Strains and methods for the production of heme-containing proteins
By employing mutant ALAS proteins with specific mutations within heme-reactive motifs, the expression of heme-binding proteins in methanol-assimilating yeast cells is enhanced, overcoming previous efficiency limitations and achieving higher production yields.
Patent Information
- Application Number
- JP2021563177
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-04-25
- Filing Date
- 2020-04-24
- Publication Date
- 2025-06-30
- Estimated Expiration
- 2040-04-24
AI Technical Summary
Current methods for expressing heme-binding proteins in methanol-assimilating yeast cells, such as Pichia pastoris, are inefficient, limiting the production yield of these proteins.
The use of mutant aminolevulinate synthase (ALAS) proteins with specific mutations within heme-reactive motifs (HRMs) to enhance the expression of heme-binding proteins by increasing the translocation of ALAS to the mitochondria.
This approach significantly increases the titer of heme-binding proteins, with production levels exceeding those achieved without the mutant ALAS constructs, even in the absence of methanol induction.
Smart Images

Figure 0007700046000018 
Figure 0007700046000019 
Figure 0007700046000020
Abstract
Description
Technical Field
[0001] Cross - reference to Related Applications This application claims priority to U.S. Provisional Application No. 62 / 838,770, filed on April 25, 2019, which is incorporated herein by reference in its entirety.
[0002] Description of Electronically Submitted Text Files A text file submitted electronically with this specification: The file name is 38767 - 0158WO1.txt, the recording date is April 24, 2020, the file size is approximately 69 kilobytes, and the content of the copy of the sequence listing in a computer - readable format is incorporated herein by reference in its entirety.
[0003] Technical Field The present disclosure generally relates to DNA constructs and methods of using such DNA constructs to genetically engineer cells (e.g., yeast cells (e.g., methanol - assimilating yeast cells)).
Background Art
[0004] Cells such as Pichia pastoris are generally used for the expression of recombinant proteins. Provided herein are constructs that can be used to efficiently express one or more proteins in cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol - assimilating yeast cells)).
Summary of the Invention
[0005] This document is based at least in part on the identification of mutations in aminolevulinate synthase (ALAS) that can confer increased expression of heme-binding proteins. The mutant ALAS proteins described herein can be used, for example, for efficient expression of heme-binding proteins in Pichia.
[0006] In one aspect of the present specification, there is provided a first exogenous nucleic acid construct comprising a nucleotide sequence encoding an aminolevulinate synthase (ALAS) protein operably linked to a first promoter element, wherein ALAS comprises a first mutation within a first heme-reactive motif (HRM), and a second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein operably linked to the first promoter element or operably linked to a second promoter element, and a methanol-assimilating yeast cell.
[0007] The implementation may have one or more of the following features. The methanol-assimilating yeast cell may be a cell of the genus Pichia, Candida, Hansenula, or Torulopsis. The methanol-assimilating yeast cell may be a Pichia methanolica cell, a Pichia pastoris cell, a Candida boidinii cell, or a Hansenula polymorpha cell. The methanol-assimilating yeast cell may be a Pichia pastoris cell. The first mutation may be a mutation from cysteine to serine. The first mutation may be a mutation from cysteine to alanine. ALAS may include a second mutation within the second HRM. The second mutation may be a mutation from cysteine to serine. The second mutation may be a mutation from cysteine to alanine. The first exogenous nucleic acid construct may include a nucleic acid sequence having at least 90% sequence identity to the nucleic acid sequence within SEQ ID NO: 28. The first exogenous nucleic acid construct may include a nucleic acid sequence having at least 95% sequence identity to the nucleic acid sequence within SEQ ID NO: 28. The ALAS protein may include an amino acid sequence having at least 90% sequence identity to the amino acid sequence within SEQ ID NO: 29. The ALAS protein may include an amino acid sequence having at least 95% sequence identity to the amino acid sequence within SEQ ID NO: 29. The heme-binding protein may be selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase. The heme-binding protein may be selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, nonsymbiotic hemoglobin, protoglobin, and truncated hemoglobin. The heme-binding protein may be nonsymbiotic hemoglobin. The heme-binding protein may be leghemoglobin.The heme-binding protein may include an amino acid sequence having at least 90% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 1 to 27. The methanol-assimilating yeast cell may further include a third nucleic acid construct containing a nucleotide sequence encoding a transcription factor, and the third nucleic acid construct is operably linked to a first promoter element, a second promoter element, or a third promoter element. The first promoter element may include a recognition sequence for the transcription factor. The second exogenous nucleic acid construct may be operably linked to the second promoter element, and the second promoter element includes a recognition sequence for the transcription factor. The third nucleic acid construct may be operably linked to the third promoter element, and the third promoter element includes a recognition sequence for the transcription factor. The methanol-assimilating yeast cell may further include a fourth nucleic acid construct containing a nucleotide sequence encoding a protein involved in heme biosynthesis, and the fourth nucleic acid construct is operably linked to a first promoter element, a second promoter element, a third promoter element, or a fourth promoter element. The protein involved in heme biosynthesis may be selected from the group consisting of ALA dehydratase, porphobilinogen deaminase, UPG III synthase, UPG III decarboxylase, CPG oxidase, PPG oxidase, and ferrochelatase. The first exogenous nucleic acid construct may be a heterologous nucleic acid construct. The second exogenous nucleic acid construct may be a heterologous nucleic acid construct. The heme-binding protein may be an exogenous heme-binding protein. The heme-binding protein may be a heterologous heme-binding protein.
[0008] In another aspect of the present specification, a method for producing a heme-binding protein in a methanol-assimilating yeast cell, comprising expressing a first exogenous nucleic acid construct comprising a nucleotide sequence encoding an aminolevulinic acid synthase (ALAS) protein operably linked to a first promoter element, wherein the ALAS comprises a first mutation within a first heme-reactive motif (HRM), and expressing a second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein, wherein the second exogenous nucleic acid construct comprising the nucleotide sequence encoding the heme-binding protein is operably linked to the first promoter element or is operably linked to a second promoter element, is provided.
[0009] The implementation may have one or more of the following features. ALAS may contain a second mutation within the second HRM. The method can produce a heme-binding protein at a titer exceeding at least 5% of the corresponding method lacking the first exogenous nucleic acid construct. The method can produce a heme-binding protein at a titer exceeding at least 10% of the corresponding method lacking the first exogenous nucleic acid construct. The method can produce a heme-binding protein at a titer exceeding at least 15% of the corresponding method lacking the first exogenous nucleic acid construct. The method can produce a heme-binding protein at a titer exceeding at least 20% of the corresponding method lacking the first exogenous nucleic acid construct. The method can produce a heme-binding protein at a titer exceeding at least 5% of the corresponding method lacking the first mutation. The method can produce a heme-binding protein at a titer exceeding at least 10% of the corresponding method lacking the first mutation. The method can produce a heme-binding protein at a titer exceeding at least 15% of the corresponding method lacking the first mutation. The method can produce a heme-binding protein at a titer exceeding at least 20% of the corresponding method lacking the first mutation. The method can produce a heme-binding protein at a titer exceeding at least 5% of the corresponding method lacking the first and second mutations. The method can produce a heme-binding protein at a titer exceeding at least 10% of the corresponding method lacking the first and second mutations. The method can produce a heme-binding protein at a titer exceeding at least 15% of the corresponding method lacking the first and second mutations. The method can produce a heme-binding protein at a titer exceeding at least 20% of the corresponding method lacking the first and second mutations. The method can be carried out in the absence of the addition of methanol. The methanol-assimilating yeast cells can be Pichia cells, Candida cells, Hansenula cells, or Torulopsis cells.The methanol-assimilating yeast cell can be a Pichia methanolica cell, a Pichia pastoris cell, a Candida boidinii cell, or a Hansenula polymorpha cell. The methanol-assimilating yeast cell can be a Pichia pastoris cell. The first mutation can be a mutation from cysteine to serine. The first mutation can be a mutation from cysteine to alanine. The second mutation can be a mutation from cysteine to serine. The second mutation can be a mutation from cysteine to alanine. The first exogenous nucleic acid construct can include a nucleic acid sequence having at least 90% sequence identity to the nucleic acid sequence within SEQ ID NO: 28. The first exogenous nucleic acid construct can include a nucleic acid sequence having at least 95% sequence identity to the nucleic acid sequence within SEQ ID NO: 28. The ALAS protein can include an amino acid sequence having at least 90% sequence identity to the amino acid sequence within SEQ ID NO: 29. The ALAS protein can include an amino acid sequence having at least 95% sequence identity to the amino acid sequence within SEQ ID NO: 29. The heme-binding protein can be selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase. The heme-binding protein can be selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated hemoglobin. The heme-binding protein can be non-symbiotic hemoglobin. The heme-binding protein can be leghemoglobin. The heterologous heme-binding protein can include an amino acid sequence having at least 90% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 1 to 27.The method may further include the step of expressing a third nucleic acid construct comprising a nucleotide sequence encoding a transcription factor, wherein the third nucleic acid construct is operably linked to a first promoter element, a second promoter element, or a third promoter element. The first promoter element may comprise a recognition sequence for the transcription factor. The second exogenous nucleic acid construct may be operably linked to the second promoter element, and the second promoter element comprises a recognition sequence for the transcription factor. The third nucleic acid construct may be operably linked to the third promoter element, and the third promoter element comprises a recognition sequence for the transcription factor. The method may further include the step of expressing a fourth nucleic acid construct comprising a nucleotide sequence encoding a protein involved in the biosynthesis of heme, wherein the fourth nucleic acid construct is operably linked to a first promoter element, a second promoter element, a third promoter element, or a fourth promoter element. The protein involved in the biosynthesis of heme may be selected from the group consisting of ALA dehydratase, porphobilinogen deaminase, UPG III synthase, UPG III decarboxylase, CPG oxidase, PPG oxidase, and ferrochelatase. The first exogenous nucleic acid construct may be a heterologous nucleic acid construct. The second exogenous nucleic acid construct may be a heterologous nucleic acid construct. The heme-binding protein may be an exogenous heme-binding protein. The heme-binding protein may be a heterologous heme-binding protein.
[0010] In another aspect of the present specification, there is provided a Pichia pastoris cell comprising a nucleotide sequence encoding an aminolevulinate synthase (ALAS) protein operably linked to a first promoter element, wherein the ALAS comprises a first mutation within a first heme-reactive motif (HRM) and a second mutation within a second HRM, and a second exogenous nucleic acid construct comprising a nucleotide sequence encoding leghemoglobin, wherein the second exogenous nucleic acid construct is operably linked to the first promoter element or to a nucleotide sequence encoding leghemoglobin operably linked to the first promoter element.
[0011] The implementation may include one or more of the following features. The first mutation may be a mutation from cysteine to serine. The second mutation may be a mutation from cysteine to serine.
[0012] In another aspect of the present specification, there is provided a method for producing leghemoglobin, the method comprising expressing a first exogenous nucleic acid construct comprising a nucleotide sequence encoding an aminolevulinate synthase (ALAS) protein operably linked to a first promoter element, wherein the ALAS comprises a first mutation within a first heme-reactive motif (HRM) and a second mutation within a second HRM, and expressing a second exogenous nucleic acid construct comprising a nucleotide sequence encoding leghemoglobin, wherein the second exogenous nucleic acid construct comprising a nucleotide sequence encoding leghemoglobin is operably linked to the first promoter element or to a second promoter element.
[0013] The implementation may have one or more of the following characteristics. The method can produce leghemoglobin at a titer exceeding at least 5% of the corresponding method lacking the first exogenous nucleic acid construct. The method can produce leghemoglobin at a titer exceeding at least 10% of the corresponding method lacking the first exogenous nucleic acid construct. The method can produce leghemoglobin at a titer exceeding at least 15% of the corresponding method lacking the first exogenous nucleic acid construct. The method can produce leghemoglobin at a titer exceeding at least 20% of the corresponding method lacking the first exogenous nucleic acid construct. The method can produce leghemoglobin at a titer exceeding at least 5% of the corresponding method lacking the first mutation and the second mutation. The method can produce leghemoglobin at a titer exceeding at least 10% of the corresponding method lacking the first mutation and the second mutation. The method can produce leghemoglobin at a titer exceeding at least 15% of the corresponding method lacking the first mutation and the second mutation. The method can produce leghemoglobin at a titer exceeding at least 20% of the corresponding method lacking the first mutation and the second mutation. The method can be carried out in the absence of the addition of methanol.
[0014] In another aspect of the present specification, a Pichia pastoris cell is provided that includes a first exogenous nucleic acid construct comprising a nucleotide sequence encoding a protein having at least 90% sequence identity to SEQ ID NO: 29, wherein the nucleic acid encodes a serine residue at a position corresponding to position 12 of SEQ ID NO: 29, the nucleic acid encodes a serine residue at a position corresponding to position 39 of SEQ ID NO: 29, and the nucleic acid is operably linked to a first promoter element.
[0015] The implementation may include one or more of the following features. The Pichia pastoris cells may contain a nucleotide sequence encoding a protein having at least 90% sequence identity to any of SEQ ID NOs: 1-27, and may further contain a second exogenous nucleic acid construct operably linked to a first promoter element or operably linked to a second promoter element. The Pichia pastoris cells may contain a nucleotide sequence encoding a protein having at least 90% sequence identity to SEQ ID NO: 4, and may further contain a second exogenous nucleic acid construct operably linked to a first promoter element or operably linked to a second promoter element.
[0016] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the practice of the present invention, methods and materials similar or equivalent to those described herein may be used, but suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
[0017] Details of one or more embodiments of the present disclosure are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the present disclosure will be apparent from the description, drawings, and claims. The phrase "comprising" in the claims may, in accordance with standard practice in patent law, be replaced by "consisting essentially of" or "consisting of".
Brief Description of the Drawings
[0018]
Figure 1
Figure 2
Figure 3
Figure 4-1
Figure 4-2
Figure 4-3
Figure 4-4
Figure 4-5
Figure 4-6
Figure 4-7
Figure 4-8
Figure 4-9
Figure 4-10
Figure 4-11
Figure 4-12
Figure 4-13
Figure 4-14
Figure 4-15
Figure 4-16
Figure 4-17
Figure 4-18
Figure 4-19
Figure 4-20
Figure 5
Figure 6-1
Figure 6-2
Figure 7-1
Figure 7-2
Figure 8-1
Figure 8-2
Figure 8-3
Mode for Carrying Out the Invention
[0019] This document relates to materials and methods for protein production. In particular, this document relates to materials and methods for the production of heme and heme-binding proteins.
[0020] Methanol-assimilating yeasts such as Pichia pastoris are generally used to produce recombinant proteins. Pichia strains are typically able to grow using methanol as the sole carbon source. The term "Pichia pastoris" is still used and may refer to any suitable Komagataella species, but it should be understood that Pichia pastoris has been reclassified as a Komagataella species such as Komagataella phaffii, Komagataella pastoris, or Komagataella pseudopastoris. Generally, laboratory strains of P. pastoris are Komagataella phaffii.
[0021] Proteins that bind to heme include, among others, cytochrome, catalase, myoglobin, and hemoglobin. Aminolevulinic acid synthase (ALAS) is an enzyme (EC 2.3.1.37) that catalyzes the first step in heme biosynthesis (see Figure 1 for a schematic of the heme b biosynthetic pathway), catalyzing the conversion of glycine and succinyl CoA to aminolevulinic acid. ALAS translocates to the mitochondria for this step of heme biosynthesis. Aminolevulinic acid is converted to heme b (Figure 2) by other enzymes (e.g., ALA dehydratase (ALAD), porphobilinogen deaminase (PBGD), uroporphyrinogen III synthase (UPG3S), uroporphyrinogen III decarboxylase (UPG3D), coproporphyrinogen oxidase (COPROX), protoporphyrinogen IX oxidase (PROTOX), and / or ferrochelatase (FC)). In some cases, the action of ALAS can be rate-limiting for the heme biosynthetic pathway. Other hemes (e.g., heme o, heme a, heme c) can be made via the action of enzymes on heme b. Hemin (Figure 3) is a complex of protoporphyrin IX (e.g., the protoporphyrin of heme b) with ferric (+3 oxidation state) iron and a chloride ligand.
[0022] As used herein, the "intermediate of the heme biosynthesis pathway" refers to one or more of delta-aminolevulinic acid (d-ALA), porphobilinogen, hydroxymethylbilane, uroporphyrinogen III, coproporphyrinogen III, protoporphyrinogen IX, or protoporphyrin IX. In some embodiments, the intermediate of the heme biosynthesis pathway can be selected from the group consisting of delta-aminolevulinic acid (d-ALA), porphobilinogen, hydroxymethylbilane, uroporphyrinogen III, coproporphyrinogen III, protoporphyrinogen IX, and protoporphyrin IX. In some embodiments, the intermediate of the heme biosynthesis pathway can be selected from the group consisting of porphobilinogen, hydroxymethylbilane, uroporphyrinogen III, coproporphyrinogen III, protoporphyrinogen IX, or protoporphyrin IX.
[0023] The translocation of some ALAS proteins to the mitochondria can be affected by one or more heme regulatory motifs (HRMs; sometimes also called heme-responsive motifs) contained within the ALAS protein. Many HRMs contain a C-P motif, and cysteine is often the ligand of the main axis for heme. In some embodiments, the HRM has the sequence of R / L / N / A / C / S / H / I / G / Q-C-P-L / V / I / F / C-L / M / P / V (SEQ ID NO: 32) (e.g., the HRM can have the sequence of A-C-P-F-V (SEQ ID NO: 33), H-C-P-V-V (SEQ ID NO: 34), I-C-P-F-M (SEQ ID NO: 35), or G-C-P-V-V (SEQ ID NO: 36); see, for example, FIG. 8). Some organisms have three HRMs in their ALAS sequences, while other organisms (e.g., methylotrophic yeasts such as Pichia pastoris) have two HRMs. Generally, HRMs can be called HRM1, HRM2, HRM3, etc., depending on where the HRM occurs within the protein sequence. For example, the HRM that occurs first within the protein sequence (read from the N-terminus to the C-terminus) will be called HRM1. Mutations of cysteine within the HRM (e.g., to serine or alanine) can increase the translocation of ALAS to the mitochondria (see, for example, Gonzalez-Dominguez, et al., Yeast. 2001 Jan 15;18(1):41-8. (PubMed ID (PMID) 11124700; Munakata et al., J Biochem. 2004 Aug;136(2):233-8. (PMID 15496594); Dailey et al, Biochem J. 2005 Mar 1;386(Pt 2):381-6. (PMID 15482256), each of which is incorporated herein by reference in its entirety). Without being bound by any particular theory, it is thought that heme binding to the HRM of wild-type ALAS inhibits the translocation of ALAS to the mitochondria in a negative feedback manner.The heme is also thought to be involved in the degradation of some ALAS proteins (see, for example, Kubota, et al., J Biol Chem. 2016 Sep 23;291(39):20516-29. doi: 10.1074 / jbc.M116.719161. Epub 2016 Aug 5. (PMID 27496948), which is incorporated herein by reference in its entirety).
[0024] The "first HRM" can be an HRM at any part of the protein sequence; it will be understood that the "first HRM" can be the first-occurring HRM (HRM1) within the protein sequence, but not necessarily so. In some embodiments, the first HRM is HRM1 and the second HRM is HRM2. In some embodiments, the first HRM is HRM1 and the second HRM is HRM3. In some embodiments, the first HRM is HRM2 and the second HRM is HRM1. In some embodiments, the first HRM is HRM2 and the second HRM is HRM3. In some embodiments, the first HRM is HRM3 and the second HRM is HRM1. In some embodiments, the first HRM is HRM3 and the second HRM is HRM2.
[0025] In some embodiments, the mutation in the nucleic acid can be an insertion, deletion, or substitution. In some embodiments, the mutation in the nucleic acid can be a substitution (e.g., a mutation from guanosine to cytosine). In some embodiments, the substitution in the coding sequence (e.g., encoding a protein) can be a silent mutation (e.g., the same amino acid is encoded). In some embodiments, the substitution in the coding sequence can be a non-synonymous mutation (e.g., a missense mutation or a nonsense mutation). In some embodiments, the substitution in the coding sequence can be a missense mutation (e.g., a different amino acid is encoded). In some embodiments, the substitution in the coding sequence can be a nonsense mutation (e.g., a premature stop codon is encoded). In some embodiments, the mutation in the nucleic acid can be a deletion. It will be understood that the mutations can be used to modify endogenous nucleic acids, for example, using CRISPR, TALEN, and / or zinc finger nucleases.
[0026] In some embodiments, the mutations in the protein sequence can be insertions, deletions, or substitutions. It will be understood that mutations in the nucleic acid encoding the protein can cause mutations in the protein sequence. In some embodiments, the mutations in the protein sequence are substitutions (e.g., a mutation from cysteine to serine, a mutation from cysteine to alanine, a mutation from cysteine to valine, a mutation from cysteine to leucine, a mutation from cysteine to isoleucine, a mutation from cysteine to glycine, a mutation from cysteine to phenylalanine, a mutation from cysteine to threonine, a mutation from cysteine to methionine, a mutation from cysteine to tryptophan, a mutation from cysteine to tyrosine, a mutation from cysteine to asparagine, a mutation from cysteine to glutamine, a mutation from cysteine to proline, a mutation from cysteine to arginine, a mutation from cysteine to histidine, a mutation from cysteine to lysine, a mutation from cysteine to aspartic acid, or a mutation from cysteine to glutamic acid). In some embodiments, the mutations in the protein sequence can be deletions.
[0027] In some embodiments, the ALAS proteins described herein can include mutations in at least one HRM; e.g., mutations in the first HRM, the second HRM, the third HRM, the fourth HRM, the fifth HRM, etc.
[0028] In some embodiments, the ALAS proteins described herein can include mutations within at least one HRM (e.g., within the first HRM). In some embodiments, the ALAS proteins described herein can include mutations within a single HRM (e.g., within the first HRM or the second HRM). In some embodiments, the ALAS proteins described herein can include mutations at the cysteine of at least one HRM (e.g., the first HRM). In some embodiments, the ALAS proteins described herein can include mutations at the cysteine of a single HRM (e.g., the first HRM or the second HRM).
[0029] In some embodiments, the ALAS proteins described herein can include mutations in at least two HRMs (e.g., a first HRM and a second HRM). In some embodiments, the ALAS proteins described herein can include mutations in each of two HRMs (e.g., a first HRM and a second HRM). In some embodiments, the mutation in the first HRM and the mutation in the second HRM can be the same (e.g., both are mutations from cysteine to serine or alanine). In some embodiments, the mutation in the first HRM and the mutation in the second HRM can be different (e.g., one is a mutation from cysteine to serine and one is a mutation from cysteine to alanine). In some embodiments, the ALAS proteins described herein can include mutations at cysteine in at least two HRMs (e.g., a first HRM and a second HRM). In some embodiments, the ALAS proteins described herein can include mutations at cysteine in each of two HRMs (e.g., a first HRM and a second HRM). In some embodiments, the mutation in the first HRM and the mutation in the second HRM can be the same (e.g., both are mutations from cysteine to serine or alanine). In some embodiments, the mutation in the first HRM and the mutation in the second HRM can be different (e.g., one is a mutation from cysteine to serine and one is a mutation from cysteine to alanine).
[0030] In some embodiments, the ALAS proteins described herein can include mutations in at least three HRMs (e.g., a first HRM, a second HRM, and a third HRM). In some embodiments, the ALAS proteins described herein can include mutations in each of three HRMs (e.g., a first HRM, a second HRM, and a third HRM). In some embodiments, the ALAS proteins described herein can include mutations in the cysteines of at least three HRMs (e.g., a first HRM, a second HRM, and a third HRM). In some embodiments, the ALAS proteins described herein can include mutations in the cysteine of each of three HRMs (e.g., a first HRM, a second HRM, and a third HRM). In some embodiments, the mutations in each of the first HRM, the second HRM, and the third HRM can be the same (e.g., all are mutations from cysteine to serine or alanine). In some embodiments, the mutations in one or two of the three HRMs can be different.
[0031] In some embodiments, the substitution (mutation to a different amino acid) can be a substitution of an amino acid (e.g., cysteine) within the HRM. In some embodiments, the mutation in the first HRM can be a substitution of an amino acid (e.g., cysteine) within the first HRM. In some embodiments, the mutation in the second HRM can be a substitution of an amino acid (e.g., cysteine) within the second HRM. In some embodiments, the mutation in the third HRM can be a substitution of an amino acid (e.g., cysteine) within the third HRM. The substitution can be any suitable substitution. In some embodiments, the different amino acid can be selected from the group consisting of arginine, histidine, lysine, serine, threonine, asparagine, glutamine, selenocysteine, glycine, proline, alanine, isoleucine, leucine, methionine, phenylalanine, tryptophan, tyrosine, and valine. In some embodiments, the different amino acid can be selected from the group consisting of arginine, histidine, lysine, serine, threonine, asparagine, glutamine, selenocysteine, glycine, proline, alanine, isoleucine, leucine, methionine, aspartic acid, glutamic acid, phenylalanine, tryptophan, tyrosine, and valine. In some embodiments, the different amino acid is selected from nonpolar aliphatic amino acids (e.g., glycine, proline, alanine, isoleucine, leucine, methionine, or valine), aromatic amino acids (e.g., phenylalanine, tryptophan, or tyrosine), polar uncharged amino acids (e.g., serine, threonine, asparagine, or glutamine), or positively charged amino acids (arginine, histidine, or lysine). In some embodiments, the different amino acid is serine. In some embodiments, the different amino acid is alanine. In some embodiments, the different amino acid is phenylalanine. In some embodiments, the different amino acid is aspartic acid. In some embodiments, the different amino acid is histidine.
[0032] Surprisingly, in each of the two HRMs, when an ALAS protein with a cysteine - to - serine mutation is co - expressed with an exogenous heme - binding protein, the titer of the exogenous heme - binding protein can increase significantly.
[0033] Generally, "titer" is a measurement of the amount of a substance in a solution. As used herein, the "titer" of a heme - binding protein, unless otherwise specified, refers to the total polypeptide amount, whether bound to heme or not. The titer of a protein can be measured by appropriate methods such as high - performance liquid chromatography (HPLC or UPLC), liquid chromatography - mass spectrometry (LC - MS), enzyme - linked immunosorbent assay (ELISA), enzyme activity measurement, iron measurement techniques such as atomic absorption spectrometry, LC - MS, or ultraviolet and / or visible light spectrometry.
[0034] Mutations within ALAS, such as the mutations described herein, can be used to increase heme production. In some embodiments, the titer of the heme - binding protein can increase. In some embodiments, the titer of leghemoglobin (LegH) can increase. The materials and methods of the present disclosure can be useful for increasing heme production.
[0035] The materials and methods described herein may have applications in many industries. For example, heme proteins can be used in foods. As another example, heme proteins (e.g., hemoglobin, cytochrome P450) can be made for research purposes (e.g., to study drug metabolism). Heme proteins can also be used in industry (e.g., for use in detergents for cleaning, pulp bleaching, lignin degradation, etc., for catalase, laccase, and / or peroxidase). Another potential application for heme proteins is biocatalysis (e.g., cytochrome P450, lipoxygenase, and / or laccase can be used in the production of pharmaceutical and consumer chemicals). Some heme proteins can be used as therapeutic agents (e.g., as part of nitric oxide synthase or a blood substitute). In some cases, heme proteins can be used for electronic engineering purposes (e.g., for the production of renewable electricity). As another example, heme therapy can be an option for treating patients with acute porphyria, a group of eight genetic diseases resulting from the inability to produce heme.
[0036] This specification provides nucleic acid constructs (also sometimes referred to as nucleic acid molecules) that enable the genetic engineering of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to generate mutant ALAS. In addition, this specification provides nucleic acid constructs that enable the genetic engineering of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins. In some embodiments, this specification provides nucleic acid constructs that enable the genetic engineering of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) to increase the expression of heme-binding proteins from an inducible promoter in the absence of an inducing molecule.
[0037] This specification provides nucleic acid constructs that enable genetic manipulation of cells. The cells can be any suitable cells. For example, the cells can be bacterial cells (e.g., Escherichia coli cells, Bacillus subtilis cells, or Lactococcus lactis cells), fungal cells, algal cells, plant cells, insect cells, or mammalian cells. In some embodiments, the cells can be fungal cells. In some embodiments, the cells can be filamentous fungal cells. In some embodiments, the cells can be Aspergillus cells or Trichoderma cells. In some embodiments, the cells can be yeast cells. Non-limiting examples of yeast cells include Pichia (e.g., Pichia methanolica, Pichia pastoris), Candida (e.g., Candida boidinii) cells, Hansenula (e.g., Hansenula polymorpha) cells, Torulopsis cells, and Saccharomyces (e.g., Saccharomyces cerevisiae) cells. In some embodiments, the cells can be methanol-assimilating yeast cells. Non-limiting examples of methanol-assimilating yeast cells include Pichia cells, Candida cells, Hansenula cells, and Torulopsis cells. In some embodiments, the cells can be Pichia cells or Saccharomyces cells. In some embodiments, the cells are eukaryotic cells. In some embodiments, the cells are fungal cells. In some embodiments, the cells are plant cells. In some embodiments, the cells are algal cells. In some embodiments, the cells are yeast cells. In some embodiments, the cells are Saccharomyces cerevisiae cells. In some embodiments, the cells are methanol-assimilating yeast cells.This specification exemplifies methods using Pichia species (e.g., P. pastoris), but other cells may also be used, such as other species of the genus Pichia, or species derived from any of the genera Candida, Hansenula, Pichia, and Torulopsis. Non-limiting examples of methanol-assimilating yeast species include Pichia methanolica, Pichia pastoris, Candida boidinii, and Hansenula polymorpha.
[0038] Accordingly, in one aspect, the present document provides materials and methods for expressing a protein. In some embodiments, the present document provides a cell (e.g., a fungal cell such as an Aspergillus cell, a Trichoderma cell, or a yeast cell (e.g., a methanol-assimilating yeast cell)) comprising a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein. In some embodiments, the first nucleic acid encodes an ALAS protein and is operably linked to a first promoter element. In some embodiments, the ALAS protein comprises at least one HRM (e.g., 1, 2, 3, or more HRMs). In some embodiments, the ALAS protein comprises at least two HRMs (e.g., 2, 3, or more HRMs). In some embodiments, the ALAS protein comprises at least three HRMs (e.g., 3 or more HRMs). In some embodiments, the ALAS protein comprises a mutation within a first HRM (also sometimes referred to as "the first mutation within the first HRM"). In some embodiments, the ALAS protein comprises a mutation within a second HRM (also sometimes referred to as "the second mutation within the second HRM"). In some embodiments, the ALAS protein comprises a mutation within the first HRM and a mutation within the second HRM. In some embodiments, the first HRM is HRM1. In some embodiments, the second HRM is HRM2. In some embodiments, the ALAS protein comprises a mutation within a third HRM (also sometimes referred to as "the third mutation within the third HRM"). In some embodiments, the ALAS protein comprises a mutation within the first HRM, a mutation within the second HRM, and a mutation within the third HRM.
[0039] In some embodiments, the mutation in the first HRM is a substitution. In some embodiments, the mutation in the first HRM is a cysteine substitution. In some embodiments, the mutation in the first HRM is a mutation from cysteine to serine. In some embodiments, the mutation in the first HRM is a mutation from cysteine to alanine. In some embodiments, the mutation in the first HRM is a mutation from cysteine to phenylalanine. In some embodiments, the mutation in the first HRM is a mutation from cysteine to aspartic acid. In some embodiments, the mutation in the first HRM is a mutation from cysteine to histidine.
[0040] In some embodiments, the mutation in the second HRM is a substitution. In some embodiments, the mutation in the second HRM is a cysteine substitution. In some embodiments, the mutation in the second HRM is a mutation from cysteine to serine. In some embodiments, the mutation in the second HRM is a mutation from cysteine to alanine. In some embodiments, the mutation in the second HRM is a mutation from cysteine to phenylalanine. In some embodiments, the mutation in the second HRM is a mutation from cysteine to aspartic acid. In some embodiments, the mutation in the second HRM is a mutation from cysteine to histidine.
[0041] In some embodiments, the mutation in the third HRM is a substitution. In some embodiments, the mutation in the third HRM is a cysteine substitution. In some embodiments, the mutation in the third HRM is a mutation from cysteine to serine. In some embodiments, the mutation in the third HRM is a mutation from cysteine to alanine. In some embodiments, the mutation in the third HRM is a mutation from cysteine to phenylalanine. In some embodiments, the mutation in the third HRM is a mutation from cysteine to aspartic acid. In some embodiments, the mutation in the third HRM is a mutation from cysteine to histidine.
[0042] In some embodiments, the mutation in the first HRM corresponds to the mutation at residue 12 in SEQ ID NO: 29. In some embodiments, the mutation in the second HRM corresponds to the mutation at residue 39 in SEQ ID NO: 29. In some embodiments, the mutation in the first HRM is a cysteine-to-serine mutation corresponding to the cysteine-to-serine mutation at residue 12 in SEQ ID NO: 29. In some embodiments, the mutation in the first HRM is a cysteine-to-alanine mutation corresponding to the cysteine-to-alanine mutation at residue 12 in SEQ ID NO: 29. In some embodiments, the mutation in the first HRM is a cysteine-to-phenylalanine mutation corresponding to the cysteine-to-phenylalanine mutation at residue 12 in SEQ ID NO: 29. In some embodiments, the mutation in the first HRM is a cysteine-to-histidine mutation corresponding to the cysteine-to-histidine mutation at residue 12 in SEQ ID NO: 29. In some embodiments, the mutation in the second HRM is a cysteine-to-serine mutation corresponding to the cysteine-to-serine mutation at residue 39 in SEQ ID NO: 29. In some embodiments, the mutation in the second HRM is a cysteine-to-alanine mutation corresponding to the cysteine-to-alanine mutation at residue 39 in SEQ ID NO: 29. In some embodiments, the mutation in the second HRM is a cysteine-to-phenylalanine mutation corresponding to the cysteine-to-phenylalanine mutation at residue 39 in SEQ ID NO: 29. In some embodiments, the mutation in the second HRM is a cysteine-to-histidine mutation corresponding to the cysteine-to-histidine mutation at residue 39 in SEQ ID NO: 29.
[0043] In some embodiments, the first nucleic acid comprises a mutation corresponding to a guanosine to cytosine mutation at nucleotide 35 of SEQ ID NO: 28. In some embodiments, the first nucleic acid comprises a mutation corresponding to a thymine to guanosine mutation at nucleotide 34 of SEQ ID NO: 28 and a guanosine to cytosine mutation at nucleotide 35 of SEQ ID NO: 28. In some embodiments, the first nucleic acid comprises a mutation corresponding to a guanosine to cytosine mutation at nucleotide 116 of SEQ ID NO: 28. In some embodiments, the first nucleic acid comprises a mutation corresponding to a thymine to guanosine mutation at nucleotide 115 of SEQ ID NO: 28 and a guanosine to cytosine mutation at nucleotide 116 of SEQ ID NO: 28. It will be appreciated that the cysteine to serine mutation can be achieved by mutations at nucleotides other than those specifically disclosed herein. It will be appreciated that the cysteine to alanine mutation can be achieved by mutations at nucleotides other than those specifically disclosed herein. In some embodiments, the first nucleic acid construct comprises SEQ ID NO: 30. In some embodiments, the ALAS protein has the sequence of SEQ ID NO: 31 (see, e.g., FIG. 7).
[0044] As used herein, "operably linked" means that a promoter, or other expression element(s), is arranged to direct or regulate the expression (e.g., in-frame) of a nucleic acid coding sequence with respect to the coding sequence.
[0045] "Corresponding" amino acid positions (or substitutions) within a protein sequence that is different from a reference protein sequence (e.g., within an ALAS protein sequence of a different organism as compared to a reference ALAS protein sequence such as SEQ ID NO: 29) can be identified by performing a sequence alignment between the protein sequences of interest. It will be understood that in some cases, gaps may be present in the protein alignment. Similarly, "corresponding" nucleic acid positions (or substitutions) within a nucleic acid sequence that is different from a reference nucleic acid sequence (e.g., an ALAS nucleic acid sequence of a different organism as compared to a reference ALAS nucleic acid sequence such as SEQ ID NO: 28) can be identified by performing a sequence alignment between the nucleic acid sequences of interest. It will be understood that in some cases, gaps may be present in the nucleic acid alignment. As used herein, a nucleotide position or amino acid position "compared to" a reference sequence can be the corresponding nucleotide position or amino acid position within the reference sequence.
[0046] In the methods described herein, the nucleic acid molecules used are typically DNA, although under appropriate circumstances, RNA molecules can also be used. As used herein, "exogenous" refers to, for example, any nucleic acid sequence that has been introduced into cells derived from the same or a different organism, or a nucleic acid produced synthetically (e.g., a codon-optimized nucleic acid sequence). For example, an exogenous nucleic acid can be a nucleic acid derived from one microorganism (e.g., one genus or species of methanol-utilizing yeast) that has been introduced into a different genus or species of methanol-utilizing yeast; an exogenous nucleic acid can also be, despite the presence of the corresponding native nucleic acid sequence, a nucleic acid derived from methanol-utilizing yeast that has been recombinantly introduced into methanol-utilizing yeast as an additional copy, and in some cases, a nucleic acid derived from methanol-utilizing yeast that has been recombinantly introduced into methanol-utilizing yeast and contains one or more mutations, insertions, or deletions compared to the sequence native to methanol-utilizing yeast. For example, P. pastoris contains an endogenous nucleic acid encoding ALAS; an additional copy of the ALAS nucleic acid of P. pastoris (e.g., recombinantly introduced into P. pastoris) is considered to be exogenous. Similarly, an "exogenous" protein is a protein encoded by an exogenous nucleic acid.
[0047] In some cases, the exogenous nucleic acid can be a heterologous nucleic acid. As used herein, a "heterologous" nucleic acid refers to any nucleic acid sequence that is not native to an organism (e.g., a heterologous nucleic acid can be a nucleic acid derived from one microorganism (e.g., one genus or species of methanol-utilizing yeast, whether codon-optimized or not) that has been introduced into a different genus or species of methanol-utilizing yeast). Similarly, a "heterologous" protein is a protein encoded by a heterologous nucleic acid.
[0048] A nucleic acid molecule is considered to be exogenous to a host organism if any part thereof (e.g., a promoter sequence or the sequence of the encoded protein) is exogenous to the host organism. A nucleic acid molecule is considered to be heterologous to a host organism if any part thereof (e.g., a promoter sequence or the sequence of the encoded protein) is heterologous to the host organism.
[0049] In some embodiments, the present document provides a cell (e.g., a fungal cell such as an Aspergillus cell, a Trichoderma cell, or a yeast cell (e.g., a methanol-assimilating yeast cell)) comprising a first nucleic acid construct and a second nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein as disclosed herein. In some embodiments, the second nucleic acid encodes a heme-binding protein and is operably linked to a first promoter element. In some embodiments, the second nucleic acid encodes a heme-binding protein and is operably linked to a second promoter element. In some embodiments, the heme-binding protein can be an exogenous heme-binding protein. In some embodiments, the heme-binding protein can be a heterologous heme-binding protein. In some embodiments, the heme-binding protein can be selected from the group consisting of globin (PF00042 in the Pfam database), cytochrome (e.g., cytochrome P450, cytochrome a, cytochrome b, cytochrome c), cytochrome c oxidase, ligninase, catalase, and peroxidase. In some embodiments, the globin can be selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin (e.g., beta-hemoglobin, alpha-hemoglobin), histoglobin, leghemoglobin, myoglobin, neuroglobin, non-symbiotic hemoglobin, protoglobin, and truncated hemoglobin (e.g., HbN, HbO, Glb3, cyanoglobin). In some embodiments, the heme-binding protein can be a non-symbiotic hemoglobin. In some embodiments, the heme-binding protein can be a leghemoglobin. In some embodiments, the heme-binding protein can be a soybean leghemoglobin (LegH). The reference amino acid sequence for LegH is presented as SEQ ID NO: 4 in FIG. 4. LegH is a protein that binds to heme, resulting in a characteristic absorption at 415 nm and a distinct red color.The LegH protein (also known as LGB2) is found naturally in the root nodules of soybeans (see, e.g., UniprotKB accession number: P02236). See also WO 2014 / 110539 and WO 2014 / 110532, each of which is incorporated herein by reference in its entirety. In some embodiments, the heme-binding protein can have an amino acid sequence that is at least 70% (e.g., at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to the amino acid sequence set forth in any of SEQ ID NOs: 1-27 (Figure 4). In some embodiments, the heme-binding protein can have the amino acid sequence set forth in any of SEQ ID NOs: 1-27. In some embodiments, the heme-binding protein uses heme as a cofactor. As used herein, a "cofactor" is a molecule or ion that is directly involved in the catalysis of an enzyme. In some embodiments, the heme-binding protein can be an enzyme or not. In some embodiments, the heme-binding protein can be part of the heme biosynthetic pathway or not. In some embodiments, the heme-binding protein can be ALAS or not. In some embodiments, the heme-binding protein can be ferrochelatase or not. In some embodiments, the heme-binding protein can be coproporphyrinogen oxidase or not. In some embodiments, the heme-binding protein can be ALAD, PBGD, UPG3S, UPG3D, COPROX, PROTOX, or FC or not. In some embodiments, the heme-binding protein has an amino acid sequence that is at least 70% (e.g., at least 75%, 80%, 85%, 90%, or 95%) identical to any of the amino acid sequences within SEQ ID NOs: 1-27. In some embodiments, the heme-binding protein is a heme-binding protein derived from bacteria, yeast, algae, fungi, or plants.
[0050] As used herein, the terms "bacteria-derived protein", "yeast-derived protein", "algae-derived protein", "fungus-derived protein", or "plant-derived protein" refer to the direct source of the protein, and can mean any protein produced in bacteria, yeast, algae, fungus, or plants, regardless of whether the protein is naturally expressed in each of bacteria, yeast, algae, fungus, or plants.
[0051] This specification provides a method for producing an ALAS protein. This specification also provides a method for producing an ALAS protein using any one of the cells described herein (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)). This specification also provides a method for producing an ALAS protein using any one of the nucleic acid constructs described herein. In some embodiments, this specification provides a method comprising the step of expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM. In some embodiments, the titer of the ALAS protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, or more) increased compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within the first HRM. In some embodiments, the titer of the ALAS protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, or more) increased compared to a corresponding method expressing a nucleic acid encoding an ALAS protein lacking a mutation within the first HRM. In some embodiments, this specification provides a method comprising the step of expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM and a mutation within a second HRM.In some embodiments, the titer of the ALAS protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, or more) greater compared to the corresponding method lacking the nucleic acid construct encoding the ALAS protein that includes the mutation in the first HRM and the mutation in the second HRM. In some embodiments, the titer of the ALAS protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, or more) greater compared to the corresponding method of expressing the nucleic acid encoding the ALAS protein that does not include the mutation in the first HRM and the mutation in the second HRM.
[0052] This specification provides a method for producing a tetrapyrrole or a derivative thereof. This specification also provides a method for producing a tetrapyrrole or a derivative thereof using any of the cells described herein (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)). This specification also provides a method for producing a tetrapyrrole or a derivative thereof using any of the nucleic acid constructs described herein. In some embodiments, this specification provides a method for producing a tetrapyrrole or a derivative thereof, the method comprising the step of expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM. In some embodiments, the titer of the tetrapyrrole or a derivative thereof can be increased by at least 5% (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more) compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM. In some embodiments, the titer of the tetrapyrrole or a derivative thereof can be increased by at least 5% (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more) compared to a corresponding method expressing a nucleic acid encoding an ALAS protein without a mutation within a first HRM. In some embodiments, this specification provides a method for producing a tetrapyrrole or a derivative thereof, the method comprising the step of expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM and a second mutation within a second HRM.In some embodiments, the titer of the tetrapyrrole or its derivative can be increased by at least 5% (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more) compared to the corresponding method lacking the nucleic acid construct comprising the nucleotide sequence encoding the ALAS protein comprising the mutation in the first HRM and the mutation in the second HRM. In some embodiments, the titer of the tetrapyrrole or its derivative can be increased by at least 5% (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more) compared to the corresponding method of expressing the nucleic acid encoding the ALAS protein without the mutation in the first HRM and the mutation in the second HRM. In some embodiments, the tetrapyrrole or its derivative is chlorin (e.g., chlorophyll) or its derivative. In some embodiments, the tetrapyrrole or its derivative is precorrin, coprecorrin, corrin (e.g., vitamin B12), or their derivatives. In some embodiments, the tetrapyrrole or its derivative is porphyrin or its derivative. In some embodiments, the tetrapyrrole or its derivative is heme or its derivative. In some embodiments, the tetrapyrrole or its derivative is heme B. In some embodiments, the tetrapyrrole or its derivative is a metabolite of heme (e.g., bilirubin or its derivative).
[0053] This specification provides methods for producing intermediates of the heme biosynthetic pathway, heme (e.g., heme B, heme o, heme a, heme c), choline (e.g., vitamin B12), chlorophyll, or derivatives thereof. This specification also provides methods for producing intermediates of the heme biosynthetic pathway, heme, choline, chlorophyll, or derivatives thereof using any of the cells described herein (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)). This specification also provides methods for producing intermediates of the heme biosynthetic pathway, heme, choline, chlorophyll, or derivatives thereof using any of the nucleic acid constructs described herein. In some embodiments, this specification provides a method for producing an intermediate of the heme biosynthetic pathway, heme, choline, chlorophyll, or a derivative thereof, the method comprising the step of expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM. In some embodiments, the titer of an intermediate of the heme biosynthetic pathway, heme, choline, chlorophyll, or a derivative thereof can be increased by at least 5% (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more) compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in the first HRM. In some embodiments, the titer of an intermediate of the heme biosynthetic pathway, heme, choline, chlorophyll, or a derivative thereof can be increased by at least 5% (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more) compared to a corresponding method expressing a nucleic acid encoding an ALAS protein lacking a mutation in the first HRM.In some embodiments, provided herein is a method for producing an intermediate of the heme biosynthetic pathway, heme, choline, chlorophyll, or a derivative thereof, the method comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM and a mutation in a second HRM. In some embodiments, the titer of the intermediate of the heme biosynthetic pathway, heme, choline, chlorophyll, or a derivative thereof is at least 5% (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more) greater compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation in a first HRM and a mutation in a second HRM. In some embodiments, the titer of the intermediate of the heme biosynthetic pathway, heme, choline, chlorophyll, or a derivative thereof is at least 5% (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more) greater compared to a corresponding method expressing a nucleic acid encoding an ALAS protein that does not comprise a mutation in a first HRM and a mutation in a second HRM. In some embodiments, the intermediate of the heme biosynthetic pathway, heme, or a derivative thereof is heme. In some embodiments, the intermediate of the heme biosynthetic pathway, heme, or a derivative thereof is heme B.
[0054] This specification provides a method for producing heme (e.g., heme B, heme o, heme a, heme c) or a derivative thereof. This specification also provides a method for producing heme or a derivative thereof using any of the cells described herein (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)). This specification also provides a method for producing heme or a derivative thereof using any of the nucleic acid constructs described herein. In some embodiments, this specification provides a method for producing heme or a derivative thereof, the method comprising the step of expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM. In some embodiments, the titer of heme or a derivative thereof can be increased by at least 5% (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more) compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM. In some embodiments, the titer of heme or a derivative thereof can be increased by at least 5% (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more) compared to a corresponding method expressing a nucleic acid encoding an ALAS protein lacking a mutation within a first HRM. In some embodiments, this specification provides a method for producing heme or a derivative thereof, the method comprising the step of expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM and a mutation within a second HRM.In some embodiments, the titer of heme or a derivative thereof can be increased by at least 5% (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more) compared to a corresponding method lacking a nucleic acid construct encoding an ALAS protein comprising a mutation in the first HRM and a mutation in the second HRM. In some embodiments, the titer of heme or a derivative thereof can be increased by at least 5% (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 150%, 160%, 180%, 200%, 220%, 240%, 250%, 280%, 300%, 320%, 340%, 350%, or more) compared to a corresponding method of expressing a nucleic acid encoding an ALAS protein that does not comprise a mutation in the first HRM and a mutation in the second HRM. In some embodiments, the heme or derivative thereof is heme B.
[0055] This specification provides a method for producing a heme-binding protein. This specification also provides a method for producing a heme-binding protein using any of the cells described herein (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)). This specification also provides a method for producing a heme-binding protein using any of the nucleic acid constructs described herein. In some embodiments, this specification provides a method comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM, and expressing a second nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein. In some embodiments, this specification provides a method comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM, and expressing a second nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein. In some embodiments, this specification provides a method comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM and a mutation within a second HRM, and expressing a second nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein. In some embodiments, this specification provides a method comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM and a mutation within a second HRM, and expressing a second nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein. In some embodiments of any of the methods described herein, the method enables an increase in the titer of the heme-binding protein.In some embodiments, the titer of the heme-binding protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more) greater compared to the corresponding method lacking the nucleic acid construct encoding the ALAS protein containing the mutation in the first HRM. In some embodiments, the titer of the heme-binding protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more) greater compared to the corresponding method of expressing a nucleic acid encoding an ALAS protein that does not contain the mutation in the first HRM. In some embodiments, the titer of the heme-binding protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more) greater compared to the corresponding method lacking the nucleic acid construct encoding the ALAS protein containing the mutations in the first HRM and the second HRM. In some embodiments, the titer of the heme-binding protein is at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more) greater compared to the corresponding method of expressing a nucleic acid encoding an ALAS protein that does not contain the mutations in the first HRM and the second HRM.
[0056] This specification provides methods for producing tetrapyrrole-binding proteins. This specification also provides methods for producing tetrapyrrole-binding proteins using any of the cells described herein (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)). This specification also provides methods for producing tetrapyrrole-binding proteins using any of the nucleic acid constructs described herein. In some embodiments, this specification provides a method comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM, and expressing a second nucleic acid construct comprising a nucleotide sequence encoding a tetrapyrrole-binding protein. In some embodiments, this specification provides a method comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM, and expressing a second nucleic acid construct comprising a nucleotide sequence encoding a tetrapyrrole-binding protein. In some embodiments, this specification provides a method comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM and a mutation within a second HRM, and expressing a second nucleic acid construct comprising a nucleotide sequence encoding a tetrapyrrole-binding protein. In some embodiments, this specification provides a method comprising expressing a first nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein comprising a mutation within a first HRM and a mutation within a second HRM, and expressing a second nucleic acid construct comprising a nucleotide sequence encoding a tetrapyrrole-binding protein. In some embodiments of any of the methods described herein, the method enables an increase in the titer of the tetrapyrrole-binding protein.In some embodiments, the titer of the tetrapyrrole-binding protein can be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more) compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein containing a mutation within the first HRM. In some embodiments, the titer of the tetrapyrrole-binding protein can be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more) compared to a corresponding method of expressing a nucleic acid encoding an ALAS protein without a mutation within the first HRM. In some embodiments, the titer of the tetrapyrrole-binding protein can be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more) compared to a corresponding method lacking a nucleic acid construct comprising a nucleotide sequence encoding an ALAS protein containing mutations within the first HRM and within the second HRM. In some embodiments, the titer of the tetrapyrrole-binding protein can be increased by at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 30%, 35%, 40%, 45%, 50%, or more) compared to a corresponding method of expressing a nucleic acid encoding an ALAS protein without mutations within the first HRM and within the second HRM. In some embodiments, the tetrapyrrole is chlorin (e.g., chlorophyll) or a derivative thereof.In some embodiments, the tetrapyrrole is precorrin, coprecorrin, cobalamin (e.g., vitamin B12), or a derivative thereof. In some embodiments, the tetrapyrrole is a porphyrin or a derivative thereof. In some embodiments, the tetrapyrrole is heme or a derivative thereof. In some embodiments, the tetrapyrrole is heme B. In some embodiments, the tetrapyrrole is a metabolite of heme (e.g., bilirubin or a derivative thereof).
[0057] As used herein, the "corresponding method" is a method that is essentially identical to the reference method in all respects except for the identified difference. For example, the corresponding method of expressing a nucleic acid encoding an ALAS protein that does not contain the mutations in the first HRM and the mutations in the second HRM would be the same in all aspects (e.g., the genetic composition of the cells, the temperature and number of times of culturing, etc.) except that the corresponding method expresses a nucleic acid encoding an ALAS protein that does not contain the mutations in the first HRM and the mutations in the second HRM.
[0058] Genetic manipulation of cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) typically involves the introduction of a recombinant nucleic acid molecule (also referred to as a nucleic acid construct) into the cell. As described herein, a recombinant nucleic acid molecule typically comprises an exogenous nucleic acid encoding a protein (e.g., a protein involved in the biosynthesis of heme, a heme-binding protein, or a transcription factor) operably linked to at least one promoter element (e.g., an inducible promoter element or a constitutive promoter element). In some embodiments, the recombinant nucleic acid molecule can comprise a linear arrangement of two or more protein-encoding sequences operably linked to the same promoter element or separate promoter elements (e.g., a first promoter operably linked to a first nucleic acid encoding a first protein and a second promoter operably linked to a second nucleic acid encoding a second protein, or a promoter operably linked to a first nucleic acid encoding a first protein and a second nucleic acid encoding a second protein). Optionally, a recombinant nucleic acid molecule comprising at least one promoter operably linked to a nucleotide sequence encoding a protein can be referred to as a cassette.
[0059] A recombinant nucleic acid can include an expression element. An expression element includes nucleic acid sequences that direct and regulate the expression of a nucleic acid coding sequence. One example of an expression element is a promoter sequence. An expression element can also include an intron, an enhancer sequence, a response element, or an induction element that regulates the expression of the nucleic acid. An expression element can be of bacterial, yeast, insect, mammalian, or viral origin, and a vector can contain a combination of elements from different origins.
[0060] Nucleic acids can be detected using any number of amplification techniques (see, e.g., PCR Primer: A Laboratory Manual, 1995, Dieffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; and U.S. Patent Nos. 4,683,195; 4,683,202; 4,800,159; and 4,965,188) with appropriate oligonucleotide (e.g., primer) pairs. Several modifications to the original PCR method have been developed and can be used to detect a selected nucleic acid.
[0061] The utilization of methanol is typically induced by the conversion of methanol to formaldehyde via the action of alcohol oxidase. Pichia pastoris contains two genes for alcohol oxidase, AOX1 and AOX2. Strains with reduced alcohol oxidase activity (''slow methanol utilization'' or MutS strains) can produce more recombinant protein expressed from the AOX1 promoter than strains with unreduced alcohol oxidase activity. Strains mutated in both AOX genes and lacking alcohol oxidase activity completely are unable to metabolize methanol but can still be induced by methanol for expression from the AOX1 promoter. These strains use other carbon sources for growth but retain the ability to express heterologous proteins from the AOX1 promoter upon addition of methanol. Since these strains do not metabolize methanol (''methanol utilization minus'' or Mut- strains), much less methanol is required for induction of protein expression, and strains carrying these mutations avoid problems associated with methanol feeding in large-scale fermentations. See, e.g., Chiruvolu et al., 1997, Enzyme Microb. Technol., 21:277-83.
[0062] Suitable transcription factors, and nucleic acids encoding transcription factors (e.g., exogenous nucleic acids encoding transcription factors) include, for example, Mxr1 derived from P. pastoris. A representative nucleic acid sequence of Mxr1 from K. pastoris can be found, for example, in GenBank accession number: DQ395124, while a representative protein sequence of Mxr1 from K. pastoris can be found, for example, in GenBank accession number: ABD57365. In some embodiments, the transcription factor is the Mit1 sequence derived from K. phaffii (see, for example, UniParc accession number: UPI0001A4D18B). Suitable transcription factors can also be found in Hansenula polymorpha (e.g., the Adr1 sequence; see, for example, GenBank accession number: AEOI02000005 for the nucleic acid sequence, bases: 858873 - 862352, and GenBank accession number: ESX01253 for the amino acid sequence), and Candida boidinii (e.g., the Trm1 sequence; see, for example, GenBank accession number: AB365355 for the nucleic acid sequence and GenBank accession number: BAF99700 for the amino acid sequence; and the Trm2 sequence; see, for example, GenBank accession number: AB548760 for the nucleic acid sequence and GenBank accession number: BAJ07608 for the amino acid sequence).
[0063] Transcription factors such as Mxr1 can usually be expressed at low levels. In some embodiments, it is desired to place an exogenous nucleic acid (e.g., a transcription factor) under the control of an inducible promoter.
[0064] The methanol-regulated transcription factors in Pichia can bind to the AOX1 promoter and act cooperatively with Mxr1 to activate transcription from the AOX1 promoter. In some embodiments, two methanol-regulated transcription factors (e.g., Mxr1 and Mit1) can be operably linked to a methanol-inducible promoter element.
[0065] There are several inducible promoters that can be used when genetically engineering cells (e.g., fungal cells such as Aspergillus or Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)). Suitable methanol-inducible promoters include pAOX1 (e.g., pAOX1 such as the promoter for AOX1 of K. pastoris (see, e.g., the promoter for GenBank accession number: U96967.1), or the promoter described in U.S. Patent Application No. 62 / 835,338, filed April 17, 2019, which is incorporated herein by reference in its entirety), other methanol-inducible promoters, or promoter elements derived therefrom.These include, without limitation, the pAOX2 promoter (e.g., the pAOX2 promoter derived from K. phaffii or K. pastoris (see, e.g., GenBank accession number: X79871.1)), for example, the alcohol oxidase (AOD1) promoter derived from Candida boidinii (see, e.g., GenBank accession number: E06147.1), the alcohol oxidase (MOX) promoter derived from Hansenula polymorpha (see, e.g., GenBank accession number: AJ313360.1), the MOD1 or MOD2 promoter derived from Pichia methanolica (see, e.g., Raymond et al., 1998, Yeast, 14:11-23; and Nakagawa et al., 1999, Yeast, 15:1223-30), the DHAS promoter derived from P. pastoris (see, e.g., the promoter for GenBank accession number: FJ752551) or a promoter element derived therefrom, the formaldehyde dehydrogenase (FLD1) promoter derived from K. pastoris (see, e.g., GenBank accession number: KJ755994.1), or the PEX8 promoter derived from P. pastoris (see, e.g., Kranthi et al., 2010, Yeast, 27:705-11). Typically, these promoters can be induced by methanol. Suitable constitutive promoters, and constitutive promoter elements, include, without limitation, the P. pastoris promoter (or portion thereof) derived from the gene for EF-1α (TEF1), a transcription elongation factor that is strongly constitutively transcribed.Without limitation, other suitable constitutive promoters (or promoter elements derived therefrom) can also be used, including the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter derived from K. pastoris (see, e.g., the promoter for GenBank accession number: U62648.1), the promoter derived from the potential glycosylphosphatidylinositol (GPI) anchor protein GCW14p (PAS_chr1-4_0586) derived from K. phaffii (see, e.g., the promoter for GenBank accession number: XM_002490678), and the promoter derived from the 3-phosphoglycerate kinase gene (PGK1) derived from K. pastoris (see, e.g., GenBank accession number: AY288296). It will be understood that the selection of the promoter can be influenced by the expression system. For example, for expression in K. phaffii, a K. phaffii promoter can be selected, while for expression in C. boidinii, a C. boidinii promoter can be selected. However, in some cases, a promoter derived from one organism (e.g., K. phaffii) may be suitable for use in another organism (e.g., C. boidinii, or K. pastoris). Furthermore, it is noted that inducible (e.g., methanol-inducible) promoters and constitutive promoters (or promoter elements derived therefrom) can be combined to further increase the expression of any of the nucleic acids operably linked thereto.
[0066] Any of the proteins encoded as described herein may be operably linked to an inducible promoter element (e.g., a methanol inducible promoter element) or a constitutive promoter element. Inducible promoters and elements derived therefrom are discussed above. Constitutive promoters, and constitutive promoter elements, are known in the art. For example, a commonly used constitutive promoter derived from P. pastoris is a promoter or a portion thereof derived from the gene for EF-1α (TEF1), a transcription elongation factor that is strongly and constitutively transcribed. However, without limitation, other constitutive promoters, or promoter elements derived therefrom, may be used, including, but not limited to, the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter derived from K. pastoris (see, e.g., the promoter for GenBank accession number: U62648.1), the promoter derived from GCW14p (PAS_chr1-4_0586), a potential glycosylphosphatidylinositol (GPI) anchor protein derived from K. phaffii (see, e.g., the promoter for GenBank accession number: XM_002490678), or the promoter derived from the 3-phosphoglycerate kinase gene (PGK1) derived from K. pastoris (see, e.g., the promoter for GenBank accession number: AY288296).
[0067] In some embodiments, any of the cells herein (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) may further comprise a third nucleic acid construct comprising a nucleotide sequence encoding a third protein operably linked to a first promoter element, a second promoter element, or a third promoter element. In some embodiments, any of the cells herein (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) may further comprise a fourth nucleic acid construct comprising a nucleotide sequence encoding a fourth protein operably linked to a first promoter element, a second promoter element, a third promoter element, or a fourth promoter element. In some embodiments, the third protein may be a transcription factor. In some embodiments, the fourth protein may be a transcription factor. In some embodiments, any of the promoter elements herein (e.g., the first promoter element, the second promoter element, the third promoter element, or the fourth promoter element) may contain one or more recognition sequences for a transcription factor. Thus, in some embodiments, a feedback loop may be constructed such that a transcription factor drives the expression of one or more of ALAS and a heme-binding protein in addition to the expression of a further copy of the transcription factor. In some embodiments, the transcription factor may be Mxr1 (see, e.g., U.S. Patent No. 9,938,327, which is incorporated by reference in its entirety). In some embodiments, the third protein may be a protein involved in heme biosynthesis. In some embodiments, the fourth protein may be a protein involved in heme biosynthesis.In some embodiments, the protein involved in heme biosynthesis can be selected from the group consisting of δ-aminolevulinic acid dehydratase (ALAD), porphobilinogen deaminase (PBGD), uroporphyrinogen III synthase (UPG3S), uroporphyrinogen III decarboxylase (UPG3D), coproporphyrinogen oxidase (COPROX), protoporphyrinogen IX oxidase (PROTOX), and / or ferrochelatase (FC). In some embodiments, the protein involved in heme biosynthesis can be selected from the group consisting of δ-aminolevulinic acid dehydratase (ALAD), porphobilinogen deaminase (PBGD), uroporphyrinogen III synthase (UPG3S), uroporphyrinogen III decarboxylase (UPG3D), coproporphyrinogen oxidase (COPROX), and / or protoporphyrinogen IX oxidase (PROTOX).
[0068] Previous studies in Saccharomyces cerevisiae have identified ALA dehydratase and porphobilinogen deaminase as rate-limiting enzymes in heme biosynthesis (see, e.g., Hoffman et al., 2003, Biochem. Biophys. Res. Commun., 310(4):1247-53). However, heterologous expression of individual heme enzymes from the glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter in P. pastoris has failed to overcome the limitations associated with the expression of heme-containing recombinant proteins (see Krainer et al., 2015, Microb. Cell Fact., 13;14:4). While it is understood that one or more of the genes involved in the heme biosynthetic pathway can be expressed from one or more constitutive promoters (see, e.g., U.S. Patent No. 9,938,327, which is incorporated by reference in its entirety), expression of recombinant heme-containing proteins in P. pastoris can be achieved by co-expressing one or more enzymes of the heme biosynthetic pathway from a methanol-inducible promoter.
[0069] In addition, the first nucleic acid encoding a first protein (e.g., an ALAS protein) operably linked to the promoter element described herein can be physically separated from the second nucleic acid encoding a second protein (e.g., a heme-binding protein) operably linked to the promoter element (i.e., the first nucleic acid and the second nucleic acid can be completely separate molecules). Alternatively, the first nucleic acid encoding a first protein operably linked to the promoter element and the second nucleic acid encoding a second protein operably linked to the promoter element can be incorporated into the same nucleic acid construct. In some embodiments, the first nucleic acid encoding a first protein operably linked to the promoter element can be contiguous with the second nucleic acid encoding a second protein operably linked to the promoter element. Those skilled in the art will appreciate that when the second nucleic acid molecule encoding the second protein is contiguous with the first nucleic acid encoding the protein of interest, a single promoter, or a promoter element derived therefrom, can be used to drive the transcription of both or all of the genes (e.g., the nucleic acids encoding the first protein as well as the second protein).
[0070] In the art, methods for introducing nucleic acids into cells (e.g., fungal cells such as Aspergillus or Trichoderma cells, or yeast cells such as methanol-assimilating yeast cells) are known and include, without limitation, transduction, electroporation, biolistic particle delivery, and chemical transformation.
[0071] In addition, in the art, methods for culturing cells (e.g., fungal cells such as Aspergillus or Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)) are also known. See, for example, Pichia Protocols, Methods In Molecular Biology, 389, Cregg, Ed., 2007, 2nd Ed., Humana Press, Inc. In some situations, as supported herein, methanol is not required to obtain efficient expression at high levels of one or more proteins of interest, but it may be desirable to introduce or add methanol to the culture medium. In some situations (e.g., when one or more nucleic acids encoding an enzyme(s) involved in heme biosynthesis are expressed), it may be desirable to supplement the culture medium with iron or a pharmaceutically or metabolically acceptable salt thereof (or GRAS salt).
[0072] The recombinant nucleic acid molecules described herein may be stably integrated into the genome of a cell (e.g., a fungal cell such as an Aspergillus cell, a Trichoderma cell, or a yeast cell (e.g., a methanol-assimilating yeast cell)) or may be expressed from a replication-competent plasmid extrachromosomally. In the art, methods for achieving either are known and used.
[0073] The methods provided herein may also include the step of purifying the expressed protein. As used herein, an "enriched" protein is, by dry weight, at least 5% (e.g., at least 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or more) of the mass of the producing cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)), or by dry weight, at least 10% (e.g., at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, 95%, or 99%) of the mass of the producing cell lysate (e.g., excluding cell wall material or cell membrane material). As used herein, a "purified" protein is, in nature, a protein that has been separated or purified from the cellular components associated therewith. Typically, a protein is considered to be "purified" if, by dry weight, it contains less than at least 60% (e.g., less than at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%) of the proteins and naturally occurring molecules with which it is naturally associated.
[0074] As used herein, nucleic acids may include DNA and RNA and may include nucleic acids containing one or more nucleotide analogs or backbone modifications. Nucleic acids may be single-stranded or double-stranded, which typically depends on their intended use. Also provided are nucleic acids and polypeptides that differ from a given sequence. Nucleic acids and polypeptides may have at least 50% sequence identity (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to a given nucleic acid sequence or polypeptide sequence.
[0075] In the calculation of the percent sequence identity, two sequences are aligned and the number of identical matches of nucleotides or amino acid residues between the two sequences is determined. The number of identical matches is divided by the length of the aligned region (i.e., the number of nucleotides or amino acid residues being aligned) and multiplied by 100 to arrive at the percent sequence identity value. It will be appreciated that the length of the aligned region can be the length of a portion of one or both sequences to the full length size of the shortest sequence. Also, a single sequence may be aligned with more than one other sequence and thus it will be appreciated that different percent sequence identity values may be obtained over each aligned region.
[0076] The alignment of two or more sequences to determine percent sequence identity can be performed using the computer program ClustalW, which allows the alignment of nucleic acid or polypeptide sequences over their entire lengths (global alignment), and using default parameters (Chenna et al., 2003, Nucleic Acids Res., 31(13):3497-500). ClustalW calculates the best match between a query sequence and one or more target sequences and aligns them so that identities, similarities, and differences can be determined. Gaps of one or more residues can be inserted into the query sequence, target sequence, or both to maximize sequence alignment. For rapid, pairwise alignment of nucleic acid sequences, default parameters (i.e., word size: 2; window size: 4; scoring method: percentage; number of top diagonals: 4; and gap penalty: 5) may be used; for multiple alignments of nucleic acid sequences, the following parameters: gap opening penalty: 10.0; gap extension penalty: 5.0; and weight transitions: yes may be used. For rapid, pairwise alignment of polypeptide sequences, the following parameters: word size: 1; window size: 5; scoring method: percentage; number of top diagonals: 5; and gap penalty: 3 may be used. For multiple alignments of polypeptide sequences, the following parameters: weight matrix: blosum; gap opening penalty: 10.0; gap extension penalty: 0.05; hydrophilic gaps: on; hydrophilic residues: Gly, Pro, Ser, Asn, Asp, Gln, Glu, Arg, and Lys; and residue-specific gap penalties: on may be used. ClustalW can be run, for example, on the Baylor College of Medicine Search Launcher website, or the European Bioinformatics Institute website, on the Internet.
[0077] Changes may be introduced into the nucleic acid molecule, resulting in changes in the amino acid sequence of the encoded polypeptide. For example, the changes may be introduced into the nucleic acid coding sequence using mutagenesis (e.g., site-directed mutagenesis, PCR-mediated mutagenesis, transposon mutagenesis, chemical mutagenesis, UV mutagenesis, or radiation-induced mutagenesis), or may be introduced into the nucleic acid coding sequence by chemically synthesizing a nucleic acid molecule having such changes. Such nucleic acid changes can result in conservative amino acid substitutions and / or non-conservative amino acid substitutions at one or more amino acid residues. A "conservative amino acid substitution" is a substitution in which one amino acid residue is replaced with a different amino acid residue having a similar side chain (see, e.g., Dayhoff et al., 1978, Atlas of Protein Sequence and Structure, 5(Suppl. 3):345-352, which presents a frequency table for amino acid substitutions), and a non-conservative substitution is a substitution in which an amino acid residue is replaced with an amino acid residue having a non-similar side chain. The nucleic acid sequence and / or polypeptide sequence can be modified as described herein to improve one or more properties, including, without limitation, increased expression (e.g., transcription and / or translation), tighter regulation, deregulation, loss of catabolite repression, specificity, secretion, thermal stability, solvent stability, oxidative stability, protease resistance, catalytic activity, and / or modification of color.
[0078] As used herein, an "isolated" nucleic acid molecule is a nucleic acid molecule that, in nature, does not contain sequences flanking one or both ends of the nucleic acid from which the isolated nucleic acid molecule is derived within the genome of the organism (e.g., cDNA, or a genomic DNA fragment made by PCR or restriction endonuclease digestion). Such isolated nucleic acid molecules are generally introduced into a vector (e.g., a cloning vector or an expression vector) for ease of manipulation or to create a fusion nucleic acid molecule, as discussed in more detail below. In addition, an isolated nucleic acid molecule can include a manipulated nucleic acid molecule, such as a recombinant nucleic acid molecule or a synthetic nucleic acid molecule.
[0079] The vectors described in this specification can be introduced into host cells (e.g., fungal cells such as Aspergillus cells, Trichoderma cells, or yeast cells (e.g., methanol-assimilating yeast cells)). As used herein, "host cell" refers to a specific cell into which a nucleic acid is introduced, and also includes progeny cells of such a cell that carry the vector. The host cell can be any prokaryotic or eukaryotic cell. For example, the nucleic acid may be expressed in bacterial cells such as Escherichia coli (E. coli), or may be expressed in insect cells, yeast cells, or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those skilled in the art. Those skilled in the art are well aware of many methods, both in vivo and in vitro, for introducing nucleic acids into host cells, including, without limitation, electroporation, calcium phosphate precipitation, polyethylene glycol (PEG) transformation, heat shock, lipofection, microinjection, and virus-mediated nucleic acid introduction.
[0080] Nucleic acids can be isolated using techniques defined in the art. For example, nucleic acids can be isolated using any method including, without limitation, recombinant nucleic acid techniques and / or polymerase chain reaction (PCR). General PCR techniques are described, for example, in PCR Primer: A Laboratory Manual, Dieffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, 1995. Recombinant nucleic acid techniques include, for example, restriction enzyme digestion and ligation, which can be used to isolate nucleic acids. Isolated nucleic acids may also be chemically synthesized as a single nucleic acid molecule or a series of oligonucleotides.
[0081] Polypeptides can be purified from natural sources (e.g., biological samples) by known methods such as DEAE ion exchange, gel filtration, and hydroxyapatite chromatography. Polypeptides can also be purified, for example, by expressing nucleic acids in an expression vector. In addition, purified polypeptides can be obtained by chemical synthesis. The purity of the polypeptide can be measured using any suitable method, such as column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.
[0082] Constructs or vectors containing nucleic acids (e.g., nucleic acids encoding polypeptides) are also provided. Constructs or vectors containing expression constructs or expression vectors are commercially available or can be made by recombinant DNA techniques as defined in the art. Constructs or vectors containing nucleic acids can have expression elements operably linked to such nucleic acids and can further contain sequences such as sequences encoding selectable markers (e.g., antibiotic resistance genes). Constructs or vectors containing nucleic acids can encode chimeric polypeptides or fusion polypeptides (i.e., polypeptides operably linked to a heterologous polypeptide, which can be at the N-terminus or C-terminus of the polypeptide). Representative heterologous polypeptides include heterologous polypeptides (e.g., 6×His tag, glutathione S-transferase (GST)) that can be used in the purification of the encoded polypeptide.
[0083] Nucleic acids can also be detected using hybridization. Hybridization between nucleic acids is discussed in detail in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Sections 7.37-7.57, 9.47-9.57, 11.7-11.8, and 11.45-11.57). Sambrook et al. disclose Southern blot conditions suitable for oligonucleotide probes less than about 100 nucleotides in length (Sections 11.45-11.46). The Tm between a sequence less than 100 nucleotides in length and a second sequence can be calculated using the formula presented in Section 11.46. In addition, Sambrook et al. disclose Southern blot conditions suitable for oligonucleotide probes greater than about 100 nucleotides in length (see Sections 9.47-9.54). The Tm between a sequence greater than 100 nucleotides in length and a second sequence can be calculated using the formula presented in Sections 9.50-9.51 of Sambrook et al.
[0084] The conditions under which a membrane containing nucleic acid is prehybridized, hybridized, and washed to remove excess and nonspecifically bound probe, in addition to the conditions for hybridization, can play a significant role in the stringency of hybridization. Such hybridization and washing can be carried out under moderately stringent or highly stringent conditions, where appropriate. For example, the washing conditions can be made more stringent by decreasing the salt concentration in the wash solution and / or by increasing the temperature at which the washing is carried out. By way of example only, highly stringent conditions typically include washing of the membrane in 0.2X SSC at 65°C.
[0085] In addition, the interpretation of the hybridization amount can be affected by, for example, the specific activity of the labeled oligonucleotide probe, the number of probe-binding sites on the template nucleic acid to which the probe hybridizes, and the exposure amount of the autoradiograph or other detection medium. Those skilled in the art can use any number of hybridization conditions and washing conditions to examine the hybridization of the probe nucleic acid molecule to the immobilized target nucleic acid, but it will be readily appreciated that it is important to examine the hybridization of the probe to the target nucleic acid under the same hybridization conditions, washing conditions, and exposure conditions. Preferably, the target nucleic acids are on the same membrane.
[0086] When hybridization to one nucleic acid is at least 5-fold (e.g., at least 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 50-fold, or 100-fold) that of hybridization to another nucleic acid, the nucleic acid molecule is considered to hybridize to one nucleic acid but not to the other nucleic acid. The amount of hybridization may be directly quantified on the membrane or, for example, may be quantified by autoradiograph using a PhosphorImager or Densitometer (Molecular Dynamics, Sunnyvale, CA).
[0087] Polypeptides can be detected using antibodies. Techniques for detecting polypeptides using antibodies include enzyme immunoassay (ELISA), Western blot, immunoprecipitation, and immunofluorescence. The antibodies can be polyclonal antibodies or monoclonal antibodies. Antibodies having specific binding affinity for a polypeptide can be produced using methods well known in the art. Antibodies can be conjugated to solid supports such as microtiter plates using methods known in the art. In the presence of the polypeptide, an antibody-polypeptide complex is formed.
[0088] Detection (e.g., detection of an amplification product, a hybridization complex, or a polypeptide) is typically achieved using a detectable label. The term "label" is intended to encompass the use of both direct and indirect labels. Detectable labels include enzymes, cofactors, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials.
[0089] Described herein are methods that can be used to generate strains lacking sequences for selection (i.e., lacking a selectable marker). These methods include the use of circular plasmid DNA vectors and linear DNA sequences; the circular plasmid DNA vectors contain a selectable marker and an origin of DNA replication (also known as an autonomous replication sequence (ARS)), and the linear DNA sequences contain sequences for integration into the genome (e.g., the Pichia genome) by homologous recombination. In addition, without limitation, the linear DNA molecule can contain nucleic acid sequences encoding one or more proteins of interest, such as ALAS, a heme-binding protein, or a third protein (e.g., a transcription factor or a protein involved in heme biosynthesis).
[0090] Cells (e.g., Pichia cells) are transformed with both DNA molecules, and transformants can be selected by the presence of the selectable marker on the circular plasmid. The transformants can then be screened, for example, using PCR, for integration of the linear DNA molecule into the genome. Once a transformant in which the marker-free linear DNA molecule has been properly integrated is identified, the cells can be grown in the absence of selection for the circular plasmid. In the absence of selection, plasmids carrying the marker are not stably maintained and are often lost very rapidly after selection is relaxed. The resulting strain carries the integrated linear DNA in the absence of heterologous sequences for selection. Thus, this technique can be used to construct strains (e.g., Pichia strains) lacking a selectable marker (e.g., a heterologous selectable marker) with little to no effect on recombinant protein yield.
[0091] In accordance with the present disclosure, conventional molecular biology methods, microbiological methods, biochemical methods, and recombinant DNA techniques within the scope of the art can be employed. Such techniques are well described in the literature. In the following examples, the materials and methods of the present disclosure are further illustrated, which do not limit the scope of the methods and compositions described in the claims.
[0092] In the following examples, the materials and methods of the present disclosure are further described, which do not limit the scope of the claims.
[0093] Exemplary Embodiments Embodiment 1. A first exogenous nucleic acid construct comprising a nucleotide sequence encoding an aminolevulinic acid synthase (ALAS) protein operably linked to a first promoter element, wherein ALAS comprises at least a first heme-responsive motif (HRM), and ALAS comprises a mutation within the first HRM; and A second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein A cell comprising A cell in which the second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein is operably linked to the first promoter element or is operably linked to a second promoter element. Embodiment 2. The cell according to Embodiment 1, which is a fungal cell. Embodiment 3. The cell according to Embodiment 2, which is an Aspergillus cell or a Trichoderma cell. Embodiment 4. The cell according to any one of Embodiments 1 to 3, which is a yeast cell. Embodiment 5. The cell according to Embodiment 4, wherein the yeast cell is a methanol-assimilating yeast cell. Embodiment 6. The cell according to Embodiment 5, wherein the methanol-assimilating yeast cell is a cell of the genus Pichia, Candida, Hansenula, or Torulopsis. Embodiment 7. The cell according to any one of Embodiments 5 to 6, wherein the methanol-assimilating yeast cell is a cell of Pichia methanolica, Pichia pastoris, Candida boidinii, or Hansenula polymorpha. Embodiment 8. The cell according to any one of Embodiments 5 to 7, wherein the methanol-assimilating yeast cell is a cell of Pichia pastoris. Embodiment 9. The cell according to any one of Embodiments 1 to 8, wherein the mutation in the first HRM is a mutation from cysteine to a different amino acid. Embodiment 10. The cell according to any one of Embodiments 1 to 9, wherein the ALAS protein contains a second HRM and the ALAS protein contains a mutation in the second HRM. Embodiment 11. The cell according to Embodiment 10, wherein the mutation in the second HRM is a mutation from cysteine to a different amino acid. Embodiment 12. The cell according to Embodiment 10 or Embodiment 11, wherein the different amino acid is the same for the mutation in the first HRM and the mutation in the second HRM. Embodiment 13. The cell according to Embodiment 10 or Embodiment 11, wherein the different amino acid is not the same for the mutation in the first HRM and the mutation in the second HRM. Embodiment 14. The cell according to any one of Embodiments 10 to 13, wherein the ALAS protein contains a third HRM and the ALAS protein contains a mutation in the third HRM. Embodiment 15. The cell according to Embodiment 14, wherein the mutation in the third HRM is a mutation from cysteine to a different amino acid. Embodiment 16. The cell according to embodiment 15, wherein different amino acids are the same for the mutation in the first HRM, the mutation in the second HRM, and the mutation in the third HRM. Embodiment 17. The cell according to any one of embodiments 9 to 16, wherein different amino acids are selected from the group consisting of arginine, histidine, lysine, serine, threonine, asparagine, glutamine, selenocysteine, glycine, proline, alanine, isoleucine, leucine, methionine, glutamic acid, aspartic acid, phenylalanine, tryptophan, tyrosine, and valine. Embodiment 18. The cell according to any one of embodiments 9 to 16, wherein different amino acids are selected from nonpolar aliphatic amino acids, aromatic amino acids, polar uncharged amino acids, or positively charged amino acids. Embodiment 19. The cell according to embodiment 18, wherein the nonpolar aliphatic amino acid is selected from the group consisting of glycine, proline, alanine, isoleucine, leucine, methionine, and valine. Embodiment 20. The cell according to embodiment 18, wherein the aromatic amino acid is selected from the group consisting of phenylalanine, tryptophan, and tyrosine. Embodiment 21. The cell according to embodiment 18, wherein the polar uncharged amino acid is selected from the group consisting of serine, threonine, asparagine, or glutamine which are polar uncharged amino acids. Embodiment 22. The cell according to embodiment 18, wherein the positively charged amino acid is selected from the group consisting of arginine, histidine, and lysine. Embodiment 23. The cell according to any one of embodiments 9 to 22, wherein different amino acids are serine. Embodiment 24. The cell according to any one of embodiments 9 to 22, wherein different amino acids are alanine. Embodiment 25. The cell according to any one of embodiments 9 to 22, wherein different amino acids are phenylalanine. Embodiment 26. The cell according to any one of embodiments 9 to 22, wherein different amino acids are histidine. Cell according to any one of Embodiments 1 to 26, wherein the first HRM is HRM1. Cell according to any one of Embodiments 10 to 27, wherein the second HRM is HRM2. Cell according to any one of Embodiments 1 to 26, wherein the first HRM is HRM2. Cell according to any one of Embodiments 10 to 27, wherein the second HRM is HRM1. Cell according to any one of Embodiments 1 to 30, wherein the first exogenous nucleic acid construct comprises a nucleic acid sequence having at least 90% sequence identity to the nucleic acid sequence within SEQ ID NO: 28. Cell according to any one of Embodiments 1 to 30, wherein the first exogenous nucleic acid construct comprises a nucleic acid sequence having at least 95% sequence identity to the nucleic acid sequence within SEQ ID NO: 28. Cell according to any one of Embodiments 1 to 30, wherein the first exogenous nucleic acid construct comprises the nucleic acid sequence within SEQ ID NO: 30. Cell according to any one of Embodiments 1 to 32, wherein the ALAS protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence within SEQ ID NO: 29. Cell according to any one of Embodiments 1 to 32, wherein the ALAS protein comprises an amino acid sequence having at least 95% sequence identity to the amino acid sequence within SEQ ID NO: 29. Cell according to any one of Embodiments 1 to 35, wherein the ALAS protein comprises the amino acid sequence within SEQ ID NO: 31. Cell according to any one of Embodiments 1 to 36, wherein the heme-binding protein is selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase. Embodiment 38. The cell according to any one of Embodiments 1 to 36, wherein the heme-binding protein is selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, nonsymbiotic hemoglobin, protoglobin, and truncated hemoglobin. Embodiment 39. The cell according to any one of Embodiments 1 to 36, wherein the heme-binding protein is nonsymbiotic hemoglobin. Embodiment 40. The cell according to any one of Embodiments 1 to 36, wherein the heme-binding protein is leghemoglobin. Embodiment 41. The cell according to any one of Embodiments 1 to 40, wherein the heme-binding protein comprises an amino acid sequence having at least 90% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 1 to 27. Embodiment 42. The cell according to any one of Embodiments 1 to 41, further comprising a third nucleic acid construct comprising a nucleotide sequence encoding a transcription factor, wherein the third nucleic acid construct is operably linked to a first promoter element, a second promoter element, or a third promoter element. Embodiment 43. The cell according to Embodiment 42, wherein the first promoter element comprises a recognition sequence for the transcription factor. Embodiment 44. The cell according to Embodiment 42 or 43, wherein the second exogenous nucleic acid construct is operably linked to a second promoter element, and the second promoter element comprises a recognition sequence for the transcription factor. Embodiment 45. The cell according to Embodiment 42 or 43, wherein the third nucleic acid construct is operably linked to a third promoter element, and the third promoter element comprises a recognition sequence for the transcription factor. Embodiment 46. A cell according to any one of Embodiments 1 to 45, further comprising a fourth nucleic acid construct comprising a nucleotide sequence encoding a protein involved in heme biosynthesis, wherein the fourth nucleic acid construct is operably linked to a first promoter element, a second promoter element, a third promoter element, or a fourth promoter element. Embodiment 47. The cell according to Embodiment 46, wherein the protein involved in heme biosynthesis is selected from the group consisting of ALA dehydratase, porphobilinogen deaminase, UPG III synthase, UPG III decarboxylase, CPG oxidase, PPG oxidase, and ferrochelatase. Embodiment 48. The cell according to any one of Embodiments 1 to 47, wherein the first exogenous nucleic acid construct is a heterologous nucleic acid construct. Embodiment 49. The cell according to any one of Embodiments 1 to 48, wherein the second exogenous nucleic acid construct is a heterologous nucleic acid construct. Embodiment 50. The cell according to any one of Embodiments 1 to 47, wherein the heme-binding protein is an exogenous heme-binding protein. Embodiment 51. The cell according to any one of Embodiments 1 to 47 or 50, wherein the heme-binding protein is a heterologous heme-binding protein. Embodiment 52. A method for producing a heme-binding protein in a cell, comprising: expressing a first exogenous nucleic acid construct comprising a nucleotide sequence encoding an aminolevulinate synthase (ALAS) protein operably linked to a first promoter element, wherein ALAS comprises at least a first heme-reactive motif (HRM) and ALAS comprises a mutation within the first HRM; and expressing a second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein wherein the second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein is operably linked to the first promoter element or operably linked to a second promoter element. Embodiment 53. The method according to Embodiment 52 for producing a heme-binding protein with a titer exceeding at least 5% using a corresponding method lacking the first exogenous nucleic acid construct. Embodiment 54. The method according to Embodiment 52 or 53 for producing a heme-binding protein with a titer exceeding at least 10% using a corresponding method lacking the first exogenous nucleic acid construct. Embodiment 55. The method according to Embodiment 52 or 53 for producing a heme-binding protein with a titer exceeding at least 15% using a corresponding method lacking the first exogenous nucleic acid construct. Embodiment 56. The method according to Embodiment 52 or 53 for producing a heme-binding protein with a titer exceeding at least 20% using a corresponding method lacking the first exogenous nucleic acid construct. Embodiment 57. The method according to Embodiment 52 for producing a heme-binding protein with a titer exceeding at least 5% using a corresponding method lacking a mutation in the first HRM. Embodiment 58. The method according to Embodiment 52 for producing a heme-binding protein with a titer exceeding at least 10% using a corresponding method lacking a mutation in the first HRM. Embodiment 59. The method according to Embodiment 52 for producing a heme-binding protein with a titer exceeding at least 15% using a corresponding method lacking a mutation in the first HRM. Embodiment 60. The method according to Embodiment 52 for producing a heme-binding protein with a titer exceeding at least 20% using a corresponding method lacking a mutation in the first HRM. Embodiment 61. The method according to any one of Embodiments 52 to 60, which is carried out in the absence of the addition of methanol. Embodiment 62. The method according to any one of Embodiments 52 to 61, wherein the cell is a fungal cell. Embodiment 63. The method according to Embodiment 62, wherein the cell is an Aspergillus cell or a Trichoderma cell. Embodiment 64. The method according to any one of Embodiments 62 to 63, wherein the cell is a yeast cell. Embodiment 65. The method according to embodiment 64, wherein the yeast cell is a methanol-assimilating yeast cell. Embodiment 66. The method according to embodiment 65, wherein the methanol-assimilating yeast cell is a Pichia cell, a Candida cell, a Hansenula cell, or a Torulopsis cell. Embodiment 67. The method according to any one of embodiments 65 to 66, wherein the methanol-assimilating yeast cell is a Pichia methanolica cell, a Pichia pastoris cell, a Candida boidinii cell, or a Hansenula polymorpha cell. Embodiment 68. The method according to any one of embodiments 51 to 53, wherein the methanol-assimilating yeast cell is a Pichia pastoris cell. Embodiment 69. The method according to any one of embodiments 52 to 68, wherein the mutation in the first HRM is a mutation from cysteine to a different amino acid. Embodiment 70. The method according to any one of embodiments 52 to 69, wherein the ALAS protein comprises a second HRM and the ALAS protein comprises a mutation within the second HRM. Embodiment 71. The method according to embodiment 70, wherein a corresponding method lacking mutations in the first HRM and the second HRM is used to produce a heme-binding protein at a titer exceeding at least 5%. Embodiment 72. The method according to embodiment 70, wherein a corresponding method lacking mutations in the first HRM and the second HRM is used to produce a heme-binding protein at a titer exceeding at least 10%. Embodiment 73. The method according to embodiment 70, wherein a corresponding method lacking mutations in the first HRM and the second HRM is used to produce a heme-binding protein at a titer exceeding at least 15%. Embodiment 74. The method according to embodiment 70, which produces a heme-binding protein with a titer exceeding at least 20% using corresponding methods lacking mutations in the first HRM and the second HRM. Embodiment 75. The method according to any one of embodiments 70 to 74, wherein the mutation in the second HRM is a mutation from cysteine to a different amino acid. Embodiment 76. The method according to any one of embodiments 70 to 75, wherein the different amino acids are the same for the mutation in the first HRM and the mutation in the second HRM. Embodiment 77. The method according to any one of embodiments 70 to 75, wherein the different amino acids are not the same for the mutation in the first HRM and the mutation in the second HRM. Embodiment 78. A cell according to any one of embodiments 70 to 77, wherein the ALAS protein comprises a third HRM and the ALAS protein comprises a mutation in the third HRM. Embodiment 79. The cell according to embodiment 78, wherein the mutation in the third HRM is a mutation from cysteine to a different amino acid. Embodiment 80. The cell according to embodiment 79, wherein the different amino acids are the same for the mutation in the first HRM, the mutation in the second HRM, and the mutation in the third HRM. Embodiment 81. The method according to any one of embodiments 69 to 80, wherein the different amino acids are selected from the group consisting of arginine, histidine, lysine, serine, threonine, asparagine, glutamine, selenocysteine, glycine, proline, alanine, isoleucine, leucine, methionine, aspartic acid, glutamic acid, phenylalanine, tryptophan, tyrosine, and valine. Embodiment 82. The method according to any one of embodiments 69 to 80, wherein the different amino acids are selected from nonpolar aliphatic amino acids, aromatic amino acids, polar uncharged amino acids, or positively charged amino acids. Embodiment 83. The method according to embodiment 82, wherein the nonpolar aliphatic amino acids are selected from the group consisting of glycine, proline, alanine, isoleucine, leucine, methionine, and valine. Embodiment 84. The method according to embodiment 82, wherein the aromatic amino acid is selected from the group consisting of phenylalanine, tryptophan, and tyrosine. Embodiment 85. The cell according to embodiment 82, wherein the polar uncharged amino acid is selected from the group consisting of serine, threonine, asparagine, or glutamine, which are polar uncharged amino acids. Embodiment 86. The method according to embodiment 82, wherein the positively charged amino acid is selected from the group consisting of arginine, histidine, and lysine. Embodiment 87. The method according to any one of embodiments 69 to 86, wherein the different amino acid is serine. Embodiment 88. The method according to any one of embodiments 69 to 86, wherein the different amino acid is alanine. Embodiment 89. The method according to any one of embodiments 69 to 86, wherein the different amino acid is phenylalanine. Embodiment 90. The method according to any one of embodiments 69 to 86, wherein the different amino acid is histidine. Embodiment 91. The cell according to any one of embodiments 52 to 90, wherein the first HRM is HRM1. Embodiment 92. The cell according to any one of embodiments 70 to 91, wherein the second HRM is HRM2. Embodiment 93. The cell according to any one of embodiments 52 to 90, wherein the first HRM is HRM2. Embodiment 94. The cell according to any one of embodiments 70 to 91, wherein the second HRM is HRM1. Embodiment 95. The method according to any one of embodiments 52 to 94, wherein the first exogenous nucleic acid construct comprises a nucleic acid sequence having at least 90% sequence identity to the nucleic acid sequence within SEQ ID NO: 28. Embodiment 96. The method according to any one of embodiments 52 to 95, wherein the first exogenous nucleic acid construct comprises a nucleic acid sequence having at least 95% sequence identity to the nucleic acid sequence within SEQ ID NO: 28. Embodiment 97. The method according to any one of embodiments 52 to 96, wherein the first exogenous nucleic acid construct comprises the nucleic acid sequence within SEQ ID NO: 30. Embodiment 98. The method according to any one of Embodiments 52 to 97, wherein the ALAS protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence within SEQ ID NO: 29. Embodiment 99. The method according to any one of Embodiments 52 to 98, wherein the ALAS protein comprises an amino acid sequence having at least 95% sequence identity to the amino acid sequence within SEQ ID NO: 29. Embodiment 100. The method according to any one of Embodiments 52 to 99, wherein the ALAS protein comprises the amino acid sequence within SEQ ID NO: 31. Embodiment 101. The method according to any one of Embodiments 52 to 100, wherein the heme-binding protein is selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase. Embodiment 102. The method according to any one of Embodiments 52 to 100, wherein the heme-binding protein is selected from the group consisting of androglobin, chlorocruorin, cytoglobin, erythrocruorin, flavohemoglobin, globin E, globin X, globin Y, hemoglobin, histoglobin, leghemoglobin, myoglobin, neuroglobin, nonsymbiotic hemoglobin, protoglobin, and truncated hemoglobin. Embodiment 103. The method according to any one of Embodiments 52 to 100, wherein the heme-binding protein is nonsymbiotic hemoglobin. Embodiment 104. The method according to any one of Embodiments 52 to 100, wherein the heme-binding protein is leghemoglobin. Embodiment 105. The method according to any one of Embodiments 52 to 100, wherein the heterologous heme-binding protein comprises an amino acid sequence having at least 90% sequence identity to any one of the amino acid sequences within SEQ ID NOs: 1 to 27. The method according to any one of embodiments 52 to 105, further comprising the step of expressing a third nucleic acid construct comprising a nucleotide sequence encoding a transcription factor, wherein the third nucleic acid construct is operably linked to a first promoter element, a second promoter element, or a third promoter element. The method according to embodiment 106, wherein the first promoter element comprises a recognition sequence for the transcription factor. The method according to embodiment 107, wherein a second exogenous nucleic acid construct is operably linked to a second promoter element, and the second promoter element comprises a recognition sequence for the transcription factor. The method according to any one of embodiments 107 to 108, wherein the third nucleic acid construct is operably linked to a third promoter element, and the third promoter element comprises a recognition sequence for the transcription factor. The method according to any one of embodiments 52 to 109, further comprising the step of expressing a fourth nucleic acid construct comprising a nucleotide sequence encoding a protein involved in heme biosynthesis, wherein the fourth nucleic acid construct is operably linked to a first promoter element, a second promoter element, a third promoter element, or a fourth promoter element. The method according to embodiment 110, wherein the protein involved in heme biosynthesis is selected from the group consisting of ALA dehydratase, porphobilinogen deaminase, UPG III synthase, UPG III decarboxylase, CPG oxidase, PPG oxidase, and ferrochelatase. The method according to any one of embodiments 52 to 111, wherein the first exogenous nucleic acid construct is a heterologous nucleic acid construct. The method according to any one of embodiments 52 to 112, wherein the second exogenous nucleic acid construct is a heterologous nucleic acid construct. The method according to any one of embodiments 52 to 113, wherein the heme-binding protein is an exogenous heme-binding protein. The method according to any one of Embodiments 52 to 111 or 114, wherein the heme-binding protein is a heterologous heme-binding protein.
Examples
[0094] [Example 1] Polymerase chain reaction The target gene was amplified from genomic DNA template or plasmid DNA template using Phusion Hi-fidelity PCR master mix (New England Biolabs, catalog number: M0531), forward primer and reverse primer at 0.6 μM each, and 10 - 50 ng of template DNA. The reaction conditions were as follows:
[0095]
Table 1
[0096] The ALAS gene of Pichia pastoris (KEGG identifier: PAS_chr2-1_0716, accessible on the Kyoto Encyclopedia of Genes and Genomes (KEGG) website) was amplified using primers (ATGGAGTTTGTCGCCCGTCAG; SEQ ID NO: 65) and (CTACAATCTGACTCCTGATGAGGTTTC; SEQ ID NO: 66) derived from genomic DNA. In the example, wtALAS represents the native sequence of this ALAS (SEQ ID NO: 28).
[0097] [Example 2] Cloning and mutagenesis of ALAS The PCR products were purified using NucleoSpin Gel and PCR Clean-Up (Takara Bio Inc., model number: 740609), and cloned into the pCR-BluntII-TOPO vector using the Zero Blunt TOPO PCR Cloning Kit (Thermo Fisher Scientific, model number: K280020) according to the manufacturer's recommendations. On the resulting vector (40 ng of purified plasmid), two primer sets (Set 1: CGTCAGTCCATGAATGCCTCTCCCTTTGTCAGGTCAACTTC: SEQ ID NO: 37; and GAAGTTGACCTGACAAAGGGAGAGGCATTCATGGACTGACG: SEQ ID NO: 38; Set 2: GCTGCTACTGCTAGTCATTCTCCCGTGGTTGGCCCTG: SEQ ID NO: 39; and CAGGGCCAACCACGGGAGAATGACTAGCAGTAGCAGC; SEQ ID NO: 40), and the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, model number: 200521) were used to perform site-directed mutagenesis to create mutALAS (SEQ ID NO: 30) carrying mutations from cysteine residues to serine residues at positions 12 and 39. In the examples, mutALAS refers to, among other things, these two mutations unless otherwise specified. The reaction conditions were as follows:
[0098]
Table 2
[0099] On the vector carrying wtALAS, C12S or C39S, which are single cysteine-to-serine mutations, were performed by site-directed mutagenesis using primer sets 1 (SEQ ID NO: 37, SEQ ID NO: 38) and set 2 (SEQ ID NO: 39, SEQ ID NO: 40), respectively.
[0100] [Example 3] Construction of the ALAS (wild-type, or C12S mutation, C39S mutation) gene integration cassette Under the methanol-inducible alcohol oxidase 1 (AOX1) promoter element derived from Pichia pastoris, and the transcription termination sequence derived from the Pichia pastoris FDH1 gene that directly follows before the translation termination signal, the integration cassette of wtALAS or mutALAS was designed such that gene integration occurs. The linear construct contained the FDH1 transcription terminator following the ALAS gene (wild-type or mutant) that follows the 3'-side of the promoter element. Immediately following this, a selection cassette containing the pTEF promoter element derived from Ashbya gossypii, the acetamidase gene (amdS) derived from Aspergillus nidulans, and the TEF terminator derived from Ashbya gossypii was followed. Finally, the construct contained the 5'-side of the promoter element (see, for example, Figure 5).
[0101] Using overlapping PCR, the linear construct [3’pAOX1-ALAS(wt / mut)-FDH1tt-pTEF-amdS-TEFtt-5’pAOX1] was created. Primers used to amplify the linear construct:
[0102] [Table 3]
[0103] The individual PCR reaction conditions were carried out as indicated above. The PCR products were purified using NucleoSpin Gel and PCR Clean-Up (Takara Bio Inc., model number: 740609). In a two-step PCR reaction, three purified PCR unit replication sequences were mixed in an equimolar ratio using 0.5 U Platinum Pfx DNA Polymerase (Thermo Fisher Scientific, model number: 11708039), 1× amplification buffer, 0.3 mM dNTP, and 1 mM MgCl2 to perform the final overlapping PCR. The PCR conditions were as follows: First part:
[0104]
Table 4
[0105] After the first part, the reaction mix was spiked with the primers AAACGCTGTCTTGGAACCTAATATGAC (SEQ ID NO: 41) and AAACTGTCAGTTTTGGGCCATTTG (SEQ ID NO: 46) (final concentration of 0.3 μM), and 1.5 U Pfx and continued to the second part.
[0106] Second part:
[0107]
Table 5
[0108] The sequences of exemplary mutant nucleic acids (e.g., SEQ ID NO: 30) and proteins (e.g., SEQ ID NO: 31) are presented in Figure 7.
[0109] Expression plasmids of wtALAS and mutALAS were constructed under the transcription termination sequence derived from the Pichia pastoris FDH1 gene following the modified pAOX1 within the self-replicating vector (panARS). The vector conferred resistance to G418 (Geneticin). Cloning of the inserts, GFP, wtALAS, and mutALAS, into the vector was carried out using Gibson Assembly Master Mix (New England Biolabs, catalog number: E2611L) according to the manufacturer's recommendations.
[0110] [Example 4] Preparation of P. pastoris Competent Cells A selected strain of P. pastoris (K. phaffii) was grown in 25 ml of YPD medium to mid-exponential growth phase (about 2 OD). The cells were harvested by centrifugation at 930×g for 15 minutes. The cell pellet was resuspended in 2 ml of a solution containing 80% YPD and 200 mM HEPES, pH 6.8. 75 μl of 1 M DTT was added. The resuspended cell pellet was mixed at 100 rpm at 30 °C for 25 minutes. 40 ml of ice-cold sterile water was added to the suspension, and the cells were harvested by centrifugation at 1125×g for 15 minutes and placed on ice. The cell pellet was resuspended in 40 ml of ice-cold water and harvested for two additional washing steps as described above. The cell pellet was then resuspended in 20 ml of 1 M ice-cold sorbitol and harvested by centrifugation as described above. The final cell pellet was resuspended in 0.3 ml of 1 M ice-cold sterile sorbitol, aliquoted, and frozen at -80 °C.
[0111] [Example 5] Transformation of P. pastoris For genomic integration, 30 μl of electrocompetent P. pastoris cells were transformed with 100 - 300 ng of linearized DNA using a GenePulser (BioRad) set to 1.15 kV with a GenePulser cuvette (Bio-Rad, model number: 1652083) having a 1 mm gap. 1 ml of YPD / 1M sorbitol (1:1 vol / vol) was immediately added to the cells. The cells were harvested for 3 hours while shaking at 30 °C and 100 rpm. 100 μl of the harvested mixture was plated onto a yeast carbon base plate (Teknova, model number: Y5216) containing 5 mM acetamide. The plates were incubated at 30 °C for 48 hours. Individual clones were streaked onto a yeast carbon base plate containing acetamide to obtain single colonies, and colony PCR or gDNA preparation was performed using the isolated colonies to confirm the integration of the gene into the chromosome and the sequence integration construct.
[0112] For transformation with plasmid DNA, the same steps as for genomic integration were followed, except that after electroporation and cell harvest, 50 - 100 μl of the harvested mixture was plated onto YPD plates containing 300 μg / ml G418 (Geneticin).
[0113] [Example 6] Construction of Strains St2, St3, St5, and St6 The high-yield parent strain (St1) had an existing recombinant ALAS in addition to multiple copies of another pAOX1-driven heme enzyme, the carbon-responsive transcription factor MxR1, and LegH under the methanol-inducible strong promoter pAOX1 (alcohol oxidase 1). The low-yield parent LegH strain (St4) lacked other heme enzymes except for recombinant MxR1, ALAS, and aminolevulinate dehydratase (ALAD).
[0114] Competent St1 cells (Table 1; high LegH titer strain) were transformed with each of the linear cassettes (for wtALAS and mutALAS), and transformants containing the amdS selection cassette were selected based on their ability to grow on agar plates containing acetamide as the sole nitrogen source. The resulting strains (St2 and St3; Table 1, each incorporating the cassette for wtALAS and mutALAS, respectively) were purified and isolated, and the presence of pAOX1-driven wtALAS or pAOX1-driven mutALAS was verified by colony PCR and sequencing. Similarly, competent St4 cells (low LegH titer strain) were transformed with linear cassettes for wtALAS and mutALAS to obtain St5 and St6, respectively.
[0115]
Table 6
[0116] [Example 7] ALAS gene copy number analysis The ALAS gene copy numbers in different strains were measured by probe-based qPCR. Briefly, genomic DNA (20 ng) was amplified in a real-time qPCR CFX96 machine (Bio-Rad) using 1X concentration of PrimeTime gene expression mastermix (Integrated DNA Technologies, catalog number: 1055770) and PrimeTime qPCR Probe Assays. qPCR normalization was performed relative to actin. The relative copy numbers of the gene of interest among the strains were calculated according to the double delta Ct analysis method. The primer sequences and probe sequences were as follows:
[0117]
Table 7
[0118] The engineered strains (Table 1) contained the same number of surplus ALAS gene copies, which were 1 copy of wtALAS or mutALAS, as measured by qPCR for ALAS normalized to actin levels. Thus, for any differences in the phenotypes of the resulting strains (e.g., St2 vs. St3 and St5 vs. St6), the ALAS gene dosage was excluded.
[0119] [Example 8] Detection of Hem Enzyme Genes, MxR1 Gene, LegH Gene, and Mb Gene by PCR Strains were characterized by PCR for pAOX1-driven recombinant hem biosynthetic pathway enzyme genes, recombinant MxR1 gene, and recombinant LegH gene. The forward primer sequence for PCR was TAGCGCAGTCTCTCTATCGCTTC (SEQ ID NO: 53), which is specific to pAOX1. The reverse primer was specific to each gene of interest as shown below.
[0120] [Table 8]
[0121] The results for these reaction solutions are shown below.
[0122] [Table 9]
[0123] [Example 9] Culture of Strains St4, St5, and St6 in Shake Flasks Strains were inoculated overnight at 30 °C into growth medium (1% yeast extract, 2% peptone supplemented with 1% glycerol) with shaking at 200 rpm. The next day, the cultures were diluted to an OD600 of 0.5 - 0.7 in YP medium supplemented with 1% methanol and 1% dextrose overnight. The cultures were grown for 48 hours and harvested by centrifugation at approximately 4000 g for 15 minutes at 4 °C.
[0124] The low LegH titer strain, St4, unlike St1, did not have an existing copy of recombinant ALAS. Integration of a copy of mutALAS (St6) resulted in an approximately 30% improvement in LegH titer compared to St5 (wtALAS). Titer calculations were based on the LegH content measured by the liquid chromatography method described in Example 13.
[0125] The relative LegH titers are shown in Table 2:
[0126]
Table 10
[0127] [Example 10] 2L culture of strains St1, St2, and St3 Strains St1, St2, and St3 were grown at 30 °C in a 2 L fermenter in a medium containing dextrose as the main carbon source. Methanol was not used. In the background of the high LegH titer strain (St1) containing the existing recombinant ALAS, St3 overexpressing mutALAS improved the LegH titer by >30% compared to the parental St1. When compared to wtALAS (in St2), mutALAS (in St3) resulted in a 20% improvement in LegH titer. Titer calculations were based on the LegH content measured by the liquid chromatography method described in Example 13.
[0128] The relative LegH titers are shown in Table 3:
[0129]
Table 11
[0130] Therefore, mutating both ALAS HRMs and overexpressing the mutant ALAS (mutALAS) in Pichia strains with different LegH titers led to a further improvement in LegH titer. Furthermore, this suggested that mutALAS improved the LegH titer independent of the genetic composition of the strain (hem enzymes other than MxR1 and ALAS) and the presence of methanol.
[0131] [Example 11] mutALAS improved the heme level A quantitative assay for total heme based on reverse-phase high-performance liquid chromatography indicated that strains with mutALAS accumulated higher levels of heme than strains containing wtALAS. Table 4 shows the quantification of heme in strain St3 (mutALAS) compared to strain St2 (wtALAS). In addition, mutALAS increased the heme loading in multiple strains.
[0132]
Table 12
[0133] [Example 12] ALAS protein level by mutALAS Generally, it is conceivable that heme regulates the ALAS level in a feedback manner to adjust its own level. At the protein level, when the strain was grown in a 2 L fermenter with dextrose, the ALAS level was 3-fold higher in St3 (mutALAS) than in St2 (wtALAS) as quantified by shotgun mass spectrometry (Table 5).
[0134]
Table 13
[0135] [Example 13] Quantification of Leg hemoglobin The cell culture fluid sample was pelleted (at 4000×g for 30 minutes at 4°C) and decanted. The pellet sample was then diluted 4-fold with lysis buffer (150 mM NaCl, 50 mM potassium phosphate, pH 7.4). 300 μL aliquots of each resuspension were dispensed into a 96-well deep well plate with 120 μL of beads (zirconium / silica beads (0.5 mm)) per well for cell lysis. Lysis was performed for 3 minutes with a Mini Bead Beater, then the plate was cooled on ice for 5 minutes and followed by another 2 minutes of bead disruption. The plate was then spin-down (at 4000×g for 30 minutes at 4°C). The supernatant was filtered through a 0.2 μm filter plate (at 4000×g for 60 minutes at 4°C).
[0136] The filtered lysate was loaded onto a UHPLC with a size exclusion column (Acquity BEH SEC column, 200 Å, 1.7 μm, 4.6×150 mm). Method parameters: 1) Mobile phase: 5 mM NaCl, 50 mM potassium phosphate (pH 7.4); 2) Flow rate: 0.3 mL / min; 3) Injection volume: 10 μL; 4) Run time: 15 minutes; 5) Sample tray temperature: 4°C. The calibration curve was generated with purified LegH standards using absorbance at 280 nm and 415 nm. Quantification was performed using peak area by valley-to-valley peak integration. Absorbance at 280 nm is proportional to the amount of polypeptide present, and absorbance at 415 nm is proportional to the amount of heme present. When a peak is seen at the same elution time at both wavelengths, a protein containing heme is detected.
[0137] [Example 14] mutALAS improved the level of bovine myoglobin In addition to LegH, the production of bovine myoglobin was assayed. The strain St7 was created by integrating the myoglobin cDNA of Bos taurus (NM_173881.2) into a strain containing recombinant copies of the heme enzyme and MxR1 integrated under pAOX1 (the characterization of St7 is as described in Example 8).
[0138] Three expression plasmids for the expression of GFP (control), wtALAS, and mutALAS were constructed as described in Example 3. Using the method described in Example 5, the strain S7 was transformed with these three plasmids that overexpress GFP, wtALAS, and mutALAS respectively, as shown in Table 6, to create three strains, St8, St9, and St10. Except that the growth medium was supplemented with 300 μg of G418 per 1 ml, the method described in Example 9 was used to grow the transformants to obtain episomal expression of wtALAS or mutALAS.
[0139] [Table 14]
[0140] The cells were pelleted and shotgun proteomics was performed by LC-MS to quantify Mb. When normalized against the myoglobin level (GFP) in the strain St8, the average myoglobin levels in St9 and St10 were as shown in Table 7.
[0141] [Table 15]
[0142] [Example 15] Mutations to other amino acids In addition to the cysteine-to-serine mutation, additional mutations were evaluated. Expression plasmids for the mutALAS mutants were constructed by gene synthesis and cloning in a self-replicating vector (panARS) under the FDH1 transcription termination sequence following the modified pAOX1. Furthermore, using the method described in Example 5, these plasmids were used to transform strain St1 and cultured using the method described in Example 9, except that the growth medium was supplemented with 300 μg of G418 per 1 ml. As a result, the resulting transformants produced LegH. The titer of LegH produced by these strains was normalized against the titer of LegH produced by wtALAS as determined by the method described in Example 13. The results are shown in Table 8:
[0143] [Table 16]
[0144] [Example 16] Mutants of single cysteine to serine in Pichia pastoris In addition to the assessment of the double mutant (C12S, C39S) of ALAS in P. pastoris, mutants of single cysteine to serine were also assessed. A single mutation was created in wtALAS by site-directed mutagenesis as described in Example 2. Expression plasmids for wtALAS, mutALAS, and single ALAS mutants (C12S and C39S) were constructed as described in Example 3 and used to transform strain St1 using the method described in Example 5. The resulting transformants produced LegH when cultured using the method described in Example 9, except that the growth medium was supplemented with 300 μg of G418 per 1 ml. The titer of LegH produced by these strains was normalized against the titer of LegH produced by wtALAS as determined by the method described in Example 13. The results are shown in Table 9:
[0145]
Table 17
[0146] Other embodiments The present invention has been described in conjunction with its detailed description, but it is to be understood that the foregoing description is intended to illustrate, and not limit, the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims. Various embodiments of the present invention are shown below 1. A first exogenous nucleic acid construct comprising a nucleotide sequence encoding an aminolevulinic acid synthase (ALAS) protein operably linked to a first promoter element, wherein the ALAS comprises at least a first heme reactive motif (HRM), and the ALAS comprises a mutation within the first HRM; and A second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein A cell comprising The cell, wherein the second exogenous nucleic acid construct comprising the nucleotide sequence encoding the heme-binding protein is operably linked to the first promoter element or is operably linked to a second promoter element 2. The cell according to 1 above, which is a fungal cell or a yeast cell 3. The cell according to 2 above, wherein the yeast cell is a Pichia pastoris cell 4. The cell according to any one of 1 to 3 above, wherein the mutation within the first HRM is a mutation from cysteine to a different amino acid 5. The cell according to any one of 1 to 4 above, wherein the ALAS protein comprises a second HRM, and the ALAS protein comprises a mutation within the second HRM 6. The cell according to 5 above, wherein the mutation within the second HRM is a mutation from cysteine to a different amino acid 7. The cell according to 5 above, wherein the different amino acid is the same for the mutation within the first HRM and the mutation within the second HRM 8. The cell according to 5 above, wherein the different amino acid is not the same for the mutation within the first HRM and the mutation within the second HRM 9. The cell according to any one of 4 to 8 above, wherein the different amino acid is selected from the group consisting of arginine, histidine, lysine, serine, threonine, asparagine, glutamine, selenocysteine, glycine, proline, alanine, isoleucine, leucine, methionine, glutamic acid, aspartic acid, phenylalanine, tryptophan, tyrosine, and valine. 10. The cell according to any one of 4 to 8 above, wherein the different amino acid is selected from nonpolar aliphatic amino acids, aromatic amino acids, polar uncharged amino acids, or positively charged amino acids. 11. The cell according to any one of 4 to 9 above, wherein the different amino acid is serine. 12. The cell according to any one of 4 to 9 above, wherein the different amino acid is alanine. 13. The cell according to any one of 4 to 9 above, wherein the different amino acid is phenylalanine. 14. The cell according to any one of 4 to 9 above, wherein the different amino acid is histidine. 15. The cell according to any one of 1 to 14 above, wherein the first exogenous nucleic acid construct comprises a nucleic acid sequence having at least 90% sequence identity to the nucleic acid sequence within SEQ ID NO: 28. 16. The cell according to any one of 1 to 15 above, wherein the ALAS protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence within SEQ ID NO: 29. 17. The cell according to any one of 1 to 16 above, wherein the heme-binding protein is selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase. 18. The cell according to any one of 1 to 16 above, wherein the heme-binding protein is leghemoglobin. 19. The cell according to any one of 1 to 16 above, wherein the heme-binding protein comprises an amino acid sequence having at least 90% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 1 to 27. 20. A method for producing a heme-binding protein in a cell, comprising: expressing a first exogenous nucleic acid construct comprising a nucleotide sequence encoding an aminolevulinate synthase (ALAS) protein operably linked to a first promoter element, wherein the ALAS comprises at least a first heme-reactive motif (HRM), and the ALAS comprises a mutation within the first HRM; and Step of expressing a second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein comprising, wherein the second exogenous nucleic acid construct comprising the nucleotide sequence encoding the heme-binding protein is operably linked to the first promoter element or is operably linked to a second promoter element, method. 21. The method according to 20 above, producing the heme-binding protein at a titer exceeding at least 5% with a corresponding method lacking the first exogenous nucleic acid construct. 22. The method according to 20 or 21 above, producing the heme-binding protein at a titer exceeding at least 10% with a corresponding method lacking the first exogenous nucleic acid construct. 23. The method according to 20 above, producing the heme-binding protein at a titer exceeding at least 5% with a corresponding method lacking the mutation in the first HRM. 24. The method according to 20 above, producing the heme-binding protein at a titer exceeding at least 10% with a corresponding method lacking the mutation in the first HRM. 25. The method according to any one of 20 to 24 above, which is carried out in the absence of addition of methanol. 26. The method according to any one of 20 to 25 above, wherein the mutation in the first HRM is a mutation from cysteine to a different amino acid. 27. The method according to any one of 20 to 26 above, wherein the ALAS protein comprises a second HRM and the ALAS protein comprises a mutation in the second HRM. 28. The method according to 26 above, producing the heme-binding protein at a titer exceeding at least 5% with a corresponding method lacking the mutations in the first HRM and the second HRM. 29. The method according to 26 above, producing the heme-binding protein at a titer exceeding at least 10% with a corresponding method lacking the mutations in the first HRM and the second HRM. 30. The method according to any one of 27 to 29 above, wherein the mutation in the second HRM is a mutation from cysteine to a different amino acid. 31. The method according to 30 above, wherein the different amino acid is the same for the mutation in the first HRM and the mutation in the second HRM. 32. The method according to 30 above, wherein the different amino acids are not the same for the mutation in the first HRM and the mutation in the second HRM. 33. The method according to any one of 26 to 32 above, wherein the different amino acids are selected from the group consisting of arginine, histidine, lysine, serine, threonine, asparagine, glutamine, selenocysteine, glycine, proline, alanine, isoleucine, leucine, methionine, aspartic acid, glutamic acid, phenylalanine, tryptophan, tyrosine, and valine. 34. The method according to any one of 26 to 33 above, wherein the different amino acid is serine. 35. The method according to any one of 26 to 33 above, wherein the different amino acid is alanine. 36. The method according to any one of 26 to 33 above, wherein the different amino acid is phenylalanine. 37. The method according to any one of 26 to 33 above, wherein the different amino acid is histidine. 38. The method according to any one of 20 to 37 above, wherein the first exogenous nucleic acid construct comprises a nucleic acid sequence having at least 90% sequence identity to the nucleic acid sequence within SEQ ID NO: 28. 39. The method according to any one of 20 to 38 above, wherein the ALAS protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence within SEQ ID NO: 29. 40. The method according to any one of 20 to 39 above, wherein the heme-binding protein is selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase. 41. The method according to any one of 20 to 39 above, wherein the heme-binding protein is leghemoglobin. 42. The method according to any one of 20 to 39 above, wherein the heterologous heme-binding protein comprises an amino acid sequence having at least 90% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 1 to 27.
Claims
**Claim 1** (a) A first exogenous nucleic acid construct comprising a nucleotide sequence encoding an aminolevulinic acid synthase (ALAS) protein operably linked to a first promoter element, wherein the ALAS protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 29, the ALAS protein comprises at least a first heme reactive motif (HRM) and a second HRM, the ALAS comprises a mutation in the first HRM and a mutation in the second HRM, the mutation in the first HRM corresponds to a mutation to serine, alanine, phenylalanine, or histidine at residue 12 in SEQ ID NO: 29, the mutation in the second HRM corresponds to a mutation to serine, alanine, phenylalanine, or histidine at residue 39 in SEQ ID NO: 29, and the ALAS protein catalyzes the conversion of glycine and succinyl CoA to aminolevulinic acid; and (b) A second exogenous nucleic acid construct comprising a nucleotide sequence encoding a heme-binding protein A cell comprising wherein the second exogenous nucleic acid construct comprising the nucleotide sequence encoding the heme-binding protein is operably linked to the first promoter element or is operably linked to a second promoter element. **Claim 2** The cell according to claim 1, which is a fungal cell, a bacterial cell, an algal cell, a plant cell, an insect cell, a mammalian cell, or a yeast cell. **Claim 3** The cell according to claim 2, wherein the yeast cell is a Pichia pastoris cell. **Claim 4** The cell according to any one of claims 1 to 3, wherein the first HRM has an amino acid sequence of any one of SEQ ID NOs: 33 to 36. **Claim 5** The cell according to any one of claims 1 to 4, wherein the second HRM has an amino acid sequence of any one of SEQ ID NOs: 33 to 36. **Claim 6** The cell according to any one of claims 1 to 5, wherein the ALAS protein comprises the amino acid sequence of SEQ ID NO: 29, except that the ALAS protein comprises the mutation in the first HRM and the mutation in the second HRM. **Claim 7** The cell according to any one of claims 1 to 5, wherein the ALAS protein consists of the amino acid sequence of SEQ ID NO: 29, except that the ALAS protein contains the mutation in the first HRM and the mutation in the second HRM.
8. The cell according to any one of claims 1 to 7, wherein the heme-binding protein is selected from the group consisting of globin, cytochrome, cytochrome c oxidase, ligninase, catalase, and peroxidase.
9. The cell according to any one of claims 1 to 8, wherein the heme-binding protein is leghemoglobin.
10. The cell according to any one of claims 1 to 9, wherein the heme-binding protein contains an amino acid sequence having at least 90% sequence identity to any one of the amino acid sequences of SEQ ID NOs: 1 to 27.
11. The cell according to any one of claims 1 to 10, wherein the heme-binding protein contains an amino acid sequence identical to any one of the amino acid sequences of SEQ ID NOs: 1 to 27.
12. A method for producing a heme-binding protein in the cell according to any one of claims 1 to 11, comprising: expressing the first exogenous nucleic acid construct; and expressing the second exogenous nucleic acid construct A method.
13. The method according to claim 12, wherein the corresponding method lacking the first exogenous nucleic acid construct or lacking the mutation in the first HRM produces the heme-binding protein at a titer exceeding at least 5%.
14. The method according to any one of claims 12 to 13, which is carried out in the absence of the addition of methanol.
Citation Information
Patent Citations
Method for producing 5-aminolevulinic acid
JP2005333907A
Method for enhancing the production of hemoproteins
US5824511A