Methods and devices for the detection and collection of biomarkers
The microneedle array with attached probes addresses the inefficiencies of current biomarker detection methods by enabling rapid, sensitive, and efficient in situ detection and extraction of biomarkers from tissues, overcoming sample volume limitations and processing time challenges.
Patent Information
- Application Number
- JP2024039825
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2012-12-14
- Filing Date
- 2024-03-14
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2033-12-13
AI Technical Summary
Current methods for detecting biomarkers are cumbersome, require multiple processing steps, and are not suitable for limited sample volumes, leading to prolonged diagnostic times, especially for localized non-circulating biomarkers.
A device comprising an array of microneedles with covalently or non-covalently attached probes specific to biomarkers, allowing in situ detection and extraction of biomarkers from tissues using microneedles made of polymers, metals, or ceramics.
Enables rapid and sensitive detection of biomarkers directly from tissues with minimal sample volume, reducing processing time and improving diagnostic efficiency.
Smart Images

Figure 0007704916000007 
Figure 0007704916000008 
Figure 0007704916000009
Abstract
Description
Background Art
[0001] Citation of Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 61 / 737,237, filed on Dec. 14, 2012. U.S. Provisional Patent Application No. 61 / 737,237 is hereby incorporated by reference in its entirety.
[0002] Background Analysis of biomarkers is becoming a preferred method for early detection of diseases, patient stratification, and monitoring treatment effectiveness. Rapid and sensitive detection of biomarker changes is often technically impossible or requires cumbersome procedures involving multiple processing steps, which inevitably leads to a large sample volume and a long diagnostic / prognostic time course. Samples derived from patients are often limited in volume and not suitable for processes or procedures that require multiple steps to extend the processing time.
[0003] Current methods for detecting target molecular biomarkers or biological analytes in diagnostic applications mainly utilize the extraction of body fluids (e.g., blood, interstitial fluid) from patients. The specific biomarkers to be assayed are derived from this body fluid sample. In more recent inventions, clinically relevant biomarkers are not directly sampled from the application site and require further processing of body fluids. Other diagnostic methods not based on molecular assays, such as biopsies, are usually cumbersome and have a high risk of misdiagnosis due to their inherent visual and subjective nature. However, for localized non-circulating biomarkers, biopsies are often the only diagnostic option at present.
Summary of the Invention
Problems to be Solved by the Invention
[0004] In the art, there is a need for better means for detecting and analyzing biomarkers present in the body of a subject having or at risk of developing various diseases or disorders. The present invention addresses this need and other needs.
Means for Solving the Problems
[0005] Summary of the Invention In one aspect, the present invention provides a device for detecting or extracting one or more biomarkers in situ from a tissue or biological sample of a subject. The device can include an array of microneedles and a plurality of probes specific to the biomarker, where the probes are covalently attached to the microneedles. In some of the devices, the probes are specific to different biomarkers and each different probe is attached to a different microneedle. In some other devices, the same probe for a specific biomarker is attached to two or more microneedles. The microneedles in the device can be made of a polymer, metal, ceramic, or any other suitable material.
[0006] In some cases, the present disclosure presents a device for detecting or extracting one or more biomarkers from an in situ tissue or biological sample of a subject, the device including one or more microneedles and one or more probes specific to the biomarker, the probes being attached to the microneedles via a covalent linkage or a non-covalent linkage.
[0007] The device may include a first micro-needle. The first micro-needle can be attached to a first probe specific to a first biomarker by covalent bonding. Alternatively, the first micro-needle can also be attached to the first probe by non-covalent bonding. Further, the first probe can be attached to a plurality of micro-needles. In some cases, the present invention provides a device including a first micro-needle, wherein the first micro-needle is attached to a first probe specific to a first biomarker by covalent or non-covalent bonding. In some cases, the first biomarker can be a polynucleotide. The first probe can be a polynucleotide complementary to the first biomarker. In other cases, the first biomarker can be a polypeptide, an antibody, a metabolite, or a small molecule. Further, the first probe can be a polynucleotide, a polypeptide, a protein, an antibody, a small molecule, or a biological receptor. In some cases, the first needle is formed on a substrate.
[0008] The device may further include a second probe specific to a second biomarker. The second probe can be different from the first probe. The second probe can be attached to the first micro-needle by covalent or non-covalent bonding. Alternatively, the second probe can also be attached to a second micro-needle by covalent or non-covalent bonding. The second biomarker can be a polynucleotide. The second probe can be a polynucleotide complementary to the second biomarker. The second biomarker can also be a polypeptide, an antibody, a metabolite, or a small molecule. Further, the second probe can also be a polynucleotide, a polypeptide, a protein, an antibody, a small molecule, or a biological receptor. In some cases, the first probe specifically binds to a first nucleotide polymorphism, and the second probe specifically binds to a second nucleotide polymorphism. In some cases, the first probe and the second probe are different antibodies each specific to a different epitope of the same biomarker.
[0009] In some cases, the device yields microneedles that include a polymer, metal, or ceramic. The first probe can be attached to the plurality of microneedles by covalent or non-covalent bonding. The second probe and the other plurality of probes can be attached to the plurality of microneedles by covalent or non-covalent bonding.
[0010] Some devices of the present invention are directed to the detection of nucleic acid biomarkers. In these devices, the probe that can be conjugated to the microneedle is an oligonucleotide or a polynucleotide complementary to the biomarker. Some of the devices employ microneedles fabricated from a thermoplastic polymer. The polynucleotide probe within the device can be conjugated to the microneedle via many suitable linkages including, but not limited to, a thiol / amino bifunctional linker or a poly(ethylene glycol) linker. In some cases, the device of the present invention further includes compartments for amplifying and identifying a first biomarker and a second biomarker.
[0011] Some other devices of the present invention are designed, inter alia, to detect peptide biomarkers or protein biomarkers. In some of these devices, the probe immobilized on the microneedle is an antibody specific to the biomarker. In various embodiments of the present invention, a planar substrate is used to support an array of microneedles. The device of the present invention can also contain means for amplifying the biomarker detected by the probe.
[0012] The device may include a plurality of microneedles. The plurality of microneedles may include at least one microneedle attached to at least one probe specific to a biomarker by covalent or non-covalent bonding. The biomarker may indicate a specific condition including but not limited to the condition of the skin or the eye. In some cases, the biomarker may indicate the condition of the skin. In some examples, the condition of the skin is skin cancer. In other cases, the biomarker may indicate the condition of the eye. In some examples, the condition of the eye is eye cancer or eye inflammation.
