Human liver chimeric non-human animals having P450 oxidoreductase deficiency and methods of using the same

A human liver chimeric non-human animal model with conditional knockout of the NADPH-P450 oxidoreductase gene and human hepatocyte transplantation addresses the challenge of predicting human drug metabolism, enhancing drug development by improving screening and reducing clinical trial failures.

JP7702140B2Active Publication Date: 2025-07-03BAYLOR COLLEGE OF MEDICINE
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2022017030
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2017-05-23
Filing Date
2022-02-07
Publication Date
2025-07-03
Estimated Expiration
2037-06-27

AI Technical Summary

Technical Problem

Current drug development is hindered by the lack of accurate experimental animal models that predict human xenobiotic metabolism, leading to high dropout rates due to ineffectiveness or toxicity in clinical trials, necessitating better pre-clinical tools.

Method used

Development of a human liver chimeric non-human animal model by creating a non-human animal with reduced or absent NADPH-P450 oxidoreductase (Por) gene expression and transplanting human hepatocytes, using somatic genome engineering techniques like CRISPR/Cas9 to achieve a conditional knockout of the Por gene, combined with additional enzyme reductions.

Benefits of technology

The model allows for precise prediction of human drug metabolism and toxicity, enabling more effective drug screening and identification of human-specific metabolites, reducing the risk of clinical trial failures.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007702140000019
    Figure 0007702140000019
  • Figure 0007702140000020
    Figure 0007702140000020
  • Figure 0007702140000021
    Figure 0007702140000021
Patent Text Reader

Abstract

A human liver chimeric non-human animal model and a method of using the human liver chimeric non-human animal model for predicting human-specific drug metabolism are provided. [Solution] The present disclosure provides chimeric non-human animals comprising human hepatocytes, methods for preparing chimeric non-human animals comprising human hepatocytes, and methods for utilizing chimeric non-human animals comprising human hepatocytes to screen and identify metabolites of any type of drug, typically a small molecule drug, that may affect human liver function and other biological functions.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims priority and benefit under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 62 / 355,102, filed Jun. 27, 2016, and U.S. Provisional Patent Application No. 62 / 509,942, filed May 23, 2017. The entire contents of each of these applications are hereby incorporated by reference in their entirety.

[0002] Incorporation by Reference of Sequence Listing The content of the text file named "KARL - 001 - WO_ST25", created on Jun. 20, 2017 and having a size of 67 KB, is hereby incorporated by reference in its entirety into this specification.

Background Art

[0003] Background of the Invention Only one out of ten drugs under development is approved for clinical use. Most of them drop out during clinical trials due to ineffectiveness or toxicity in humans. The lack of experimental animal models that accurately predict human xenobiotic metabolism is a significant limitation, and it endangers human lives and wastes drug development costs. Therefore, there is an urgent need to develop better pre - clinical tools. The present disclosure addresses these needs in the art by providing a human liver chimeric non - human animal model and a method of using the human liver chimeric non - human animal model to predict drug metabolism specific to humans.

Summary of the Invention

[0004] Summary of the Invention The present disclosure provides a method of preparing a chimeric non - human animal comprising human hepatocytes, the method comprising: (a) providing a non - human animal comprising a reduction or deletion of the NADPH - P450 oxidoreductase (Por) gene that results in a reduction or absence of Por protein expression, and (b) transplanting human hepatocytes into the non - human animal.

[0005] The non-human animal may comprise reducing or deleting the Por gene, which results in reduced or absent expression of the Por protein. The reduced or deleted Por gene may be a conditional knockdown or knockout of the Por gene. The reduced or deleted Por gene may be the result of somatic genome engineering, including mutations, transgenes, treatment with exogenous substances, or the CRISPR (clustered regularly interspaced short palindromic repeats) system. Somatic genome engineering includes Guide RNA (gRNA) and Caspase 9 (Cas9).

[0006] The non-human animal may comprise floxed alleles of the Por gene, and here, the non-human animal is provided with Cre recombinase sufficient to effect a conditional knockout of the Por gene. The non-human animal comprising floxed alleles of the Por gene is provided at least with the first administration of a virus encoding Cre recombinase. The non-human animal is provided at least with a second administration of a virus encoding Cre recombinase. The non-human animal comprising floxed alleles of the Por gene is mated with a transgenic non-human animal strain expressing Cre recombinase.

[0007] In one aspect, the method of the disclosure comprises: (a) providing a non-human animal comprising floxed alleles of the Por gene with the first administration of a virus encoding Cre recombinase; (b) transplanting human hepatocytes into the non-human animal; and (c) providing the non-human animal with a second administration of a virus encoding Cre recombinase. Steps (a) and (b) may occur sequentially or simultaneously.

[0008] The non-human animal further comprises a reduction or deletion of at least one additional gene encoding an enzyme involved in drug metabolism. The at least one additional enzyme can be a phase II drug enzyme. In one embodiment, the non-human animal can further comprise a reduction or deletion of the UDP-glucose 6-dehydrogenase (UGDH) gene, a reduction or deletion of the glutathione synthetase (GSS) gene, or a combination thereof.

[0009] A reduction or deletion of the UGDH gene can result in a reduction or absence of the expression of the UGDH protein. A reduction or deletion of the GSS gene can result in a reduction or absence of the expression of the GSS protein. A reduction or deletion of the UGDH gene can be a conditional knockdown or knockout of the UGDH gene. A reduction or deletion of the GSS gene can be a conditional knockdown or knockout of the GSS gene. The reduced or deleted UGDH or GSS gene may be the result of somatic genome engineering including mutations, transgenes, treatment with exogenous substances, or the CRISPR (clustered regularly interspaced short palindromic repeats) system. Somatic genome engineering includes Guide RNA (gRNA) and Caspase 9 (Cas9).

[0010] The non-human animal can be selected from the group consisting of primates, birds, mice, rats, chickens, dogs, cats, cows, horses, goats, camels, sheep, and pigs. In a preferred embodiment, the non-human animal is a mouse.

[0011] A non-human animal comprising a reduced or deleted Por gene is (i) an FRG (Fah - / - / Rag2 - / - / Il2rg - / - ) non-human animal, (ii) a transgenic urokinase-type plasminogen activator (uPA) non-human animal (one that overexpresses uPA under an inducible promoter, preferably an albumin promoter restricted to the liver), (iii) a thymidine kinase-NOD / Shi-scid / IL-2Rγ null(TK-NOG) A non-human animal (an immunodeficient NOG non-human animal having transgenic expression of thymidine kinase under the control of a liver-restricted promoter), (iv) a non-human animal that expresses inducible caspase 8 in the liver, and (v) a non-human animal that expresses inducible caspase 9 in the liver, can be selected from the group consisting of.

[0012] The present disclosure also provides chimeric non-human animals, their offspring, or parts thereof, which have a chimeric liver containing human hepatocytes prepared by any of the methods disclosed herein.

[0013] The chimeric non-human animal can be immunodeficient. The chimeric non-human animal is substantially lacking in autologous hepatocytes. The human hepatocytes can account for more than about 1%, for example, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% of all hepatocytes of the chimeric liver of the chimeric non-human animal. "Non-human animal" can be an amphibian, reptile, bird, or non-human mammal. The non-human animal can be, for example, any non-human mammal, such as a primate, chicken, mouse, rat, pigeon, dog, cat, cow, horse, goat, camel, sheep. In a preferred embodiment, the non-human animal is a mouse.

[0014] In one aspect, the present disclosure provides a method for preparing a chimeric non-human animal comprising human hepatocytes, the method comprising the following steps: (a) providing a non-human animal that has a liver capable of repopulating with human hepatocytes and that contains a non-functional NADPH-P450 oxidoreductase created either by an exogenous factor such as a genome engineering tool such as CRISPR / Cas9 or by genome engineering or knockdown using a floxed allele of the NADPH-P450 oxidoreductase (Por) gene, in the presence of a first administration of a virus encoding Cre recombinase or with a Cre transgenic animal, thereby effecting a conditional knockout of the Por gene; (b) transplanting human hepatocytes into the non-human animal; and (c) providing a second administration of a virus encoding Cre recombinase to the non-human animal. The chimeric non-human animal may substantially lack autologous or endogenous hepatocytes and instead contain human hepatocytes. Steps (a) and (b) may occur sequentially or simultaneously. Any non-human animal containing a mutation and / or transgene that enables its liver to repopulate with human hepatocytes may be used in combination with a floxed or deleted allele of the NADPH-P450 oxidoreductase (Por) gene or a functional inactivation of the Por protein. In an aspect, the non-human animal containing a mutation and / or transgene that enables its liver to repopulate with human hepatocytes is (i) FRG (Fah - / - / Rag2 - / - / Il2rg - / -(i) a non-human animal, (ii) a transgenic uPA non-human animal (one that overexpresses urokinase-type plasminogen activator (uPA) in the liver under an inducible promoter and / or preferably an albumin promoter restricted to the liver), (iii) a TK-NOG non-human animal (an immunodeficient NOG non-human animal with transgenic expression of thymidine kinase under the control of an albumin promoter restricted to the liver), (iv) a non-human animal that expresses inducible caspase 8 in the liver, or (v) a non-human animal that expresses inducible caspase 9 in the liver, (vi) a non-human animal that expresses a human heparin-binding epidermal growth factor-like receptor (BH-EGF)-like receptor under the control of a liver cell-specific albumin promoter (alb-TRECK). "Non-human animal" is an amphibian, reptile, bird, or non-human mammal.

[0015] In one aspect, the present disclosure is a method of preparing a chimeric mouse that is substantially lacking in mouse hepatocytes and instead contains human hepatocytes, the method comprising the following steps: (a) providing a mouse that has a liver capable of repopulating with human hepatocytes and that contains a non-functional NADPH-P450 oxidoreductase created by either genome engineering by CRISPR / Cas9-mediated deletion or knockdown using an exogenous factor or floxed alleles of the NADPH-P450 oxidoreductase (Por) gene, by providing the mouse with a first administration of a virus encoding Cre recombinase or with a Cre transgenic mouse, thereby causing a conditional knockout of the Por gene; (b) transplanting human hepatocytes into the mouse; and (c) providing the mouse with a second administration of a virus encoding Cre recombinase. Steps (a) and (b) can occur sequentially or simultaneously. Any mouse that has a liver capable of repopulating with human hepatocytes can be used in combination with a floxed allele of the NADPH-P450 oxidoreductase (Por) gene or somatic gene deletion or reduction or inactivation of the Por gene at the protein level, respectively. In an aspect, the mouse that has a liver capable of repopulating with human hepatocytes is (i) an FRG (Fah- / - / Rag2 - / - / Il2rg - / - ) (i) mouse, (ii) transgenic uPA mouse (which overexpresses urokinase-type plasminogen activator (uPA) in the liver under an inducible promoter, preferably the albumin promoter restricted to the liver), (iii) TK-NOG mouse (severe immunodeficient NOG mouse with transgenic expression of thymidine kinase under the control of the albumin promoter restricted to the liver), (iv) mouse expressing inducible caspase 8 in the liver, (v) mouse expressing inducible caspase 9 in the liver, or (vi) mouse expressing a human heparin-binding epidermal growth factor-like receptor (BH-EGF)-like receptor under the control of the liver cell-specific albumin promoter (alb-TRECK).

[0016] The present disclosure also provides a method for screening and identifying metabolites of any type of drug, typically small molecule drugs, that act on human liver function but may also act on other body functions, the method comprising the following: (a) administering a test substance to a chimeric non-human animal of the present disclosure; (b) measuring one or more values in the chimeric non-human animal to which the test substance was administered in (a); and (c) comparing with one or more values measured in a chimeric non-human animal not administered the test substance, or a chimeric non-human animal without a deletion of the Por gene, or a non-human animal without a human chimera, and selecting a test substance that causes an increase or decrease in the one or more values measured in (b). Preferably, the one or more values include, but are not limited to, metabolites of the test substance, human albumin concentration, body weight curve, liver weight to body weight ratio, total albumin value, total protein level, alanine aminotransferase (ALT) level, aspartate aminotransferase (AST) level, and total bilirubin level, creatinine, blood urea nitrogen (BUN), troponin, blood cell count, TSH, and histological evaluation of the pathology of human and non-human organs. A "non-human animal" can be an amphibian, reptile, bird, or mammal other than a human. The non-human animal can be, for example, any mammal other than a human, such as a primate, chicken, mouse, rat, pigeon, dog, cat, cow, horse, goat, camel, sheep. Preferably, the non-human animal is a mouse.

[0017] The present disclosure further provides a method for screening substances that act on human liver function, comprising the following: (a) administering a test substance to the chimeric mice of the present disclosure; (b) measuring one or more values in the chimeric mice to which the test substance was administered in (a); and (c) comparing with one or more values measured in chimeric mice to which the test substance has not been administered, and selecting a test substance that causes an increase or decrease in the one or more values measured in (b). Preferably, the one or more values are selected from the group consisting of metabolites of the test substance, human albumin concentration, body weight curve, liver weight to body weight ratio, total albumin value, total protein level, ALT level, AST level, and total bilirubin level, and histological evaluation of the pathology of human and non-human organs.

[0018] The present disclosure also provides a method for evaluating the toxicity of a test substance to human hepatocytes, comprising the following: (a) administering a test substance to the chimeric non-human animals of the present disclosure; (b) measuring one or more indicators in the chimeric non-human animals to which the test substance was administered in (a); and (c) comparing with one or more indicators measured in chimeric non-human animals to which the test substance has not been administered, and using the one or more indicators measured in (b) to evaluate the effect of the test substance on human hepatocytes. Preferably, the one or more indicators are selected from the group consisting of an increase or decrease in metabolites of any one or more test substances, human albumin concentration, body weight curve, liver weight to body weight ratio, total albumin value, total protein level, ALT level, AST level, and total bilirubin level, and histological evaluation of the indicators in human and non-human organs. The "non-human animal" can be an amphibian, a reptile, a bird, or a mammal other than a human. The non-human animal can be, for example, any mammal other than a human, such as a primate, a bird, a mouse, a rat, a chicken, a dog, a cat, a cow, a horse, a goat, a camel, a sheep. Preferably, the non-human animal is a mouse.

[0019] Throughout the specification, the word "comprising", or variations such as "comprises" or "comprising", is understood to mean that the recited element, integer or step, or group of elements, integers or steps, is included, but does not exclude other elements, integers or steps, or group of elements, integers or steps.

[0020] "About" can be understood to be within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the recited value. Unless otherwise apparent from the context, all numerical values provided in this specification are modified by the term "about".

[0021] Although the disclosure has been described in conjunction with its detailed description, the above description is intended to be illustrative only and not intended to limit the scope of the disclosure, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

[0022] The patents and scientific literature referred to in this specification establish knowledge available to those skilled in the art. All U.S. patents and published or unpublished U.S. patent applications cited herein are incorporated by reference. All published foreign patents and patent applications cited herein are incorporated herein by reference. Genbank and NCBI deposits indicated by accession numbers cited herein are incorporated herein by reference. All other published references, documents, manuscripts, and scientific literature cited herein are incorporated herein by reference.

[0023] A patent or application file contains at least one colored drawing. Copies of this patent or patent application publication, which include a colored drawing, are provided by the Patent Office upon payment of the fee required for the claims.

[0024] The foregoing features and additional features will be more clearly understood from the following detailed description when taken in conjunction with the accompanying drawings.

Brief Description of the Drawings

[0025]

Figure 1A

Figure 1B-1C

Figure 1D

Figure 2A-2B

Figure 2C

Figure 2D-2E

Figure 3A-3B

Figure 3C-3D

Figure 3E

Figure 4A-4B

Figure 5

Figure 6A

Figure 6B

Figure 7A

Figure 7B

Figure 8

Figure 9

Figure 10

Figure 11A-11B

Figure 12A-12B

Figure 13A-13B

Figure 14A-14C

Figure 15

[0026]

Figure 16A-16B

Figure 17

Figure 18

Figure 19A-19B

Figure 20

Figure 21A-21B

Figure 22

Figure 23

Figure 24

Figure 25A-25D

Mode for Carrying Out the Invention

[0027] Detailed Description of the Invention Human liver chimeric mice have been recently introduced to predict human xenobiotic metabolism and toxicity. Despite their potential, the presence of mouse liver containing an extended set of P450 cytochromes makes it difficult to accurately predict human drug metabolism. Therefore, the present disclosure provides a conditional knockout mouse of the NADPH-P450 oxidoreductase (Por) gene, and it is the sole electron donor for all mouse cytochromes and, when deleted, is embryonically lethal 1 , thereby enabling the functional inactivation of all mouse cytochromes.

[0028] Any mouse containing mutations and / or transgenes that enable its liver to repopulate with human hepatocytes may be used in combination with a conditional knockout allele of the NADPH-P450 oxidoreductase (Por) gene or other genomic deletions. In embodiments, a mouse containing mutations and / or transgenes that enable its liver to repopulate with human hepatocytes is (i) an FRG (Fah - / - / Rag2 - / - / Il2rg - / - ) mouse, (ii) a transgenic uPA mouse (one that overexpresses urokinase-type plasminogen activator (uPA) in the liver under an inducible promoter, preferably the albumin promoter restricted to the liver), (iii) a TK-NOG mouse (an immunodeficient NOG mouse with transgenic expression of thymidine kinase under the control of the albumin promoter restricted to the liver), (iv) a mouse expressing inducible caspase 8 in the liver, (v) a mouse expressing inducible caspase 9 in the liver, or (vi) a mouse expressing a human heparin-binding epidermal growth factor-like receptor (BH-EGF)-like receptor under the control of the liver cell-specific albumin promoter (alb-TRECK). By using such mice in combination with an adenovirus expressing CRE or a transgenic strategy, a nearly complete deletion of the mouse Por gene can be created, leading to exclusive human cytochrome metabolism.

[0029] In uPA SCID mice (Rhim et al 1994; Tateno et al. 2004), the genetic cause of mouse hepatocyte resection is urokinase plasminogen activator (uPA); the mice are in a SCID immunodeficient background or Rag2 (or Rag1) - / - and / or Il2rg - / - status, all leading to the ability to transplant and implant human hepatocytes.

[0030] In FRG mice (Azuma et al 2007 7 , Bissig et al 2007 5 ), the genetic cause of mouse hepatocyte resection is fumarylacetoacetate hydrolase deletion, and mouse hepatocyte resection is controlled by ±NTBC and / or ± low tyrosine diet; the mice are in an Il2rg - / - and Rag2 - / - background status. FRG mice combine an immunodeficiency-mediated mutation group within the recombination activating gene 2 (Rag2) and the γ chain of the interleukin 2 receptor (Il2rg) with a functional knockout of the fumarylacetoacetate hydrolase (Fah) gene (Azuma et al 2007 7, Bissig et al 2007 5 ). The latter gene encodes an enzyme in the tyrosine catabolism pathway, and its mutation leads to the intracellular accumulation of toxic intermediates in hepatocytes. Different from the uPA / SCID model, the onset and severity of hepatocyte injury in FRG mice are controllable by the administration and discontinuation of the protective agent 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3-cyclohexanedione (NTBC), and it blocks an enzyme upstream of the tyrosine pathway, thereby preventing the accumulation of toxic intermediates.

[0031] In TK-NOG mice (Hasegawa et al 2011), the genetic cause of mouse hepatocyte resection is herpes simplex virus thymidine kinase, and mouse hepatocyte resection is controlled by ± ganciclovir; the mice are in an Il2rg - / -and is in a SCID background state. Mouse hepatocyte resection in this TK-NOG model was achieved by the liver-specific expression of herpes simplex virus 1 thymidine kinase (HSVtk) in severely immunodeficient NOG mice and the administration of ganciclovir (GCV), taking advantage of the fact that HSVtk converts non-toxic GCV into a toxic intermediate by other means.

[0032] In AFC8 mice (Washburn et al 2011), the genetic cause of mouse hepatocyte resection is the FK508-capsae8 fusion, and mouse hepatocyte resection is controlled by ±AP20187; the mouse is in an Il2rg - / - and Rag2 - / - background state.

[0033] In Alb-TRECK / SCID mice (Zhang et al 2015), the genetic cause of mouse hepatocyte resection is the human heparin-binding EGF-like receptor, and mouse hepatocyte resection is controlled by ±diphtheria toxin; the mouse is in a SCID immunodeficient background state.

[0034] Sheer and Wilson, 2015 compare the main features of various different liver humanization models and liver reconstruction processes in the most frequently used models to date. This reference is hereby incorporated by reference in its entirety.

[0035] The present disclosure also provides a method of using humanized, mouse Por-deficient mice to predict human drug metabolism. In certain embodiments, FRG mice are combined with conditional Por - / - mice to create a (PIRF (Por - / - Il2rg - / - / Rag2 - / - / Fah - / - ) strain. Homozygous PIRF mice are fertile and can repopulate human hepatocytes that result in high human chimerism (>80% human).

[0036] The human p450 cytochrome cluster contains 57 putative functional genes and 58 pseudogenes, while the mouse cytochrome cluster consists of 102 putative functional genes and 88 pseudogenes and is greatly expanded. 2 This allows for a precise prediction of human drug metabolism following antigen administration to mice. In addition, hepatotoxicity, along with hypersensitivity / dermal reactions, has the poorest correlation with animal studies and yet remains the most frequent reason for toxicity leading to the discontinuation of drugs in clinical development. 3 .

[0037] Since the liver is the major organ for drug metabolism, human liver chimeric mice are increasingly used for in vitro substance research. 4-6 The shortcoming of humanized mice is the remaining mouse liver tissue. Even in mice that can achieve high human chimerism, it has previously been shown that the average humanization rate is 42%. 7 To functionally block mouse cytochrome metabolism, a conditional (floxed exons 3 and 4) knockout of the NADPH-P450 oxidoreductase (Por) gene was created by targeting mouse embryonic stem cells (Figure 4). 8 Injected blastocysts and appropriately targeted embryonic stem cells produced mice with germ cell transmission of the Por "knock-out first" allele. 9 Expression from the targeted Por locus using a lacZ expression cassette was confirmed in fetal and adult liver (Figure 5). The mice were then bred with a flippase-expressing strain 10 to generate a CRE recombinase conditional Por knockout strain. Homozygous mutants from this strain were targeted for simultaneous deletion of essential exons of the Il2-rg, Rag2, and Fah genes (Figure 6) using a bacterial type II clustered, regularly interspaced short palindromic repeat / Cas9 (CRISPR-Cas9) system 11-13Inject together to generate the PIRF strain (Figure 1A). Homozygous PIRF mice are immunodeficient (T-, B-, and NK cell deficient), but healthy and fertile. Since adenoviral gene therapy vectors efficiently transduce hepatocytes in vivo, the Por gene was deleted using an adenovirus encoding CRE recombinase (Adeno-CRE). Increasing doses of the virus (2.2×10 8-10 ) were injected intravenously into PIRF mice. Quantitative RT-PCR of hepatic POR mRNA revealed effective deletion only at high doses (Figure 1B). These findings were confirmed by immunostaining for POR (Figure 1C), while on the other hand, minimal residual signal could be detected by Western blot even at the highest dose used (Figure 1D). POR-deficient PIRF mouse livers initiated lipid accumulation 2 weeks after adenoviral transduction, similar to previously reported liver-specific Por deficiency 14 (Figure 7).

[0038] To create human-specific P450 cytochrome metabolism, human hepatocytes 7、15、16 were transplanted into Por-deficient PIRF mice to generate human liver chimeric mice. However, since clonal expansion of residual Por-expressing mouse hepatocytes was observed in Adeno-Cre-treated PIRF mice (Figure 8), some humanized PIRF (Hu-PIRF) mice were injected with an additional dose of Adeno-Cre. Immunostaining revealed that almost complete deletion of the Por gene could be achieved only in doubly injected humanized PIRF (Hu-PIRF2x) mice (Figure 2A).

[0039] Next, gene expression profiles were compared in Hu-PIRF mice in which human hepatocytes with or without Por deficiency were regrown (Figure 2B). The expression of mouse P450 cytochrome was clearly altered for about half of the genes: 14 cytochromes were upregulated >1.5-fold, and 18 cytochromes were downregulated <0.5-fold (Figure 2c). The expression profiles of these mouse cytochromes were equivalent to those of previous studies in non-humanized mice (Table 1). Table 1 shows the comparison of the mouse gene expression profiles of chimeric livers with previously published non-humanized mice. The gene expression of conditional (Alb-Cre) Por KO mice was quantified by microarray analysis (Weng et al. 2005 J Biol Chem 280, 31686-31698 (2005)). Here, RNA-Seq was used to compare gene expression in humanized livers transduced with Adeno-Cre and Adeno-GFP (Figure 2B). Table 1 lists all of the previously published cytochromes along with the values (fold changes) compared to the dataset described herein. Multiple numbers represent multiple sets of microarray probes.

[0040]

Table 1

[0041] In the same chimeric liver, all human P450 cytochromes were downregulated by the deletion of mouse Por, except for CYP2C18 (Figure 2D). Half of the human cytochromes were reduced only slightly (<50%), and the other half, including CYP3A4 and CYP2C19, were more significantly downregulated (>1.5-fold).

[0042] Not all human cytochromes play an important role in xenobiotic metabolism. Of the 200 major prescription drugs in the United States, approximately three-quarters are metabolized by P450 cytochromes, with CYP3A4 / 5, 2C9, 2C19, 2D6, and 1A2 accounting for 95% of them. 17These human cytochrome clusters from the chimeric liver (Hu-PIRF2x) were compared to the resulting isogenic primary hepatocytes after isolation from the donor liver. The expression levels were similar to the major clusters strongly expressed in the chimeric liver and these important cytochromes (Figure 3D).

[0043] To demonstrate the utility of Hu-PIRF mice for human drug metabolism, the xenobiotic metabolism of gefitinib 18 , an inhibitor of the epidermal growth factor receptor used against lung cancer and various other cancers 19 was tested. Gefitinib is mainly metabolized by the P450 cytochrome system including CYP3A4 and 2D6. New gefitinib metabolites have recently been identified and demonstrated 20 a large difference between human and mouse liver microsomes. Gefitinib is excreted in feces, and less than 7% in urine, regardless of dose, route or species 21、22 . Therefore, the feces of non-humanized PIRF mice were analyzed for gefitinib metabolites during the first 24 hours after intravenous injection of gefitinib. Mass spectrometry revealed a reduction in several gefitinib metabolites due to the deletion of the Por gene, implicating a Por-dependent P450 cytochrome deficiency for these metabolites (Figure 3A). The largest and most relevant reduction was observed for O-desmethyl gefitinib (M4, M523595), which is the most abundant metabolite in human feces, while rodents produce many different metabolites including M4 21、22(Figure 3B). Therefore, M4 metabolites were analyzed in mouse Por-deficient and Por-expressing humanized and non-humanized control mice (Figure 9). The highest levels of M4 can be detected in mouse Por-deficient Hu-PIRF mice, where human hepatocytes preferentially metabolize gefitinib to M4 and the remaining mouse hepatocytes are inhibited in their drug metabolism (Figure 3C). Mouse hepatocytes preferentially generate metabolites other than M4, but human-specific metabolites were measured. M28 is the most abundant human metabolite and it cannot possibly be detected in non-humanized control mice. Mass spectrometry again showed the highest levels of this human-specific metabolite in mouse Por-deficient Hu-PIRF mice, confirming a more human-like metabolism in these mice (Figure 3D). Human xenobiotic metabolism was also measured with another drug, but this time using liver homogenates from PIRF mice. It had previously been demonstrated using human and mouse microsomes that atazanavir metabolite M15 is primarily a human metabolite (see Li, F et al., “CYP3A-mediated generation of aldehyde and hydrazine in atazanavir metabolism.” Drug Metab Dispos 39, 394-401). Mice were injected intravenously with a retroviral therapeutic and the liver was excised 30 minutes after injection. The results showed that M15 was increased 5.4-fold in POR-deficient humanized PIRF mice compared to non-deficient mice (Figure 3E), again confirming optimized human drug metabolism in this new mouse model.

[0044] The identification of human metabolites using current experimental animal models is a major challenge. Nevertheless, the identification of reactive metabolites is important because they are determinants of human drug toxicity. 23、24。The novel humanized mouse model of the present disclosure inhibits mouse drug metabolism without interfering with human metabolism. Mouse Por deficiency humanization can be used in combination with other repopulation models such as transgenic uPA mice, and can more easily identify human-specific metabolites for better benefits of drug safety.

[0045] Identification of most human or human-specific metabolites is possible using the present disclosure regardless of toxicity. Toxicity exists; however, this is not always the case. For example, as shown herein, gefitinib does not cause even a slight increase in liver enzymes, yet mainly human metabolites were identified.

[0046] The present disclosure provides a method for preparing a chimeric mouse substantially lacking mouse hepatocytes and instead containing human hepatocytes, the method comprising the following steps: (a) providing a mouse containing knockout mutations in each of the Il2-rg, Rag2, and Fah genes, and a floxed allele of the NADPH-P450 oxidoreductase (Por) gene, together with a first administration of a virus encoding Cre recombinase, thereby causing a conditional knockout of the Por gene in Il2-rg, Rag2, and Fah deficient mice, or a knockout of the Por gene using somatic genome engineering (CRIPSR / Cas9) and a gene therapy vector; (b) transplanting human hepatocytes into the mouse; and (c) providing a second administration of a virus encoding Cre recombinase to the mouse. Steps (a) and (b) may occur sequentially or simultaneously.

[0047] The conditional knockout POR allele can also be created by delivery of CRE recombinase by any method known in the art. Non-limiting examples of Cre recombinase delivery include viral or non-viral gene therapy vectors. In one embodiment, the gene therapy vector is an adenovirus. For example, delivery of the Cre recombinant gene under a cell, tissue, or developmentally specific promoter, or under an inducible promoter is also contemplated. In fact, Cre recombinase is activated in the mouse liver of transgenic animals by Cre expressed under albumin or other liver-specific promoters (Figure 11).

[0048] The present disclosure also provides a chimeric mouse, its offspring, or a part thereof, and it has a chimeric liver containing human hepatocytes. Preferably, the chimeric mouse, its progeny, or a part thereof is prepared by the method of the present disclosure. The chimeric mouse may be immunodeficient.

[0049] In the present disclosure, examples of the murine part include parts of a mouse. The term "part of a mouse" refers to mouse-derived tissues, body fluids, cells, their disrupted products or extracts therefrom, such as (examples thereof are not particularly limited thereto). Examples of such tissues include, but are not limited to, the heart, lungs, kidneys, liver, gallbladder, pancreas, spleen, intestine, muscle, blood vessels, brain, testis, ovary, uterus, placenta, bone marrow, thyroid gland, thymus, and mammary gland. Examples of body fluids include, but are not limited to, blood, lymph, and urine. The term "cells" refers to cells contained in the above-mentioned tissues or body fluids, and examples thereof include cultured cells, sperm cells, eggs, and fertilized eggs obtained by isolation and culture thereof. Examples of cultured cells include both primary cultured cells and cells of established cell lines. Examples of the murine part also include tissues, body fluids, and cells at the developmental stage (embryonic formation period), and their disrupted products or extracts. In addition, established cell lines from the mice of the present disclosure can be established using known methods (Primary Culture Methods for Embryonic Cells (Shin Seikagaku Jikken Koza (New Biochemical Experimental Lecture Series), Vol. 18, pages 125-129, TOKYO KAGAKU DOZIN CO., LTD., and Manuals for. Mouse Embryo Manipulation, pages 262-264, Kindai Shuppan)).

[0050] The mouse of the present disclosure may be an immunodeficient mouse. The immunodeficient mouse of the present disclosure may be used as a host mouse for transplantation of human hepatocytes. Examples of "immunodeficient mice" can be any mouse that does not show a rejection reaction against hepatocytes from another animal origin (particularly human hepatocytes), and include, but are not limited to, SCID (severe combined immunodeficiency) mice showing deletion of T and B cell lines, mice that have lost T cell function due to gene deletion of the thymus (nude mice), and mice created by knocking out the RAG2 gene by known gene targeting methods (Science, 244: 1288-1292, 1989) (RAG2 knockout mice).

[0051] Moreover, the present disclosure provides a chimeric mouse having human hepatocytes. The chimeric mouse of the present disclosure may be immunologically incomplete. The chimeric mouse of the present disclosure can be prepared by transplanting human hepatocytes into the immunodeficient mouse of the present disclosure.

[0052] Since human hepatocytes are to be used for transplantation, human hepatocytes isolated from normal human liver tissue by conventional methods such as, for example, the collagenase perfusion method can be used. Thus, the isolated hepatocytes can also be used by thawing after cryopreservation. Alternatively, chimeric mouse hepatocytes, defined as human hepatocytes isolated by techniques such as, for example, the collagenase perfusion method from a chimeric mouse liver (where mouse hepatocytes have been replaced by human hepatocytes), can be used in a fresh state, and cryopreserved chimeric mouse hepatocytes are also available for use after thawing.

[0053] Such human hepatocytes can be transplanted into the liver via the spleen of the mouse of the present disclosure. Such human hepatocytes may also be directly transplanted via the portal vein. The number of human hepatocytes to be transplanted can range from about 1 to 2,000,000 cells, and preferably can range from about 200,000 to 1,000,000 cells. The gender of the mouse of the present disclosure is not particularly limited. Also, the age of the mouse of the present disclosure at the time of transplantation is not particularly limited. When human hepatocytes are transplanted into a young mouse (early week age), the human hepatocytes proliferate more actively as the mouse grows. Therefore, after birth, mice about 0 to 40 days old, and particularly, mice about 8 to 40 days old after birth are preferably used.

[0054] The transplanted human hepatocytes consist of human chimeras of more than about 1% of all hepatocytes in the chimeric liver of the chimeric non-human animal, for example, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% of any percentage.

[0055] The present disclosure further provides a method for screening a substance that acts on human liver function, which involves using the chimeric mouse of the present disclosure. Examples of the method include the following steps: (a) administering a test substance to the chimeric mouse of the present disclosure; (b) measuring one or more values in the chimeric mouse to which the test substance was administered in (a); and (c) selecting a test substance that causes an increase or decrease in the one or more values measured in (b) as compared to one or more values of the chimeric mouse to which the test substance has not been administered, which is an evaluation method.

[0056] Preferably, the one or more values are selected from the group consisting of metabolites of the test substance, human albumin concentration, body weight curve, liver weight to body weight ratio, total albumin value, total protein level, ALT level, AST level, and total bilirubin level, and histological evaluation of the toxicity of human and non-human organs.

[0057] Examples of "test substances" in the method of the present disclosure are not particularly limited, and include natural compounds, organic compounds, inorganic compounds, proteins, antibodies, peptides, and single compounds such as amino acids and nucleic acids, as well as compound libraries, expression products from gene libraries, cell extracts, cell culture supernatants, products of fermented microorganisms, extracts from marine organisms, plant extracts, extracts from prokaryotic cells, extracts from eukaryotic single cells, and extracts from animal cells. These products may be purified products or unpurified products such as plant, animal, or microbial extracts, for example. Also, the method for producing the test substance is not particularly limited. The test substance used in the present specification may be a substance isolated from a natural product, chemically or biochemically synthesized, or prepared by genetic engineering techniques.

[0058] The above test substances are appropriately labeled and then used as needed. Examples of labels include radiolabels and fluorescent labels. Examples of test substances include, in addition to the above test samples, mixtures of multiple types of these test samples.

[0059] Examples of test samples include, but are not limited to, feces, urine, blood (and any blood products such as whole blood, serum, and plasma), and tissues such as liver tissue. The liver tissue may be obtained from a sample of the liver (such as a biopsy specimen or an explant) or from an entire, intact liver removed, for example, after sacrificing a mouse.

[0060] Examples of methods for administering a test substance to a mouse are not particularly limited. Such an administration method can be appropriately selected from oral administration or parenteral administration such as subcutaneous, intravenous, topical, transdermal, and enteral (intrarectal) administration, depending on the type of test substance to be administered.

[0061] The present disclosure further provides a method for evaluating the hepatotoxicity of a test substance to human hepatocytes, which involves the use of the chimeric mice of the present disclosure. Examples of this method include the following steps: (a) administering the test substance to the chimeric mice of the present disclosure; (b) measuring one or more values in the chimeric mice to which the test substance was administered in (a); and (c) using the one or more indicators measured in (b) to evaluate the effect of the test substance on human hepatocytes by comparing them with one or more indicators of the chimeric mice to which the test substance has not been administered.

[0062] Preferably, the one or more values are selected from the group consisting of metabolites of the test substance, human albumin concentration, body weight curve, liver weight to body weight ratio, total albumin value, total protein level, ALT level, AST level, and total bilirubin level. Preferably, the one or more indicators are selected from the group consisting of an increase or decrease in any one or more of human albumin concentration, body weight curve, liver weight to body weight ratio, total albumin value, total protein level, ALT level, AST level, and total bilirubin level.

[0063] The human nuclear sequence encoding the representative Por gene of the present disclosure consists of or includes Genbank accession number: NM_000941.2.

[0064]

Chemical formula

[0065] The human amino acid sequence corresponding to the sequence encoding the representative Por gene of the present disclosure consists of or includes Genbank accession number: NP_000932.3.

[0066]

Chemical formula

[0067] The mouse nuclear sequence encoding a representative Por gene of the present disclosure consists of or includes Genbank accession number: NM_008898.2.

[0068]

Chem.

[0069] The mouse amino acid sequence corresponding to the sequence encoding a representative Por gene of the present disclosure consists of or includes Genbank accession number: NP_032924.1.

[0070]

Chem.

[0071] The human nuclear sequence encoding a representative II2-rg gene of the present disclosure consists of or includes Genbank accession number: NM_000206.2.

[0072]

Chem.

[0073] The human amino acid sequence corresponding to the sequence encoding a representative II2-rg gene of the present disclosure consists of or includes Genbank accession number: NP_000197.1.

[0074]

Chem.

[0075] The mouse nuclear sequence encoding a representative II2-rg gene of the present disclosure consists of or includes Genbank accession number: NM_013563.4.

[0076]

Chem.

[0077] The mouse amino acid sequence corresponding to the sequence encoding the representative II2-rg gene of the present disclosure consists of or includes Genbank accession number: NP_038591.1.

[0078]

Chemical formula

[0079] The human nuclear sequence encoding the representative Rag2 gene of the present disclosure consists of or includes Genbank accession number: NM_000536.3.

[0080]

Chemical formula

[0081] The human amino acid sequence corresponding to the sequence encoding the representative Rag2 gene of the present disclosure consists of or includes Genbank accession number: NP_000527.2.

[0082]

Chemical formula

[0083] The mouse nuclear sequence encoding the representative Rag2 gene of the present disclosure consists of or includes Genbank accession number: NM_009020.3.

[0084]

Chemical formula

[0085] The amino acid sequence corresponding to the sequence encoding the representative Rag2 gene of the present disclosure consists of or includes a gene consisting of Genbank accession number: NP_033046.1.

[0086]

Chemical formula

[0087] The human nuclear sequence encoding a representative Fah gene of the present disclosure consists of or includes a gene consisting of Genbank accession number: NM_000137.2.

[0088]

Chemical formula

[0089] The human amino acid sequence corresponding to the sequence encoding a representative Fah gene of the present disclosure consists of or includes a gene consisting of Genbank accession number: NP_000128.1.

[0090]

Chemical formula

[0091]

Chemical formula

[0092] The mouse amino acid sequence corresponding to the sequence encoding a representative Fah gene of the present disclosure consists of or includes a gene consisting of Genbank accession number: NP_034306.2.

[0093]

Chemical formula

[0094] The following examples are provided to more fully illustrate the claimed disclosure and should not be construed as limiting the scope of the present disclosure. To the extent that specific monomers are mentioned, it is for illustrative purposes only and not intended to limit the disclosure. Those skilled in the art may develop equivalent means or reactants without exercising inventive faculty and without departing from the scope of the present disclosure.

Examples

[0095] Example 1: Generation of Por-floxed mouse strain The Por knockout first targeting vector was purchased from the National Institutes of Health (NIH) Knockout Mouse Program (KOMP) (Figure 4A). The vector was linearized using the AsisI restriction enzyme, and the DNA was electroporated into Jm8A3 mouse embryonic stem cells (ESCs) (Pettitt, S.J. et al. “Agouti C57BL / 6N embryonic stem cells for mouse genetic resources.” Nat Methods 6, 493-495 (2009)) by the mouse embryonic stem cell core at Baylor College of Medicine. Integration clones were selected using neomycin resistance. The DNA of the ESC clones was digested with the NSiI restriction enzyme and screened for site-specific integration by Southern blotting using the DIG non-isotopic detection system (Roche Applied Biosciences) according to the manufacturer's instructions (full blot in Figure 17). 500bp-sized 5’ and 3’ probes that bind outside the homologous arms of the vector were synthesized using the following primer sets.

[0096] 5’POR Fw2 GGCCTCAGAGAGGACATAGTGCCC (SEQ ID NO: 1)

[0097] 5’POR Rev2 GCCCTCTGGTGTCAGGTCCC (SEQ ID NO: 2)

[0098] 3’POR Fw2 CCTCACGCAGCTTAATGTGGCC (SEQ ID NO: 3)

[0099] 3’POR Rev2 GGAAGTTAAGGACGTGATTACAGGGAGC (SEQ ID NO: 4)

[0100] Properly targeted ESC cells were injected into C57 / BL blastocysts by the Genetically Engineered Mouse Core at Baylor College of Medicine. Male chimeras were bred with C57 / BL albino females (Taconic) to enable germline transmission of the targeted ESCs. The FRT - flanked LacZ and neomycin cassettes were removed to generate conditional POR knockout strains, and the mice were mated with Rosa26 FLPe strains (Farley, F.W., Soriano, P., Steffen, L.S. & Dymecki, S.M. “Widespread recombinase expression using FLPeR (flipper) mice.” Genesis 28, 106 - 110 (2000)). Genotyping was performed by Transnetyx (Cordova, TN).

[0101] Example 2: X - Gal Staining

[0102] Fetal and fresh liver sections were fixed in 4% PFA at 4°C for 1 hour, washed with X - Gal rinse buffer (1× PBS containing 0.02% Igepal and 0.01% deoxycholate) for 2×30 minutes, followed by incubation overnight with X - Gal staining solution (1× PBS containing 5 mM K3Fe(CN)6, 5 mM K4Fe(CN)6, 0.02% Igepal, 0.01% deoxycholate, 2 mM MgCl2, 5 mM EGTA and 1 mg / ml fresh X - Gal). Samples were post - fixed in 4% PFA at 4°C overnight.

[0103] Example 3: Generation of PIRF (Por c / c / Il2rg - / - / Rag2 - / - / Fah - / - ) Mouse Strains

[0104] The important exons targeting the 6 gRNA sequences of the Rag2, Il2-rg, or Fah genes were selected using two different online tools (crispr.mit.edu and COSMID) (Cradick, T.J., Qiu, P., Lee, C.M., Fine, E.J. & Bao, G. “COSMID: A Web-based Tool for Identifying and Validating CRISPR / Cas Off-target Sites.” Molecular therapy. Nucleic acids 3, e214 (2014)) (Figure 1A, Figure 6, and Figure 7). Complementary oligonucleotides were annealed and ligated into the DR274 vector (Addgene plasmid # 42250) (Hwang, W.Y. et al. “Efficient genome editing in zebrafish using a CRISPR-Cas system.” Nat Biotechnol 31, 227-229 (2013)) using standard molecular cloning techniques with restriction enzyme BsaI (NEB) and T4 DNA ligase (NEB). The T7 bacterial promoter sequence was inserted upstream of the Cas9 transcription start site in the pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene plasmid # 42230) using standard molecular cloning techniques (Cong, L. et al. “Multiplex genome engineering using CRISPR / Cas systems.” Science 339, 819-823 (2013)). The DR274 vector was cut using DraI (NEB) and gel purified using the Zymoclean Gel DNA Recovery Kit (Zymo, Cat#11-301). In vitro transcription of sgRNA was performed using the MEGAshortscript T7 Transcription Kit (life tech AM1345) according to the manufacturer's instructions.The obtained RNA was purified using RNA Clean&Concentrator-5 (Zymo, R1015) and dissolved in RNase-free water. Synthesis was confirmed by polyacrylamide gel electrophoresis. pX330 (containing the T7 promoter) was digested with NcoI and NotI and gel purified. Cas9 mRNA was synthesized from the digested pX330-T7 vector using the mMessage mMachine T7 ULTRA Kit (life tech AM1345) according to the manufacturer's protocol. Polyadenylation was confirmed by denaturing agarose gel electrophoresis (1% agarose and 6.6% formaldehyde in MOPS buffer).

[0105] Por c / c Zygotes from mice were injected with S. pyogenes Cas9 mRNA (60 ng / μl) and six gRNAs (15 ng / μL each). All possible zygotes were implanted into three pseudopregnant females. To detect the deletion region, all 23 offspring were genotyped after weaning using the following primers:

[0106] Fah Fw CTGGGTTGCATACTGGTGGG (SEQ ID NO: 5)

[0107] Fah Rev AAACAGGGTCTTTGCTGCTG (SEQ ID NO: 6)

[0108] Fah Int Fw ACAAAGGTGTGGCAAGGGTT (SEQ ID NO: 7)

[0109] Il2 Fw CCACCGGAAGCTACGACAAA (SEQ ID NO: 8)

[0110] Il2 Rev GGGGGAATTGGAGGCATTCT (SEQ ID NO: 9)

[0111] Il2 Int Rev CTTCTTCCCGTGCTACCCTC (SEQ ID NO: 10)

[0112] Rag2 Fw CCTCCCACCTCTTCGTTATCC (SEQ ID NO: 11)

[0113] Rag2 Rev AGTCTGAGGGGCTTTTGCTA (SEQ ID NO: 12)

[0114] Rag2 Int Fw AGTCTGAGGGGCTTTTGCTA (SEQ ID NO: 13)

[0115] Additional genotyping of the offspring was performed by Transnetyx (Cordova, TN).

[0116] Example 4: Humanization of PIRF Mice

[0117] Hepatocytes (3×10 6 cells / mouse) were transplanted into the mouse liver of PIRF mice by splenic injection as originally described for mouse hepatocytes (Ponder, K.P. et al. “Mouse hepatocytes migrate to liver parenchyma and function indefinitely after intrasplenic transplantation.” Proc Natl Acad Sci U S A 88, 1217-1221 (1991)). Briefly, the abdominal cavity was opened by a midline incision and 3×10 6Individual human hepatocytes were injected into the spleen. Immediately after transplantation, a selection pressure directed at the transplanted human hepatocytes was applied by removing the drug nitisinone (NTBC) from the drinking water in the following steps: 25% for 2 days, 12% for the next 2 days, and finally 6% for 2 days relative to the colony maintenance amount before complete drug discontinuation (100% = 7.5 mg / l) (Bissig, K.D. et al. “Human liver chimeric mice provide a model for hepatitis B and C virus infection and treatment.” The Journal of clinical investigation 120, 924 - 930 (2010)). Mice with clinical symptoms (such as hunched posture, lethargy, weight loss, etc.) were returned to 100% nitisinone for several days before discontinuing the drug again as previously described. To measure the degree of human chimerism, human albumin in mouse blood (ELISA, Bethyl laboratories) was measured, which has been shown to correlate with the level of human chimerism previously evaluated by immunostaining of human hepatocytes (Bissig, K.D. et al. (2010)). Only mice with >70% human chimerism were further used. When indicated, some PIRF mice were injected intravenously with an adenovirus encoding CRE recombinase under 100 μl of the CMV promoter (Ad5 CMV - Cre, 2.3×10 11 pfu / ml, provided by the Vector Development Laboratory of Baylor College of Medicine) either 24 hours before hepatocyte transplantation and / or at any time when high human chimerism (>70%) was reached. Information on available hepatocyte donors is shown in Table 2. All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of Baylor College of Medicine. All animals (including controls) used for humanization were female due to fewer postoperative complications.

[0118] Example 5: qPCR

[0119] Total mRNA was isolated from fresh frozen tissue samples using the Purelink RNA Mini Kit (Invitrogen). 2 μg of total mRNA was reverse transcribed using qScript cDNA supermix (Quanta Biosciences), and 20 ng of cDNA was used for qPCR reactions, performed with Perfecta SYBR Green Fast Mix (Quanta Biosciences), and analyzed on an ABI Prism 7900HT Sequence Detection System (Applied Biosciences). The following primers were used for amplification of Por mRNA in PIRF mouse samples:

[0120] mPor Fw2: GGCCCCACCTGTCAAAGAGAGCAGC (SEQ ID NO: 14)

[0121] mPor Rev1: CAAACTTGACACCCGTGAGGTCC (SEQ ID NO: 15)

[0122] For humanized PIRF mouse liver samples, mouse Por and human POR were amplified using the following primer sets:

[0123] mPor Fw1: TCTATGGCTCCCAGACGGGAACC (SEQ ID NO: 16)

[0124] mPor Rev2: CCAATCATAGAAGTCCTGCGCG (SEQ ID NO: 17)

[0125] hPOR Fw1: CCAATCATAGAAGTCCTGCGCG (SEQ ID NO: 18)

[0126] hPOR Rev5: ACCTTGGCCGCATCTATGTCGG (SEQ ID NO: 19)

[0127] Each sample was normalized to Gapdh / GADPH as an internal control gene using the following primers:

[0128] mGapdh Fw: AGAACATCATCCCTGCATCCA (SEQ ID NO: 20)

[0129] mGapdh Rev: CAGATCCACGACGGACACATT (SEQ ID NO: 21)

[0130] hGAPDH fw: CAGAACATCATCCCTGCCTCTAC (SEQ ID NO: 22)

[0131] hGAPDH Rev: TTGAAGTCAGAGGAGACCACCTG (SEQ ID NO: 23)

[0132] Example 6: RNA-Seq Library

[0133] Total transcriptome RNA sequencing (RNA-Seq) was performed using total RNA extracted from fresh frozen liver tissue from which samples were taken from all seven liver lobes. Total RNA was isolated using the Purelink RNA Mini Kit (Invitrogen). Libraries were generated from total RNA using the TrueSeq Stranded mRNA LT Kit (Illumina) according to the manufacturer's recommendations. Libraries were sequenced on a NextSeq500 sequencer. The average reads per sample were 17 million. RNA-Seq TPM expression values were calculated using the read aligner Bowtie2 53 and RSEM 52 (version 1.2.17) applied to the combined human and mouse NCBI Refseq (3 / 21 / 16) transcriptomes. RNA sequencing data are available from the European Nucleotide Archive, ENA accession code PRJEB14714. Low-abundance cytochromes (human <20 TPM and mouse <20 TPM) were compared only if one of the experimental groups reached >20 TPM. Gene expression was determined using three human housekeeping genes and their mouse counterparts (PSMB2, PSMB4, RAB7A, and VPS2929; Psmb2, Psmb4, Rab7, and Vps29)54 It was normalized against 54 . The RNA-Seq data is available from the European Nucleotide Archive, ENA accession code PRJEB14714.

[0134] Example 7: Western blot

[0135] The Western blot method was performed as previously described (Bissig-Choisat, B. et al. “Development and rescue of human familial hypercholesterolaemia in a xenograft mouse model.” Nature communications 6, 7339 (2015)). Tissues from frozen livers were homogenized in RIPA buffer (Sigma, catalog number R0278-50ml) containing protease inhibitor (Roche, catalog number 04693159001). 30 μg of total protein was electrophoresed on a NuPAGE 4–12% Bis Tris Gel (Invitrogen, catalog number NP0336BOX) and transferred to a PVDF membrane (Millipore, catalog number IPVH00010). The blot was then blocked in 5% milk and subsequently incubated with the primary antibody. Rabbit anti-Por (Abcam catalog number ab13513) or mouse anti-β-actin (Sigma, catalog number A1978) was diluted 1:1,000 and 1:3,000, respectively (for the full blots in Figures 18 and 19). The secondary antibodies were donkey anti-rabbit IgG / HRP and donkey anti-mouse IgG / HRP (Jackson Immunoresearch Labs, catalog numbers 711-035-152 and 711-035-150), used at 1:10,000 and 1:50,000, respectively. The membrane was imaged using Amersham ECL Western Blotting Detection Reagent (General Electric Healthcare Life Sciences, catalog number RPN2106).

[0136] Example 8: Immunohistochemistry

[0137] 10-μm sections from cryopreserved tissue blocks were fixed with 3% PFA for 15 minutes and then incubated overnight at 4°C with the following primary antibodies: anti-Por (Abcam, catalog number ab13513) diluted 1:500, anti-human Nuclei (EMD Millipore, catalog number MAB1281) diluted 1:250 in PBS containing 0.2% Triton X-100 and 0.5% BSA. Secondary antibodies (1:1,000, Alexa-fluor conjugated, Molecular Probes) were incubated for 60 minutes at room temperature in the same buffer. Sections were mounted with Vectashield plus DAPI (Vector Labs).

[0138] Example 9: Mouse Management

[0139] All mice (6-10 months old, humanized or non-humanized) were maintained under a standard 12-hour light / dark cycle with water and diet provided ad libitum. All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) at Baylor College of Medicine.

[0140] Example 10: Sample Preparation for Mass Spectrometry

[0141] A group of mice was treated with gefitinib (10 mg / kg) (i.v.) and then housed separately in metabolic cages for 16 hours of fecal collection. Fecal samples were weighed and homogenized in water (100 mg of feces in 1,000 μl of H2O). Subsequently, 300 μl of methanol was added to 100 μl of the resulting mixture, followed by centrifugation at 15,000 g for 20 minutes. The supernatant was transferred to a new Eppendorf vial for a second centrifugation (15,000 g, 20 minutes). The final concentration of agomelatine was 2 μM. Each supernatant was transferred to an autosampler vial for analysis (described below).

[0142] For atazanavir metabolism in the liver, liver samples were collected 30 minutes after atazanavir (i.v., 30 mg / kg) treatment. Briefly, the liver was weighed and homogenized in water / MeOH with the internal standard agomelatine [100 mg of liver in 300 μl of H2O / MeOH (v / v 3:1)]. Subsequently, 300 μl of methanol was added to 100 μl of the resulting mixture, followed by centrifugation at 15,000 g for 20 minutes. For the second centrifugation (15,000 g, 20 minutes), the supernatant was transferred to a new Eppendorf vial. The final concentration of agomelatine was 2 μM in the sample. For analysis, each supernatant was transferred to an autosampler vial. 5 μl of each prepared sample was injected into a system combining ultra-high performance liquid chromatography (UHPLC) and quadrupole time-of-flight mass spectrometry (QTOFMS) for analysis.

[0143] Example 11: Mass spectrometry (UHPLC-QTOFMS analysis)

[0144] Metabolites from gefitinib and atazanavir were separated using a 1260 Infinity Binary LC System (Agilent Technologies, Santa Clara, CA) equipped with a 100 mm × 2.7 mm (Agilent XDB C18) column. The column temperature was maintained at 40 °C. The flow rate was 0.3 mL / min, and during a 15-minute run, a gradient containing 0.1% formic acid ranged from 2% to 98% aqueous acetonitrile. Quadrupole time-of-flight mass spectrometry (QTOFMS) was operated in positive ion mode using electrospray ionization. Ultra-high purity nitrogen was applied as the drying gas (12 L / min) and the collision gas. The drying gas temperature was set at 325 °C, and the nebulizer pressure was maintained at 35 psi. The capillary tube potential was set at 3.5 kV. During mass spectrometry, real-time mass correction and accurate mass were achieved by continuously measuring standard reference ions at m / z 121.0508 and 922.0098 in positive ion mode. Mass chromatograms and mass spectra were acquired by MassHunter Workstation data Acquisition software (Agilent, Santa Clara, CA) in the mass range of m / z 50 - 1000 with mass center and profile format. The collection rate was set at 1.5 spectra per second. The method used in this study was demonstrated by previous studies on gefitinib metabolism in human liver microsomes 39 。At the same time, quality control samples were performed every 10 samples during sample runs. Due to the lack of authentic compounds of the metabolites available, the identification of metabolites was based on their accurate masses and MS / MS fragments. Chromatograms and relative amounts of metabolites were performed by Qualitative Analysis software (Agilent, Santa Clara, CA). The relative amounts were evaluated based on the integrated peak areas of each metabolite.

[0145] Example 12: Statistics

[0146] The sample size for the experiment was determined by the differences estimated between groups and the availability of highly humanized mice. Neither randomization of animals before assignment to experimental groups nor blinding of experimental groups was performed. Statistical analysis was performed using PRISM version 6.0 software (Graph Pad software) using the Mann-Whitney test or ANOVA. Statistical significance was assumed at a p-value < 0.05( * ). Unless otherwise stated, bars in graphs represent mean ± SEM. Group size (N) represents the biological sample size.

[0147] Example 13: Generation of a novel mouse model for hepatocyte repopulation

[0148] To functionally disrupt mouse cytochrome metabolism, conditional (floxed exons 3 and 4) knockout of the NADPH-P450 oxidoreductase (Por) gene was created by targeting mouse embryonic stem cells 28 (Figure 4). Blastocysts injected with appropriately targeted embryonic stem cells gave rise to chimeras with germline transmission of the Por "knockout first" allele 29 . Expression from the targeted Por locus was confirmed using a lacZ expression cassette in fetal and adult livers (Figure 5). The following mice were mated with a flippase-expressing strain 30 to generate a CRE recombinase conditional Por knockout strain (Por c / c ). Simultaneous deletion of the important exons Il2-rg, Rag2, and Fah genes (Figures 6 and 7) in homozygous mutants from this strain was targeted using a bacterial type II clustered, regularly interspaced short palindromic repeat / Cas9 (CRISPR-Cas9) system 31、32、33We injected [the relevant substance] to generate the PIRF strain (Figure 1A). As a result, homozygous PIRF mice are immunodeficient, lacking T, B, and NK cells, but are healthy and fertile. Since adenoviral gene therapy vectors efficiently transduce hepatocytes in vivo, the Por gene was deleted using an adenovirus encoding CRE recombinase (Adeno-CRE). Increasing doses of the virus (2.2×10 8-10 ) were intravenously injected into PIRF mice. Quantitative RT-PCR of Por mRNA in the liver revealed effective deletion only with high doses of adenovirus (Figure 1B). These findings were confirmed by immunostaining of Por (Figure 1C), although minimal residual signal could be detected by Western blotting even at the highest dose used (Figure 1D). Por-deficient PIRF mouse livers began to accumulate lipids approximately 2 weeks after adenoviral transduction (Figure 2), but in contrast to the immunocompetent Alb-Cre / Por c / c strain 25、27 , there was no infiltration and no necrosis (Figure 20). Nevertheless, residual Por-expressing hepatocytes had a growth advantage over lipid-rich Por-deficient hepatocytes, and clonal expansion of some Por-expressing cells could be detected by immunostaining 4 weeks after adenoviral transduction (Figure 9).

[0149] Example 14: Characterization of Humanized PIRF Mice

[0150] We generated human liver chimeric mice using the PIRF strain 5、20、34 . To ensure that cytochrome P450 metabolism would be specific to humans, we administered Adeno-Cre (2.3×10 10(pfu / mouse) was injected, and in addition, in some highly humanized PIRF (Hu-PIRF) mice, an additional dose of Adeno-Cre was injected. Immunostaining revealed that almost complete deletion of the Por gene could be achieved only in double-injected humanized PIRF (Hu-PIRF2x) mice (Figure 2A). Quantitative PCR and Western blotting confirmed a large-scale deletion of mouse Por by adenoviral delivery of CRE (Figure 12). To compare PIRF mice in which human hepatocytes (Hu-PIRF) had repopulated after injection with either Adeno-CRE (Hu-PIRF2x) or Adeno-GFP, gene expression profiles were performed (Figure 2B). Human hepatocytes from the same liver donor were used to avoid individual variations (Table 2), and repopulated in both groups.

[0151] [Table 2]

[0152] The expression of mouse P450 cytochrome was clearly altered in 27 out of 38 genes analyzed after Por deletion (Figure 2C): 24 cytochromes were significantly upregulated (1.5 - 12.5-fold), and 3 cytochromes were significantly downregulated (0.5 - 0.3-fold). The expression profiles of these mouse cytochromes generally match those from previous studies in non-humanized, Por-deficient mice (Table 1). 35 In the human part of the same chimeric liver, human P450 cytochrome was not changed much by the deletion of mouse Por (Figure 2D). Half of the human cytochromes were only slightly changed (0.5 - 1.5-fold change), while the other half was moderately upregulated (1.5 - 2.4-fold).

[0153] Not all human cytochromes play an important role in xenobiotic metabolism. Of the 200 most prescribed prescription drugs in the United States, approximately three-quarters are metabolized by P450 cytochrome, and CYP3A4 / 5, 2C9, 2C19, 2D6, and 1A2 account for 95% of them. 36Comparison of these human cytochrome clusters from chimeric liver (Hu-PIRF2x) with primary hepatocytes of isogenic origin that developed. Two donor hepatocytes (Table 2) and corresponding human (isogenic) liver chimeric mice (N = 6) for this comparison. Expression levels were similar to the major clusters strongly expressed in chimeric liver and these important cytochromes (Figure 2E). Interestingly, several human clusters (CYP1A2, CYP2B6, CYP2C19, and CYP3A4) were expressed at higher levels in chimeric liver rather than in primary human hepatocytes.

[0154] Example 15: Xenobiotic Metabolism in Humanized PIRF Mice

[0155] To demonstrate Hu-PIRF mice for human drug metabolism, xenobiotic metabolism of gefitinib 37 , an inhibitor of epidermal growth factor receptor used against lung cancer and various other neoplasms 38 was used. Gefitinib is mainly metabolized by the P450 cytochrome system including CYP3A4 and 2D6. Gefitinib metabolites showed a large difference between human and mouse liver microsomes 39 , but regardless of dose, route, or species, gefitinib was mainly excreted in feces (less than 7% in urine) 40、41 . Then, feces of non-humanized PIRF mice were analyzed for gefitinib metabolites during the first 24 hours after intravenous injection of gefitinib.

[0156] Mass spectrometry revealed a reduction of some gefitinib metabolites due to deletion of the Por gene, implicating a Por-dependent P450 cytochrome deficiency for these metabolites (Figure 3A and Figure 13A). Since some metabolites were not significantly altered, the possibility of involvement of the mouse P450 cytochrome metabolic system with residual Por activity was tested. Por c / c strains were mated with transgenic mice expressing CRE under the albumin promoter. Alb-CRE / Por c / cPor protein was efficiently depleted in the livers of animals (Figure 14); nevertheless, the metabolic profiles formed after gefitinib injection were comparable to those of PIRF mice using adenovirus deficiency of Por (Figure 13). The similarity of this result indicates that gefitinib has both P450-dependent and -independent drug metabolisms.

[0157] The largest and most optimal reduction was observed for O-desmethyl gefitinib (M4, M523595), which is the most abundant metabolite in human feces by far. Rodents produce many different metabolites in addition to M4 40、41 (Figure 3B), so the M4 metabolite in mouse Por-deficient and humanized and non-humanized control mice with Por expression was analyzed (Figure 10). The highest level of M4 was detected in mouse Por-deficient Hu-PIRF mice, where human hepatocytes were preferentially used to metabolize gefitinib to M4 and residual mouse hepatocytes were inhibited in their drug metabolism (Figure 3C). Next, other human-specific metabolites were measured. The most abundant human metabolite is M28, which could not be detected at all in non-humanized control mice. Mass spectrometry again showed the highest levels of this human-specific metabolite in mouse Por-deficient Hu-PIRF mice (Figures 3D and 15), confirming that these mice exhibited liver metabolism closer to that of humans.

[0158] Por-deficient Hu-PIRF mice are a novel model system for drug metabolism studies, so for these major gefitinib metabolites, different body components, such as serum (1 hour after injection) and urine, were used for analysis. M4 could not be detected in urine and was greatly reduced in serum (23-fold in Hu-PIRF mice), while M28 could be detected at lower concentrations in both the urine and serum of Hu-PIRF mice (Figures 16A and 16B). Present at low levels in both compartments, M28 reflected the relative amounts observed in feces (Figure 3C). These findings support that gefitinib metabolites are mainly excreted by feces40、41 .

[0159] To confirm human xenobiotic metabolism using liver homogenates of PIRF mice, atazanavir, an antiretroviral drug (protease inhibitor) for the treatment of human immunodeficiency virus, was tested. Previous studies in human and mouse microsomes demonstrated that atazanavir metabolite M15 is the major human metabolite 42 . To measure the level of M15 in humanized PIRF mice, PIRF mice were injected intravenously with atazanavir and their livers were excised 30 minutes after injection. The M15 levels in Por-deficient humanized PIRF mice were 5.4-fold higher than those observed in non-deficient mice (Figure 3E), again indicating that these mice metabolize the drug as humans do.

[0160] Example 16: Deficiency of UDP-glucose 6-dehydrogenase (UGDH)

[0161] Deficiency of UDP-glucose 6-dehydrogenase (UGDH) leads to a deficiency of UDP-glucuronic acid, which is a substrate for all UDP-glucuronosyltransferases (UGTs). UGTs are glucuronidated hydrophobic drugs (phase II) in the liver, thereby contributing to the biotransformation of drugs in the liver; glucuronidated drugs become more polar (hydrophilic) and are thus more easily excreted. Deficiency of UGDH is embryonically lethal and thus needs to be conditionally or somatic genome engineered like POR. Troglitazone was developed as an antidiabetic drug but was withdrawn from the market due to hepatotoxicity. Interestingly, mice and humans metabolize drugs in different forms, meaning that humans mainly produce sulfate metabolites (the main plasma metabolite), while glucuronide conjugates of troglitazone are not so common in humans, in contrast to mice, which mainly produce glucuronide conjugates. Thus, in addition to Por deficiency and humanization, troglitazone provides an opportunity to demonstrate the effectiveness of an approach that inhibits UDP-glucuronosyltransferase (UGT) by deficiency of UDP-glucose 6-dehydrogenase (UGDH) in human liver chimeric mice.

[0162] Glutathione synthetase (GSS) catalyzes the second step of glutathione biosynthesis. Glutathione is a substrate for glutathione S-transferase (GST), and it binds molecules to hydrophobic drugs (phase II), thereby contributing to the biotransformation of drugs in the liver.

[0163] Apply somatic cell genome engineering to the simultaneous deletion of mouse P450 oxidoreductase (Por) and other mouse enzymes involved in drug metabolism in humanized mice. In humanized FRG mice (human albumin in mouse serum > 2 mg / ml), inject an adeno-associated virus (AAV, serotype 8) expressing an sgRNA targeting the initial exon of mouse Por, the UDP-glucose 6-dehydrogenase (Ugdh) or glutathione synthetase (Gss) gene (see gene therapy vector design, Figure 21). Inject the AAV one week before the injection of an adenovirus expressing Cas9 (7×10 9 pfu / Ad / mouse) (2×10 11 GC / AAV / mouse). Inject only the adenovirus vector into control mice (Figure 22, bottom row). The results show the deletion of the mouse por, as well as the ugdh and gss genes. The knockdown of mouse por by CRISPR / Cas9 in humanized mice is substantial but not as effective as the knockdown observed with the loxP / CRE system when viewed at the DNA (Figure 23) and protein levels (Figure 22). Also, the por deficiency is independent of the deficiency of the other two genes (ugdh and gss) because their sgRNAs (targeting molecules) are all on different AAV vectors, especially in FRG mice. However, immunostaining (Figure 22) demonstrated that a substantial amount of cells had deficiencies in por and gss (Figure 22), whereas the deficiency of ugdh was not as effective.

[0164] Humanized PIRF mice with transgenic Alb-CRE and deletion of other mouse enzymes involved in drug metabolism are used. Instead of adenoviral CRE, Por is deleted by the expression of CRE, and this PIRF mouse carries the Alb-CRE sequence in the mouse genome. These mice efficiently repopulate human hepatocytes, as demonstrated by >2 mg / ml of human-specific albumin in mouse blood and transthyretin (prealbumin) staining in chimeric livers (Figure 24). Since the albumin promoter is already expressed in the liver during late embryogenesis, mouse por is efficiently deleted in these chimeric mouse livers. Also, in these humanized PIRF mice, in addition to por, gss and ugdh are also deleted (Figure 23).

[0165] Example 17: Analysis of Troglitazone Metabolites

[0166] Troglitazone metabolites (2 hours after i.p. injection of 600 mg / kg of troglitazone) in the livers of humanized and non-humanized FRG mice with and without Por and Ugdh deficiencies were analyzed. The non-humanized livers of control mice had much larger amounts of glucuronide conjugates than human or humanized PIRF mice (Figure 24). Furthermore, the glucuronide conjugates were significantly reduced by the deficiencies of ugdh and por in non-humanized and humanized PIRF mice. This data supports that the deficiency of ugdh also leads to dysfunction or inactivation of UGT in human liver chimeric livers.

[0167] The present disclosure provides a next-generation humanized mouse model suitable for human drug metabolism with minimal interference from mouse P450 cytochrome. The production of human metabolites for two different drugs was compared between humanized PIRF mice and "normal" humanized FRG mice. The analysis revealed higher concentrations of human metabolites in the humanized PIRF mice than in the FRG mice in mouse feces and liver homogenates, demonstrating that these mice have humanized drug metabolism. The PIRF and FRG strains used in this study have a mixed (C57B and 129S) genetic background. Apart from potential differences in the background relative to two previously established FRG mouse strains 5、7 , our CRISPR / Cas9 created knockout strains that do not express any transgenes, such as neomycin phosphotransferase, which inactivates a broad range of aminoglycoside antibiotics. This model system is useful for the early detection of reactive metabolites and is a refined method that further prevents large and confounding clusters of drug-metabolizing mouse enzymes. In addition to the novel mouse model provided herein, the present disclosure provides (a) knockout of Por in combinations of multiple organs, such as the intestine and liver or the lung and liver, which would be desirable, (b) additional deficiencies in other drug-metabolizing enzymes, and / or, the achievement of a more efficient Por deficiency. However, the use of transgenic mice expressing Cre recombinase requires an additional mating step to quadruple transgenic (PIRF) mice, and the initial organ-specific deficiency would not result in a healthy strain suitable for xenotransplantation.

[0168] In summary, the present disclosure provides a novel mouse model that combines a human chimera with a functional deficiency of all mouse cytochromes due to Por deficiency. Such mouse Por-deficient humanization can be used in combination with other repopulation models, such as transgenic uPA mice 11、21 . Tests using two different drugs in two different body parts demonstrated that tests in humanized PIRF mice are useful for the efficient confirmation of human metabolites.

[0169] References 1. Olson H, et al. Concordance of the toxicity of pharmaceuticals in humans and in animals. Regulatory toxicology and pharmacology : RTP 32, 56-67 (2000). 2. Nelson DR, Zeldin DC, Hoffman SM, Maltais LJ, Wain HM, Nebert DW. Comparison of cytochrome P450 (CYP) genes from the mouse and human genomes, including nomenclature recommendations for genes, pseudogenes and alternative-splice variants. Pharmacogenetics 14, 1-18 (2004). 3. Guengerich FP, Cheng Q. Orphans in the human cytochrome P450 superfamily: approaches to discovering functions and relevance in pharmacology. Pharmacological reviews 63, 684-699 (2011). 4. Mercer DF, et al. Hepatitis C virus replication in mice with chimeric human livers. Nat Med 7, 927-933 (2001). 5. Bissig KD, Le TT, Woods NB, Verma IM. Repopulation of adult and neonatal mice with human hepatocytes: a chimeric animal model. Proc Natl Acad Sci U S A 104, 20507-20511 (2007). 6. Dandri M, et al. Repopulation of mouse liver with human hepatocytes and in vivo infection with hepatitis B virus. Hepatology 33, 981-988 (2001). 7. Azuma H, et al. Robust expansion of human hepatocytes in Fah(- / -) / Rag2(- / -) / Il2rg(- / -) mice. Nat Biotechnol 25, 903-910 (2007). 8. Hasegawa M, et al. The reconstituted 'humanized liver' in TK-NOG mice is mature and functional. Biochemical and biophysical research communications 405, 405-410 (2011). 9. Washburn ML, et al. A humanized mouse model to study hepatitis C virus infection, immune response, and liver disease. Gastroenterology 140, 1334-1344 (2011). 10. Suemizu H, et al. Establishment of a humanized model of liver using NOD / Shi-scid IL2Rgnull mice. Biochem Biophys Res Commun 377, 248-252 (2008). 11. Heckel JL, Sandgren EP, Degen JL, Palmiter RD, Brinster RL. Neonatal bleeding in transgenic mice expressing urokinase-type plasminogen activator. Cell 62, 447-456 (1990). 12. Tateno C, et al. Near completely humanized liver in mice shows human-type metabolic responses to drugs. Am J Pathol 165, 901-912 (2004). 13. Samuelsson K, et al. Troglitazone metabolism and transporter effects in chimeric mice: a comparison between chimeric humanized and chimeric murinized FRG mice. Xenobiotica; the fate of foreign compounds in biological systems 44, 186-195 (2014). 14. Lootens L, et al. Steroid metabolism in chimeric mice with humanized liver. Drug testing and analysis 1, 531-537 (2009). 15. Foster JR, et al. Differential effect of troglitazone on the human bile acid transporters, MRP2 and BSEP, in the PXB hepatic chimeric mouse. Toxicologic pathology 40, 1106-1116 (2012). 16. Xu D, et al. Fialuridine induces acute liver failure in chimeric TK-NOG mice: a model for detecting hepatic drug toxicity prior to human testing. PLoS medicine 11, e1001628 (2014). 17. Bateman TJ, Reddy VG, Kakuni M, Morikawa Y, Kumar S. Application of chimeric mice with humanized liver for study of human-specific drug metabolism. Drug Metab Dispos 42, 1055-1065 (2014). 18. Nishimura T, et al. Using chimeric mice with humanized livers to predict human drug metabolism and a drug-drug interaction. J Pharmacol Exp Ther 344, 388-396 (2013). 19. Tanoue C, et al. Prediction of human metabolism of the sedative-hypnotic zaleplon using chimeric mice transplanted with human hepatocytes. Xenobiotica; the fate of foreign compounds in biological systems 43, 956 - 962 (2013). 20. Bissig KD, et al. Human liver chimeric mice provide a model for hepatitis B and C virus infection and treatment. The Journal of clinical investigation 120, 924 - 930 (2010). 21. Meuleman P, et al. Morphological and biochemical characterization of a human liver in a uPA - SCID mouse chimera. Hepatology 41, 847 - 856 (2005). 22. Kato K, et al. Development of Murine Cyp3a Knockout Chimeric Mice with Humanized Liver. Drug Metab Dispos 43, 1208 - 1217 (2015). 23. Nakada N, et al. Murine Cyp3a knockout chimeric mice with humanized liver: prediction of the metabolic profile of nefazodone in humans. Biopharmaceutics & drug disposition, (2015). 24. Shen AL, O'Leary KA, Kasper CB. Association of multiple developmental defects and embryonic lethality with loss of microsomal NADPH-cytochrome P450 oxidoreductase. J Biol Chem 277, 6536-6541 (2002). 25. Wu L, et al. Conditional knockout of the mouse NADPH-cytochrome p450 reductase gene. Genesis 36, 177-181 (2003). 26. Henderson CJ, et al. Inactivation of the hepatic cytochrome P450 system by conditional deletion of hepatic cytochrome P450 reductase. J Biol Chem 278, 13480-13486 (2003). 27. Gu J, et al. Liver-specific deletion of the NADPH-cytochrome P450 reductase gene: impact on plasma cholesterol homeostasis and the function and regulation of microsomal cytochrome P450 and heme oxygenase. J Biol Chem 278, 25895-25901 (2003). 28. Thomas KR, Capecchi MR. Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells. Cell 51, 503-512 (1987). 29. Skarnes WC, et al. A conditional knockout resource for the genome-wide study of mouse gene function. Nature 474, 337-342 (2011). 30. Farley FW, Soriano P, Steffen LS, Dymecki SM. Widespread recombinase expression using FLPeR (flipper) mice. Genesis 28, 106-110 (2000). 31. Haft DH, Selengut J, Mongodin EF, Nelson KE. A guild of 45 CRISPR-associated (Cas) protein families and multiple CRISPR / Cas subtypes exist in prokaryotic genomes. PLoS computational biology 1, e60 (2005). 32. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821 (2012). 33. Jansen R, Embden JD, Gaastra W, Schouls LM. Identification of genes that are associated with DNA repeats in prokaryotes. Molecular microbiology 43, 1565-1575 (2002). 34. Bissig-Choisat B, et al. Development and rescue of human familial hypercholesterolaemia in a xenograft mouse model. Nature communications 6, 7339 (2015). 35. Weng Y, DiRusso CC, Reilly AA, Black PN, Ding X. Hepatic gene expression changes in mouse models with liver-specific deletion or global suppression of the NADPH-cytochrome P450 reductase gene. Mechanistic implications for the regulation of microsomal cytochrome P450 and the fatty liver phenotype. J Biol Chem 280, 31686-31698 (2005). 36. Williams JA, et al. Drug-drug interactions for UDP-glucuronosyltransferase substrates: a pharmacokinetic explanation for typically observed low exposure (AUCi / AUC) ratios. Drug Metab Dispos 32, 1201-1208 (2004). 37. Barker AJ, et al. Studies leading to the identification of ZD1839 (IRESSA): an orally active, selective epidermal growth factor receptor tyrosine kinase inhibitor targeted to the treatment of cancer. Bioorganic & medicinal chemistry letters 11, 1911-1914 (2001). 38. Herbst RS, Fukuoka M, Baselga J. Gefitinib--a novel targeted approach to treating cancer. Nat Rev Cancer 4, 956-965 (2004). 39. Liu X, et al. Metabolomics reveals the formation of aldehydes and iminium in gefitinib metabolism. Biochem Pharmacol 97, 111-121 (2015). 40. McKillop D, et al. Metabolic disposition of gefitinib, an epidermal growth factor receptor tyrosine kinase inhibitor, in rat, dog and man. Xenobiotica; the fate of foreign compounds in biological systems 34, 917-934 (2004). 41. Scheffler M, Di Gion P, Doroshyenko O, Wolf J, Fuhr U. Clinical pharmacokinetics of tyrosine kinase inhibitors: focus on 4-anilinoquinazolines. Clinical pharmacokinetics 50, 371-403 (2011). 42. Li F, Lu J, Wang L, Ma X. CYP3A-mediated generation of aldehyde and hydrazine in atazanavir metabolism. Drug Metab Dispos 39, 394-401 (2011). 43. Baillie TA. Future of toxicology-metabolic activation and drug design: challenges and opportunities in chemical toxicology. Chemical research in toxicology 19, 889-893 (2006). 44. Guengerich FP, MacDonald JS. Applying mechanisms of chemical toxicity to predict drug safety. Chemical research in toxicology 20, 344-369 (2007). 45. Dalvie D, et al. Assessment of three human in vitro systems in the generation of major human excretory and circulating metabolites. Chemical research in toxicology 22, 357-368 (2009). 46. Anderson S, Luffer-Atlas D, Knadler MP. Predicting circulating human metabolites: how good are we? Chemical research in toxicology 22, 243-256 (2009). 47. Pettitt SJ, et al. Agouti C57BL / 6N embryonic stem cells for mouse genetic resources. Nat Methods 6, 493-495 (2009). 48. Cradick TJ, Qiu P, Lee CM, Fine EJ, Bao G. COSMID: A Web-based Tool for Identifying and Validating CRISPR / Cas Off-target Sites. Molecular therapy Nucleic acids 3, e214 (2014). 49. Hwang WY, et al. Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol 31, 227-229 (2013). 50. Cong L, et al. Multiplex genome engineering using CRISPR / Cas systems. Science 339, 819-823 (2013). 51. Ponder KP, et al. Mouse hepatocytes migrate to liver parenchyma and function indefinitely after intrasplenic transplantation. Proc Natl Acad Sci U S A 88, 1217-1221 (1991). 52. Li B, Dewey CN. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 12, 323 (2011). 53. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357-359 (2012). 54. Eisenberg E, Levanon EY. Human housekeeping genes, revisited. Trends in genetics : TIG 29, 569-574 (2013).

Claims

1. A method for preparing a chimeric mouse containing human hepatocytes, comprising: Fah that includes reduction or deletion of the NADPH-P450 oxidoreductase (Por) gene, resulting in reduced or absent expression of the NADPH-P450 oxidoreductase (Por) protein -/- Rag2 -/- Il2rg -/- provides a mouse, and (b) transplanting human hepatocytes into the mouse, wherein the human hepatocytes account for at least 70% of all hepatocytes in the liver of the chimeric mouse; A method comprising the above.

2. The method according to claim 1, wherein the reduced or deleted Por gene is a conditional knockdown or knockout of the Por gene, or is the result of a treatment using a mutation, transgene, exogenous substance or somatic cell genome engineering tool.

3. The method according to claim 2, wherein the somatic cell genome engineering tool comprises a Guide RNA (gRNA) and caspase 9 (Cas9).

4. The method according to claim 1, wherein the mouse contains a floxed allele of the Por gene and is provided with a Cre recombinase sufficient to cause a conditional knockout of the Por gene.

5. The method according to claim 4, wherein the mouse containing the floxed allele of the Por gene is provided at least with the first administration of a virus encoding Cre recombinase.

6. The method according to claim 5, wherein the mouse is provided at least with a second administration of a virus encoding Cre recombinase.

7. (a) providing a mouse containing a floxed allele of the Por gene together with the first administration of a virus encoding Cre recombinase; (b) transplanting human hepatocytes into the mouse; and (c) providing the mouse with a second administration of a virus encoding Cre recombinase; The method according to claim 1, comprising the above.

8. The method according to claim 7, wherein steps (a) and (b) occur continuously or simultaneously.

9. The method according to claim 4, wherein the mouse containing the floxed allele of the Por gene is mated with a transgenic mouse expressing Cre recombinase.

10. The method according to claim 1, wherein the mouse further comprises a reduction or deletion of at least one additional gene encoding an enzyme involved in drug metabolism.

11. The method according to claim 10, wherein the at least one additional enzyme is a phase II drug enzyme.

12. The method according to claim 1, wherein the mouse further comprises a reduction or deletion of the UDP-glucose 6-dehydrogenase (UGDH) gene or the glutathione synthetase (GSS) gene.

13. The method according to claim 12, wherein the inducible promoter is an albumin promoter restricted to the liver.

14. A chimeric mouse having a chimeric liver containing human hepatocytes, prepared by the method according to any one of claims 1 to 13.

15. The chimeric mouse according to claim 14, wherein the human hepatocytes account for at least 80%, at least 90%, at least 95% or at least 99% of all hepatocytes of the chimeric liver.

16. The chimeric mouse according to claim 14, wherein the chimeric mouse is immunodeficient.

17. A method for screening a substance that acts on human liver function, comprising: (a) administering a test substance to the chimeric mouse according to claim 14; (b) measuring one or more values in the chimeric mouse to which the test substance has been administered in (a); and (c) selecting a test substance that causes an increase or decrease in the one or more values measured in (b) as compared with the one or more values measured in a chimeric mouse to which no test substance has been administered.

18. The method according to claim 17, wherein the one or more values are selected from the group consisting of metabolites of the test substance, human albumin concentration, body weight curve, liver weight to body weight ratio, total albumin value, total protein level, alanine aminotransferase (ALT) level, aspartate aminotransferase (AST) level, and total bilirubin level, creatinine, blood urea nitrogen (BUN), troponin, blood cell count, TSH, and histological evaluation of the pathology of human and non-human organs.

19. A method for evaluating the toxicity of a test substance to human hepatocytes and other non-human organs in a chimeric mouse, comprising: (a) administering a test substance to the chimeric mouse according to claim 14; (b) measuring one or more indicators in the chimeric mouse to which the test substance has been administered in (a); and A method comprising: evaluating the effect of a test substance on human hepatocytes and other non-human organs using one or more indicators measured in (b) as compared to one or more indicators measured in a chimeric mouse not administered the test substance.

20. The method according to claim 19, wherein the one or more indicators are selected from the group consisting of metabolites of the test substance, human albumin concentration, body weight curve, liver weight to body weight ratio, total albumin value, total protein level, alanine aminotransferase (ALT) level, aspartate aminotransferase (AST) level, and total bilirubin level, creatinine, blood urea nitrogen (BUN), troponin, blood cell count, TSH, and histological evaluation of the pathology of human and non-human organs.

21. A chimeric mouse comprising human hepatocytes, wherein the chimeric mouse has a chimeric liver comprising a reduction or deletion of the NADPH-P450 oxidoreductase (Por) gene, resulting in a reduction or absence of the expression of the NADPH-P450 oxidoreductase (Por) protein, Fah -/- Rag2 -/- Il2rg -/- A chimeric mouse, wherein in the chimeric liver, human hepatocytes are transplanted into the chimeric mouse, and wherein the human hepatocytes account for at least 70% of all hepatocytes in the liver of the chimeric mouse.

Citation Information

Patent Citations

  • Transgenic animals for assessing drug metabolism and toxicity in man

    WO2005074677A1