Generation of chimeric antigen receptor (CAR)-primary NK cells for cancer immunotherapy using a combination of CAS9 / RNP and AAV virus

AAV plasmids with optimized homology arms and PAMs enhance CRISPR/Cas9 delivery and integration in cells, addressing efficiency and immune response issues, enabling stable transgene expression in primary NK cells for cancer immunotherapy.

JP7702878B2Active Publication Date: 2025-07-04RES INST AT NATIONWIDE CHILDRENS HOSPITAL
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2021557392
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-03-27
Filing Date
2020-03-27
Publication Date
2025-07-04
Estimated Expiration
2040-03-27

AI Technical Summary

Technical Problem

Current methods for delivering CRISPR/Cas9 into cells face limitations such as low efficiency in vitro and in vivo, immune response induction, and cell apoptosis, making it challenging to genetically engineer cells effectively.

Method used

The use of AAV plasmids with optimized homology arms and PAMs for CRISPR/Cas9 integration, combined with AAV vectors, allows for efficient delivery and integration of transgenes into cells, including primary NK cells, using RNP complexes and electroporation or viral co-infection.

Benefits of technology

This method enhances the efficiency of gene editing in cells, particularly primary NK cells, enabling stable transgene expression and overcoming previous limitations of cell resistance and apoptosis, facilitating cancer immunotherapy applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007702878000005
    Figure 0007702878000005
  • Figure 0007702878000006
    Figure 0007702878000006
  • Figure 0007702878000007
    Figure 0007702878000007
Patent Text Reader

Abstract

Disclosed herein are methods for genetically engineering cells using the CRISPR / CAS9 system and adeno-associated virus (AAV) delivery of ribonucleoproteins for integration. In some embodiments, disclosed herein are AAV plasmids for carrying out the methods.
Need to check novelty before this filing date? Find Prior Art

Description

Background Art

[0001] In recent years, the CRISPR / Cas9 technology has been used for cell manipulation. This technology has proven to be a robust method for gene silencing by generating DNA breaks or making small substitutions or small insertions. However, the technology is plagued by technical hurdles. Technologies for delivering CRISPR / Cas9 (along with any donor DNA or RNA) into cells, such as microinjection, electroporation, and nucleofection, are not suitable for in vivo use. Furthermore, knock-in mutations typically have very low efficiency in in vitro, in vivo, and clinical applications. Delivering CRISPR / Cas9 into cells using viral vectors addresses in vivo compatibility but has limitations on the size of the transgene, induces a host immune response, and can lead to substantial cell apoptosis associated with the procedure, limiting the production of genetically engineered cells. What is needed are new methods and vectors for genetically engineering cells.

Summary of the Invention

[0002] Methods and compositions related to AAV plasmids for delivering a CRISPR / CAS9 gene editing system into cells are disclosed. In some embodiments, the AAV plasmid further comprises a transgene.

[0003] In one aspect, plasmids for use in a clustered regularly interspaced short palindromic repeat (CRISPR) / CRISPR-associated 9 (Cas9) integration system are disclosed herein, the plasmids comprising a left homology arm, a splice acceptor, a transgene, and a right homology arm in sequence, the left homology arm and the right homology arm each having a length of 800 bp or less (e.g., 30 bp for plasmids 1 and 2, 300 bp for plasmids 3 and 4, 500 bp for plasmids 5 and 6, or 800 bp). In some aspects, the plasmid can further comprise a polyadenylation signal between the transgene and the right homology arm.

[0004] Plasmids of any preceding aspect in which the left homology arm and the right homology arm are of the same length or different lengths are also disclosed herein.

[0005] In one aspect, plasmids for use in a CRISPaint (or non-homologous end joining) method consisting of one or two protospacer adjacent motifs (PAMs), and CRISPR RNA (crRNA), and a transgene are disclosed herein, the order of the encoded nucleic acids comprising a PAM, a gRNA, and a transgene, and when two PAMs and gRNAs are used, the encoded nucleic acids comprise a first PAM, a first gRNA, a transgene, a second PAM, and a second gRNA.

[0006] Plasmids of any preceding aspect in which the homology arm or PAM of the plasmid specifically hybridizes to the adeno-associated virus integration site 1 (AAVS1) on human chromosome 19 are disclosed herein.

[0007] Plasmids of any preceding aspect in which the transgene comprises a polynucleotide encoding a chimeric antigen receptor of a tumor antigen are also disclosed.

[0008] In one aspect, an adeno-associated virus (AAV) vector (such as an AAV vector of serotype AAV6) containing the plasmid of any preceding aspect is disclosed herein. In one aspect, the AAV can be single-stranded AAV or self-complementary AAV.

[0009] Any preceding vector in which the vector further contains a plasmid encoding a gRNA (crispr RNA (crRNA), tracer RNA (tracrRNA)), and a CAS endonuclease is also disclosed herein.

[0010] In one aspect, a modified cell containing the plasmid or vector of any preceding aspect is disclosed herein.

[0011] Also disclosed herein is a method of treating cancer in a subject, comprising administering to the subject having cancer the modified cell of any preceding aspect.

[0012] In one aspect, a method for genetically modifying cells (including, but not limited to, T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells, including primary cells or proliferating cells) by homology-directed repair is disclosed herein, comprising: a) obtaining an AAV vector comprising a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a corresponding CRISPR / Cas guide RNA, and a plasmid comprising a transgene (e.g., a chimeric antigen receptor of a tumor antigen), wherein the transgene is flanked by homology arms, and the homology arms are of a length of 800 bp or less; and b) introducing the transgene and the RNP complex into the cells, wherein the transgene is introduced into the cells via infection of the cells with an adeno-associated virus (AAV), the RNP complex hybridizes to a target sequence within the genomic DNA of the cells, and the DNA repair enzymes of the cells insert the transgene into the host genome at the target sequence (e.g., by homologous repair), thereby generating modified cells. In some aspects, the RNP complex can be introduced into the cells via electroporation. In some aspects, the RNP complex can be introduced into the cells via viral delivery (i.e., co-infection) within the same or different AAVs.

[0013] In one aspect, a method for genetically modifying a cell (including, but not limited to, primary cells or proliferating cells such as T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells) by non-homologous end joining is disclosed herein, comprising: a) obtaining an AAV vector comprising a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a corresponding CRISPR / Cas guide RNA, and a plasmid comprising a transgene (e.g., a chimeric antigen receptor of a tumor antigen), wherein the transgene is adjacent to one PAM and crRNA or flanked by two PAMs and crRNAs; and b) introducing the transgene and the RNP complex into the cell, wherein the transgene is introduced into the cell via infection of the target cell with an adeno-associated virus (AAV), hybridizes to and cleaves a target sequence in the genomic DNA of the cell within the ribonucleoprotein (RNP) complex, and the DNA repair enzyme of the cell inserts the transgene into the host genome at the target sequence (e.g., by non-homologous end joining), thereby generating a modified cell.

[0014] Also disclosed herein is a method for genetically modifying a cell of any preceding aspect, wherein the primary cells are incubated for 4 days in the presence of IL-2 and / or irradiated feeder cells prior to infection and / or electroporation.

[0015] Also disclosed herein is a method for genetically modifying a cell of any preceding aspect, further comprising expanding the modified cells together with irradiated mbIL-21-expressing feeder cells after infection and / or electroporation.

[0016] The accompanying drawings, which are incorporated herein and constitute a part of this specification, illustrate some embodiments and, together with the description, exemplify the disclosed compositions and methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0017]

Figure 1-1

[0017] shows a schematic diagram of the CRISPR / Cas9 complex using AAV vectors for the delivery of CRISPR / Cas9 and transgenes. The schematic diagram shows the details of the action of the CRISPR / Cas9 system in the integration of transgenes via homology-directed repair, shows the AAVS1 target site on chromosome 19, and provides details of donor plasmids with homologous arms of 30, 300, 500, or 800 bp.

Figure 1-2

Figure 2

Figure 2

Figure 3A

Figure 3A

Figure 3B

Figure 3A

Figure 4A

Figure 4A

Figure 4B

Figure 4B

Figure 5A

Figure 5B

Figure 5C

Figure 6A

Figure 6B

Figure 7A

Figure 7B

Figure 7C

Figure 7D

Figure 7E

Figure 7F

Figure 7G

Figure 7H

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15-1

Figure 15-2

Figure 16A-1

Figure 16A-2

Figure 16B

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Mode for Carrying Out the Invention

[0018] Before the compounds, compositions, articles, devices, and / or methods of the present invention are disclosed and described, it should be understood that, unless otherwise specified, they are not limited to a particular synthetic method or a particular recombinant biotechnology method, and, unless otherwise specified, they are not limited to particular reagents (which, of course, may vary). It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0019] A. Definitions As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a pharmaceutical carrier" includes mixtures of two or more such carriers, and the like.

[0020] In this specification, a range may be expressed as from “about” a particular value and / or to “about” another particular value. When such a range is expressed, another embodiment includes from a particular value and / or to another particular value. Similarly, when a value is expressed as an approximation, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. Further, it will be understood that each endpoint of a range is significant both in relation to the other endpoint and independently of the other endpoint. It is also understood that some of the values disclosed herein exist, and each value, in addition to the value itself, is disclosed herein as “about” that particular value. For example, if the value “10” is disclosed, then “about 10” is also disclosed. As will be appropriately understood by those skilled in the art, when a value is disclosed as being “less than or equal to” a value, it is also understood that “greater than or equal to” the value and the possible ranges therebetween are also disclosed. For example, if the value “10” is disclosed, then “less than or equal to 10” as well as “greater than or equal to 10” are also disclosed. Also, throughout this application, the data is provided in several different formats, and this data is also understood to represent ranges of endpoints and starting points, as well as any combination of data points. For example, if a particular data point “10” and a particular data point 15 are disclosed, then in addition to between 10 and 15, greater than 10, greater than or equal to 10, equal to 10, less than 15, less than or equal to 15, and equal to 15 are understood to be disclosed. It is also understood that each unit between two particular units is also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.

[0021] In this specification and the appended claims, reference is made to several terms that are defined to have the following meanings.

[0022] “Optional” or “optionally” means that the event or circumstance described hereinafter may or may not occur, and the description includes instances where the event or circumstance occurs and instances where it does not occur.

[0023] A "primer" is a subset of probes that can support certain enzymatic manipulations and can hybridize to a target nucleic acid so that the enzymatic manipulation can occur. A primer can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art that do not interfere with the enzymatic manipulation.

[0024] A "probe" is typically a molecule that can interact with a target nucleic acid in a sequence-specific manner, for example, through hybridization. Nucleic acid hybridization is well understood in the art and is discussed herein. Typically, a probe can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art.

[0025] A DNA sequence that "encodes" a particular RNA is a DNA nucleic acid sequence that is transcribed into the RNA. A DNA polynucleotide may encode an RNA (mRNA) that is translated into a protein (thus, both the DNA and the mRNA encode the protein), or a DNA polynucleotide may encode an RNA that is not translated into a protein (e.g., tRNA, rRNA, microRNA (miRNA), "non-coding" RNA (ncRNA), guide RNA, etc.).

[0026] A "protein coding sequence" or a sequence that encodes a particular protein or polypeptide is a nucleic acid sequence that, when placed under the control of appropriate regulatory sequences, is transcribed into an mRNA and (in the case of DNA) translated into a polypeptide in vitro or in vivo (in the case of mRNA). The boundaries of the coding sequence are determined by the start codon at the 5' end (N-terminus) and the translation stop nonsense codon at the 3' end (C-terminus). Coding sequences include, but are not limited to, cDNA derived from prokaryotic or eukaryotic mRNA, genomic DNA sequences derived from prokaryotic or eukaryotic DNA, and synthetic nucleic acids. Transcription termination sequences are usually located 3' of the coding sequence.

[0027] As used herein, the terms "naturally occurring" or "unmodified" or "wild-type" when applied to a nucleic acid, polypeptide, cell, or organism refer to a nucleic acid, polypeptide, cell, or organism found in nature. For example, a polypeptide or polynucleotide sequence present in an organism (including a virus) that can be isolated from a natural source and has not been intentionally modified by humans in the laboratory is wild-type (and naturally occurring).

[0028] "Administration to a subject" includes any route by which a drug is introduced or delivered to the subject. Administration can be effected by any suitable route including, for example, oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-articular, parenteral, intra-arterial, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation, via an implant reservoir, parenterally (e.g., subcutaneous, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intramedullary, intraperitoneal, intrahepatic, intralesional, and intracranial injection or infusion techniques), and the like. As used herein, "concurrent administration" (concurrent administration, administration in combination, simultaneous administration, or administered simultaneously) means that the compounds are administered at the same point in time or are administered essentially immediately after one another. In the latter case, the two compounds are administered at a time close enough such that the observed results are indistinguishable from those obtained if the compounds were administered at the same point in time. "Systemic administration" refers to introducing or delivering a drug to a subject via a route that introduces or delivers the drug to a broad area of the subject's body (e.g., an area greater than 50% of the body), such as through an entry into the circulatory or lymphatic system. In contrast, "local administration" refers to introducing or delivering a drug to a subject via a route that introduces or delivers the drug to the area of or immediately adjacent to the point of administration and does not introduce the drug systemically in a therapeutically significant amount. For example, a drug administered locally is readily detectable in the immediate vicinity of the point of administration but is undetectable or detectable in negligible amounts in distal portions of the subject's body. Administration includes self-administration and administration by another person.

[0029] The "effective amount" of a drug refers to an amount of the drug sufficient to provide the desired effect. The amount of a drug that is "effective" will vary from subject to subject depending on a number of factors such as the age and general condition of the subject, the particular drug(s), etc. Accordingly, it is not always possible to specify a quantified "effective amount". However, an appropriate "effective amount" for any given subject may be determined by one of ordinary skill in the art using routine experimentation. Also, as used herein, unless otherwise specified, the "effective amount" of a drug can also refer to an amount that covers both a therapeutically effective amount and a prophylactically effective amount. The "effective amount" of a drug required to achieve a therapeutic effect can vary according to factors such as the age, sex, and weight of the subject. The dosing regimen can be adjusted to provide an optimal therapeutic response. For example, the dosage may be administered in several divided doses per day, or the dosage may be proportionally reduced as indicated by the exigencies of the therapeutic situation.

[0030] A "pharmaceutically acceptable" component is a component that is not biologically or otherwise undesirable, i.e., a component that can be incorporated into the pharmaceutical formulations of the present invention and administered to a subject as described herein without causing a significant undesirable biological effect or interacting in a harmful manner with any of the other components of the formulation in which it is contained. When used in reference to administration to humans, this term generally means that the component meets the required criteria of toxicity tests and manufacturing tests, or that it is included in the Inactive Ingredients Guide prepared by the U.S. Food and Drug Administration.

[0031] "Pharmaceutically acceptable carrier" (which may be referred to as "carrier") generally means a carrier or excipient useful in the preparation of a generally safe and non-toxic pharmaceutical or therapeutic composition, including carriers acceptable for veterinary and / or human pharmaceutical or therapeutic use. The term "carrier" or "pharmaceutically acceptable carrier" can include, but is not limited to, phosphate buffered saline, water, emulsions (such as oil / water or water / oil emulsions), and / or various types of wetting agents. As used herein, the term "carrier" encompasses any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or material well known in the art for use in pharmaceutical formulations, and materials further described herein, but is not limited thereto.

[0032] "Pharmacological activity" (or simply "activity") can refer to derivatives or analogs of "pharmacological activity" that have the same type of pharmacological activity as the parent compound and are derivatives or analogs of approximately equal degree (e.g., salts, esters, amides, complexes, metabolites, isomers, fragments, etc.).

[0033] "Therapeutic agent" refers to any composition having a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition (e.g., non-immunogenic cancer). These terms also encompass pharmaceutically acceptable active derivatives of the beneficial agents specifically referred to herein, including, but not limited to, salts, esters, amides, prodrugs, active metabolites, isomers, fragments, analogs, etc. When the term "therapeutic agent" is used, or when a specific agent is specifically identified, it should be understood that this term includes the agent itself, as well as pharmaceutically acceptable pharmacologically active salts, esters, amides, prodrugs, complexes, active metabolites, isomers, fragments, analogs, etc.

[0034] The "therapeutically effective amount" or "therapeutically effective dosage" of a composition (e.g., a composition comprising an agent) refers to an amount effective to obtain a desired therapeutic result. In some embodiments, the desired therapeutic result is the control of type I diabetes. In some embodiments, the desired therapeutic result is the control of obesity. The therapeutically effective amount of a given therapeutic agent will typically vary with respect to factors such as the type and severity of the disorder or disease being treated, and the age, sex, and weight of the subject. This term can also refer to the amount of a therapeutic agent, or the rate of delivery of a therapeutic agent (e.g., the amount over time), effective to promote a desired therapeutic effect such as pain relief. The exact desired therapeutic effect will vary according to the condition being treated, the tolerance of the subject, the agent and / or pharmaceutical formulation being administered (e.g., the potency of the therapeutic agent, the concentration of the agent in the formulation, etc.), and various other factors understood by those of skill in the art. In some cases, the desired biological or medical response is achieved after multiple administrations of the composition over a period of days, weeks, or years.

[0035] Throughout this application, various publications are referenced. The disclosures of these publications are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this application pertains. The disclosed references are also discussed in the text that relies on them, and the materials contained therein are hereby incorporated by reference into this specification individually and specifically.

[0036] B. Methods of Genetically Modifying Plasmids and Cells In one aspect, plasmids are disclosed herein for delivering a donor transgene to a cell and integrating the transgene into the cell in combination with CRISPR / Cas9.

[0037] An endonuclease / RNP (e.g., Cas9 / RNP) consists of a three-component recombinant endonuclease protein (e.g., Cas9 endonuclease) complexed with a CRISPR locus. The endonuclease complexed with the CRISPR locus can be referred to as a CRISPR / Cas guide RNA. The CRISPR locus includes a synthetic single guide RNA (gRNA) consisting of RNA that can hybridize to a complementary repeat RNA (crRNA) complexed with a target sequence and a trans-complementary repeat RNA (tracrRNA). Thus, the CRISPR / Cas guide RNA hybridizes to a target sequence within the genomic DNA of a cell. In some cases, class 2 CRISPR / Cas endonucleases are type II CRISPR / Cas endonucleases. In some cases, class 2 CRISPR / Cas endonucleases are Cas9 polypeptides, and the corresponding CRISPR / Cas guide RNA is a Cas9 guide RNA. These Cas9 / RNPs can cleave genomic targets with higher efficiency compared to foreign DNA-dependent approaches because they are delivered as functional complexes. In addition, the rapid clearance of Cas9 / RNP from cells can reduce off-target effects such as the induction of apoptosis.

[0038] To produce the RNP complex, crRNA and tracrRNA are mixed at a ratio of 1:1, 2:1, or 1:2 at a concentration of about 50 μM to about 500 μM (e.g., 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 35, 375, 400, 425, 450, 475, or 500 μM), preferably 100 μM to about 300 μM, and most preferably about 200 μM at 95°C for about 5 minutes to form a crRNA:tracrRNA complex (i.e., guide RNA). The crRNA:tracrRNA complex can then be mixed at a final dilution of about 20 μM to about 50 μM (e.g., 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 μM) with a Cas endonuclease (e.g., Cas9, etc.).

[0039] When bound to a target sequence in a target cell, the CRISPR locus can modify the genome by introducing into the target DNA one or more base pair insertions or deletions, insertion of a heterologous DNA fragment (e.g., a donor polynucleotide), deletion of an endogenous DNA fragment, inversion or translocation of an endogenous DNA fragment, or a combination thereof. Thus, when combined with DNA for homologous recombination, knockouts or knockins can be generated using the methods of the present disclosure. As used herein, transduction of Cas9 / RNP via adeno-associated virus (AAV) is shown to be an easy and relatively efficient method to overcome previous limitations of gene modification in cells (e.g., T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells, etc.).

[0040] The CRISPR / Cas9 system has recently been shown to facilitate high levels of accurate genome editing using adeno-associated virus (AAV) vectors to function as donor template DNA during homologous recombination (HR). However, the prior use of AAV is limited by the immune function of NK cells, which are resistant to viral and bacterial vectors and the induction of apoptosis of NK cells by such vectors. Therefore, prior to this method, CRISPR / Cas modification of NK cells had not been successful. Furthermore, the maximum AAV packaging capacity of approximately 4.5 kilobases limits the donor size including homologous arms. It is recommended that any transcript over 100 bp and any transgene have homologous arms that are at least 800 bp for each arm, and many systems use a total of 1800 bp of 800 bp and 1000 bp asymmetric arms. Thus, AAV vectors cannot deliver transgenes over approximately 2.5 kb. In one aspect, as shown in Table 1, a donor construct plasmid having homologous arms of 30 bp to 1000 bp, including but not limited to 30, 50, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 bp, is disclosed herein in an AAV CRISPR / CAS9 nucleotide delivery system.For example, homologous arms can be symmetric 30 bp homologous arms such as plasmids 1 and 2 (Figures 7A and 7B) in the case of homologous recombination (HR), symmetric 300 bp homologous arms such as plasmids 3 and 4 (Figures 7C and 7D), symmetric 500 bp homologous arms such as plasmids 5 and 6 (Figures 7E and 7F), or asymmetric 800 bp homologous arms such as plasmids 7 and 8 (Figures 7G and 7H) containing an 800 bp left homologous arm (LHA) and a 1000 bp right homologous arm (RHA), or in the case of non-homologous end joining using a homology-independent targeting integration (HITI) plasmid, can have no homologous arms at all (plasmids 9, 10, 11, and 12). The advantage of plasmids 1, 2, 3, 4, 5, and 6 over any existing plasmids is that they can be used not only for insertions but also for large transcripts. Plasmids 1, 2, 3, 4, 5, and 6 can be used in any cell type and have a clinically approved splice acceptor (SA) (SEQ ID NO: 10) and a clinically approved polyadenylation terminator (PA) (e.g., BGH poly A terminator SEQ ID NO: 11, etc.). Plasmids 7 and 8 have a clinically approved splice acceptor (SA) and a clinically approved polyadenylation terminator (PA). It is understood and contemplated herein that homologous arms can be symmetric (the same length on each side) or asymmetric (different lengths on each side) to accommodate different transgene lengths.That is, the homologous arm lengths can have combinations of left homologous arm (LHA) lengths and right homologous arm (RHA) lengths including, but not limited to, LHA 30 bp (SEQ ID NO: 2) and RHA 30 bp (SEQ ID NO: 1), LHA 30 bp and RHA 100 bp, LHA 30 bp and RHA 300 bp (SEQ ID NO: 3), LHA 30 bp and RHA 500 bp (SEQ ID NO: 5), LHA 30 bp and RHA 800 bp (1000 bp of plasmids 7 and 8 in reality, SEQ ID NO: 7), LHA 30 bp and RHA 1000 bp, LHA 100 bp and RHA 30 bp, LHA 100 bp and RHA 100 bp, LHA 100 bp and RHA 300 bp, LHA 100 bp and RHA 500 bp, LHA 100 bp and RHA 800 bp, LHA 100 bp and RHA 1000 bp, LHA 300 bp (SEQ ID NO: 4) and RHA 30 bp, LHA 300 bp and RHA 100 bp, LHA 300 bp and RHA 300 bp, LHA 300 bp and RHA 500 bp, LHA 300 bp and RHA 800 bp, LHA 300 bp and RHA 1000 bp, LHA 500 bp (SEQ ID NO: 6) and RHA 30 bp, LHA 500 bp and RHA 100 bp, LHA 500 bp and RHA 300 bp, LHA 500 bp and RHA 500 bp, LHA 500 bp and RHA 800 bp, LHA 500 bp and RHA 1000 bp, LHA 800 bp (SEQ ID NO: 8) and RHA 30 bp, LHA 800 bp and RHA 100 bp, LHA 800 bp and RHA 300 bp, LHA 800 bp and RHA 500 bp, LHA 800 bp and RHA 800 bp, LHA 800 bp and RHA 1000 bp, LHA 1000 bp and RHA 30 bp, LHA 1000 bp and RHA 100 bp, LHA 1000 bp and RHA 300 bp, LHA 1000 bp and RHA 500 bp, LHA 1000 bp and RHA 800 bp, and LHA 1000 bp and RHA 1000 bp.

[0041] Plasmids 9, 10, 11, and 12 are significantly different from plasmids 1-8 or any plasmid described in the art. These plasmids have the same clinically approved SA and PA and can be used in any cell type, but instead of being integrated via homology-directed repair (HDR), they are integrated via HITI, CRISPaint, or other non-homologous end joining (NHEJ). Therefore, they have the advantage of being integrated with higher efficiency. To assist in the identification of cleavage sites for removing the transgene for integration, the plasmids contain a protospacer adjacent motif (PAM) and crRNA (i.e., gRNA) (SEQ ID NO: 9) for targeting donor transgene integration. Plasmids 11 and 12 contain two PAM sequences to increase the likelihood of Cas9 targeting at least one site on the donor transgene plasmid.

[0042] As shown in Table 1, changes in the homology arms and can dramatically affect the ability of the plasmid to incorporate the donor transgene, similar to whether the plasmid is single-stranded or self-complementary.

Table 1

[0043] In addition, despite the advantage of using single-stranded (SS) plasmids to insert larger transgenes, SS plasmids fold intracellularly and require more time to function as double-stranded DNA before integration, increasing DNA sensing mechanisms and cytotoxicity in some cells (e.g., T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells, etc.). This problem is overcome herein by using self-complementary (SC) (double-stranded) constructs to reduce the exposure time of exogenous DNA in cells, such as plasmids 2, 4, 6, 8, 10, and 12. The plasmids of the present disclosure.

[0044] In this specification, it is understood and contemplated that crispr RNA (crRNA) is used to target Cas9 nuclease activity to a target site and also to cleave a donor plasmid to enable recombination of a donor transgene into host DNA. In some cases, the crRNA is combined with a tracrRNA to form a guide RNA (gRNA). The disclosed plasmid uses AAV integration with the intron 1 of the protein phosphatase 1 regulatory subunit 12C (PPP1R12C) gene on human chromosome 19, designated AAVS1, as the target site for integration of the transgene. This locus is a "safe harbor gene" and allows for stable long-term transgene expression in many cell types. Since disruption of PPP1R12C is not associated with any known disease, the AAVS1 locus is often considered a safe harbor for targeting transgenes. Since the AAVS1 site is used as the target location, the CRSPR RNA (crRNA) must target the DNA. Here, the guide RNA used in the disclosed plasmid includes GGG GCC ACT AGG GAC AGG AT (SEQ ID NO:1), or any 10 nucleotide sense or antisense continuous fragment thereof. AAVS1 is used for illustrative purposes in this specification, but it is understood and contemplated herein that other "safe harbor genes" may be used with equivalent results and may be substituted for AAVS1 if more appropriate considering the particular cell type being transfected or the transgene. Examples of other safe harbor genes include, but are not limited to, C-C chemokine receptor type 5 (CCR5), the ROSA26 locus, and TRAC.

[0045] As described above, the use of AAV as a vector for delivering the disclosed CRISPR / Cas9 plasmid and any donor transgene is limited to a maximum of about 4.5 kb. One way to increase the allowable size of the transgene is to generate additional room by replacing the typically used Cas9 of Streptococcus pyogenes (SpCas9) with synthetic Cas9 or Cas9 from a different bacterial source, as understood and contemplated herein. The replacement of Cas9 can also be used to increase target specificity, thus requiring less use of gRNA. Thus, for example, Cas9 can be derived from Staphylococcus aureus (SaCas9), Acidaminococcus sp. (AsCpf1), Lachnospiraceae bacterium (LbCpf1), Neisseria meningitidis (NmCas9), Streptococcus thermophilus (StCas9), Campylobacter jejuni (CjCas9), enhanced SpCas9 (eSpCas9), SpCas9-HF1, Fokl-fused dCas9, proliferating Cas9 (xCas9), and / or catalytically inactive Cas9 (dCas9).

[0046] It is understood and contemplated herein that the use of a particular Cas9 can change the PAM sequence used to screen for targets using a Cas9 endonuclease (or alternative). As used herein, suitable PAM sequences include NGG (SpCas9 PAM), NNGRRT (SaCas9 PAM), NNNNGATT (NmCAs9 PAM), NNNNRYAC (CjCas9 PAM), NNAGAAW (St), TTTV (LbCpf1 PAM and AsCpf1 PAM); TYCV (LbCpf1 PAM variant and AsCpf1 PAM variant), where N is any nucleotide, V is A, C or G, Y is C or T, W is A or T, and R is A or G.

[0047] In one aspect, a method of genetically modifying a cell is provided herein, comprising obtaining a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a corresponding CRISPR / Cas guide RNA (gRNA) specific for a target DNA sequence of the cell, and a plasmid comprising a transgene (e.g., a chimeric antigen receptor of a tumor antigen), wherein the transgene is flanked by homologous arms, obtaining, and b) introducing the transgene and the RNP complex into the cell, wherein the transgene is introduced into the cell via infection of the target cell with an adeno-associated virus (AAV), and the RNP complex hybridizes to the target sequence within the genomic DNA of the cell. In one aspect, the method can further comprise introducing the RNP complex into the cell via electroporation (such as when modifying NK cells). In one aspect, the method can further comprise superinfecting the target cell with a second AAV virus comprising the RNP complex. In one aspect where the transgene is small enough, the same AAV can comprise both the transgene and the RNP complex. In still further aspects, the transgene and the RNP complex can be encoded on the same plasmid.

[0048] The methods of the present disclosure are understood to be available and contemplated herein for any cell type, including T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells, as well as any other cell type. Human NK cells are particularly excellent targets for the disclosed plasmids and their methods of use. NK cells are a subset of peripheral blood lymphocytes defined by the expression of CD56 or CD16 and the absence of the T cell receptor (CD3). NK cells sense and kill target cells lacking major histocompatibility complex (MHC) class I molecules. NK cell activating receptors include, among others, natural cytotoxicity receptors (NKp30, NKp44, and NKp46), as well as the lectin-like receptor NKG2D and DNAM-1. Their ligands are expressed on stressed, transformed, or infected cells but not on normal cells, so normal cells are resistant to NK cell killing. NK cell activation is negatively regulated via inhibitory receptors such as killer immunoglobulin (Ig)-like receptors (KIR), NKG2A / CD94, TGFβ, and leukocyte Ig-like receptor-1 (LIR-1). In one aspect, the target cells can be from a donor source (e.g., an allogeneic donor source or an autologous donor source (i.e., the ultimate recipient of the modified cells) for adoptive cell therapy), an NK cell line (including, but not limited to, NK RPMI8866, HFWT, K562, and EBV-LCL), or primary NK cells from a primary NK cell source or a proliferating NK cell source derived from an NK cell line.

[0049] Prior to the transduction of cells (such as, for example, T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells), the cells can be incubated in a medium suitable for cell growth. It is understood and contemplated herein that the culture conditions can include the addition of cytokines, antibodies, and / or feeder cells. Thus, in one aspect, a method of genetically modifying cells (such as, for example, T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells) further includes incubating the cells for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days prior to transducing the cells in a medium that supports cell growth, wherein the medium further includes cytokines, antibodies, and / or feeder cells, and a method is disclosed herein. For example, the medium can include IL-2, IL-12, IL-15, IL-18, and / or IL-21. In one aspect, the medium can also include an anti-CD3 antibody. In one aspect, the feeder cells can be purified from feeder cells that stimulate the cells. For example, the NK cell-stimulating feeder cells for use in the invention described in the claims disclosed herein can be irradiated autologous or allogeneic peripheral blood mononuclear cells (PBMCs) or non-irradiated autologous or PBMCs, RPMI8866, HFWT, K562, membrane-bound IL-15 and 41BBL, or IL-21, or K562 cells transfected with any combination thereof, or EBV-LCL. In some aspects, the feeder cells are provided in combination with a solution of IL-21, IL-15, and / or 41BBL. The feeder cells can be seeded for cell culture at a ratio of 1:2, 1:1, or 2:1. It is understood and contemplated herein that the culture period can be 1 to 14 days (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days) after AAV infection, preferably 3 to 7 days, and most preferably 4 to 6 days.

[0050] It is understood and contemplated herein that the incubation conditions for primary cells and proliferating cells (including, but not limited to, primary and proliferating T cells, NK cells, or B cells) may vary. In one aspect, the culture of primary NK cells prior to AAV infection includes a medium, cytokines (such as, for example, IL-2, IL-12, IL-15, IL-18, and / or IL-21, etc.), and / or anti-CD3 antibody for less than 5 days (such as, for example, 1, 2, 3, or 4 days). For proliferating NK cells, the culture can be performed in the presence of NK feeder cells (such as, for example, at a 1:1 ratio) in addition to, or instead of, cytokines (such as, for example, IL-2, IL-12, IL-15, IL-18, and / or IL-21, etc.) and / or anti-CD3 antibody. The culture of proliferating NK cells can be performed for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days prior to transduction. Thus, in one aspect, a method of genetically modifying cells (such as, for example, T cells, B cells, macrophages, NK cells, fibroblasts, neurons, osteoblasts, hepatocytes, epithelial cells, and / or muscle cells, etc.) is disclosed herein, including incubating primary cells in the presence of IL-2 for 4 days prior to infection with an AAV vector and / or electroporation (when the RNP complex is introduced via electroporation), or incubating proliferating cells in the presence of irradiated feeder cells for 4, 5, 6, or 7 days prior to infection with an AAV and / or electroporation when the RNP complex is introduced via electroporation.

[0051] After transduction of cells (e.g., T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells, etc.) (e.g., via AAV infection or electroporation), the modified cells can finally be grown in a medium containing feeder cells that stimulate the modified cells (e.g., T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells, etc.). Thus, the modified cells can be grown after AAV infection and / or electroporation (when the RNP complex is introduced via electroporation) using irradiated feeder cells, thereby maintaining viability and growth potential. For example, the NK cell-stimulating feeder cells for use in the claimed invention disclosed herein can be irradiated autologous or allogeneic peripheral blood mononuclear cells (PBMCs) or non-irradiated autologous or PBMCs, RPMI8866, HFWT, K562, membrane-bound IL-15 and 41BBL, or IL-21, or K562 cells transfected with any combination thereof, or EBV-LCL. In some embodiments, the NK cell feeder cells are provided in combination with a solution of IL-21, IL-15, and / or 41BBL. The feeder cells can be seeded for the culture of NK cells at a ratio of 1:2, 1:1, or 2:1. The culture period can be understood and is contemplated herein to be 1 to 14 days (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days), preferably 3 to 7 days, and most preferably 4 to 6 days after infection and / or electroporation. In some embodiments, the medium for culturing the modified NK cells can further contain cytokines such as, for example, IL-2, IL-12, IL-15, IL-18, and / or IL-21.

[0052] In one aspect, it is understood and contemplated herein that the disclosed plasmids can be used to modify cells useful for the treatment of cancer. Cancer immunotherapy has advanced in recent years, and genetically modified chimeric antigen receptor (CAR) T cells are an excellent example of engineered immune cells that have been successfully deployed in cancer immunotherapy. These cells have recently been approved by the FDA for the treatment of CD19+ B cell malignancies, but to date, success has been limited to diseases with a small number of targetable antigens, and targeting such a limited antigen repertoire is prone to failure due to immune escape. Furthermore, CAR T cells have focused on the use of autologous T cells due to the risk of graft-versus-host disease caused by allogeneic T cells. In contrast, NK cells can kill tumor targets in an antigen-independent manner and do not cause graft-versus-host disease (GvHD), making them an excellent candidate for cancer immunotherapy. It is understood and contemplated herein that the disclosed modified plasmids and methods can be used to generate CAR T cells and CAR NK cells to target T cells and / or NK cells to cancer.

[0053] As used herein, "chimeric antigen receptor" refers to a chimeric receptor that targets a cancer antigen and directs a cell expressing the receptor to cancer cells expressing the target antigen. Typically, a CAR comprises a natural ligand of a tumor antigen, a molecule that recognizes a peptide derived from a tumor antigen presented by an MHC molecule, or an antibody or fragment thereof (e.g., Fab’, scFv, Fv, etc.) that is expressed on the surface of a CAR cell targeting a cancer antigen. The receptor is fused via a linker to a signaling domain (e.g., the CD3ζ domain for T and NKG2C, NKP44, or the CD3ζ domain for NK cells, etc.). The tumor antigen target is a protein produced by tumor cells that elicits an immune response, particularly a B cell-, NK cell-, and T cell-mediated immune response. The selection of the antigen-binding domain depends on the particular type of cancer being treated. Tumor antigens are known in the art and include, for example, glioma-associated antigens, carcinoembryonic antigen (CEA), EGFRvIII, IL-llRa, IL-13Ra, EGFR, FAP, B7H3, Kit, CA LX, CS-1, MUC1, BCMA, bcr-abl, HER2, β-human chorionic gonadotropin, alpha-fetoprotein (AFP), ALK, CD19, CD123, cyclin Bl, lectin-reactive AFP, Fos-related antigen 1, ADRB3, thyroglobulin, EphA2, RAGE-1, RUl, RU2, SSX2, AKAP-4, LCK, OY-TESl, PAX5, SART3, CLL-1, fucosyl GM1, GloboH, MN-CA IX, EPCAM, EVT6-AML, TGS5, human telomerase reverse transcriptase, polysialic acid, PLAC1, RUl, RU2(AS), intestinal carboxylesterase, lewisY, sLe, LY6K, mut hsp70-2, M-CSF, MYCN, RhoC, TRP-2, CYPIBI, BORIS, prostase, prostate-specific antigen (PSA), PAX3, PAP, NY-ESO-1, LAGE-la, LMP2, NCAM, p53, p53 variants, Ra variants, gplOO, prostein, OR51E2, PANX3, PSMA, PSCA, Her2 / neu, hTERT, HMWMAA, HAVCR1, VEGFR2, PDGFR-β, survivin and telomerase, legumain, HPVE6, E7, sperm protein 17, SSEA-4, tyrosinase, TARP, WT1, prostate cancer tumor antigen-1 (PCTA-1), ML-IAP, MAGE, MAGE-A1, MAD-CT-1, MAD-CT-2, MelanA / MART 1, XAGE1, ELF2M, ERG (TMPRSS2 ETS fusion gene), NA17, neutrophil elastase, sarcoma translocation breakpoint, NY-BR-1, ephnnB2, CD20, CD22, CD24, CD30, CD33, CD38, CD44v6, CD97, CD171, CD179a, androgen receptor, FAP, insulin growth factor (IGF)-I, IGFII, IGF-I receptor, GD2, o-acetyl-GD2, GD3, GM3, GPRC5D, GPR20, CXORF61, folate receptor (FRa), folate receptor β, ROR1, Flt3, TAG72, TN Ag, Tie 2, TEM1, TEM7R, CLDN6, TSHR, UPK2, as well as mesothelin. Non-limiting examples of tumor antigens include the following differentiation antigens, such as tyrosinase, TRP-1, TRP-2 and tumor-specific multi-lineage antigens, such as MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, pi 5; overexpressed embryonic antigens, such as CEA; overexpressed cancer genes and mutant tumor suppressor genes, such as p53, Ra, HER-2 / neu; unique tumor antigens resulting from chromosomal translocations; such as BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR; as well as viral antigens, such as Epstein-Barr virus antigen EBVA and human papillomavirus (HPV) antigens E6 and E7. Other large protein-based antigens include TSP-180, MAGE-4, MAGE-5, MAGE-6, RAGE, NY-ESO, pl85erbB2, pl80erbB-3, c-met, nm-23H1, PSA, IL13Ra2, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, β-catenin, CDK4, Mum-1, p15, p16, 43-9F, 5T4, 791Tgp72, α-fetoprotein, β-HCG, BCA225, BTAA, CA 125, CA 15-3\CA 27.29\BCAA, CA 195, CAExamples include 242, CA-50, CAM43, CD68 / P1, CO-029, FGF-5, G250, Ga733 / EpCAM, HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB / 70K, NY-CO-1, RCASl, SDCCAG16, TA-90 / Mac-2 binding protein, cyclophilin C-related protein, TAAL6, TAG72, TLP, TPS, GPC3, MUC16, LMP1, EBMA-1, BARF-1, CS1, CD319, HER1, B7H6, L1CAM, IL6, and MET.

[0054] In one aspect, it is understood and contemplated herein that one objective of the disclosed methods of genetically modifying cells is to produce modified cells. Accordingly, modified T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells produced by the methods of the present disclosure are disclosed herein.

[0055] As pointed out throughout the present disclosure, the disclosed modified NK cells are ideally suitable for use in immunotherapies such as adoptively transferring the modified (i.e., engineered) NK cells to a subject in need thereof. Thus, in one aspect, a method of adoptively transferring engineered cells to a subject in need thereof is disclosed herein, the method comprising: a) obtaining a target cell to be modified (e.g., a T cell, B cell, macrophage, NK cell, fibroblast, osteoblast, hepatocyte, neuron, epithelial cell, and / or muscle cell, etc.); b) obtaining an adeno-associated virus (AAV) vector comprising a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a corresponding CRISPR / Cas guide RNA, and a plasmid comprising a transgene (e.g., a chimeric antigen receptor of a tumor antigen, etc.), wherein the transgene is flanked by homology arms, and the homology arms are less than 800 bp in length; c) introducing the transgene and the RNP complex into the cell, wherein the transgene is introduced into the cell via infection of the cell with AAV, the RNP complex hybridizes to a target sequence in the genomic DNA of the cell, and the DNA repair enzyme of the cell inserts the transgene into the host genome at the target sequence in the genomic DNA of the target cell (e.g., by homologous repair), thereby generating an engineered cell (e.g., a T cell, B cell, macrophage, NK cell, fibroblast, osteoblast, hepatocyte, neuron, epithelial cell, and / or muscle cell, etc.); and d) transplanting the engineered cell (e.g., a T cell, B cell, macrophage, NK cell, fibroblast, osteoblast, hepatocyte, neuron, epithelial cell, and / or muscle cell, etc.) into the subject. In one aspect, the transgene can be included on the same plasmid as the Cas9 endonuclease or encoded on a second plasmid within the same or a different AAV vector. In one aspect, the target cell can be transduced with the RNP complex via electroporation before or simultaneously with infection of the cell with the AAV comprising the transgene.

[0056] In one aspect, a method of genetically modifying a cell (including, but not limited to, primary cells or proliferating cells such as T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells) by non-homologous end joining is disclosed herein, comprising: a) obtaining an AAV vector comprising a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a corresponding CRISPR / Cas guide RNA, and a plasmid comprising a transgene (e.g., a chimeric antigen receptor of a tumor antigen), wherein the transgene is adjacent to one PAM and crRNA, or adjacent to two PAMs and crRNAs; and b) introducing the transgene and the RNP complex into the cell, wherein the transgene is introduced into the cell via infection of the target cell with an adeno-associated virus (AAV), hybridizes to and cleaves a target sequence in the genomic DNA of the cell within the ribonucleoprotein (RNP) complex, and the DNA repair enzymes of the cell insert the transgene into the host genome at the target sequence (e.g., by non-homologous end joining), thereby generating a modified cell.

[0057] In one aspect, the modified cells (e.g., modified T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells, etc.) used in the methods of immunotherapy of the present disclosure can be from a donor source (e.g., an allogeneic donor source or an autologous donor source (i.e., the ultimate recipient of the modified cells) for adoptive transfer therapy), a cell line (including, but not limited to, NK cell lines NK RPMI8866, HFWT, K562, and EBV-LCL), or primary cells from a primary cell source or a source of proliferating cells derived from a cell line. Since primary cells can be used, it is understood and contemplated herein that the disclosed modifications of the cells can occur ex vivo or in vitro.

[0058] After transduction of cells (e.g., T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells, etc.), the modified (i.e., engineered) cells can be expanded and stimulated before administration to a subject. For example, methods of adoptively transferring immune cells to a subject in need thereof are disclosed herein, and immune cells (e.g., T cells, B cells, macrophages, natural killer (NK) cells, NK T cells, tumor infiltrating lymphocytes (TIM), marrow infiltrating lymphocytes (MIL), tumor infiltrating NK cells (TINK), fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells, etc.) are expanded with irradiated feeder cells, plasma membrane (PM) particles, or exosome (EX) expressing membrane-bound IL-21 (mbIL-21) (PM particles and EX exosomes expressing mbIL-21 are referred to herein as PM21 particles and EX21 exosomes, respectively). In some embodiments, expansion can further include irradiated feeder cells, plasma membrane (PM) particles, or exosome expressing membrane-bound IL-15 (mbIL-15), and / or membrane-bound 4-1BBL (mb4-1BBL). It is understood and contemplated herein that in some embodiments, stimulation and expansion of the modified (i.e., engineered) cells can occur in vivo after or simultaneously with administration of the modified cells to the subject. Thus, methods of immunotherapy for expanding cells (e.g., T cells, B cells, macrophages, NK cells, NK T cells, TIL, MIL, TINK, fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells, etc.) in a subject after transplantation of cells to the subject via administration of PM particles having IL-21 or mbIL-21, exosomes having mbIL-21, and / or irradiated mbIL-21-expressing feeder cells are disclosed herein. In some embodiments, expansion further includes administration of IL-15 and / or 4-1BBL or PM particles, exosomes, and / or irradiated feeder cells expressing membrane-bound IL-15 and / or 4-1BBL.

[0059] The disclosed modified cells (e.g., T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neurons, epithelial cells, and / or muscle cells, etc., and including but not limited to CAR NK cells and CAR T cells disclosed herein) and methods of adoptive transfer of modified cells can be an effective immunotherapy against cancer and are contemplated herein. Using the methods and compositions of the present disclosure, any disease in which uncontrolled cell growth such as cancer occurs can be treated. A non-limiting list of different types of cancers is as follows: lymphoma (Hodgkin and non-Hodgkin), leukemia, carcinomas, solid tissue cancers, squamous cell carcinoma, adenocarcinoma, sarcoma, glioma, high-grade glioma, blastoma, neuroblastoma, plasmacytoma, histiocytoma, melanoma, adenoma, hypoxic tumor, myeloma, AIDS-related lymphoma or sarcoma, metastatic cancer, or general cancer.

[0060] A representative but non-limiting list of cancers that can be treated using the disclosed compositions is as follows: lymphoma, B cell lymphoma, T cell lymphoma, mycosis fungoides, Hodgkin's disease, myeloid leukemia, bladder cancer, brain cancer, nervous system cancer, head and neck cancer, squamous cell carcinoma of the head and neck, lung cancers such as small cell lung cancer and non-small cell lung cancer, neuroblastoma / glioblastoma, ovarian cancer, skin cancer, liver cancer, melanoma, squamous cell carcinoma of the mouth, pharynx, larynx, and lung, cervical cancer, cervical carcinoma, breast cancer, and epithelial cancer, kidney cancer, genitourinary cancer, pulmonary cancer, esophageal cancer, head and neck carcinoma, colorectal cancer, hematopoietic cancer, testicular cancer, colon cancer, rectal cancer, prostate cancer, or pancreatic cancer.

[0061] "Treat," "treating," "treatment," and grammatical variations thereof, as used herein, when the administration of a composition is intended or purposed to partially or completely prevent, delay, cure, heal, alleviate, relieve, change, remedy, ameliorate, improve, stabilize, mitigate, and / or reduce the intensity or frequency of one or more diseases or conditions, the symptoms of a disease or condition, or the underlying cause of a disease or condition. Treatment according to the invention can be applied preventively, prophylactically, palliatively, or therapeutically. Prophylactic treatment is administered to a subject before onset (e.g., before overt signs of cancer), during early onset (e.g., at initial signs and symptoms of cancer), or after the development of established cancer. Prophylactic administration can be made from one (several) day(s) to several years before the manifestation of symptoms of an infectious disease.

[0062] 1. Hybridization / Selection Hybridization The term hybridization typically refers to a sequence-driven interaction between at least two nucleic acid molecules, such as a primer or probe and a gene. A sequence-driven interaction means an interaction that occurs in a nucleotide-specific manner between two nucleotides or nucleotide analogs or nucleotide derivatives. For example, G that interacts with C, or A that interacts with T, are sequence-driven interactions. Typically, sequence-driven interactions occur on the Watson-Crick or Hoogsteen faces of nucleotides. The hybridization of two nucleic acids is affected by several conditions and parameters known to those skilled in the art. For example, the salt concentration, pH, and temperature of the reaction all affect whether two nucleic acid molecules will hybridize.

[0063] The parameters for selective hybridization between two nucleic acid molecules are known to those skilled in the art. For example, in some embodiments, the conditions for selective hybridization can be defined as stringent hybridization conditions. For example, the stringency of hybridization is controlled by both the temperature and salt concentration of either or both of the hybridization and washing steps. For example, the conditions for hybridization to achieve selective hybridization are hybridization in a high ionic strength solution (6X SSC or 6X SSPE) at a temperature approximately 12 - 25 °C lower than the Tm (the melting temperature at which half of the molecules dissociate from their hybridization partners), followed by washing at a combination of temperature and salt concentration selected such that the washing temperature is approximately 5 °C - 20 °C lower than the Tm. In a preliminary experiment where a sample of reference DNA immobilized on a filter is hybridized to the labeled nucleic acid of interest and then washed under conditions of different stringencies, the temperature and salt conditions are readily determined empirically. The hybridization temperature is typically higher for DNA - RNA and RNA - RNA hybridizations. As described above, or as known in the art, these conditions can be used to achieve stringency. Preferred stringent hybridization conditions for DNA:DNA hybridization can be in 6X SSC or 6X SSPE at approximately 68 °C (in aqueous solution), followed by washing at 68 °C. Optionally, the stringency of hybridization and washing can be reduced further as the degree of desired complementarity decreases, and also in accordance with the G - C or A - T richness of any region where variability is being searched. Optionally, the stringency of hybridization and washing can be increased further as the degree of desired complementarity increases, and also in accordance with the G - C or A - T richness of any region where high complementarity is desired, as is known to those skilled in the art.

[0064] Another way to define selective hybridization is by looking at the amount (percentage) of one nucleic acid that binds to the other nucleic acid. For example, in some embodiments, the selective hybridization conditions are when at least about 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% of the restricted nucleic acid binds to the non-restricted nucleic acid. Typically, the non-restricted primer is, for example, 10 or 100 or 1000-fold in excess. This type of assay can be performed under conditions where both the restricted primer and the non-restricted primer are, for example, less than 10-fold or 100-fold or 1000-fold of their k d or only one of the nucleic acid molecules is 10-fold or 100-fold or 1000-fold, or one or both of the nucleic acid molecules are their k d above.

[0065] Another way to define selective hybridization is to examine the percentage of primers that are enzymatically manipulated under conditions where hybridization is required to facilitate the desired enzymatic manipulation. For example, in some embodiments, the conditions for selective hybridization are when at least about 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% of the primers are enzymatically manipulated under conditions that facilitate enzymatic manipulation. For example, if the enzymatic manipulation is DNA extension, the conditions for selective hybridization are when at least about 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% of the primer molecules are extended. Also included in the preferred conditions are the conditions suggested by the manufacturer or those indicated in the art appropriate for the enzyme performing the manipulation.

[0066] It is understood that, as with positive homology, various methods for determining the level of hybridization between two nucleic acid molecules are disclosed herein. Although these methods and conditions can provide different percentages of hybridization between two nucleic acid molecules, it will be sufficient to meet the parameters of any method unless otherwise indicated. For example, if 80% hybridization is required, as long as hybridization occurs within the parameters required by any one of these methods, it is considered to be within what is disclosed herein.

[0067] One of ordinary skill in the art will understand that if a composition or method meets any one of these criteria for determining hybridization, either collectively or individually, it is a composition or method disclosed herein.

[0068] 2. Nucleic acid There are various molecules disclosed herein based on nucleic acids, including, for example, nucleic acids (e.g., nucleic acids encoding TGFβR2 or any of the nucleic acids disclosed herein for creating TGFRβ2 knockout), or fragments thereof, as well as various functional nucleic acids. The disclosed nucleic acids are composed of, for example, nucleotides, nucleotide analogs, or nucleotide surrogates. Non-limiting examples of these and other molecules are discussed herein. For example, when a vector is expressed intracellularly, it is understood that the expressed mRNA is typically composed of A, C, G, and U. Similarly, for example, when an antisense molecule is introduced into a cell or cell environment, for example, through exogenous delivery, it is understood that it is advantageous for the antisense molecule to be composed of nucleotide analogs that reduce the degradation of the antisense molecule in the cell environment.

[0069] a) Nucleotides and related molecules A nucleotide is a molecule containing a base moiety, a sugar moiety, and a phosphate moiety. Nucleotides can be linked together through their phosphate and sugar moieties to form internucleoside bonds. The base moiety of a nucleotide can be adenin-9-yl (A), cytosin-1-yl (C), guanin-9-yl (G), uracil-1-yl (U), and thymin-1-yl (T). The sugar moiety of a nucleotide is ribose or deoxyribose. The phosphate moiety of a nucleotide is a pentavalent phosphate. Non-limiting examples of nucleotides would be 3'-AMP (3'-adenosine monophosphate) or 5'-GMP (5'-guanosine monophosphate). There are a wide variety of these types of molecules available in the art and available herein.

[0070] Nucleotide analogs are nucleotides that contain some kind of modification in either the base, sugar, or phosphate moiety. Modifications to nucleotides are known in the art and would include, for example, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, and 2-aminoadenine, as well as modifications in the sugar or phosphate moiety. There are a wide variety of these kinds of molecules available in the art and available herein.

[0071] Nucleotide substitutes are molecules that have similar functional properties to nucleotides but do not contain a phosphate moiety, such as peptide nucleic acids (PNA). Nucleotide substitutes recognize nucleic acids in a Watson-Crick or Hoogsteen fashion but are linked together through moieties other than the phosphate moiety. Nucleotide substitutes can adopt a double helix-like structure when interacting with an appropriate target nucleic acid. There are a wide variety of these kinds of molecules available in the art and available herein.

[0072] It is also possible to link other kinds of molecules (complexes) to nucleotides or nucleotide analogs, for example, to enhance cellular uptake. The complex can be chemically linked to the nucleotide or nucleotide analog. Such complexes include, but are not limited to, lipid moieties, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556). There are a wide variety of these kinds of molecules available in the art and available herein.

[0073] The Watson-Crick interaction is at least one interaction with the Watson-Crick face of a nucleotide, nucleotide analog, or nucleotide substitute. The Watson-Crick face of a nucleotide, nucleotide analog, or nucleotide substitute includes the C2, N1, and C6 positions of a purine nucleotide, nucleotide analog, or nucleotide substitute, and the C2, N3, and C4 positions of a pyrimidine nucleotide, nucleotide analog, or nucleotide substitute.

[0074] The Hoogsteen interaction is an interaction that occurs on the Hoogsteen face of a nucleotide or nucleotide analog exposed in the major groove of double-stranded DNA. The Hoogsteen face includes the reactive groups (NH2 or O) at the N7 and C6 positions of a purine nucleotide.

[0075] b) Sequence There are various sequences related to protein molecules involved in the signal transduction pathways disclosed herein, such as TGFβR2, and all of these are either encoded by nucleic acids or are nucleic acids. The human analogs of these genes, as well as other analogs, and the alleles of these genes, and the sequences of splice variants and other types of variants are available in various protein and gene databases including Genbank. Those skilled in the art understand methods for analyzing sequence mismatches and differences, and methods for adapting compositions and methods related to a particular sequence to other related sequences. Primers and / or probes can be designed for any given sequence that provides information disclosed herein and known in the art.

[0076] c) Primers and probes Compositions are disclosed that include primers and probes that can interact with the disclosed nucleic acids such as TGFβR2 and / or HPRT1 disclosed herein. In certain embodiments, primers are used to support DNA amplification reactions. Typically, the primers will be extended in a sequence-specific manner. Extension of the primers in a sequence-specific manner includes any method by which the sequence and / or composition of the nucleic acid molecule to which the primer hybridizes or otherwise associates induces or affects the composition or sequence of the product produced by the extension of the primer. Thus, extension of the primers in a sequence-specific manner includes, but is not limited to, PCR, DNA sequencing, DNA extension, DNA polymerization, RNA transcription, or reverse transcription. Techniques and conditions for amplifying the primers in a sequence-specific manner are preferred. In certain embodiments, the primers are used in DNA amplification reactions such as PCR or direct sequencing. In certain embodiments, the primers can also be extended using non-enzymatic techniques; for example, it should be understood that the nucleotides or oligonucleotides used to extend the primers are modified such that they chemically react to extend the primers in a sequence-specific manner. Typically, the disclosed primers hybridize to the disclosed nucleic acid or region of the nucleic acid, or they hybridize to the complement of the nucleic acid or region of the nucleic acid.

[0077] In certain embodiments, the size of the primer or probe for interacting with the nucleic acid can be any size that supports the desired enzymatic manipulation of the primer, such as DNA amplification or just hybridization of the probe or primer. A typical primer or probe is at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides in length.

[0078] In other embodiments, the primer or probe can be 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides in length or less.

[0079] Primers for the TGFβR2 and HPRT1 genes are typically used to produce an amplified DNA product that contains the region or the complete gene of the TGFβR2 and HPRT1 genes. Generally, typically, the size of this product can be determined accurately to within 3 nucleotides, or within 2 nucleotides, or within 1 nucleotide of size.

[0080] In certain embodiments, the product is at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides in length.

[0081] In other embodiments, the product is 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides in length or less.

[0082] 3. Delivery of the Composition to Cells There are several compositions and methods that can be used to deliver nucleic acids to cells, either in vitro or in vivo. These methods and compositions can be broadly classified into two classes: virus-based delivery systems and non-virus-based delivery systems. For example, nucleic acids can be delivered via several direct delivery systems such as electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, cosmids, etc., or via the transfer of genetic material in cells or carriers such as cationic liposomes. Appropriate means for transfection, including viral vectors, chemical transfectants, or physical and mechanical methods such as electroporation and direct diffusion of DNA, are described, for example, by Wolff, J.A., et al., Science, 247, 1465-1468, (1990), and Wolff, J.A. Nature, 352, 815-818, (1991). Such methods are well known in the art and can be readily adapted for use with the compositions and methods described herein. In certain cases, the methods will be modified to specifically function with large DNA molecules. Furthermore, these methods can be used to target specific diseases and cell populations by using the targeting properties of the carriers.

[0083] a) Nucleic acid-based delivery systems An introduction vector can be any nucleotide construct that is used to deliver a gene into a cell (e.g., a plasmid) or that is used as part of a general strategy for delivering a gene, e.g., as part of a recombinant retrovirus or adenovirus (Ram et al. Cancer Res. 53:83-88, (1993)).

[0084] As used herein, a plasmid or viral vector is an agent that transports the disclosed nucleic acid into a cell without degradation and contains a promoter that results in gene expression within the cell to which it is delivered. Viral vectors include, for example, adenovirus, adeno-associated virus, herpes virus, vaccinia virus, poliovirus, AIDS virus, neurotrophic virus, Sindbis, and other RNA viruses having an HIV backbone. Preferably, any viral family that shares the properties of these viruses and is also suitable for use as a vector. Retroviruses include murine Moloney leukemia virus, MMLV, and retroviruses that express the desired properties of MMLV as a vector. Retroviral vectors can carry a larger gene payload, i.e., a transgene or marker gene, than other viral vectors and are thus commonly used vectors. However, they are not useful in non-proliferating cells. Adenoviral vectors are relatively stable, easy to handle, have a high titer, can be delivered as an aerosol formulation, and can transfect non-dividing cells. Poxvirus vectors are large, have several sites for inserting genes, are heat-stable, and can be stored at room temperature. Preferred embodiments are viral vectors engineered to suppress the immune response of the host organism induced by viral antigens. Preferred vectors of this type carry the coding region of interleukin 8 or 10.

[0085] Viral vectors can have a higher transaction (gene transfer ability) ability than chemical or physical methods for introducing genes into cells. Typically, a viral vector contains non-structural early genes, structural late genes, RNA polymerase III transcripts, inverted terminal repeats necessary for replication and capsid formation, and a promoter that controls transcription and replication of the viral genome. When engineered as a vector, the virus typically removes one or more of the early genes and inserts a gene or gene / promoter cassette into the viral genome in place of the removed viral DNA. This type of construct can carry up to approximately 8 kb of foreign genetic material. The necessary functions of the removed early genes are typically supplied by a cell line engineered to express the gene products of the early genes in trans.

[0086] (1) Adeno-associated virus vector Another type of viral vector is based on adeno-associated virus (AAV). This defective parvovirus is a preferred vector because it can infect many cell types and is non-pathogenic to humans. AAV-based vectors can transport approximately 4 - 5 kb, and wild-type AAV is known to integrate stably into chromosome 19 (e.g., AAV integration site 1 (AAVS1), etc.). Vectors containing this site-specific integration property are preferred. The AAV used can be any AAV serotype including, but not limited to, AAC1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and recombinant (rAAV) such as AAV-Rh74, and / or synthetic AAV (e.g., AAV-DJ, Anc80, etc.). The AAV serotype can be selected based on cell or tissue tropism. The AAV vectors for use in the disclosed compositions and methods can be single-stranded (SS) or self-complementary (SC).

[0087] In another type of AAV virus, the AAV contains a pair of inverted terminal repeats (ITRs) adjacent to at least one cassette containing a promoter that directs cell-specific expression operably linked to a heterologous gene. In this context, heterologous refers to any nucleotide sequence or gene that is not native to AAV or parvovirus B19.

[0088] Typically, the AAV and B19 coding regions are deleted, resulting in a safe, non-cytotoxic vector. The AAV ITR, or a modification thereof, confers infectivity and site-specific integration but not cytotoxicity, and the promoter directs cell-specific expression.

[0089] Thus, the disclosed vectors provide DNA molecules that can integrate into the mammalian chromosome without substantial toxicity.

[0090] Inserted genes in viruses and retroviruses typically contain a promoter and / or enhancer that serves to control the expression of the desired gene product. A promoter is generally a sequence (or sequences) of DNA that functions when in a relatively fixed position with respect to the transcription start site. A promoter contains the core elements necessary for the basic interaction of RNA polymerase and transcription factors and may contain upstream elements and response elements.

[0091] It is understood and contemplated herein that the packaging capacity of AAV is limited. One way to overcome the payload capacity of an AAV vector is through the use of two vectors, where the transgene is split between two plasmids and the 3' splice donor and 5' splice acceptor are used to ligate the two pieces of the transgene into a single full-length transgene. Alternatively, two transgenes can be created with substantial overlap, and homologous recombination joins the two segments into a full-length transcript.

[0092] 4. Expression System Nucleic acids delivered to cells typically contain an expression control system. For example, transgenes in viral and retroviral systems usually contain a promoter and / or enhancer that serves to control the expression of the desired gene product. A promoter is generally a DNA sequence that functions when located at a relatively fixed position with respect to the transcription start site. A promoter contains the core elements necessary for the basic interaction of RNA polymerase and transcription factors, and may contain upstream elements and response elements.

[0093] a) Viral promoters and enhancers Preferred promoters for controlling transcription from vectors in mammalian host cells can be obtained from the genomes of various sources, such as viruses like polyoma, simian virus 40 (SV40), adenovirus, retrovirus, hepatitis B virus, and most preferably cytomegalovirus, or from heterologous mammalian promoters, such as the β-actin promoter. The early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment that also contains the SV40 origin of replication (Fiers et al., Nature, 273:113 (1978)). The immediate early promoter of human cytomegalovirus is conveniently obtained as a HindIII E restriction fragment (Greenway, P.J. et al., Gene 18:355 - 360 (1982)). Of course, promoters from the host cell or related species are also useful herein.

[0094] Enhancers generally function even when located at a certain distance from the transcription start site and can be DNA sequences either on the 5' side (Laimins, L. et al., Proc. Natl. Acad. Sci. 78:993 (1981)) or the 3' side (Lusky, M. L., et al., Mol. Cell Bio. 3:1108 (1983)) of the transcription unit. Furthermore, enhancers can be within introns (Banerji, J. L. et al., Cell 33:729 (1983)) and even within the coding sequences themselves (Osborne, T. F., et al., Mol. Cell Bio. 4:1293 (1984)). These are usually 10 - 300 bp in length and function in cis. Enhancers function to increase transcription from nearby promoters. Enhancers also often contain response elements that mediate the regulation of transcription. Promoters can also contain response elements that mediate the regulation of transcription. Enhancers often determine the regulation of gene expression. Many enhancer sequences are currently known from mammalian genes (globin, elastase, albumin, fetoprotein, and insulin), but typically, enhancers derived from viruses of eukaryotic cells are used for general expression. Preferred examples are the SV40 enhancer (100 - 270 bp) on the late side of the origin of replication, the enhancer of the cytomegalovirus immediate early promoter, the polyoma enhancer on the late side of the origin of replication, and the adenovirus enhancer.

[0095] Promoters and / or enhancers can be specifically activated by either light or specific chemical events that trigger their function. The system can be regulated by reagents such as tetracycline and dexamethasone. There are also methods to enhance gene expression of viral vectors by exposure to irradiation such as gamma - ray irradiation or by alkylating chemotherapeutic agents.

[0096] In certain embodiments, the promoter and / or enhancer region can act as a constitutive promoter and / or enhancer to maximize the expression of the region of the transcription unit being transcribed. In certain constructs, the promoter and / or enhancer region is active in all eukaryotic cell types, even if it is expressed only in certain types of cells at a particular time. A preferred promoter of this type is the CMV promoter (650 bases). Other preferred promoters are the SV40 promoter, the cytomegalovirus (full-length promoter), and the LTR of retroviral vectors.

[0097] It has been shown that all specific regulatory elements can be cloned and used to construct expression vectors that are selectively expressed in specific cell types such as melanoma cells. The glial fibrillary acetic acid protein (GFAP) promoter has been used to selectively express genes in glia-derived cells.

[0098] In addition, expression vectors used in eukaryotic host cells (yeast, fungi, insects, plants, animals, humans, or nucleated cells) may contain sequences necessary for the termination of transcription that can affect the expression of mRNA. These regions are transcribed as polyadenylation segments in the untranslated portion of the mRNA encoding the tissue factor protein. The 3' untranslated region also contains the transcription termination site. The transcription unit preferably also contains a polyadenylation region. One advantage of this region is that it increases the likelihood that the transcription unit will be processed and transported like mRNA. The identification and use of polyadenylation signals in expression constructs are well established. It is preferred that homologous polyadenylation signals be used in the transgene construct. In certain transcription units, the polyadenylation region is derived from the SV40 early polyadenylation signal and consists of approximately 400 bases. Also, the transcription unit preferably contains other standard sequences, alone or in combination with the above sequences, that improve the expression or stability from the construct.

[0099] b) Marker The viral vector can contain a nucleic acid sequence encoding a marker product. This marker product is used to determine whether the gene has been delivered to the cell and is expressed when delivered. Preferred marker genes are the E. coli lacZ gene encoding β-galactosidase and green fluorescent protein.

[0100] In some embodiments, the marker may be a selectable marker. Examples of selectable markers suitable for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hygromycin, and puromycin. When such a selectable marker is successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive when placed under selective pressure. There are two different categories of widely used selection regimens. The first category is based on the use of mutant cell lines that lack the ability to grow independently of cell metabolism and supplemented media. Two examples are CHO DHFR cells and mouse LTK cells. These cells lack the ability to grow without the addition of nutrients such as thymidine or hypoxanthine. Since these cells lack specific genes required for the complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in the supplemented media. An alternative means of supplementing the media is to change their growth requirements by introducing an intact DHFR or TK gene into cells that lack each respective gene. Individual cells not transformed with the DHFR or TK gene would not be able to survive in non-supplemented media.

[0101] The second category refers to selection schemes used in any cell type and is dominant selection that does not require the use of mutant cell lines. These schemes typically use drugs to arrest the growth of host cells. Those cells with the new gene will express a protein that confers drug resistance and will survive the selection. Examples of such dominant selection include the use of the drugs neomycin (Southern P. and Berg, P., J. Molec. Appl. Genet. 1:327 (1982)), mycophenolic acid (Mulligan, R.C. and Berg, P. Science 209:1422 (1980)), or hygromycin (Sugden, B. et al., Mol. Cell. Biol. 5:410 - 413 (1985)). Three examples use bacterial genes under the control of eukaryotic cells to confer resistance to the appropriate drugs G418 or neomycin (geneticin), xgpt (mycophenolic acid) or hygromycin, respectively. Others include the neomycin analog G418 and puromycin.

[0102] 5. Peptide a) Protein Variant Protein variants and derivatives are well understood by those skilled in the art and can include amino acid sequence modifications. For example, amino acid sequence modifications typically fall into one or more of three classes: substitution, insertion, or deletion variants. Insertions include amino- and / or carboxyl-terminal fusions, as well as in-sequence insertions of single or multiple amino acid residues. Insertions will usually be smaller than amino- or carboxyl-terminal fusions, on the order of, for example, about 1 to 4 residues. Derivatives of immunogenic fusion proteins, such as those described in the examples, are made by fusing a polypeptide of sufficient size to confer immunogenicity to the target sequence, either by cross-linking in vitro or by recombinant cell culture transformed with the DNA encoding the fusion. Deletions are characterized by the removal of one or more amino acid residues from the sequence of a protein. Typically, about 2 to 6 or fewer residues are deleted at any one site within the protein molecule. These variants are usually prepared by site-directed mutagenesis of nucleotides within the DNA encoding the protein, thereby producing the DNA encoding the variant, which is then expressed in recombinant cell culture. Techniques for making substitution mutations at predetermined sites in DNA having a known sequence, such as M13 primer mutagenesis and PCR mutagenesis, are well known. Amino acid substitutions are typically of the single residue variety, but can occur at several different locations at once, insertions are usually on the order of about 1 to 10 amino acid residues, and deletions are in the range of about 1 to 30 residues. Deletions or insertions are preferably made in adjacent pairs, i.e., a deletion of two residues or an insertion of two residues. Substitutions, deletions, insertions, or any combination thereof, can be combined to arrive at the final construct. Mutations must not cause the sequence to go out of frame and preferably do not generate complementary regions that could produce secondary mRNA structure. Substitution variants are variants in which at least one residue has been removed and a different residue inserted in its place. Such substitutions generally are made according to the following Tables 2 and 3 and are referred to as conservative substitutions. [Table 2]

Table 3

[0103] Substantial changes in function or immunological identity are made by selecting substitutions that are less conservative than those in Table 3, i.e., by selecting residues whose effects on maintaining (a) the structure of the polypeptide backbone in the substitution area as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain, are significantly different. In general, substitutions that are expected to result in the greatest changes in protein properties are those in which (a) a hydrophilic residue, e.g., seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl, or alanyl, (b) cysteine or proline is substituted for (or by) any other residue, (c) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histidyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl, or (d) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) a residue having no side chain, e.g., glycine, where (e) the substitution is made by increasing the number of sites of sulfation and / or glycosylation.

[0104] For example, replacing one amino acid residue with another that is biologically and / or chemically similar is known to those of skill in the art as a conservative substitution. For example, a conservative substitution is replacing one hydrophobic residue with another hydrophobic residue or one polar residue with another polar residue. Substitutions include, for example, combinations such as Gly, Ala, Val, Ile, Leu, Asp, Glu, Asn, Gln, Ser, Thr, Lys, Arg, and Phe, Tyr. Such conservatively substituted variations of each explicitly disclosed sequence are included in the mosaic polypeptides provided herein.

[0105] Using substitution or deletion mutagenesis, sites for N-glycosylation (Asn-X-Thr / Ser) or O-glycosylation (Ser or Thr) can be inserted. Deletion of cysteine or other labile residues may also be desirable. Deletion or substitution of potential proteolytic sites (e.g., Arg) is achieved, for example, by deleting one of the basic residues or substituting with a glutaminyl or histidyl residue.

[0106] Certain post-translational derivatizations are the result of the action of the recombinant host cell on the expressed polypeptide. Glutaminyl and asparaginyl residues are often deamidated to the corresponding glutamyl and aspartyl residues after translation. Alternatively, these residues are deamidated under weakly acidic conditions. Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of the hydroxyl group of a seryl or threonyl residue, methylation of the o-amino group of the lysine, arginine, and histidine side chains (T.E. Creighton, Proteins: Structure and Molecular Properties, W.H. Freeman & Co., San Francisco pp 79-86

[1983] ), acetylation of the N-terminal amine, and, in some cases, amidation of the C-terminal carboxyl.

[0107] It should be understood that one way to define variants and derivatives of the proteins disclosed herein is by defining the variants and derivatives in terms of homology / identity to a particular known sequence. Specifically disclosed are these variants and other proteins disclosed herein that have at least 70% or 75% or 80% or 85% or 90% or 95% homology to the recited sequences. One of ordinary skill in the art can readily understand how to determine the homology of two proteins. For example, homology can be calculated after aligning the two sequences such that the level of homology is at its highest.

[0108] Another way to calculate identity can be performed by published algorithms. Optimal alignment of arrays for comparison can be done by the local identity algorithm of Smith and Waterman Adv. Math. 2:482 (1981), by the identity alignment algorithm of Needleman and Wunsch, J. Mol Biol. 48:443 (1970), by the similarity search method of Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85:2444 (1988), by computer implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA, on the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr, Madison, WI).

[0109] For nucleic acids, the same type of identity can be obtained, for example, by the algorithms disclosed in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, Jaeger et al. Methods Enzymol. 183:281-306, 1989.

[0110] It is understood that descriptions of conservative mutations and identity can be combined together in any combination, for example, in embodiments where a variant has at least 70% identity to a particular sequence that is a conservative mutation.

[0111] This specification, in discussing various proteins and protein sequences, is understood to also disclose nucleic acids that can encode those protein sequences. This includes all degenerate sequences related to a particular protein sequence, i.e., all nucleic acids having a sequence that encodes one particular protein sequence, as well as all nucleic acids including degenerate nucleic acids that encode disclosed variants and derivatives of the protein sequence. Thus, although each particular nucleic acid sequence may not be described herein, it is understood that each sequence and all sequences are in fact disclosed and described herein through the disclosed protein sequences. Also, although there is no amino acid sequence disclosed herein that indicates a particular DNA sequence encoding a protein within the organisms disclosed herein, it is understood that known nucleic acid sequences encoding that protein are also known, disclosed, and described herein.

[0112] It is understood that there are numerous amino acid and peptide analogs that can be incorporated into the disclosed compositions. For example, there are numerous D - amino acids or amino acids with functional substituents different from those shown in Tables 2 and 3. Opposite stereoisomers of naturally occurring peptides, as well as stereoisomers of peptide analogs, are disclosed. These amino acids can be readily incorporated into polypeptide chains by charging a selected amino acid to a tRNA molecule and by manipulating gene constructs that insert the analog amino acid into the peptide chain in a site - specific manner, for example, using an amber codon.

[0113] It is possible to produce molecules that resemble peptides but are not linked through natural peptide bonds. For example, linkages for amino acids or amino acid analogs include CH2NH--, --CH2S--, --CH2--CH2--, --CH=CH-- (cis and trans), --COCH2--, --CH(OH)CH2--, and --CHH2SO- (these and others are found in Spatola, A.F. in Chemistry and Biochemistry of Amino Acids, Peptides, and Proteins, B. Weinstein, eds., Marcel Dekker, New York, p. 267 (1983), Spatola, A.F., Vega Data (March 1983), Vol. 1, Issue 3, Peptide Backbone Modifications (general review), Morley, Trends Pharm Sci (1980) pp. 463 - 468; Hudson, D. et al., Int J Pept Prot Res 14:177 - 185 (1979) (--CH2NH--, CH2CH2--), Spatola et al. Life Sci 38:1243 - 1249 (1986) (--CH H2--S), Hann J. Chem. Soc Perkin Trans. I 307 - 314 (1982) (--CH--CH--, cis and trans), Almquist et al. J. Med. Chem. 23:1392 - 1398 (1980) (--COCH2--), Jennings - White et al. Tetrahedron Lett 23:2533 (1982) (--COCH2--), Szelke et al. European Appln, EP 45665 CA (1982):97:39405 (1982) (--CH(OH)CH2--), Holladay et al. Tetrahedron. Lett 24:4401 - 4404 (1983) (--C(OH)CH2--), and Hruby Life Sci 31:189 - 199 (1982) (--CH2--S--), each of which is hereby incorporated by reference into this specification.A particularly preferred non - peptide bond is --CH2NH--. It is understood that peptidomimetics can have two or more atoms between the bonding atoms such as β - alanine and γ - aminobutyric acid.

[0114] Amino acid analogs and analogs as well as peptidomimetics often have more economical production, greater chemical stability, enhanced pharmacological properties (half - life, absorption, potency, efficacy, etc.), changes in specificity (e.g., broad - spectrum biological activity), reduced antigenicity, etc.

[0115] Since D - amino acids are not recognized by peptidases, etc., D - amino acids can be used to produce more stable peptides. One or more amino acids of a consensus sequence can be systematically substituted with the same type of D - amino acid (e.g., D - lysine instead of L - lysine) to produce more stable peptides. Cysteine residues can be used to cyclize or bind two or more peptides together. This can be beneficial for constraining the peptide into a specific conformation.

[0116] 6. Pharmaceutical Carrier / Delivery of Pharmaceutical Products As described above, the composition can also be administered in vivo in a pharmaceutically acceptable carrier. "Pharmaceutically acceptable" means a material that is not biologically or otherwise undesirable, i.e., a material that does not cause any undesirable biological effects or interact in a harmful manner with any of the other components of the pharmaceutical composition, and that can be administered to a subject, together with a nucleic acid or vector. The carrier will of course be selected to minimize any degradation of the active ingredient and any harmful side - effects in the subject, as is well - known to those skilled in the art.

[0117] The composition can be administered orally, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, ex vivo, locally (including topical intranasal administration or administration by inhalation), etc. As used herein, "topical intranasal administration" means delivering the composition to the nose and nasal passages via one or both nostrils, and can include delivery by a spray or droplet mechanism, or by aerosolization of the nucleic acid or vector. Administration of the composition by inhalation can be through the nose or mouth via delivery by a spray or droplet mechanism. Delivery can also be directly to any region of the respiratory system (e.g., the lungs) via intubation. The exact amount of the composition required will vary depending on the species, age, weight, and general condition of the subject, the severity of the allergic disorder being treated, the particular nucleic acid or vector used, its method of administration, etc. Thus, it is not possible to specify an exact amount for all compositions. However, an appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation in light of the teachings herein.

[0118] Parenteral administration of the composition, when used, generally features injection. Injectables can be prepared in conventional forms as liquid solutions or suspensions, in solid forms suitable for solution of the suspension in a liquid prior to injection, or as emulsions. More recently revised approaches to parenteral administration involve the use of sustained or controlled release systems such that a constant dosage is maintained. See, e.g., U.S. Patent No. 3,610,795, which is incorporated herein by reference.

[0119] The materials may be in solution, suspension (e.g., incorporated into microparticles, liposomes, or cells). These can target specific cell types via antibodies, receptors, or receptor ligands. The following references are examples of the use of this technology for targeting specific proteins in tumor tissue (Senter, et al., Bioconjugate Chem., 2:447-451, (1991), Bagshawe, K.D., Br. J. Cancer, 60:275-281, (1989), Bagshawe, et al., Br. J. Cancer, 58:700-703, (1988), Senter, et al., Bioconjugate Chem., 4:3-9, (1993), Battelli, et al., Cancer Immunol. Immunother., 35:421-425, (1992), Pietersz and McKenzie, Immunolog. Reviews, 129:57-80, (1992), and Roffler, et al., Biochem. Pharmacol, 42:2062-2065, (1991)). Vehicles such as "stealth" and other antibody-conjugated liposomes (including lipid-mediated drugs targeting colon cancer), receptor-mediated targeting of DNA through cell-specific ligands, lymphocyte-specific tumor targeting, and highly specific therapeutic retroviral targeting of mouse glioma cells in vivo. The following references are examples of the use of this technology for targeting specific proteins in tumor tissue (Hughes et al., Cancer Research, 49:6214-6220, (1989), and Litzinger and Huang, Biochimica et Biophysica Acta, 1104:179-187, (1992)). Generally, receptors are involved in the pathway of endocytosis, either constitutive or ligand-induced. These receptors cluster within clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through acidified endosomes where the receptors are sorted, and then are either recycled to the cell surface, stored intracellularly, or degraded in lysosomes.Internal migration pathways serve various functions such as nutrient uptake, removal of activating proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligands, and regulation of receptor levels. Many receptors follow two or more intracellular pathways depending on cell type, receptor concentration, type of ligand, ligand valence, and ligand concentration. The molecular and cellular mechanisms of receptor-mediated endocytosis have been outlined (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)).

[0120] Plasmids are also provided herein that sequentially include a left homologous arm, a splice acceptor, a transgene, and a right homologous arm, and the left and right homologous arms each have a length of 800 bp or less.

[0121] In one aspect, plasmids are provided herein that contain or consist of one or two protospacer adjacent motifs (PAMs), and CRISPR RNA (crRNA), and a transgene, and the order of the encoded nucleic acids includes the PAM, crRNA, and transgene, and when two PAMs and crRNAs are used, the encoded nucleic acids include the first PAM, the first crRNA, the transgene, the second PAM, and the second gRNA.

[0122] Also provided herein are the plasmids of the present invention, the AAV vectors of the present invention, or the modified cells of the present invention for use as a medicament. The present invention further provides the use of the plasmids of the present invention, the AAV vectors of the present invention, or the modified cells of the present invention for the manufacture of a medicament. The present invention also provides the plasmids of the present invention, the AAV vectors of the present invention, or the modified cells of the present invention for use in the treatment of cancer. The present invention further provides the use of the plasmids of the present invention, the AAV vectors of the present invention, or the modified cells of the present invention for the manufacture of a medicament for the treatment of cancer. Various embodiments of the present invention are shown below. 1. A plasmid for use with a clustered regularly interspaced short palindromic repeat (CRISPR) / CRISPR-associated 9 (Cas9) integration system, the plasmid comprising a left homology arm, a splice acceptor, a transgene, and a right homology arm in that order, the left homology arm and the right homology arm each having a length of 800 bp or less. 2. The plasmid according to 1 above, further comprising a polyadenylation signal between the transgene and the right homology arm. 3. The plasmid according to 1 or 2 above, wherein the left homology arm and the right homology arm have the same length. 4. The plasmid according to 3 above, wherein the homology arm has a length of 30 bp. 5. The plasmid according to 3 above, wherein the homology arm has a length of 300 bp. 6. The plasmid according to 3 above, wherein the homology arm has a length of 500 bp. 7. The plasmid according to 3 above, wherein the homology arm has a length of 800 bp. 8. The plasmid according to 1 or 2 above, wherein the left homology arm and the right homology arm have different lengths. 9. A plasmid for use in a CRISPR / Cas9 integration method consisting of one or two protospacer adjacent motifs (PAMs), a CRISPR RNA (crRNA), and a transgene, the order of the encoded nucleic acids comprising a PAM, a crRNA, and a transgene, and when two PAMs and crRNAs are used, the encoded nucleic acids comprising a first PAM, a first crRNA, a transgene, a second PAM, and a second gRNA. 10. The plasmid according to any one of 1 to 9 above, wherein the homologous arm of the plasmid according to any one of 1 to 8 above and the PAM of the plasmid according to 9 above specifically hybridize to the adeno-associated virus integration site 1 (AAVS1) on human chromosome 19. 11. The plasmid according to any one of 1 to 10 above, wherein the transgene comprises a polynucleotide encoding a chimeric antigen receptor of a tumor antigen. 12. An adeno-associated virus (AAV) vector comprising the plasmid according to any one of 1 to 11 above. 13. The AAV vector according to 12 above, wherein the serotype of the AAV includes AAV6. 14. The AAV vector according to 12 or 13 above, wherein the vector further comprises a plasmid encoding crRNA, tracer RNA (trcrRNA), and a CAS endonuclease. 15. The AAV vector according to any one of 12 to 14 above, wherein the vector is a single-stranded AAV (ssAAV). 16. The AAV vector according to any one of 12 to 15 above, wherein the vector is a self-complementary AAV (scAAV). 17. A modified cell comprising the plasmid according to any one of 1 to 11 above or the AAV vector according to any one of 12 to 16 above. 18. The modified cell according to 17 above, wherein the modified cell is a CAR NK cell. 19. A method for treating cancer in a subject, the method comprising administering to a subject having cancer the modified cell according to 17 or 18 above. 20. A method for genetically modifying a cell by homology-directed repair, a) obtaining an AAV vector comprising a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a corresponding CRISPR / Cas guide RNA and a plasmid comprising a transgene (e.g., a chimeric antigen receptor of a tumor antigen, etc.), wherein the transgene is adjacent to a homologous arm, and the homologous arm has a length of 800 bp or less; b) introducing the transgene and the RNP complex into the cell, wherein the transgene is introduced into the cell via infection of the cell with the adeno-associated virus (AAV), the RNP complex hybridizes to a target sequence in the genomic DNA of the cell, and the DNA repair enzyme of the cell inserts the transgene into the host genome at the target sequence in the genomic DNA of the cell, thereby generating a modified cell. 21. The method according to 20 above, wherein the cell is a primary cell or a proliferating cell. 22. The method according to 21 above, wherein the primary cell is incubated for 4 days in the presence of IL-2 prior to infection. 23. The method according to 22 above, wherein the primary cell is grown for 4 days in the presence of irradiated feeder cells prior to infection. 24. The method according to any one of 20 to 23 above, further comprising growing the modified cell together with irradiated mbIL-21-expressing feeder cells after infection. 25. The method according to any one of 20 to 24 above, wherein the cell is a NK cell. 26. The method according to any one of 20 to 25 above, wherein the transgene is a chimeric antigen receptor of a tumor antigen. 27. The method according to any one of 20 to 26 above, wherein the RNP complex is introduced into the cell via electroporation. 28. The method according to any one of 20 to 27 above, wherein the RNP complex is introduced into the cell via transfection, and the RNP complex is encoded on the same or different AAV. 29. A method for genetically modifying at least one cell by homology-directed repair (HDR), (a) introducing into the cell an adeno-associated virus (AAV) vector comprising (i) a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease complexed with a CRISPR / Cas guide RNA encoding a target sequence in the genome of the cell, and (ii) a plasmid comprising a transgene flanked by first and second homologous arms each having a length of 800 bp or less, wherein the transgene encodes a chimeric antigen receptor. (b) maintaining the cells for a time and under conditions sufficient for (i) the RNP complex to hybridize to the target sequence, introduce a double-strand break (DSB) into the target sequence, and (ii) the cells to insert the transgene into the genome of the cell at the target sequence and repair the break by HDR, thereby integrating the transgene into the genome of the cell at the site of the DSB. 30. The method of claim 28, wherein the cell is a primary cell or a proliferating cell. 31. The method of claim 28 or 29, wherein the cell is a natural killer (NK) cell. 32. The method of claim 28 or 29, wherein the class 2 CRISPR / Cas endonuclease is Cas9. 33. The method of claim 28 or 29, wherein the cell is a primary cell and the method further comprises incubating the cell in the presence of IL-2 for at least about 4 days prior to step (a). 34. The method of claim 28 or 29, wherein the cell is a primary cell and the method further comprises growing the cell in the presence of mbIL-21 for at least about 4 days after step (b). 35. The method of claim 33, wherein the mbIL-21 comprises irradiated mbIL-21-expressing feeder cells, PM21 particles, EX21 exosomes, or any combination thereof.

Example

[0123] C. Examples The following examples are provided to fully disclose and describe to those skilled in the art the methods of making and evaluating the compounds, compositions, articles, devices, and / or methods claimed herein, and are intended to be purely exemplary and not limiting of the present disclosure. Although efforts have been made to ensure accuracy with respect to numerical values (e.g., amounts, temperatures, etc.), some errors and deviations should be taken into account. Unless otherwise specified, parts are parts by weight, temperature is in °C, or ambient temperature, and pressure is at or near atmospheric pressure.

[0124] 1. Example 1 Genetically modified chimeric antigen receptor (CAR) T cells are an excellent example of engineered immune cells that have been successfully deployed in cancer immunotherapy. These cells have recently been approved by the FDA for the treatment of CD19+ B cell malignancies, but so far success has been limited to diseases with a small number of targetable antigens. They also have several side effects that make NK cells a better alternative.

[0125] A DNA-free technique for genome editing of primary and proliferating human cells (including NK cells) using the Cas9 ribonucleoprotein complex (Cas9 / RNP) is disclosed herein (see Figure 1).

[0126] Transgene delivery using the non-pathogenic virus natural recombinant adeno-associated virus (rAAV) donor vector has been shown to enable site-specific gene insertion (HITI, CRISPaint) by homology-directed or homology-independent target integration (Figure 3).

[0127] Twelve novel plasmids were developed for the directed integration of a gene of interest into human primary cells including NK cells and HEK293 cells, used in combination with Cas9 / RNP (Figure 2), using essential sequences from different serotypes of AAV plasmids.

[0128] In the new methodology, the Cas9 RNP complex cleaves DNA (at the AAVS1 locus). The exogenous gene was inserted into the genomes of human NK cells and HEK293 cells as proof, in the presence of a selected DNA fragment (CAR-expressing DNA or reporter gene) provided by one of our 12 AAV plasmids (single-stranded or self-complementary) having 30 - 1000 bp homologous arms on each side between the target and the donor DNA adjacent to the Cas9 cleavage site for HDR-induced gene insertion or homology-independent induced insertion (by providing the crRNA + PAM sequence to the DNA template).

[0129] To test the system, NK cells were transfected with a CRISPR / Cas9 plasmid containing the transgene and AAV delivered with the plasmid. To determine the appropriate AAV serotype for infection in NK cells, NK cells were infected under various transfection conditions using various AAV serotypes containing a plasmid encoding green fluorescent protein (GFP) coding (Figure 4A). AAV6 was determined to consistently provide the highest expression under any culture conditions. Furthermore, infection with AAV6 was shown to have approximately 2.5×10 6 copies of the virus 6 hours after an MOI of 3×10 7 but to decline to levels that are almost undetectable by 48 hours post-infection (4B). This is particularly important as it indicates a reduced risk of off-target infection.

[0130] Next, HEK293 cells were electroporated with a ribonucleoprotein (RNP) complex containing a class 2 CRISPR / Cas endonuclease (Cas9) complexed with the corresponding CRISPR / Cas guide RNA and infected with an AAV encoding a mCherry transgene targeting the AAVS1 locus (Figure 5). PCR with primers for mCherry1 or mCherry2 was used to test for mCherry integration in HEK293 cells (5A). These results were confirmed by flow cytometry (5B) and microscopy (5C).

[0131] Next, experiments were repeated using human primary NK cells (Figure 6) that showed the same results with stable expression at the AAVS1 locus using any of the plasmids having a 30 bp homology arm, a 500 bp homology arm, or an 800 bp homology arm (6A), and confirmed by flow cytometry (6B). The success of all plasmids in integration of constructs of various sizes is summarized in Table 1.

[0132] 2. Example 2 Genetic modification of NK cells using viral or non-viral vectors is difficult due to robust foreign DNA and RNA sensing mechanisms and thus limits the efficiency of gene delivery methods to NK cells. To overcome this limitation, a new method for directly electroporating the Cas9 / ribonucleoprotein complex (Cas9 / RNP) into primary human NK cells was developed. This method introduces double-strand breaks (DSBs) into the genome of NK cells, succeeds in gene knockout, and improves antitumor activity. The Cas9 protein is preferred over mRNA delivery due to its fast action and clearance. After this initial success in gene silencing, this method was further developed for gene insertion. Following the action of Cas9 introducing DSBs, two independent pathways known as homologous recombination (HR) and homology-independent repair can be utilized to repair the damage. In the presence of a DNA template encoding the gene of interest, the exogenous gene can be integrated into the Cas9 target site using either repair mechanism. There are several methods for providing such DNA templates, including viral and non-viral methods. In the non-viral approach, single-stranded or double-stranded DNA templates are typically electroporated together with Cas9 / RNP. For viral gene delivery, adeno-associated virus (AAV) is safely used in clinical trials and is effective as a vector for susceptible primary immune cells including T cells. Transcripts delivered via the AAV vector can be packaged as linear single-stranded (ss) DNA (ssAAV) or linear self-complementary (sc) DNA (scAAV) with a length of approximately 4.7 kb. scAAV contains mutant ITRs that help bypass the rate-limiting step of second-strand generation to convert ssDNA to double-stranded (ds) DNA. However, as a result, scAAV has only half the packaging capacity compared to ssAAV and is thus not suitable for larger transgenes. Both ssAAV and scAAV are designed and tested for DNA template delivery to NK cells.

[0133] Stable gene integration via the HR mechanism depends on providing the transgene with optimal homology arms for the regions adjacent to the DSB. To find the optimal length of the homology arms and optimize the packaging capacity of the transgene into ssAAV and scAAV, HAs of 30 bp, 300 bp, 500 bp, and 800 - 1000 bp were designed for the right and left sides of the Cas9 target site. Since the design of homology arms is a time-consuming procedure and requires multiple optimizations, the CRISPaint approach, a homology-independent method for gene insertion or tagging, was also investigated. In this method, the same Cas9 target site, including the crRNA and PAM sequence, is provided to the DNA template encoding the gene of interest. When the Cas9 complex is introduced, both the template and genomic DNA are cleaved simultaneously. As a result, the CRISPaint template is presented as linearized double-stranded DNA that can be integrated via the non-homologous repair mechanism. In both methods, as a proof of concept, mCherry was used to generate highly efficient and stable transgene-modified NK cells.

[0134] 3. Example 3 a) Purification and expansion of human NK cells NK cells were purified. Briefly, NK cells were isolated from PBMCs using the RosetteSep™ Human NK Cell Enrichment Cocktail (Figure 8). The phenotype of the purified NK cells was determined using flow cytometry as a >90% CD3-negative / CD56-positive population (Figure 9). These cells were stimulated on the day of purification with irradiated mbIL21-expressing K562 feeder cells at a ratio of 2:1 (feeder:NK) (Figure 9). The stimulated cells were cultured for 7 days in serum-free AIM-V / ICSR growth medium containing 100 IU / mL of IL-2.

[0135] b) Targeting of genomic safe harbors for gene insertion. Genomic Safe Harbor (GSH) is a site within the genome that can be modified without changing the normal function of the host cell and enables proper expression of the transgene. One of the GSHs, the adeno-associated virus site 1 (AAVS1), an exemplary locus within the phosphatase 1 regulatory subunit 12C (PPP1R12C) gene, was selected. This locus has been successfully used for targeted gene insertion into several cell types. First, the chromatin accessibility of AAVS1 was evaluated in naive and proliferating NK cells by ATAC-seq assay, and no difference was shown between naive and IL-21 proliferating cells (Figure 10). As described above, AAVS1 was targeted using one gRNA (crRNA: 5’GGGGCCACTAGGGACAGGAT (SEQ ID NO: 17)) via electroporation of Cas9 / RNP into proliferating NK cells.

[0136] Briefly, 3×10 6 proliferating NK cells were harvested, washed twice with 13 mL of PBS, then centrifuged at 300 g for 7 minutes, and the PBS was aspirated. The cell pellet was resuspended in 20 ul of P3 Primary Cell 4D-Nucleofector solution. To the cell suspension, 5 ul of pre-complexed Cas9 / RNP (Alt-R® CRISPR-Cas9 crRNA, Alt-R® CRISPR-Cas9 tracrRNA, and Alt-R® S.p.HiFi Cas9 nuclease V3) (Integrated DNA Technologies, Inc., Coralville, Iowa), targeting AAVS1, and 1 ul of 100 uM electroporation enhancer (Alt-R® Cas9 electroporation enhancer) were added. The total 26 ul volume of the CRISPR reaction was transferred to a 4D-Nucleofector™ 16-well strip and electroporated using program EN-138. After electroporation, the cells were transferred to 2 ml of serum-free medium containing 100 IU of IL-2 in a 12-well plate (Figure 11) and incubated at 37 °C and 5% CO2 pressure.

[0137] After 48 hours, NK cell DNA was isolated for the detection of insertions and deletions (indels) in CRISPR-edited NK cells. The region adjacent to the Cas9 target site was PCR amplified, and the amplification product was Sanger sequenced. The inference of CRISPR editing (ICE) was used to analyze the indel frequency (Figure 12). The ICE results showed that more than 85% of the CRISPR-modified NK cells had at least one indel at the AAVS1 Cas9 target site. To ensure that genome modification at this locus did not interfere with the ability to target cancer cells, the cytotoxicity of AAVS1-KO NK cells was evaluated using the Kasumi AML cancer cell line. Using the calcein AM assay, no difference in their killing ability was observed between wild-type and CRISPR-modified NK cells (Figure 13).

[0138] c) Testing of various adeno-associated virus vector serotypes for DNA template delivery. To determine the best serotype of AAV for transduction of primary NK cells and provide the highest number of DNA templates encoding the gene of interest to NK cells, we transduced cells at a multiplicity of infection (MOI) of 300,000 with several serotypes including AAV4, AAV6, AAV8, and AAV9 encoding GFP. NK cells transduced with AAV6 had the highest expression levels of GFP detected by flow cytometry. Importantly, the AAV6 viral genome could be detected by qPCR analysis up to 48 hours after transduction, which is the critical time for the endonuclease function of the Cas9 protein (Figure 14).

[0139] d) Design of HR and CRISPaint gene delivery constructs. After successfully demonstrating that the AAVS1 locus can be modified in NK cells without altering its ability to target cancer cells, the AAV-mediated delivery of the mCherry transgene for gene insertion in AAVS1 was evaluated. For HR-directed gene insertion, DNA encoding mCherry with homology arms (HAs) adjacent to the Cas9 target site was cloned into the backbone of single-stranded or self-complementary AAV vectors. HAs of 30 bp, 300 bp, 500 bp, and 1000 bp were designed for the right HA, and 30 bp, 300 bp, 500 bp, and 800 bp were designed for the left HA (Figure 15). For the CRISPaint DNA template, single (PAMg) or double (PAMgPAMg) Cas9 target sequences are incorporated around the mCherry transgene but within the ITRs. Thus, Cas9 can cleave both the gDNA and the CRISPaint DNA template simultaneously, enabling integration at the genomic DSB (Figures 16A - 16B). Prior to packaging the transgene into AAV6, circular DNA encoding mCherry was co-electroporated into HEK293 cells along with Cas9 / RNP targeting AAVS1 to ensure the accuracy of the designed HR and CRISPaint DNA templates. The results showed that both the HR and CRISPaint DNA were successfully integrated at the genomic DSB and mCherry was efficiently expressed (Figure 17).

[0140] e) Study the NHEJ and HR pathways in primary NK cells to determine the optimal pathway for genome editing. CRISPaint and HR are regulated by enzymatic reactions. CRISPaint is a LIG4-dependent process, while other proteins such as BRCA1 and BRCA2 regulate HR. Therefore, the expression levels of these genes in NK cells were analyzed to evaluate which repair pathway might be more efficient in this cell type. RNA-seq analysis showed that proliferating NK cells have higher expression of BRCA1 and BRCA2 compared to naive NK cells and no decrease in LIG4 levels in these cells (Figure 18), providing optimal conditions for either HR or NHEJ-directed gene insertion via CRISPaint.

[0141] f) Combine Cas9 / RNP and AAV6 to generate mCherry NK cells. On day 6 of NK cell proliferation, 1 day prior to experimental manipulation, medium exchange and resuspension were performed at 5×10 5 cells / ml. The NK cells were then electroporated with Cas9 / RNP targeting AAVS1 on day 7 as described above. Thirty minutes after electroporation, viable cells were harvested and resuspended at 1×10 per ml 6The cells were resuspended in medium containing 100 IU of IL2 in a 24-well plate. For each transduction condition using ssAAV6 or scAAV6 to deliver HR or CRISPaint DNA encoding mCherry, 300,000 electroporated cells were transduced at 300,000 MOI or 150,000 MOI. Alternatively, to test the transduction efficiency of higher MOI of AAV6, 150,000 cells were transduced at 500,000 MOI of ssAAV6 delivering HR 800bp and scAAV6 delivering CRISPaint PAMgPAMg (Figure 19). Negative controls included non-electroporated NK cells, NK cells electroporated with Cas9 / RNP but not AAV transduced, or NK cells transduced with 300,000 MOI of AAV6 without electroporation of Cas9 / RNP. The day after electroporation and transduction, 150 ul of fresh medium containing 100 IU of IL2 was added to each well without changing the old medium. The cells were cultured for 48 hours after electroporation and then restimulated with K562 feeder cells at a ratio of 2:1 and maintained in a total volume of 1 ml in a 24-well plate.

[0142] g) Flow cytometry of CRISPR-modified human NK cells shows successful integration of the mCherry gene. Two days after electroporation and transduction, and prior to expansion, flow cytometry was performed to evaluate mCherry expression and viability (GhostRed 780 dye). Overall, NK cells transduced with the AAV6-delivered HR vector had a higher knock-in efficiency than CRISPaint. Furthermore, scAAV6 showed significantly better gene insertion. mCherry expression was not observed in control NK cells. Under experimental conditions where cells were transduced with ssAAV6 delivering DNA encoding mCherry with an 800 bp HA using the HR vector, nearly 20% of NK cells were mCherry positive. For NK cells transduced with 300,000 MOI of scAAV6 delivering CRISPaint PAMg or 300,000 MOI and 500,000 MOI of PAMgPAMg, a maximum of 8% mCherry-positive cells were found. Importantly, the percentage of mCherry-positive cells was significantly higher in cells transduced with the scAAV6 HR vector containing shorter homology arms. These conditions included transduction with 300,000 MOI or 150,000 MOI of the HR scAAV6 vector with 30 bp (19 - 20%), 300 bp (80 - 85%), 500 bp (75 - 85%), and 800 bp (80 - 89%). For cells with lower transduction efficiency (ssAAV6-HR-800bp, scAAV6-CRISPaint PAMgPAMg), the mCherry-positive population was enriched to 85% by FACS sorting and expanded for up to 20 days using irradiated mbIL21-expressing K562 feeder cells with no change in the percentage of mCherry-positive NK cells (Figures 20 - 22). Flow analysis was repeated on mCherry-positive NK cells expanded for up to 20 days after transduction, and no significant change in the percentage of mCherry was observed in cells generated by the combination of Cas9 / RNP and ssAAV6 or scAAV6.Although the efficiency of gene integration was observed to be lower using CRISPaint compared to HR-directed gene insertion, this method is still very attractive because it allows researchers to integrate the gene of interest into a user-defined locus without the need to design homologous arms. Furthermore, better proliferation was observed in NK cells transduced with the CRISPaint vector.

[0143] h) Combining Cas9 / RNP with non-viral gene delivery causes cell death in primary human NK cells. To minimize the time and cost of virus production, non-viral gene integration has been used in T cells. This approach was also tested in NK cells by electroporating Cas9 / RNP targeting AAVS1 with naked chemically synthesized DNA encoding mCherry. The transgene was generated in two forms: as a Megamer® single-stranded DNA fragment from IDT with an 80 bp homologous arm for the region adjacent to the Cas9 target site, and another form with the same HR and CRISPaint DNA cloned into an AAV backbone but not packaged into any AAV capsid. Expanded NK cells were electroporated with Cas9 / RNP targeting AAVS1 and 1 or 2 μg of DNA encoding mCherry, with a total volume of 26 μl. Two days later, cells with Megamer® were 100% dead, and only 10% of the cells electroporated with HR and CRISPaint DNA survived. These cells were able to proliferate, and the DNA was integrated at the DSB site, but less than 1% of the resulting cells were mCherry positive. This indicates that AAV-mediated NK cell modification has better tolerance and is more efficient compared to naked DNA delivery. Sequence SEQ ID NO: 1 30 bp right homologous arm gattggtgacagaaaagccccatccttagg SEQ ID NO: 2 30 bp left homologous arm ttatctgtcccctccaccccacagtggggc Right homologous arm of SEQ ID NO: 3, 300 bp gattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacctcctgttaggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtttgcttacgatggagccagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcccggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggctgtc Left homologous arm of SEQ ID NO: 4, 300 bp gttctcctgtggattcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctagctcttccagccccctgtcatggcatcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatgtccacttcaggacagcatgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccggttaatgtggctctggttctgggtacttttatctgtcccctccaccccacagtggggc Right homologous arm of SEQ ID NO: 5, 500 bp gattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacctcctgttaggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtttgcttacgatggagccagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcccggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggctgtctggtgcgtttcactgatcctggtgctgcagcttccttacacttcccaagaggagaagcagtttggaaaaacaaaatcagaataagttggtcctgagttctaactttggctcttcacctttctagtccccaatttatattgttcctccgtgcgtcagttttacctgtgagataaggccagtagccagccccgtcctggcag Sequence number 6, 500 bp left homologous arm tcccttttccttctccttctggggcctgtgccatctctcgtttcttaggatggccttctccgacggatgtctcccttgcgtcccgcctccccttcttgtaggcctgcatcatcaccgtttttctggacaaccccaaagtaccccgtctccctggctttagccacctctccatcctcttgctttctttgcctggacaccccgttctcctgtggattcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctagctcttccagccccctgtcatggcatcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatgtccacttcaggacagcatgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccggttaatgtggctctggttctgggtacttttatctgtcccctccaccccacagtggggc Sequence number 7, 800 bp right homologous arm gattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacctcctgttaggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtttgcttacgatggagccagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcccggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggctgtctggtgcgtttcactgatcctggtgctgcagcttccttacacttcccaagaggagaagcagtttggaaaaacaaaatcagaataagttggtcctgagttctaactttggctcttcacctttctagtccccaatttatattgttcctccgtgcgtcagttttacctgtgagataaggccagtagccagccccgtcctggcagggctgtggtgaggaggggggtgtccgtgtggaaaactccctttgtgagaatggtgcgtcctaggtgttcaccaggtcgtggccgcctctactccctttctctttctccatccttctttccttaaagagtccccagtgctatctgggacatattcctccgcccagagcagggtcccgcttccctaaggccctgctctgggcttctgggtttgagtccttggcaagcccaggagaggcgctcaggcttccctgtcccccttcctcgtccaccatctcatgcccctggctctcctgccccttccctacaggggttcctggctctgctcttcagactgagccccgttcccctgcatccccgttcccctgcatcccccttcccctgcatcccccagaggccccaggccacctacttggcctggaccccacgagaggccaccccagccctgtctaccaggctgccttttgggtggattctcctccaactgtggggtgactgcttgg。 Left homologous arm of SEQ ID NO: 8, 800 bp tgctttctctgacctgcattctctcccctgggcctgtgccgctttctgtctgcagcttgtggcctgggtcacctctacggctggcccagatccttccctgccgcctccttcaggttccgtcttcctccactccctcttccccttgctctctgctgtgttgctgcccaaggatgctctttccggagcacttccttctcggcgctgcaccacgtgatgtcctctgagcggatcctccccgtgtctgggtcctctccgggcatctctcctccctcacccaaccccatgccgtcttcactcgctgggttcccttttccttctccttctggggcctgtgccatctctcgtttcttaggatggccttctccgacggatgtctcccttgcgtcccgcctccccttcttgtaggcctgcatcatcaccgtttttctggacaaccccaaagtaccccgtctccctggctttagccacctctccatcctcttgctttctttgcctggacaccccgttctcctgtggattcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctagctcttccagccccctgtcatggcatcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatgtccacttcaggacagcatgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccggttaatgtggctctggttctgggtacttttatctgtcccctccaccccacagtggggc PAM gRNA of SEQ ID NO: 9 TIFF0007702878000004.tif762 Splice acceptor of SEQ ID NO: 10 atcgatcgcaggcgcaatcttcgcatttcttttttccag SEQ ID NO: 11 BGH PolyA Terminator cctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattc SEQ ID NO: 12 mCherry gtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaa SEQ ID NO: 13 30 bp plasmid having the integrated mCherry transgene ttatctgtcccctccaccccacagtggggccactagggacagcgatcgggtacatcgatcgcaggcgcaatcttcgcatttcttttttccaggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaacgcggccgccctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattcgattggtgacagaaaagccccatccttagg A 300 bp plasmid with the integrated mCherry transgene of accession number 14. A 500bp plasmid incorporated with the mCherry transgene of Accession No. 15. An 800-bp plasmid with the integrated mCherry transgene of accession number 16. Array number 17 (crRNA) GGGGCCACTAGGGACAGGAT

Claims

1. A plasmid for use with a clustered regularly interspaced short palindromic repeat (CRISPR) / CRISPR-associated 9 (Cas9) integration system that is clustered, wherein the plasmid sequentially comprises a left homologous arm, a splice acceptor, a transgene, a polyadenylation terminator, and a right homologous arm, the left homologous arm and the right homologous arm specifically hybridize to the adeno-associated virus integration site 1 (AAVS1) of human chromosome 19, have a length of 30 bp to 100 bp, the right homologous arm comprises a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7, and the left homologous arm comprises a nucleic acid sequence selected from SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, or SEQ ID NO:

8.

2. The plasmid according to claim 1, wherein the left homologous arm and the right homologous arm are of the same length.

3. The plasmid according to claim 1, wherein the left homologous arm and the right homologous arm are of different lengths.

4. The plasmid according to any one of claims 1 to 3, wherein the transgene comprises a polynucleotide encoding a chimeric antigen receptor of a tumor antigen.

5. An adeno-associated virus (AAV) vector sequentially comprising the left homologous arm, the splice acceptor, the transgene, the polyadenylation terminator, and the right homologous arm of the plasmid according to any one of claims 1 to 4.

6. The AAV vector according to claim 5, wherein the serotype of the AAV comprises AAV6.

7. The AAV vector according to claim 5, wherein the vector further comprises a plasmid encoding crRNA, tracer RNA (tracrRNA), and a CAS endonuclease.

8. The AAV vector according to claim 5, wherein the vector is single-stranded AAV (ssAAV) or self-complementary AAV (scAAV).

9. Modified natural killer (NK) cells comprising the plasmid according to any one of claims 1 to 4 or the AAV vector according to claim 5.

10. The modified cells according to claim 9 for treating cancer.

11. An ex vivo method for genetically modifying natural killer (NK) cells by homology-directed repair, a) obtaining a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease complexed with a corresponding CRISPR / Cas guide RNA, and the AAV vector according to claim 5, wherein the left and right homologous arms are each 800 bp or less in length; b) introducing the transgene and the RNP complex into the NK cells, wherein the transgene is introduced into the NK cells via infection of the NK cells with the AAV vector according to claim 5, the RNP complex hybridizes to a target sequence in the genomic DNA of the NK cells, and the DNA repair enzyme of the NK cells inserts the transgene into the host genome at the target sequence in the genomic DNA of the NK cells, thereby generating genetically modified NK cells. **Claim 12** The method according to claim 11, wherein the NK cells are primary cells and are incubated for 4 days in the presence of IL-2 prior to infection. **Claim 13** The method according to claim 12, wherein the NK cells are primary cells that are further grown for 4 days in the presence of irradiated feeder cells prior to infection. **Claim 14** The method according to claim 11, further comprising growing the modified NK cells together with mbIL-21 after infection. **Claim 15** The method according to claim 14, wherein the mbIL-21 comprises irradiated mbIL-21-expressing feeder cells, PM21 particles, EX21 exosomes, or any combination thereof. **Claim 16** The method according to claim 11, wherein the AAV vector is introduced into the cells via electroporation. **Claim 17** The method according to claim 11, wherein the AAV vector is introduced into the cells via transfection. **Claim 18** An ex vivo method for genetically modifying natural killer (NK) cells by homology-directed repair (HDR), comprising: a) introducing into the cells (i) a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease complexed with a CRISPR / Cas guide RNA encoding a target sequence in the genome of the cells, and (ii) the AAV vector according to claim 5, wherein the transgene encodes a chimeric antigen receptor. (b) maintaining the NK cells under conditions and for a time sufficient for the RNP complex to hybridize to the target sequence, introduce a double-strand break (DSB) into the target sequence, and for the NK cells to insert the transgene into its genome at the target sequence and repair the break by HDR, thereby integrating the transgene into the genome of the NK cells at the site of the DSB.

19. The method according to claim 11 or 18, wherein the NK cells are primary NK cells or expanded NK cells.

20. The method according to claim 18, wherein the class 2 CRISPR / Cas endonuclease is Cas9.

21. The method according to claim 18, wherein the NK cells are primary cells and the method further comprises incubating the NK cells in the presence of IL-2 for at least about 4 days prior to step (a).

22. The method according to claim 18, wherein the NK cells are primary cells and the method further comprises expanding the NK cells in the presence of mbIL-21 for at least about 4 days after step (b).

23. The method according to claim 22, wherein the mbIL-21 comprises irradiated mbIL-21-expressing feeder cells, PM21 particles, EX21 exosomes, or any combination thereof.

Citation Information

Patent Citations

  • Viral methods of making genetically modified cells

    WO2018081470A1

  • Genetically-modified t cells comprising a modified intron in the t cell receptor alpha gene

    WO2019005957A1