[0013] In some cases, the present disclosure presents a device including a plurality of microneedles, wherein the plurality of microneedles include at least one microneedle attached to at least one probe specific to a biomarker by covalent or non-covalent bonding, and the biomarker indicates the condition of the skin or the eye. In some cases, the biomarker is a polynucleotide and at least one probe is complementary to the biomarker. In some cases, at least one probe includes different polynucleotide probes specific to different nucleotide polymorphisms of the same biomarker. In some cases, the biomarker is a peptide or polypeptide and at least one probe is an antibody specific to the biomarker. In some cases, at least one probe includes different antibodies specific to different epitopes of the same biomarker.
[0014] The device of the present invention can include a plurality of probes specific to a plurality of different biomarkers, in which case the plurality of probes are attached to the same or different microneedles. In some cases, at least two different probes are attached to the same microneedle. In some cases, the device includes at least two identical probes for a specific biomarker, and the at least two identical probes are attached to one or more microneedles.
[0015] Alternatively, biomarkers can also be obtained during the intraoperative procedure. The device can further include a sensor where the probe emits an optical signal when detecting a biomarker. In some examples, the optical signal of the probe can change when the probe detects a biomarker.
[0016] In another aspect, the present disclosure presents a method for detecting or amplifying one or more biomarkers from in situ tissue (e.g., skin, blood flow, tissue) or ex vivo tissue samples in a subject. The method involves: (a) preparing a plurality of microneedles with a plurality of probes specific to the biomarker covalently attached; (b) contacting the microneedles with the subject's tissue or biological sample; and (c) detecting the biomarker bound to the probes on the microneedles.
[0017] In some cases, the present disclosure provides a method for detecting one or more biomarkers from in situ tissue or biological samples in a subject, the method comprising: (a) contacting the microneedles with the subject's tissue or biological sample, wherein the microneedles are attached to a set of probes, and the probes bind in situ to one or more biomarkers; and (b) detecting the one or more biomarkers bound to the probes.
[0018] In some cases, the present disclosure provides a device comprising a plurality of microneedles, wherein at least one microneedle of the plurality of microneedles is attached to a probe specific to a biomarker by covalent or non-covalent bonding, and the probe comprises a sensor that emits an optical signal when the probe detects the biomarker. In some cases, the optical signal of the probe increases when the probe detects the biomarker. In some cases, the optical signal of the probe decreases when the probe detects the biomarker.
[0019] In some cases, the present disclosure provides a method for detecting one or more biomarkers from in situ tissue or a biological sample in a subject, the method comprising: (a) preparing a device comprising one or more microneedles having one or more probes specific to the biomarker covalently attached thereto; (b) contacting the microneedle device with the subject's tissue or biological sample; and (c) detecting the biomarker bound to the probe on the microneedle array.
[0020] In some cases, the present disclosure provides a method for detecting one or more biomarkers from in situ tissue or a biological sample in a subject, the method comprising: (a) contacting a microneedle device with the subject's tissue or biological sample, the microneedle device comprising one or more probes specific to the biomarker, wherein at least one probe comprises a sensor that emits a visual signal when the probe detects the biomarker; and (b) detecting the biomarker based on the visual signal.
[0021] Alternatively, the method may also comprise: (a) contacting a microneedle device with the subject's tissue or biological sample and at least two probes specific to the biomarker, wherein the at least two probes specific to the biomarker are different and the probes are attached to the microneedle via covalent linkage or non-covalent linkage; and (b) detecting the biomarker bound to the probe.
[0022] In some cases, the present disclosure provides a method for detecting one or more biomarkers in a subject's tissue, the method comprising: (a) contacting a microneedle with the subject's tissue in situ, wherein the tissue comprises an extracellular matrix and the microneedle is covalently attached to a set of probes, and the probes bind to the biomarker in situ; and (b) disrupting the extracellular matrix. In some cases, the extracellular matrix is disrupted by enzymatic activity. In some cases, disrupting the extracellular matrix comprises applying ultrasonic energy to the extracellular matrix. In some cases, the extracellular matrix is disrupted by a potential.
[0023] In a further example, the method can comprise: (a) contacting a microneedle device with a sample comprising an extracellular matrix, wherein the microneedle is covalently attached to a set of probes, and the probes bind to the biomarker in situ; and (b) disrupting the extracellular matrix. Alternatively, the method can also comprise disrupting the cell membrane. In any of the examples, the extracellular matrix or the cell membrane can be disrupted by enzymatic activity, ultrasonic energy, or a potential.
[0024] In yet another example, the method can comprise: (a) contacting a microneedle device with a subject's tissue or a biological sample, wherein the microneedle device comprises one or more probes specific for one or more biomarkers; and (b) amplifying the biomarker.
[0025] The biomarker can be a polynucleotide, and the probe can be a polynucleotide complementary to the biomarker. In some cases, the probes can be different polynucleotide probes specific for different nucleotide polymorphisms of the same biomarker.
[0026] A biomarker can be a peptide or polypeptide, and a probe can be an antibody specific for the biomarker. In some cases, the probe can be different antibodies specific for different epitopes of the same biomarker.
[0027] To simultaneously detect different biomarkers, the probes used in the method can be specific for different biomarkers. The probes can be attached to different microneedles or the same microneedle. In some other embodiments, at least two microneedles may carry the same probe, and multiple probes may be used to detect specific biomarkers.
[0028] The present disclosure also presents a method for preparing a microneedle device, including: (a) obtaining a solution containing an inorganic salt; (b) adding a probe and a microneedle to the solution; and (c) conjugating the probe to the microneedle in the solution. In some cases, the inorganic salt is sodium chloride. In some cases, the concentration of the inorganic salt is less than 2.5M.
[0029] In the fabrication of the microneedle arrays used in these methods, any suitable material can be used. Examples include, but are not limited to, polymers, metals, or ceramics. In some methods of the present invention, the detection of nucleic acid biomarkers is intended. In these methods, the probes employed are oligonucleotide molecules or polynucleotide molecules with sequences complementary to the sequences of the biomarkers. In some of the methods, the nucleic acid biomarkers captured by the microneedle device are detected and analyzed by PCR or quantitative real-time PCR (qRT-PCR). In some of the methods, the microneedles are fabricated from a polymer, and the probes are attached to the microneedles via a thiol / amino bifunctional linker. Alternatively, the microneedles are fabricated from stainless steel and coated with gold, and the probes are attached to the microneedles via a thiol linker. In some embodiments, the microneedles can be solid. In some other methods of the present invention, the detection of peptide biomarkers or polypeptide biomarkers is intended. In these methods, the probes employed are molecules capable of specifically binding to the biomarkers, such as monoclonal antibodies. When captured with an antibody conjugated to the microneedle, the peptide biomarker or protein biomarker bound to the probe on the microneedle can be detected by adding a secondary antibody tagged with an oligonucleotide and then PCR amplifying the conjugated tag.
[0030] In some cases, a method for detecting one or more polynucleotide biomarkers from skin or eye tissue in a subject can include contacting a microneedle device with the subject's skin or eye tissue. The method can further include contacting the microneedle device with the subject's skin capillaries. In other cases, the method can include contacting the microneedle device with the subject's tissue or biological sample during a surgical procedure. The tissue or biological sample can be derived from an organ selected from the group consisting of the brain, heart, breast, liver, pancreas, spleen, bladder, stomach, lung, uterus, cervix, prostate, kidney, intestine, appendix, and colon. The method can further include contacting the microneedle with the margin of a tumor after removing the tumor from the subject. In some cases, the methods of the present disclosure detect biomarkers present in the subject's blood.
[0031] The present disclosure also presents a method for conjugating a probe to a microneedle, which includes adding an inorganic salt. Examples of inorganic salts include, but are not limited to, lithium salts, potassium salts, sodium salts, magnesium salts, and calcium salts, which often involve halide counterions. In some cases, the inorganic salt is sodium chloride. The inorganic salt can be added at a concentration between about 0.1 M and 2.0 M. Further, the inorganic salt can also be added at a concentration between about 0.5 M and 1.5 M.
[0032] The various methods of the present invention can further include detecting one or more biomarkers from a reference tissue obtained from a subject. Some devices or methods of the present invention are designed to detect and collect biomarkers from the bloodstream of a subject. In these embodiments, a microneedle array conjugated with a probe is contacted with the subject's bloodstream by puncturing the subject's skin.
[0033] In yet another aspect, the present invention provides a kit comprising any of the devices for detecting or extracting biomarkers described in this application. The kit may further comprise a set of reagents for polymerase chain reaction. In some examples, the set of reagents may be for reverse transcriptase polymerase chain reaction. The kit may further comprise a holder or instructions for its use.
[0034] In some cases, the present disclosure presents a kit comprising: (a) a device comprising a plurality of microneedles, wherein at least one of the plurality of microneedles has a first probe specific for a biomarker attached thereto by covalent or non-covalent bonding; and (b) a set of reagents for polymerase chain reaction. In some cases, the kit further comprises a holder. In some cases, the set of reagents includes a polymerase enzyme, a buffer, and a control sample. In some cases, the kit further comprises instructions for its use.
[0035] In a further aspect, the present invention provides a composition comprising a plurality of microneedles coated with a substrate capable of destroying the extracellular matrix. In some cases, the substrate can be an enzyme. The enzyme can be selected from the group consisting of serine proteases, thiol proteases, and MMPs. Specific enzymes include papain, hyaluronidase, streptokinase, streptodornase, trypsin, chymotrypsin, alpha-chymotrypsin, alpha-amylase, DNase, collagenase, and strypsin. In one example, the enzyme is hyaluronidase.
[0036] A further understanding of the nature and advantages of the present invention can be made by reference to the remainder of the specification and the claims. In certain embodiments, for example, the following are provided: (Item 1) A device comprising a first microneedle, wherein the first microneedle is attached to a first probe specific for a first biomarker by covalent or non-covalent bonding. (Item 2) The device according to item 1, wherein the first biomarker is a polynucleotide and the first probe is a polynucleotide complementary to the first biomarker. (Item 3) The device according to item 1, wherein the first biomarker is a polypeptide. (Item 4) The device according to item 1, wherein the first probe is an antibody specific for the first biomarker. (Item 5) The device according to item 1, further comprising a second probe specific for a second biomarker, wherein the second probe is different from the first probe. (Item 6) The device according to item 5, wherein the second probe is attached to the first microneedle by covalent or non-covalent bonding. (Item 7) The device according to item 5, wherein the second probe is attached to a second microneedle by covalent or non-covalent bonding. (Item 8) The device according to item 5, wherein the second biomarker is a polynucleotide and the second probe is a polynucleotide complementary to the second biomarker. (Item 9) The device according to item 5, wherein the first probe specifically binds to a first nucleotide polymorphism and the second probe specifically binds to a second nucleotide polymorphism. (Item 10) The device according to item 5, wherein the second biomarker is a polypeptide. (Item 11) The device according to item 5, wherein the first probe and the second probe are different antibodies each specific for a different epitope of the same biomarker. (Item 12) The device according to item 1, wherein the first probe is attached to a plurality of microneedles. (Item 13) The device according to item 1, wherein the first microneedle comprises a polymer, a metal, or a ceramic. (Item 14) The device according to item 1, wherein the first microneedle comprises a polymer. (Item 15) The device according to item 1, wherein the first probe is attached to the first microneedle via a linker. (Item 16) The device according to item 15, wherein the linker is a thiol / amino bifunctional linker. (Item 17) The device according to item 15, wherein the linker is a poly(ethylene glycol) linker. (Item 18) The device according to item 1, wherein the first microneedle is formed on a substrate. (Item 19) The device according to item 1, further comprising a compartment for amplifying and identifying the first biomarker and the second biomarker. (Item 20) A device comprising a plurality of microneedles, wherein at least one of the plurality of microneedles is attached to at least one probe specific to a biomarker by a covalent or non-covalent bond, and the biomarker indicates a skin or eye condition. (Item 21) The device according to item 20, wherein the biomarker indicates a skin condition. (Item 22) The device according to item 21, wherein the skin condition is skin cancer. (Item 23) The device according to item 20, wherein the biomarker indicates an eye condition. (Item 24) The device according to item 21, wherein the state of the eye is eye inflammation or eye cancer. (Item 25) The device according to item 20, wherein the biomarker is a polynucleotide, and the at least one probe is complementary to the biomarker. (Item 26) The device according to item 25, wherein the at least one probe comprises different polynucleotide probes specific to different nucleotide polymorphisms of the same biomarker. (Item 27) The device according to item 20, wherein the biomarker is a peptide or polypeptide, and the at least one probe is an antibody specific to the biomarker. (Item 28) The device according to item 27, wherein the at least one probe comprises different antibodies specific to different epitopes of the same biomarker. (Item 29) The device according to item 20, comprising a plurality of probes specific to a plurality of different biomarkers, and attaching the plurality of probes to the same or different microneedles. (Item 30) The device according to item 29, wherein at least two different probes are attached to the same microneedle. (Item 31) The device according to item 20, comprising at least two identical probes for a specific biomarker, and attaching the at least two identical probes to one or more microneedles. (Item 32) The device according to item 20, wherein the microneedle comprises a polymer, a metal, or a ceramic. (Item 33) The device according to item 32, wherein the microneedle comprises a polymer. (Item 34) The device according to item 20, wherein the probe is attached to the microneedle via a linker. (Item 35) The device according to item 34, wherein the linker is a thiol / amino bifunctional linker. (Item 36) The device according to item 34, wherein the linker is a poly(ethylene glycol) linker. (Item 37) The device according to item 20, wherein the plurality of microneedles are formed on a substrate. (Item 38) The device according to item 20, further comprising a compartment for amplifying and identifying the biomarker captured by the probe in situ. (Item 39) A device comprising a plurality of microneedles, wherein at least one of the plurality of microneedles is attached to a probe specific for a biomarker by a covalent or non-covalent bond, and the probe comprises a sensor that emits an optical signal when the probe detects the biomarker. (Item 40) The device according to item 39, wherein the optical signal of the probe increases when the probe detects the biomarker. (Item 41) The device according to item 39, wherein the optical signal of the probe decreases when the probe detects the biomarker. (Item 42) The device according to item 39, wherein the biomarker is a polynucleotide and the probe is a polynucleotide complementary to the biomarker. (Item 43) The device according to item 42, wherein the probe is different polynucleotide probes specific for different nucleotide polymorphisms of the same biomarker. (Item 44) The device according to item 39, wherein the biomarker is a peptide or polypeptide and the probe is an antibody specific for the biomarker. (Item 45) The device according to item 44, wherein the probe is different antibodies specific to different epitopes of the same biomarker. (Item 46) The device according to item 39, comprising a plurality of probes specific to a plurality of different biomarkers, wherein the plurality of probes are attached to the same or different microneedles. (Item 47) The device according to item 39, wherein at least two different probes are attached to the same microneedle. (Item 48) The device according to item 39, comprising at least two identical probes for a specific biomarker, wherein the identical probes are attached to one or more microneedles. (Item 49) The device according to item 39, wherein the microneedle is made of polymer, metal, or ceramic. (Item 50) The device according to item 49, wherein the microneedle contains a polymer. (Item 51) The device according to item 39, wherein the probe is attached to the microneedle via a linker. (Item 52) The device according to item 51, wherein the linker is a thiol / amino bifunctional linker. (Item 53) The device according to item 51, wherein the linker is a poly(ethylene glycol) linker. (Item 54) The device according to item 39, further comprising a compartment for amplifying and identifying the biomarker captured by the probe in situ. (Item 55) (a) A device comprising a plurality of microneedles, wherein at least one of the plurality of microneedles is attached to a first probe specific to a biomarker by a covalent or non-covalent bond. (b) A set of reagents for polymerase chain reaction and A kit containing the same. (Item 56) The kit according to Item 55, wherein at least one microneedle is attached to a second probe specific for a different biomarker by covalent or non-covalent bonding. (Item 57) The kit according to Item 55, further comprising a holder. (Item 58) The kit according to Item 55, wherein the biomarker is a polynucleotide and the probe is a polynucleotide complementary to the biomarker. (Item 59) The kit according to Item 58, wherein the probe is a different polynucleotide probe specific for a different nucleotide polymorphism of the same biomarker. (Item 60) The kit according to Item 55, wherein the set of reagents includes a polymerase enzyme, a buffer, and a control sample. (Item 61) The kit according to Item 55, further comprising instructions for its use. (Item 62) The kit according to Item 55, comprising a plurality of probes specific for a plurality of different biomarkers, and attaching the plurality of probes to the same or different microneedles. (Item 63) The kit according to Item 62, wherein at least two different probes are attached to the same microneedle. (Item 64) The kit according to Item 55, further comprising at least two identical probes for a specific biomarker, and attaching the identical probes to one or more microneedles. (Item 65) The kit according to Item 55, wherein the microneedle is made of a polymer, metal, or ceramic. (Item 66) The kit according to Item 65, wherein the microneedle contains a polymer. (Item 67) The kit according to item 55, wherein the probe is attached to the microneedle via a linker. (Item 68) The kit according to item 67, wherein the linker is a thiol / amino bifunctional linker. (Item 69) The kit according to item 67, wherein the linker is a poly(ethylene glycol) linker. (Item 70) The kit according to item 55, further comprising a compartment for amplifying and identifying the biomarker captured by the probe in situ. (Item 71) The kit according to item 55, wherein the probe comprises a sensor that emits a visual signal when the probe detects the biomarker. (Item 72) The kit according to item 55, which detects or extracts one or more biomarkers derived from the state of the skin upon contact with a biological sample. (Item 73) The kit according to item 55, which detects or extracts one or more biomarkers derived from the state of the eye upon contact with a biological sample. (Item 74) The kit according to item 55, wherein the set of reagents is for reverse transcriptase polymerase chain reaction. (Item 75) A method for detecting one or more biomarkers from an in situ tissue or biological sample in a subject, comprising: (a) contacting a microneedle with the tissue or biological sample of the subject, wherein the microneedle is attached to a set of probes, and the probes bind to the one or more biomarkers in situ; and (b) detecting the one or more biomarkers bound to the probes. (Item 76) The method according to item 75, wherein the one or more biomarkers are polynucleotides and the probe is a polynucleotide complementary to the biomarker. (Item 77) The method according to item 76, wherein the probe is a different polynucleotide probe specific for different nucleotide polymorphisms of the same biomarker. (Item 78) The method according to item 75, wherein the one or more biomarkers are peptides or polypeptides and the probe is an antibody specific for the biomarker. (Item 79) The method according to item 78, wherein the probe is a different antibody specific for different epitopes of the same biomarker. (Item 80) The method according to item 75, comprising a plurality of probes specific for a plurality of different biomarkers, and attaching the plurality of probes to the same or different microneedles. (Item 81) The method according to item 80, wherein at least two different probes are attached to the same microneedle. (Item 82) The method according to item 75, comprising at least two identical probes for a specific biomarker, and attaching the identical probes to one or more microneedles. (Item 83) The method according to item 75, wherein the microneedle comprises a polymer, a metal, or a ceramic. (Item 84) The method according to item 83, wherein the microneedle comprises a polymer. (Item 85) The method according to item 75, wherein the probe is attached to the microneedle via a linker. (Item 86) The method according to item 85, wherein the linker is a thiol / amino bifunctional linker. (Item 87) The method according to item 85, wherein the linker is a poly(ethylene glycol) linker. (Item 88) The method according to item 75, wherein said detecting comprises contacting said one or more biomarkers with a detectable label. (Item 89) The method according to item 88, wherein said detectable label is a fluorophore. (Item 90) The method according to item 75, wherein said detecting comprises amplifying said biomarker. (Item 91) The method according to item 75, wherein said biomarker bound to said probe on said microneedle is detected by polymerase chain reaction. (Item 92) The method according to item 75, wherein said biomarker bound to said probe on said microneedle is detected by PCR amplification of a secondary antibody tagged with a polynucleotide and said polynucleotide tag. (Item 93) The method according to item 75, wherein said biomarker is a small molecule or metabolite and said probe is a ligand specific for said biomarker. (Item 94) A method for detecting one or more biomarkers from an in situ tissue or biological sample in a subject, comprising: (a) contacting a microneedle device with the tissue or biological sample of the subject, wherein the microneedle device comprises one or more probes specific for the one or more biomarkers, and at least one probe comprises a sensor that emits a visual signal when the probe detects the biomarker; and (b) detecting the biomarker based on the visual signal. (Item 95) The method according to item 94, wherein said one or more biomarkers are polynucleotides and said probes are polynucleotides complementary to said biomarkers. (Item 96) The method according to item 95, wherein the probe is a different polynucleotide probe specific for different nucleotide polymorphisms of the same biomarker. (Item 97) The method according to item 94, wherein the one or more biomarkers are peptides or polypeptides, and the probe is an antibody specific for the biomarker. (Item 98) The method according to item 96, wherein the probe is a different antibody specific for different epitopes of the same biomarker. (Item 99) The method according to item 94, comprising a plurality of probes specific for a plurality of different biomarkers, and attaching the plurality of probes to the same or different microneedles. (Item 100) The method according to item 99, wherein at least two different probes are attached to the same microneedle. (Item 101) The method according to item 94, further comprising at least two identical probes for a specific biomarker, and attaching the identical probes to one or more microneedles. (Item 102) The method according to item 94, wherein the microneedle is made of a polymer, metal, or ceramic. (Item 103) The method according to item 102, wherein the microneedle contains a polymer. (Item 104) The method according to item 94, wherein the probe is attached to the microneedle via a linker. (Item 105) The method according to item 104, wherein the linker is a thiol / amino bifunctional linker. (Item 106) The method according to item 104, wherein the linker is a poly(ethylene glycol) linker. (Item 107) The method according to item 94, further comprising a system for amplifying and identifying the biomarker captured by the probe in situ. (Item 108) The method according to item 94, wherein said detecting comprises contacting said one or more biomarkers with a detectable label. (Item 109) The method according to item 108, wherein said detectable label is a fluorophore. (Item 110) The method according to item 94, wherein said detecting comprises amplifying said biomarker. (Item 111) The method according to item 94, wherein the biomarker bound to the probe on the microneedle is detected by polymerase chain reaction. (Item 112) The method according to item 94, wherein the biomarker bound to the probe on the microneedle is detected by PCR amplification of a secondary antibody tagged with a polynucleotide and the polynucleotide tag. (Item 113) The method according to item 94, wherein said biomarker is a small molecule or metabolite and said probe is a ligand specific for said biomarker. (Item 114) The method according to item 94, wherein said one or more biomarkers are related to the state of the skin. (Item 115) The method according to item 94, wherein said one or more biomarkers are related to the state of the eye. (Item 116) The method according to item 94, wherein said microneedle is etched to increase the surface area of said microneedle. (Item 117) A composition comprising a plurality of microneedles coated with an agent capable of disrupting the extracellular matrix. (Item 118) The composition according to item 117, wherein said agent is an enzyme. (Item 119) The composition according to item 117, wherein the enzyme is selected from the group consisting of serine protease, thiol protease, MMP, papain, hyaluronidase, streptokinase, streptodornase, trypsin, chymotrypsin, alpha-chymotrypsin, alpha-amylase, DNase, collagenase, and strychnine. (Item 120) The composition according to item 117, wherein the enzyme is hyaluronidase. (Item 121) A method for detecting one or more biomarkers in a subject's tissue, comprising: (a) contacting a microneedle with the tissue of the subject in situ, wherein the tissue contains an extracellular matrix, and the microneedle is covalently attached to a set of probes, and the probes bind to the biomarker in situ; and (b) destroying the extracellular matrix. (Item 122) The method according to item 121, wherein the extracellular matrix is destroyed by enzymatic activity. (Item 123) The method according to item 121, wherein destroying the extracellular matrix comprises applying ultrasonic energy to the extracellular matrix. (Item 124) The method according to item 121, wherein the extracellular matrix is destroyed by an electric potential. (Item 125) A method for detecting one or more biomarkers from a subject's in situ tissue, comprising: (a) contacting a microneedle with the tissue, wherein the tissue contains a cell membrane, and the microneedle is attached to a set of probes, and the probes bind to the biomarker in situ; and (b) destroying the cell membrane. (Item 126) The method according to item 125, wherein the cell membrane is destroyed by enzymatic activity. (Item 127) The method according to item 125, wherein destroying the cell membrane comprises applying ultrasonic energy to the cell membrane. (Item 128) The method according to item 125, wherein the cell membrane is destroyed by a potential. (Item 129) A method for preparing a microneedle device, comprising: (a) obtaining a solution containing an inorganic salt; (b) adding a probe and a microneedle to the solution; (c) conjugating the probe to the microneedle in the solution. The method comprising. (Item 130) The method according to item 129, wherein the inorganic salt is sodium chloride. (Item 131) The method according to item 129, wherein the concentration of the inorganic salt is less than 2.5 M. (Item 132) A method for detecting one or more biomarkers in a subject, the method comprising contacting a microneedle device with the skin or eye tissue of the subject. (Item 133) The method according to item 132, wherein the one or more biomarkers are related to the state of the skin or eye. (Item 134) The method according to item 132, wherein the biomarker is a polynucleotide. (Item 135) The method according to item 132, wherein the biomarker is present in the blood of the subject. (Item 136) A method for detecting one or more biomarkers in a subject, the method comprising contacting a microneedle device with the skin capillaries of the subject. (Item 137) The method according to item 136, further comprising contacting the microneedle device with a blood sample of the subject. (Item 138) A method for detecting one or more polynucleotide biomarkers from in situ tissue in a subject, the method comprising contacting a micro-needle device with the tissue of the subject during an intraoperative procedure. (Item 139) The method according to item 138, wherein the tissue is derived from an organ selected from the group consisting of brain, heart, breast, liver, pancreas, spleen, bladder, stomach, lung, uterus, cervix, prostate, kidney, intestine, appendix, thyroid, and colon. (Item 140) The method according to item 138, wherein the tissue of the subject includes benign tissue. (Item 141) The method according to item 138, wherein the tissue of the subject includes tissue suspected of being malignant. (Item 142) The method according to item 138, wherein the micro-needle device contacts malignant tissue and benign tissue adjacent to the malignant tissue. (Item 143) The method according to item 138, wherein the micro-needle device contacts benign tissue adjacent to malignant tissue. (Item 144) The method according to item 138, wherein the micro-needle device contacts a tumor. (Item 145) The method according to item 138, further comprising determining a surgical margin of a tumor. (Item 146) The method according to item 75, 94, 121, 125, 129, 132, 136, or 138, further comprising detecting one or more biomarkers from reference tissue obtained from the subject. (Item 147) The device according to item 14, wherein the polymer is a thermoplastic polymer. (Item 148) The device according to item 14, wherein the thermoplastic polymer is selected from the group consisting of polycarbonate, poly(methyl methacrylate), polyethylene, and polypropylene.
[0037] Incorporation by reference All publications and patent applications mentioned in this specification are hereby incorporated by reference into this specification, as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
[0038] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the invention will be obtained from the following detailed description, which illustrates exemplary embodiments in which the principles of the invention are utilized, and from the accompanying drawings (also referred to as "Figure" or "FIG").
Brief Description of the Drawings
[0039]
Figure 1
[0040]
Figure 2
[0041]
Figure 3
[0042]
Figure 4
[0043]
Figure 5
[0044]
Figure 6
[0045]
Figure 7
[0046]
Figure 8
DETAILED DESCRIPTION OF THE INVENTION
[0047] Detailed Description In this specification, various embodiments of the present invention have been shown and described. However, it will be apparent to those skilled in the art that such embodiments are presented for illustrative purposes only. Without departing from the present invention, those skilled in the art can envision numerous modifications, variations, and alternatives. In practicing the present invention, it should be understood that various alternatives to the embodiments of the present invention described herein may be employed.
[0048] The present invention provides a device and method for detecting and collecting biomarkers, particularly molecular biomarkers, from within a subject's body. In some embodiments, a micro-needle array-based device with single or multiple micro-needles is fabricated according to the present invention. The length of the individual micro-needles on the array can vary, for example, in the range of 50 μm to 5 mm. The device can be fabricated from different materials, composites, and combinations of materials including, but not limited to, metals and alloys, inorganic ceramics, and polymers. The micro-needles are chemically modified to couple a probe for the biomarker to the micro-needle surface. The specific coupling chemical reaction depends on the material of the micro-needle. Different biomarkers can be detected by cognate probes immobilized on the same array or on the same micro-needle. By way of illustration, the device can be applied to an anatomical location of a patient, such as the skin, eye, tumor, or other tissue, for the purpose of enabling binding to a probe presenting the desired biomarker. The application can be performed by hand (e.g., pressure from the thumb), or with an applicator device with or without a strap or band to hold it in place over the duration of sampling. By physically inserting the micro-needle probe, the cell membrane can be disrupted to release genetic material containing biomarkers capable of binding to the probe on the inserted micro-needle. Extracellular biomarkers can bind directly to the probe and do not need to be sampled from the material released from the disrupted cells.
[0049] The time required for a biomarker to bind to the microneedle will depend on several parameters including, but not limited to, the total amount of biomarker, biodistribution, and concentration, the organization of the tissue, and the physical and chemical size of the microneedle probe (e.g., surface area, number of probes, number of binding sites). The application time can range, for example, from less than 10 seconds to 60 minutes. When removing the microneedle array from the tissue, several different techniques can be used to assay the biomarker, including, but not limited to, PCR, quantitative PCR, protein PCR, sandwich ELISA, elution mass spectrometry, elution Western blot, and elution ELISA. The biomarker can be assayed after separation from the microneedle or directly on the microneedle.
[0050] As exemplified in detail in the Examples, for the conjugation of probes to microneedles, a variety of chemical reactions can be used depending on the microneedle and probe being coupled. Chemical modification of microneedles made from polymers for covalently attaching biomolecules can be carried out by a number of linkages developed in the art. For example, in the case of microneedles with a polycarbonate surface, the carbonate monomer contains an aromatic moiety that can be chemically derivatized after polymerization. After treating the needles with nitric acid, reduction of the resulting nitro groups yields an amine handle that can couple molecules to the polymer backbone. It is important that this two-step reaction can be carried out on the fabricated microneedle array without compromising the integrity of the array or individual microneedles. Using this procedure, standard amide bond coupling reagents can be used to link carboxylic acid-containing probes to the microneedle surface.
[0051] When fabricating microneedles from metal, it is possible to achieve the same principle as described for the polymer surface for application to the metal surface. For example, the surface of stainless steel can be coated with gold via a sputter coating process, which can provide chemical handles for attachment. Then, by leveraging the affinity of thiols for the gold surface, which has been well characterized, a divalent crosslinking agent can be attached to the metal surface by thiols at one end and amines at the other end, thereby enabling the same coupling chemical reaction of probe molecules to the microneedle surface. In the art, methods suitable for chemical modification of other types of microneedle surfaces (e.g., inorganic ceramics) for covalently linking biomolecules are also known.
[0052] The invention described herein has broad applicability in many different aspects of diagnostic methods, including gene (e.g., mRNA, DNA) biomarkers, protein biomarkers, hormone biomarkers, small molecule biomarkers, and cell biomarkers for the diagnosis and prognostic diagnosis of diseases. For example, the devices or methods described herein can be useful in the detection of skin-based biomarkers, whole body circulation biomarkers, pathogens (e.g., bacteria, viruses, or parasites), or the determination of tumor margins during the surgical resection of tumors. As described herein, specific examples of skin-based diagnostic applications of the invention include the detection of biomarkers for cutaneous malignant melanoma, non-melanocytic skin cancers (e.g., basal cell carcinoma, squamous cell carcinoma), autoimmune disorders (e.g., psoriasis), infectious diseases, and local diseases (e.g., Buruli ulcer, onchocerciasis). Specific examples of non-skin-based diagnostic applications of the invention include the detection of biomarkers for neoplastic diseases, blood diseases, cardiovascular diseases, Down syndrome, and the rapid real-time detection of biomarkers during clinical trials.
[0053] The following sections provide more detailed guidance for practicing the present invention.
[0054] Definitions Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The following references provide those of ordinary skill in the art with general definitions of many of the terms used in this invention. Academic Press Dictionary of Science and Technology, Morris (Ed.), Academic Press (1st ed., 1992); Oxford Dictionary of Biochemistry and Molecular Biology, Smith et al. (Eds.), Oxford University Press (Rev. ed., 2000); Encyclopaedic Dictionary of Chemistry, Kumar (Ed.), Anmol Publications Pvt. Ltd. (2002); Dictionary of Microbiology and Molecular Biology, Singleton et al. (Eds.), John Wiley & Sons (3rd ed., 2002); Dictionary of Chemistry, Hunt (Ed.), Routledge (1st ed., 1999); Dictionary of Pharmaceutical Medicine, Nahler (Ed.), Springer-Verlag Telos (1994); Dictionary of Organic Chemistry, Kumar and Anandand (Eds.), Anmol Publications Pvt. Ltd. (2002); and A Dictionary of Biology (Oxford Paperback Reference), Martin and Hine (Eds.), Oxford University Press (4th ed., 2000). In addition, the following definitions are provided to assist the reader in the practice of this invention.
[0055] A biomarker broadly refers to any characteristic that is objectively measured and evaluated as an indicator of a normal biological process, a pathogenic process, or a pharmacological response to a therapeutic intervention. Unless otherwise indicated, the term "biomarker" as used herein specifically refers to a biomarker having a biophysical property that enables its measurement in a biological sample (e.g., plasma, serum, cerebrospinal fluid, bronchoalveolar lavage fluid, biopsy). Unless otherwise indicated, the term "biomarker" is used interchangeably with "molecular biomarker" or "molecular marker". Examples of biomarkers include nucleic acid biomarkers (e.g., oligonucleotides or polynucleotides), peptide biomarkers or protein biomarkers, lipid markers, and lipopolysaccharide markers.
[0056] As used herein, "microneedle device or microneedle array (microarray)" refers to a device comprising at least one small puncturing element or microneedle to which a diagnostic agent or diagnostic compound is immobilized. A microneedle is capable of piercing a biological barrier in a human or other mammalian subject (e.g., the stratum corneum of the skin) upon contact. Preferably, the device comprises a plurality of such microneedles, e.g., 2, 5, 10, 25, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 2000, 5000, 10000, 20000 or more microneedles. By conjugating a diagnostic probe to the microneedles, the microneedle device of the present invention provides a means for in situ detection of biomarkers in a subject's tissue or in a biological sample (e.g., in the bloodstream or in the skin).
[0057] As used herein, the terms "polynucleotide" or "nucleic acid" refer to polymers of nucleotides of any length, whether ribonucleotides or deoxyribonucleotides, and include purine and pyrimidine bases, or other natural nucleotide bases, chemically or biochemically modified nucleotide bases, unnatural nucleotide bases, or derivatized nucleotide bases. Polynucleotides of embodiments of the present invention include sequences of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or DNA copies of ribonucleic acid (cDNA), all of which can be isolated from natural sources, produced recombinantly, or synthesized artificially. Further examples of polynucleotides are polyamide polynucleotides (PNA). Polynucleotides and nucleic acids can exist as single-stranded or double-stranded. The backbone of a polynucleotide can contain sugar and phosphate groups typically found in RNA or DNA, or can contain modified or substituted sugar or phosphate groups. Polynucleotides can contain modified nucleotides such as methylated nucleotides and nucleotide analogs. The nucleotide sequence can be interrupted by components other than nucleotides. Also herein, polymers made from nucleotides, such as nucleic acids and polynucleotides, may also be referred to as nucleotide polymers.
[0058] The term "oligonucleotide" is defined as a molecule containing two or more deoxyribonucleotides, preferably more than three deoxyribonucleotides. Its exact size will depend on many factors, and many of these factors will depend on the ultimate function and use of the oligonucleotide. As used herein, the term "primer" refers to an oligonucleotide that, whether occurring naturally in a purified restriction digest or produced synthetically, induces the synthesis of a primer extension product that is complementary to a nucleic acid strand, i.e., that can act as a starting point for synthesis when placed under appropriate temperature and pH conditions in the presence of agents such as nucleotides and DNA polymerase. A primer may be single-stranded or double-stranded, but must be long enough to prime the synthesis of the desired extension product to a sufficient extent in the presence of the agent. The exact length of the primer will depend on many factors, including temperature, the source of the primer, and the method used. For example, in diagnostic applications, oligonucleotide primers typically contain from 15 to 25 or more nucleotides, depending on the complexity of the target sequence, although they may contain fewer nucleotides. Those skilled in the art are readily aware of the factors involved in determining the appropriate primer length.
[0059] A polypeptide is a polymer chain containing amino acid residue monomers attached together by amide bonds (peptide bonds). Amino acids can be in the L - optical isomer form or the D - optical isomer form. Generally, a polypeptide refers to a long - chain polymer of amino acid residues, for example, a long - chain polymer consisting of at least 10, 20, 50, 100, 200, 500 or more amino acid residue monomers. A polypeptide can be a chain composed of at least two amino acids, peptidomimetics, proteins, recombinant proteins, antibodies (monoclonal or polyclonal antibodies), antibody fragments, antigens, epitopes, enzymes, receptors, vitamins, or structural analogs, or combinations thereof. However, unless otherwise stated, the term "polypeptide" as used herein also encompasses short - chain peptides that are two or more amino acid monomers but typically contain 10, 15, or 20 or fewer amino acid monomers.
[0060] A protein is a long - chain polymer of amino acids linked through peptide bonds and can consist of two or more polypeptide chains. More specifically, the term "protein" refers to a molecule consisting of one or more amino acid chains in a specific order, for example, one or more amino acid chains in an order determined by the nucleotide base sequence within a gene encoding the protein. Proteins are essential for the structure, function, and regulation of cells, tissues, and organs in the body, and each protein has a unique function. Examples are hormones, enzymes, and antibodies. In some embodiments, the term "polypeptide" and the term "protein" can be used interchangeably.
[0061] As used herein, the term "biological sample" refers to a sample of biological tissue or chemical fluid suspected of containing a target biomarker or analyte. The sample may be an ex vivo sample or an in vivo sample. Samples include, for example, whole blood, serum, plasma, cerebrospinal fluid, urine, lymph fluid, and body fluids such as various excretions from the respiratory tract, intestinal tract, and urogenital tract, such as tears, saliva, semen, breast milk, etc.; and other biological fluids such as cell culture suspensions, cell extracts, cell culture supernatants, etc. Samples may also include, for example, tissue biopsies from the lung, liver, brain, eye, tongue, colon, kidney, muscle, heart, breast, skin, pancreas, uterus, cervix, prostate, salivary gland, etc. Samples may also be micro-biopsies, small samples, or even single cells that are extracted from a patient and then processed, for example, using laser capture microdissection. Samples can be suspended or dissolved, for example, in a buffer, an extract, a solvent, etc.
[0062] As used herein, the term "tissue" refers to a collection of similar cells and the intracellular material surrounding them. In the body, there are four basic tissues: 1) epithelium; 2) connective tissue including blood, bone, and cartilage; 3) muscle tissue; and 4) nervous tissue.
[0063] In this specification, a range can be expressed as a range from "about" one particular value and / or to "about" another particular value. When expressing such a range, another embodiment includes the range from one particular value and / or to another particular value. Similarly, it will be understood that when a value is expressed as an approximation by use of the antecedent "about", the particular value forms another embodiment. It will further be understood that each endpoint of a range is significant in relation to the other endpoint and is also significant independent of the other endpoint. In the context of a particular usage, the term "about" as used herein refers to a range of ±15% from the stated numerical value. For example, about 10 would include the range from 8.5 to 11.5.
[0064] A covalent bond is a chemical bond involving the sharing of electron pairs between atoms. Covalent bonds include many types of interactions including σ bonds, π bonds, metal–metal bonds, agostic interactions, and three-center two-electron bonds. Non-covalent interactions differ from covalent bonds in that they do not involve sharing of electrons. Non-covalent bonds can generally be classified into four categories: electrostatic bonds, π-effects, van der Waals forces, and hydrophobic effects.
[0065] Biomarker The devices or methods described herein can be employed in a variety of diagnostic applications for detecting and capturing specific biomarkers. Biomarkers can also be used in clinical practice to identify the risk of disease or diagnose disease, stratify patients, assess disease severity or progression, predict prognosis, and guide treatment. In drug development, biomarkers can be used to help determine how a drug works in the body, determine the bioactive dose of a drug, help assess whether a drug is safe or effective, and help identify patients who are most likely to respond to treatment or least likely to suffer adverse events when treated with the drug. In some cases, biomarkers can also be used as part of the approval process for a drug or treatment to provide information for regulatory decision-making.
[0066] In some cases, the methods and devices of the invention can be used to detect various biomarkers in a subject's body by employing the microneedle array devices described herein and commonly practiced amplification techniques (e.g., genomics or proteomics techniques). In some cases, a microneedle array device can be used to capture a biomarker or set of biomarkers, and then one or more additional tagged probes can be used to detect the captured biomarkers to detect various biomarkers from a subject.
[0067] Biomarkers that can be detected according to the present disclosure include nucleic acid-based biomarkers (DNA, RNA, mRNA transcripts, genomic DNA, tRNA, siRNA, miRNA, mitochondrial DNA, mitochondrial RNA, exosomal nucleic acids, cell-free DNA or cell-free RNA, polynucleotides carrying mutant genes and polymorphisms), peptides, proteins, lipids, lipid metabolites, and small molecules. Biomarkers include diagnostic biomarkers (e.g., cardiac troponin for diagnosing myocardial infarction), disease staging by disease biomarkers (e.g., brain natriuretic peptide for congestive heart failure), prognostic diagnostic biomarkers for diseases (cancer biomarkers), and biomarkers for monitoring clinical responses to interventions (HbAlc for anti-diabetic treatment). Biomarkers also include those used in decision-making in early drug development. For example, a pharmacodynamics (PD) biomarker is a marker for a certain pharmacological response that is particularly targeted in dose optimization studies. Examples of biomarkers implicating diseases include serum LDL for high cholesterol and hypertension, and the P53 gene and MMP for cancer. Further examples of specific nucleic acid biomarkers and protein biomarkers suitable for detection by the methods and devices of the present invention are described below.
[0068] Some preferred embodiments of the present invention are directed to the detection and amplification of nucleic acid biomarkers. In the art, many nucleic acid biomarkers are known. Examples include telomerase reverse transcriptase mRNA as a diagnostic biomarker for hepatocellular carcinoma (Miura et al., Clin. Cancer Res., Vol. 11: 3205-3209, 2005), plasma hnRNP B1 mRNA as a biomarker for lung cancer (Sato et al., J. Cancer Res. Clin. Oncol., Vol. 134: 1191-1197, 2008), GD2 / GM2 synthase mRNA as a biomarker for small cell lung cancer (Chen et al., Lung Cancer., Vol. 67: 216-220, 2010), serum transforming growth factor-alpha mRNA as a prognostic diagnostic biomarker for fulminant hepatitis (Miura et al., Hepatol Int., Vol. 2: 213-221, 2008), plakophilin 3 mRNA for gastrointestinal cancer (Valladares-Ayerbes et al., Cancer Epidemiol Biomarkers Prev., Vol. 19: 1432-1440, 2010), metallothionein as a biomarker for heavy metal exposure (Yamada et al., Industrial Health, Vol. 39: 29-32, 2001), WT1 mRNA as a biomarker for monitoring minimal residual disease in acute myeloid leukemia (Sakamoto et al., Tohoku J Exp Med., Vol. 219: 169-176, 2009), and granzyme A mRNA as a biomarker for kidney transplant rejection (van Ham et al., Kidney Int’l., August 18, 2010). In addition to these biomarkers, all other diverse nucleic acid biomarkers known in the art are also suitable for detection by the methods and devices of the present invention. In the art, the polynucleotide sequences of these known biomarkers have already been described and characterized. Based on their known sequences, specific probes (e.g., oligonucleotide primers) for detecting these biomarkers can be easily designed and synthesized by methods of molecular biology.See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, N.Y., (3rd ed., 2000); and Brent et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (loose-leaf ed., 2003).
[0069] In some other embodiments, the devices and methods of the present invention detect peptide biomarkers or protein biomarkers. The methods and devices described herein are useful for detecting a variety of peptide biomarkers or protein biomarkers characterized in the art. Specific examples of peptide biomarkers or protein biomarkers suitable for the present invention include PSA as a biomarker for prostate cancer (Polascik et al., J. Urol., Vol. 162: 293 - 306, 1999), cancer antigen 125 (CA125) as a biomarker for ovarian cancer (Jacobs et al., Lancet, Vol. 353: 1207 - 1210, 1999), BC1, BC2, and BC3 as serum biomarkers for detecting breast cancer (Mathelin et al., Breast Cancer Res. Treat., Vol. 96: 83 - 90, 2006), β - defensin - 2 protein as a serum biomarker for psoriasis (Patrick et al., PLoS ONE, Vol. 4: e4725, 2009), C - reactive protein as a biomarker for metastasis of renal cell carcinoma (Johnson et al., Mol. Diagn. Ther., Vol. 14: 191 - 3, 2010), high - molecular - weight melanoma - associated antigen as a biomarker for fibroblastic melanoma (Goto et al., Pigment Cell Melanoma Res., Vol. 23: 137 - 140, 2010), telomerase expression as a biomarker for malignant transformation in patients with inflammatory bowel disease (Gonzalo et al., Gastroenterol Hepatol., Vol. 33: 288 - 96, 2010), and insulin - like growth factor II mRNA - binding protein 3 (IMP3) as a prognostic diagnostic biomarker for oral squamous cell carcinoma (Li et al., Head Neck., July 22, 2010), including but not limited to these.Probes (e.g., monoclonal antibodies) for detecting these biomarkers can be easily created by standard immunological techniques (e.g., hybridoma technology) or obtained from suppliers (e.g., Abnova Corporation, