confirmed that a 1840 bp band (the sequences of primers P5 and P8 are shown in Table 1) was obtained, while a 622 bp band (the sequences of primers P1 and P2 are shown in Table 1) was not obtained (Figure 5). Primers P5 and P18 were used for detection by sequencing (Beijing Tsingke Biotechnology Co., Ltd.), and it was confirmed that the MiTDvv-mCherry backbone virus had functionally defective TK and VGF genes, four repeat sequences of miR199T and the mCherry red marker gene inserted into the 3' UTR region of the E10R gene, and the gpt screening gene in the TK gene region (Figure 6).

[0135] Preparation Example 4 Packaging and Identification of the Oncolytic Virus MiTDvv-hIL21-mCherry 1) Recombination of oncolytic vaccinia virus: CV1 cells were seeded in a 6-well plate at 4×10 5 cells / well, and the cell density was allowed to reach 80% - 90% the next day. The MEM medium in the 6-well plate was discarded, and DDvv-hIL21 virus (the preparation method is as described in Chinese Patent Application Publication No. 109554353(A), the entire content of which is incorporated herein by reference) was added at 8×10 31 mL of serum-free and antibiotic-free MEM medium containing pfu was added to each well to achieve an infection concentration of 0.02 MOI. The cells were incubated at 37 °C for 2 hours, the medium was discarded, and replaced with MEM medium supplemented with 2% FBS + 1% P / S. 300 μL of the pZB-E10R-miR199T plasmid / Lipo3000 mixed solution (prepared in the same manner as in Preparation Example 2) was added. When complete cell degeneration was observed under the microscope 24 - 48 hours later, the supernatant and cells were collected, freeze-thawing was repeated 3 times, centrifuged at 300 g for 5 minutes, and the virus released into the supernatant was collected and named the P0 generation. The viral genome was extracted using the TIANamp Virus DNA / RNA Kit (TIANGEN, DP315). PCR using primers zP19 / zP20 confirmed the successful recombination of the MiTDvv-hIL21-mCherry oncolytic virus.

[0136] 2) Screening of single clones of recombinant oncolytic vaccinia virus: The specific operation is the same as that described in Preparation Example 2). Four hours after infecting CV1 cells with the P0 generation virus diluted in steps, 10 mL of 2% (w / v) agarose gel was added, and the virus was fixed and cultured for about 48 hours. Single plaques with red fluorescence were selected for identification by PCR. According to the results of PCR, positive clones were selected for repeated screening of the P2 - P5 generations to obtain single clones of the virus. Identification by PCR confirmed that a 2310 bp band was obtained (the sequences of primers zP19 and zP20 are shown in Table 1). The accuracy of the sequence was confirmed by sequencing using Z11, Z15, zP19, and zP20 (the sequences of the primers are shown in Table 1) Beijing Tsingke Biotechnology Co., Ltd. The MiTDvv-hIL21-mCherry oncolytic virus is both a virus in which the VGF gene is functionally defective and the TK gene is functionally defective, with four repeats of miR199T and the mCherry red marker gene inserted into the 3' UTR region of the E10R gene, and the IL-21 functional gene retained within the TK gene region (Figure 8).

[0137] Preparation Example 5 Preparation of MiTDvv Skeleton Virus and MiTDvv-hIL21 Oncolytic Virus by Cre-LoxP Cleavage To obtain MiTDvv skeleton virus (MiTDvv-mCherry virus lacking mCherry / Zeocin sequence) and MiTDvv-hIL21 oncolytic virus (MiTDvv-hIL21-mCherry virus lacking mCherry / Zeocin sequence).

[0138] 1) CV1 cells were seeded in a 6-well plate at 4×10 5 cells / well, and the cell density was allowed to reach approximately 70% the next day. The medium was replaced with MEM medium supplemented with 5% FBS + 1% P / S, and 300 μL of pBS185 CMV-Cre plasmid (the Cre gene is controlled by the CMV promoter capable of expressing Cre enzyme in mammalian cells, purchased from Addgene, cat. No. 11916) / Lipo3000 mixed solution (prepared in the same manner as in Preparation Example 2) was added to each well, and incubated at 37 °C and 5% CO2 in an incubator for 24 hours. Then, MiTDvv-mCherry and MiTDvv-hIL21-mCherry viruses were appropriately added to the wells at 8×10 5 pfu, and control wells were prepared using virus alone and plasmid alone. They were cross-mixed and the incubation was continued for an additional 24 hours. After complete degeneration of the cells was observed under a microscope, freezing / thawing was repeated 3 times, and the virus was collected by centrifugation at 300 g for 5 minutes. This virus was named the P0 generation.

[0139] 2) CV1 cells were seeded in five 100-mm Petri dishes, and the cell density was allowed to reach 80% - 90% the next day. The P0 generation virus was diluted 10 -1 ~10 -5It was serially diluted 10-fold up to. The MEM medium in the Petri dish was discarded, and 3 ml of the serially diluted virus solution was appropriately added to the Petri dish, and the cells were incubated in an incubator at 37 °C and 5% CO2 for 2 hours. During incubation, the cells were cross-mixed every 30 minutes, and the incubation was continued for 2 hours. Then, the medium was discarded, and 10 mL of 2% (w / v) agarose gel was added. After the agarose solidified, the Petri dish was returned to the incubator to continue the culture. After about 48 hours, a single white plaque without red fluorescence was selected and placed into a tube containing 200 μL of sterile PBS, and freeze-thawing was repeated 3 times to release the virus. 100 μL of the virus solution was taken out from each plaque and placed into a 24-well plate together with CV1 cells (with a cell density reaching 80%) for propagation. After about 48 hours, when the cells were completely degenerated, the virus was collected and named P1-X (X is numbers 1, 2, 3, 4... and represents different virus clones). 200 μL of the virus solution was applied to genomic extraction for PCR assay (the sequences of primers zP19 and zP20 are shown in Table 1) from each plaque.

[0140] 3) Step 2) was repeated once to obtain single clones MiTDvv and MiTDvv-hIL21 of the P2 generation virus, and these were identified by PCR (see Table 1 for the sequences of primers zP19 and zP20). After confirming that the sequences were correct by sequencing using primers zP19 and zP20 (Beijing Tsingke Biotechnology Co., Ltd.) (the primer sequences are shown in Table 1), they were stored at -80 °C.

[0141] From the results of PCR and sequencing, it was shown that four repeated miR199T sequences in the MiTDvv backbone virus were integrated into the 3’UTR region of E10R of the Dvv-VSC20 vaccinia virus, did not contain the mCherry / Zeocin sequence, and the gpt gene was integrated into the TK region, thus indicating that the TK function was inactivated. The four repeated miR199T sequences in the MiTDvv-hIL21 oncolytic virus were integrated into the 3’UTR region of E10R of the DDvv-hIL21 vaccinia virus and did not contain the mCherry / Zeocin sequence. That is, the recombination of these two types of viruses was successful (Figure 9). The structure of the virus is shown in Figure 10.

[0142] Preparation Example 6 Production and Purification of Oncolytic Virus 1) Place HeLa cells in 50 150-mm culture dishes, and the next day, adjust the cell density to reach approximately 80%. Infect these cells with No. 1 of the single clone of the P2 generation MiTDvv backbone virus and No. 1 of the single clone of the P2 generation MiTDvv-hIL21 oncolytic virus at 0.2 MOI, respectively. Approximately 2 to 3 days later, bead-like cell degeneration connected in the cells was observed under a microscope, and then the cells and the medium were collected with a cell scraper.

[0143] 2) The cells were centrifuged at 4°C and 25,924×g for 30 minutes, and the supernatant was discarded. The pellet was reconstituted in 20 mL of MEM containing 10% FBS. The suspension was frozen / thawed three times with liquid nitrogen / autoclaved water and then centrifuged at 4°C and 25,924×g for 30 minutes. The pellet was washed with 20 mL of PBS and centrifuged at 4°C and 25,924×g for 30 minutes. The pellet was resuspended in 10 mL of 10 mM Tris, pH 9.0, and sonicated at 60 W and 4°C for 30 seconds with a 30-second interval for a total of 3 minutes, centrifuged at 300×g for 5 minutes, and the supernatant was collected for the next step. 13.2 mL was taken and added to 6 mL of 36% (w / v) sucrose in an ultracentrifugation tube. 5 mL of the virus supernatant was slowly added from top to bottom and centrifuged at 4°C and 32,900×g for 80 minutes. The pellet was resuspended in 5 mL of 1 mM Tris (pH 9.0) and sonicated for 30 seconds with a 30-second interval for a total of 3 minutes.

[0144] 3) Preparation and loading of sucrose gradient purification tubes: Sucrose gradient purification tubes were prepared by slowly adding 2.2 mL each of 40% (w / v), 36% (w / v), 32% (w / v), 28% (w / v), and 24% (w / v) sucrose solutions to 13.2 mL ultracentrifugation tubes. Then, 2 mL of the virus suspension obtained in step 2) was slowly added along the wall of the ultracentrifugation tube and centrifuged at 4°C and 26,000×g for 50 minutes. Thereafter, a milky white virus band could be visually confirmed in the center of the ultracentrifugation tube. Using an 18G - 5 mL syringe needle, the ultracentrifugation tube was pierced to aspirate the virus band, and the virus was placed in a new ultracentrifugation tube (the volume of the aspirated virus band was recorded as V1).

[0145] 4) 1 mM Tris, pH 9.0 buffer was added in a two-fold volume of V1 to wash the virus and remove residual sucrose, and then centrifuged at 32,900 g for 1 hour at 4°C. The supernatant was discarded, and the pellet was resuspended in 1 mM Tris, pH 9.0, 5 mL, and sonicated at 4°C for a total of 3 minutes with 30-second intervals for 30 seconds each, dispensed into sterile EP tubes at 50 μL / tube, and stored at -80°C. At the same time, the virus titer was detected by the conventional plaque method. The titer detection result of MiTDvv-hIL21 was 6.4×10 9 pfu / mL, and the titer detection result of MiTDvv was 1.92×10 9 pfu / mL.

[0146] Example 1 Selective Replication of MiTDvv Backbone Virus in Tumor Cells Normal human umbilical vein endothelial cells HUVEC and human cervical cancer cells Hela were seeded in 6-well plates at 3×10 5 cells / well, incubated overnight at 37°C, 5% CO2, and the cell density was adjusted to reach 70% the next day. The MiTDvv virus prepared by the above method was added to each at 0.1 MOI. After infecting for 2 hours, the medium was replaced with a medium containing 5% FBS. After culturing for 24 hours and 48 hours, the medium and cells were collected, the cells were lysed by repeating freeze-thawing 3 times, and the virus amount in the lysate was assayed by the conventional plaque assay.

[0147] The results are shown in Fig. 11. Under the infection condition of 0.1 MOI, the replication of the MiTDvv virus in normal HUVEC cells was lower than that in Hela tumor cells. Fig. 11A shows the virus amounts in HUVEC cells and HeLa cells 24 hours after infection with the MiTDvv backbone virus; Fig. 11B shows the virus amounts 48 hours after infection of the MiTDvv backbone virus into HUVEC cells and HeLa cells; Fig. 11C shows the ratio of the replication ability of the MiTDvv backbone virus in HUVEC cells to that in HeLa cells. The replication of the virus in HeLa cells 24 hours and 48 hours after virus infection was 50.46 times and 60.56 times, respectively, compared with the virus replication in HUVEC cells.

[0148] Example 2 Comparison of the in vitro killing effects of the MiTDvv backbone virus and the DDvv-RFP backbone virus on normal cell lines Human normal embryonic lung fibroblasts MRC-5 were seeded in 96-well plates at 1×10 4 cells / well and incubated overnight at 37°C and 5% CO2 until the cell density reached 80% the next day. The DDvv-RFP and the MiTDvv virus prepared by the above method were added at 0.03 MOI and 0.1 MOI, respectively. After infecting for 2 hours, the medium was replaced with DMEM medium containing 5% FBS. The cell growth chart was detected over 24 hours using the xCELLigence Real-time Label-free Cell Analyzer (RTCA) SP (ACEA, xCELLigenc RTCA SP) (n = 6, the experiment was repeated 2 - 3 times). In this experiment, the group of wells without virus with only cells (without virus infection) was used as the negative control group. The same was done simultaneously for the control group, and 6 replicate experimental wells were used for each group. The cell death rate was calculated as the ratio (%) of the virus-treated group to the negative control group.

[0149] The results are shown in Figure 12. Under different MOI values, the killing effect of the MiTDvv virus on MRC-5 normal cells was significantly lower than that of the DDvv virus on MRC-5 normal cells (p<0.001).

[0150] Example 3 Comparison of replication of MiTDvv backbone virus and DDvv-RFP backbone virus in normal cells Human normal embryonic lung fibroblasts MRC-5 were seeded into 24-well culture plates at 1×10 5 cells / well, and incubated overnight at 37°C and 5% CO2 in DMEM medium with 2% FBS, and the cell density reached 80% the next day. The DDvv-RFP virus and MiTDvv virus prepared by the above method were added at 0.1 MOI and 0.3 MOI, respectively. After infecting for 2 hours, the medium was replaced with DMEM medium containing 5% FBS. In this experiment, a group of wells with only cells without virus was used as the negative control group. The corresponding medium replacement was also carried out for the control group at the same time. After culturing at 37°C and 5% CO2 for 24 hours, the medium and cells were collected. The viral genome was extracted using the TIANamp Virus DNA / RNA Kit (TIANGEN, DP315), the viral A46R gene was detected by QPCR method, and the viral load was detected. The primer sequences are shown in Table 2. The experiment was repeated 3 times, and the average value was used for statistical analysis.

[0151]

Table 2

[0152] The results are shown in Figure 13. Under different MOI values, the replication of the MiTDvv virus in MRC-5 normal cells was significantly lower than that of the DDvv virus in MRC-5 normal cells ( * p<0.01; ** p<0.05).

[0153] Example 4 Comparison of the killing effect of MiTDvv-hIL21 and DDvv-hIL21 oncolytic vaccinia virus on normal cells Human normal embryonic lung fibroblast MRC-5 cells were seeded into 96-well culture plates at a density of 1×10 4 cells / well, and the cell density was adjusted to reach 80% the next day. The MiTDvv-hIL21 oncolytic vaccinia virus and DDvv-hIL21 oncolytic vaccinia virus prepared by the above method were added at 0.3 MOI and 1 MOI, respectively. After infection for 2 hours, the medium was replaced with DMEM medium containing 5% FBS, and the culture was continued at 37°C and 5% CO2 for 12 hours. The cell growth curve was detected using the xCELLigence Real-time Label-free Cell Analyzer (RTCA) SP (ACEA, xCELLigenc RTCA SP). In this experiment, the group of MRC-5 cells without virus addition was used as the blank control group. The corresponding medium replacement was also performed simultaneously for the control group, and 6 wells were used for each group. The experiment was repeated more than 3 times, and the average value was used for statistical analysis.

[0154] The results are shown in Figure 14. The killing effect of MiTDvv-hIL21 and DDvv-hIL21 oncolytic vaccinia viruses on normal human lung fibroblast MRC-5 cells showed a dose-dependent increasing trend. The killing effect of MiTDvv-hIL21 oncolytic vaccinia virus on normal human lung fibroblast MRC-5 cells was significantly weaker than that of DDvv-hIL21 oncolytic vaccinia virus on MRC-5 cells at the same dose (0.3 MOI, p < 0.05; 1 MOI, p < 0.01).

[0155] Example 5 Comparison of replication of MiTDvv-hIL21 and DDvv-hIL21 oncolytic vaccinia viruses in normal cells Human normal embryonic lung fibroblast MRC-5 cells were seeded into 24-well culture plates at a density of 1×10 5Cells were placed in wells and the cell density was adjusted to reach 80% the next day. The MiTDvv-hIL21 oncolytic vaccinia virus and DDvv-hIL21 oncolytic vaccinia virus prepared by the above method were added at 0.1 MOI and 0.3 MOI, respectively. After infecting for 2 hours, the medium was replaced with DMEM medium containing 5% FBS, and the culture was continued at 37 °C and 5% CO2 for 24 hours. Then, the medium and cells were collected, and the viral genome was extracted using the TIANamp Virus DNA / RNA Kit. The viral load was detected by detecting the A46R, a viral gene, by real-time fluorescence quantitative PCR. The primer sequences are shown in Table 2. In this experiment, a group of MRC-5 cells without added virus was used as a blank control group. The corresponding medium replacement was also carried out simultaneously for the control group. Three replicate experimental wells were used for each group, and the average value was used for statistical analysis.

[0156] The results are shown in Figure 15. Under the infection conditions of 0.1 MOI and 0.3 MOI, the replication of the MiTDvv-hIL21 oncolytic vaccinia virus in normal cells MRC-5 was significantly lower than that of the DDvv-hIL21 oncolytic vaccinia virus in MRC-5.

[0157] Example 6 Comparison of Replication of MiTDvv-hIL21 Oncolytic Vaccinia Virus in Normal Cells and in Tumor Cells Normal human lung fibroblasts MRC-5 and human non-small cell lung cancer cells A549 were seeded in a 24-well culture dish at 1×10 5Cells were spread in wells and the cell density was adjusted to reach 80% the next day. The MiTDvv-hIL21 oncolytic vaccinia virus prepared by the above method was added at 0.03 MOI, 0.3 MOI, and 3 MOI, respectively. After infecting for 2 hours, the medium was replaced with DMEM medium containing 5% FBS, and the culture was continued at 37°C and 5% CO2 for 24 hours. Then, the cells and the medium were collected, and the viral genome was extracted using the TIANamp Virus DNA / RNA Kit. The viral gene A46R was detected by real-time fluorescence quantitative PCR to detect the viral load. The primer sequences are shown in Table 2. In this experiment, the group of cells without added virus was used as the blank control group. The corresponding medium replacement was performed on the control group at the corresponding time point, and three replicate experimental wells were used for each group.

[0158] The results are shown in Figure 16A. The replication of the MiTDvv-hIL21 oncolytic vaccinia virus in the tumor cells A549 was significantly higher than that in the normal cells MRC-5. The ratios (A549 / MRC-5) of the replication of the MiTDvv-hIL21 oncolytic vaccinia virus in the tumor cells A549 to that in the normal cells MRC-5 at 0.03 MOI, 0.3 MOI, and 3 MOI were 51, 23, and 16, respectively (Figure 16B). The X-axis represents the ratio of the replication of the oncolytic virus in A549 cells to that in MRC-5 cells (i.e., A549 / MRC-5), and the Y-axis represents the MOI of virus infection.

[0159] Example 7 In Vitro Killing Effect of MiTDvv-hIL21 Oncolytic Vaccinia Virus against Different Tumor Cell Lines Various types of human tumor cells were added to a 96-well plate at 4,000 - 5,000 cells per well. The tumor cells included SK-HEP-1 cells (human liver cancer cells), A549 cells (human non-small cell lung cancer cells), FaDu cells (human head and neck cancer cells), PANC-1 (human pancreatic cancer cells), U251 cells (human glioma cells), LOVO cells (human colorectal cancer cells), and MNNG / HOS C1 cells (human osteosarcoma cells). The cells were incubated at 37°C and 5% CO2 overnight until they reached 70%. Half of the volume of the medium in each well was aspirated and discarded, and then serum-free medium containing the MiTDvv-hIL21 oncolytic vaccinia virus prepared by the above method at different concentrations (0.001 MOI, 0.003 MOI, 0.01 MOI, 0.03 MOI, 0.1 MOI, 0.3 MOI, 1 MOI, 3 MOI, 10 MOI) was added to each well in an equal volume. Four hours after infection, the medium was replaced with a medium containing 5% FBS and incubated at 37°C and 5% CO2 for 48 hours (MNNG / HOS C1, A549, LOVO, FaDu) or 72 hours (SK-HEP-1, U251, PANC-1). Apoptosis of the tumor cells was detected by MTT assay (n = 6, the experiment was repeated 2 - 3 times). The control groups of this test were the negative control group (without virus infection) and the positive control group (10 μM paclitaxel, purchased from Beijing SL Pharmaceutical Co., Ltd.), and each experimental group and control group were prepared in six duplicate wells. The cell killing rate (inhibition rate) was the ratio (%) of the experimental group or the positive control group to the negative control group.

[0160] From the results, it was shown that the killing effect of the MiTDvv-hIL21 oncolytic vaccinia virus on tumor cells was dose-dependent (Figure 17). The median inhibitory rates (IC 50 ) of the MiTDvv-hIL21 oncolytic vaccinia virus against SK-HEP-1 cells, U251 cells, PANC-1 cells, MNNG / HOS C1 cells, A549 cells, LOVO cells, and FaDu cells were 0.18, 0.79, 0.54, 0.53, 0.66, 0.68, and 0.29, respectively (Table 3).

[0161]

Table 3

[0162] Example 8 Evaluation of the Correlation between the Expression Level of Mature miR-199 in Different Cells and the Cytotoxic Effect of MiTDvv-hIL21 Oncolytic Vaccinia Virus 1) Evaluation of miR-199 expression levels in different tumor cells (Note: The miR-199 expression levels in all tumor cells are relative to those in HEK-293T cells): HEK-293T cells, MNNG / HOS C1 cells, SaoS2 cells (human osteosarcoma cells), A549 cells, FaDu cells, SK-BR-3 cells (human breast cancer cells), HepG2 cells (human liver cancer cells), HeLa cells (cervical cancer cells), SKOV3 cells (human ovarian cancer cells), MCF-7 cells (human breast cancer cells), C33A cells (human cervical cancer cells), LOVO cells, U251 cells, HCT116 cells (human colorectal cancer cells), SK-HEP-1 cells, CFPAC-1 cells (human pancreatic cancer cells), PANC-1 cells (human pancreatic cancer cells), NCI-H1299 cells (human non-small cell lung cancer cells), and U87MG cells (human glioma cells) were each added to 6-well plates. After the cells completely filled the wells, the medium was discarded. 1 mL of Trizol reagent (Invitrogen) was added to extract RNA. Using 1 μg of RNA, cDNA was synthesized with a reverse transcription kit (Tiangen cat# KR116-02), and the expression levels of the mature form of miR-199 (hsa-miR-199a-3p or hsa-miR-199b-3p) in tumor cells were detected with a fluorescence quantitative PCR reagent kit. As shown in Table 4, the reverse transcription primer miR199-RT obtained from the combination of the universal stem-loop sequence GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC (SEQ ID NO: 36) and the 7-base inverted repeat sequence at the 3'-end of the miR199-3p mature form was used; the sequences of the qRT-PCR primers (synthesized by Beijing Tsingke Biotechnology Co., Ltd.) are shown in Table 4. At the same time, the relative expression level of miR-199 was calculated using the endogenous gene U6 as an internal reference.From the results, it was shown that MNNG / HOS C1 cells and SaoS2 cells are cell lines with high expression of miR-199 (++, ≥10), FaDu cells, HepG2 cells and SK-BR-3 cells are cell lines with moderate expression of miR-199 (+, ≥1 and <10), and all other tumor cell lines are cell lines with low expression of miR-199 (±, <1) (Figure 18).

[0163]

Table 4

[0164] 2) To compare the killing effects of the MiTDvv-hIL21 oncolytic vaccinia virus prepared by the above method, according to the intracellular miR-199 expression levels shown in Figure 18, PANC-1, SK-HEP-1, FaDu and MNNG / HOS C1 cells were selected as tumor cell lines with low expression, moderate expression and high expression of miR-199: MNNG / HOS C1, FaDu, SK-HEP-1 and PANC-1 cells were seeded in 96-well plates, and the number of cells in each well was adjusted according to the cell growth rate. After overnight culture, the cell density reached 80%. Then, the medium was discarded, and 100 μL of serum-free medium containing MiTDvv-hIL21 oncolytic vaccinia virus at 0.1 MOI was added. Four hours after infection, the medium was replaced with medium containing 5% FBS, and incubation was continued for 48 hours. Apoptosis of tumor cells was detected by MTT assay (n = 6, the experiment was repeated 2 - 3 times). The control group of this test was the negative control group (without virus infection), and each experimental group and control group were prepared in six duplicate wells, and the cell viability was expressed as the ratio (%) of the experimental group to the negative control group. From the results, it was shown that the killing effect of the MiTDvv-hIL21 oncolytic vaccinia virus on tumor cells with low expression of miR-199 was significantly higher than that on tumor cells with high expression of miR-199 (Figure 19).

[0165] Example 9 Evaluation of the killing effect of MiTDvv-hIL21 oncolytic vaccinia virus against tumor cells highly expressing miR-199 by stable transfection The purpose of this experiment is to further demonstrate the mechanism of the oncolytic virus of the present invention. The TK / VGF double-deleted oncolytic vaccinia virus itself has different killing effects on different types of tumor cells. In order to further verify that the MiTDvv-hIL21 oncolytic vaccinia virus of the present invention can be regulated by microRNA, stably transfected tumor cells highly expressing miR-199 (including has-miR-199a-3p and has-miR-199b-3p) were constructed for comparison among the same type of tumor cells.

[0166] 1) Construction of lentivirus with miR-199: HEK-293 cells (Agilent Technologies) were seeded in 6-well plates with DMEM medium supplemented with 10% FBS + 1% P / S at 4×10 5Cells were seeded into wells and allowed to reach a cell density of approximately 70% the next day. After replacing with DMEM medium supplemented with 5% FBS + 1% P / S, 300 μL of the plasmid / Lipo3000 mixed solution (the same as in Preparation Example 2) was added to each well. The plasmids for preparing LV-miR199 lentivirus included: p59-rev, pP60-VSV-G, p61-gag-P01 and LV3-has-miR199-GFP, which were purchased from Shanghai GenePharma Co., Ltd. The LV3-has-miR199-GFP plasmid contains a DNA sequence capable of expressing the mature form of miR199, hsa-miR-199b-3p: 5’-GATCCGACAGTAGTCTGCACATTGGTTATTCAAGAGATAACCAATGCAGACTACTGTCTTTTTTGAATT-3’ (SEQ ID NO: 37), and a DNA sequence capable of expressing GFP green fluorescent protein that can be used for screening and detection. The plasmids for preparing LV-miRNC lentivirus included: p59-rev, pP60-VSV-G, p61-gag-P01 and LV3-shNC, which were purchased from Shanghai GenePharma Co., Ltd. LV3-shNC is a control plasmid with an irrelevant control DNA sequence: 5’-GATCCGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAACTTTTTTGAATT-3’ (SEQ ID NO: 38); “LV3” is the serial number of the lentiviral plasmid vector of Shanghai GenePharma Co., and “hsa” indicates that it is derived from humans. The cells were incubated in an incubator at 37 °C and 5% CO2 for 48 hours, then the supernatant was collected and centrifuged at 4 °C and 5000 rpm for 30 minutes. The supernatant was collected, filtered through a 0.45 μm filter membrane, dispensed into 1 mL per tube, and stored at -80 °C. These are the lentivirus LV-miR199 with miR-199 and the backbone lentivirus LV-miRNC, respectively.

[0167] 2) Construction of tumor cells highly expressing miR-199: HCT116 cells were infected with LV-miR199 lentivirus and the backbone lentivirus LV-miRNC respectively (by conventional means), and single clones of positive cells were selected to construct the HCT116-miR199 cell line with stable expression of miR-199 and the cell line HCT116-miRNC as the negative control. The expression of GFP was detected using the green fluorescence channel of a hemocytometer (Figure 20A), and the PCR method was used for identification (Figure 20B) (which can be adjusted according to experimental conditions). The QPCR primer sequences are shown in Table 4. The results of flow cytometry showed that the positive transfection rates of the HCT116-miR199 cell line and the HCT116-miRNC cell line were 99.91% and 99.64% respectively. The results of PCR confirmed that the HCT116-miR199 cell line highly expressed miR-199 (including has-miR-199a-3p and has-miR-199b-3p).

[0168] 3) The HCT116-miR199 cell line and the HCT116-miRNC cell line were seeded into 96-well plates at 5000 cells per well in 10% FBS medium and incubated overnight until the cell density reached 80% the next day. After discarding the medium, 100 μL of serum-free medium containing the MiTDvv-hIL21 oncolytic vaccinia virus prepared by the above method at 0.03 MOI, 0.3 MOI, and 3 MOI respectively was added. Four hours after infection, the medium was replaced with medium containing 5% FBS, and the cells were incubated at 37 °C and 5% CO2 for 48 hours. The apoptosis of tumor cells was detected by MTT assay (n = 6, the experiment was repeated 2 - 3 times). The control group of this test was the negative control group (without virus infection). Each experimental group and the control group were prepared in six duplicate wells, and the cell killing rate was expressed as the ratio (%) of the experimental group to the negative control group. The results showed that the killing effect of the MiTDvv-hIL21 oncolytic vaccinia virus was significantly reduced in tumor cells highly expressing miR-199 (Figure 21).

[0169] Example 10 Tumor Suppressive Effect of MiTDvv-hIL21 Oncolytic Vaccinia Virus against Colorectal Cancer Using human colorectal cancer HCT116 cells in the logarithmic growth phase, a tumor model of NCG mice, which are severely immunodeficient mice, was established. In this experiment, severely immunodeficient NCG mice (obtained from Jiangsu GemPharmatech Co., Ltd.) (8 weeks old, female) were used, and 1 million HCT116 cells were subcutaneously inoculated into the posterior part of the hind limb of each mouse. When the tumor volume reached approximately 100 mm 3 Upon reaching, the MiTDvv-hIL21 oncolytic vaccinia virus prepared by the above method was injected into the tumor at 5×10 5 pfu / mouse with an administration volume of 50 μL. Each group consisted of 4 mice, and the tumor size and body weight of the mice were measured every 3 days. In this experiment, a control group administered with PBS was prepared. From the results, it was shown that the MiTDvv-hIL21 oncolytic vaccinia virus effectively inhibited tumor growth (Figure 22A). The relative tumor growth rate (T / C, that is, the value of the ratio of the tumor volume of the virus-administered group to the tumor volume of the control group, and a value of <40% indicates effectiveness) of the administration group was less than 40% after the 10th day of administration (Figure 22B). No significant decrease in the body weight of the mice was observed throughout the experiment (Figure 22C).

[0170] Example 11 Tumor Suppressive Effect of MiTDvv-hIL21 Oncolytic Vaccinia Virus against Human Osteosarcoma Using human osteosarcoma MNNG / HOS C1 cells in the logarithmic growth phase, a tumor model of severely immunodeficient NCG mice was constructed. In this experiment, severely immunodeficient NCG mice (obtained from Jiangsu GemPharmatech Co., Ltd.) (8 weeks old, female) were used, and 500,000 MNNG / HOS C1 cells were subcutaneously inoculated into the posterior part of the hind limb of each mouse. When the tumor volume reached about 100 mm 3 Upon reaching, the MiTDvv-hIL21 oncolytic vaccinia virus prepared by the above method was injected into the tumor at 1×10 6In pfu / mouse, with an administration volume of 50 μL, it was injected into the tumor. Each group consisted of 4 mice, and the tumor size and body weight of the mice were measured every 3 days. In this experiment, a control group administered with PBS was prepared. From the results, it was shown that the MiTDvv-hIL21 oncolytic vaccinia virus effectively inhibited the growth of MNNG / HOS C1 tumors highly expressing miR-199 in mice (Figure 23A). The relative tumor growth rate (T / C) was less than 40% after the 8th day of administration (Figure 23B). No significant decrease in the body weight of the mice was observed throughout the experiment (Figure 23C).

[0171] Example 12 Tumor Suppressive Effect of MiTDvv-hIL21 Oncolytic Vaccinia Virus Against Human Liver Cancer Using human hepatoma SK-HEP-1 cells in the logarithmic growth phase, a tumor model of severely immunodeficient NCG mice was constructed. In this experiment, severely immunodeficient NCG mice (obtained from Jiangsu GemPharmatech Co., Ltd.) (7-week-old, female) were used, and 10 million SK-HEP-1 cells were subcutaneously inoculated into the posterior part of the hind limb of each mouse. When the tumor volume reached about 100 mm 3 When it reached, the MiTDvv-hIL21 oncolytic vaccinia virus prepared by the above method was injected into the tumor at 2×10 5 pfu / mouse, with an administration volume of 50 μL. The mice in each group were 3 - 4 in number, and the tumor size and body weight of the mice were measured every 3 days. In this experiment, a control group administered with PBS was prepared. From the results, it was shown that the MiTDvv-hIL21 oncolytic vaccinia virus effectively inhibited tumor growth (Figure 24A). No significant decrease in the body weight of the mice was observed throughout the experiment (Figure 24B).

[0172] Example 13 Evaluation of the Killing Effect of MiTDvv-hIL21 and DDvv-hIL21 Oncolytic Vaccinia Viruses Against Tumor Cells with Different miR-199 Expression Levels Various human tumor cells were seeded in a 96-well plate at 4000 - 5000 cells per well. The tumor cells included MNNG / HOS C1, SaoS2, FaDu, SK-BR-3, HepG2, Hela, SKOV3, C33A, LOVO, U251, HCT116, SK-HEP-1, CFPAC-1, and PANC-1 cells. The cells were incubated overnight at 37°C and 5% CO2 to reach a cell density of 70%. The medium was replaced with serum-free medium containing the MiTDvv-hIL21 oncolytic vaccinia virus or the DDvv-hIL21 oncolytic vaccinia virus prepared by the above method at 0.3 - 10 MOI (since the susceptibilities of various tumor cells to the virus differed, the MOI explored in previous in vitro experiments was used: 0.3 MOI for MNNG / HOS C1 and FaDu; 1 MOI for LOVO, U251, and SK-HEP-1; 3 MOI for SaoS2, SK-BR-3, HepG2, Hela, SKOV3, C33A, CFPAC-1, and PANC-1; and 10 MOI for HCT116). Four hours after infection, the medium was replaced with medium containing 5% FBS, and the cells were incubated at 37°C and 5% CO2 for 48 hours. Apoptosis of the tumor cells was detected by the MTT assay (n = 6, the experiment was repeated 2 - 3 times). The negative control group of this test was not infected with the virus, and each experimental group and control group were prepared in six duplicate wells. The cell death rate (cell growth inhibition rate) was expressed as the ratio (%) of the experimental group to the negative control group. From the results, in the tumor cells MNNG / HOS C1 and SaoS2 with high miR-199 expression, no difference in the cell killing effect was observed between the MiTDvv-hIL21 oncolytic vaccinia virus and the DDvv-hIL21 oncolytic vaccinia virus, but in the tumor cells FaDu, SK-BR-3, HepG2, Hela, SKOV3, C33A, LOVO, U251, HCT116, SK-HEP-1, CFPAC-1, PANC-1, etc. with moderate or low miR-199 expression, the MiTDvv-hIL21 oncolytic vaccinia virus showed a more potent killing effect (Figure 25).

[0173] Example 14 Evaluation of the Tumor Suppressive Effects of MiTDvv-hIL21 and DDvv-hIL21 Oncolytic Vaccinia Viruses on Tumor-Bearing Mice with Different miR-199 Expression Levels Using human colorectal cancer HCT116 cells in the logarithmic growth phase and human osteosarcoma MNNG / HOS C1 cells in the logarithmic growth phase, a tumor model of severe immunodeficient NCG mice was established. According to the methods for constructing the tumor models described in Examples 10 and 11, human osteosarcoma MNNG / HOS C1 cells with high miR-199 expression and human colorectal cancer HCT116 cells with low miR-199 expression were subcutaneously inoculated into the posterior part of the hind limbs of NCG mice. When the tumor volume reached about 100 mm 3 Once reached, the MiTDvv-hIL21 oncolytic virus and DDvv-hIL21 oncolytic vaccinia virus prepared by the above method were injected into the tumor. The dosage for MNNG / HOS C1 tumor-bearing mice was 1×10 6 pfu / mouse, the dosage for HCT116 tumor-bearing mice was 5×10 5 pfu / mouse, and the administration volume was 50 μL. Each group consisted of 3 mice, and the tumor size and body weight of the mice were measured every 3 days. From the results, it is shown that a relatively good tumor suppressive effect was demonstrated in both the HCT116 tumor model group and the MNNG / HOS C1 tumor model group. In comparison, in the HCT116 tumor with low miR-199 expression, the tumor suppressive effect of the MiTDvv-hIL21 oncolytic vaccinia virus was stronger than that of the DDvv-hIL21 oncolytic vaccinia virus (Figure 26A). However, in the MNNG / HOS C1 tumor with high miR-199 expression, the tumor suppressive effect of the MiTDvv-hIL21 oncolytic vaccinia virus was weaker than that of the DDvv-hIL21 oncolytic vaccinia virus (Figure 26B).

[0174] Example 15 Evaluation of the Tissue Distribution of MiTDvv-hIL21 and DDvv-hIL21 Oncolytic Vaccinia Viruses in Mice Eight-week-old normal C57BL / 6N female mice were intravenously administered 200 μL of PBS containing 1×10 9 pfu / kg of either MiTDvv-hIL21 oncolytic vaccinia virus or DDvv-hIL21 oncolytic vaccinia virus prepared by the above method. Each group consisted of 5 mice. One group of mice (5 mice) was sacrificed on day 1 (D1), day 3 (D3), day 7 (D7), and day 15 (D15) after administration, and peripheral blood, heart, liver, spleen, lung, kidney, ovary, and uterus were collected, and the distribution of vaccinia virus was detected by QPCR of A46R, a viral gene. The primer sequences are shown in Table 2. From the results, it was shown that the replication of MiTDvv-hIL21 oncolytic vaccinia virus in the ovary, uterus, liver, and spleen was lower than that of DDvv-hIL21 oncolytic vaccinia virus, and the virus amount of MiTDvv-hIL21 oncolytic vaccinia virus in the lung was the same as that of DDvv-hIL21 oncolytic vaccinia virus. In peripheral blood, the virus amount of MiTDvv-hIL21 oncolytic vaccinia virus was higher than that of DDvv-hIL21 oncolytic vaccinia virus (Figure 27). Neither MiTDvv-hIL21 oncolytic vaccinia virus nor DDvv-hIL21 oncolytic vaccinia virus was detected in the heart and kidney (data not shown).

Claims

**Claim 1** An isolated recombinant oncolytic vaccinia virus, wherein the recombinant oncolytic vaccinia virus is regulatable by a microRNA whose expression level in mammalian tumor cells is lower than its expression level in normal mammalian cells, and a target sequence of the microRNA is incorporated into the 3'UTR region of the E10R gene of the recombinant oncolytic vaccinia virus genome. **Claim 2** The recombinant oncolytic vaccinia virus according to claim 1, wherein the microRNA is selected from the group consisting of miR-9, miR-15a, miR-16, miR-26a, miR-27b, miR-29b, miR-30a, miR-32, miR-33, miR-34, miR-95, miR-101, miR-122, miR-124, miR-125a, miR-125b, miR-126, miR-127, miR-128, miR-133b, miR-139, miR-140, miR-142, miR-143, miR-145, miR-181, miR-192, miR-195, miR-198, miR-199a, miR-199b, miR-200, miR-203, miR-204, miR-205, miR-218, miR-219, miR-220, miR-224, miR-345, and miR-375. **Claim 3** The recombinant oncolytic vaccinia virus according to claim 1, wherein the TK gene and / or the VEGF gene is / are functionally defective. **Claim 4** The recombinant oncolytic vaccinia virus according to claim 1, wherein the target sequence of the microRNA is repetitive and contains 2 to 8 repetitions. **Claim 5** The recombinant oncolytic vaccinia virus according to claim 3, wherein an exogenous IL-21 gene is incorporated into the genome of the recombinant oncolytic vaccinia virus, and the IL-21 gene is expressible in tumor cells. **Claim 6** The recombinant oncolytic vaccinia virus according to claim 3, wherein the TK gene is functionally defective by insertion of an exogenous nucleotide sequence into the TK gene locus. **Claim 7** The recombinant oncolytic vaccinia virus according to claim 5, wherein the exogenous IL-21 gene is inserted into the TK gene locus, thereby causing a functional defect of the TK gene. **Claim 8** The recombinant oncolytic vaccinia virus according to claim 3, wherein the VGF gene is functionally defective by knockout or by insertion of an exogenous nucleotide sequence into the VGF locus.

9. The recombinant oncolytic vaccinia virus according to claim 1, wherein the recombinant oncolytic vaccinia virus is a WR strain or a Wyeth strain.

10. The recombinant oncolytic vaccinia virus according to claim 1, wherein an exogenous screening gene containing a gpt gene and / or a LacZ gene is further incorporated into the genome of the recombinant oncolytic vaccinia virus.

11. The recombinant oncolytic vaccinia virus according to claim 5, wherein the exogenous IL-21 gene is derived from a mouse or a human.

12. The recombinant oncolytic vaccinia virus according to claim 2, wherein the microRNA is selected from miR-199a and miR-199b.

13. A pharmaceutical composition comprising the recombinant oncolytic vaccinia virus according to any one of claims 1 to 12 as an active ingredient and a pharmaceutically acceptable excipient.

14. The pharmaceutical composition contains the recombinant oncolytic vaccinia virus at a dose of 1×10 5 to 5×10 9 pfu, and is the pharmaceutical composition according to claim 13.

15. The pharmaceutical composition according to claim 13, wherein the recombinant oncolytic vaccinia virus is administered intratumorally or intravenously.

16. A vector for preparing the recombinant oncolytic vaccinia virus according to any one of claims 1 to 12.

17. The vector according to claim 16, wherein the vector contains an exogenous IL-21 gene controlled by a promoter.

18. A host cell containing the vector according to claim 16 or 17.

19. Use of the recombinant oncolytic vaccinia virus according to any one of claims 1 to 12 in the manufacture of a drug for treating a tumor and / or cancer.

20. The tumor and / or cancer according to claim 19, wherein the tumor and / or cancer includes lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumor, colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphatic cancer, leukemia, bone cancer, testicular cancer, and osteosarcoma.

21. An isolated recombinant oncolytic vaccinia virus for treating a tumor and / or cancer, comprising administering the recombinant oncolytic vaccinia virus according to any one of claims 1 to 12 to a patient with a tumor and / or cancer.

22. The recombinant oncolytic vaccinia virus is administered at a dose of 1×10 5 to 5×10 9 pfu once a day for 1 to 6 consecutive days, or once every 2 days for 1 to 6 consecutive times. The recombinant oncolytic vaccinia virus according to claim 21.

23. The recombinant oncolytic vaccinia virus according to claim 21, wherein the recombinant oncolytic vaccinia virus is administered intratumorally or intravenously.

24. The recombinant oncolytic vaccinia virus according to claim 21, wherein the tumor and / or cancer includes lung cancer, melanoma, head and neck cancer, liver cancer, intracranial tumor, colorectal cancer, bladder cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, gastric cancer, esophageal cancer, kidney cancer, prostate cancer, pancreatic cancer, lymphoma, leukemia, bone cancer, testicular cancer and osteosarcoma.

Citation Information

Patent Citations

  • Oncolytic adenovirus subjected to dual regulation of transcriptional level and and posttranscriptional level and construction method thereof

    CN104178460A

  • Recombination oncolytic virus composition and application thereof

    CN109745343A

  • Oncolytic viral vectors and uses thereof

    JP2019508063A

  • Compositions and methods for organ-protective expression and regulation of encoding ribonucleic acids

    JP2021514190A

  • Compositions and methods for organ-protective expression and regulation of encoding ribonucleic acids

    JP2023514594A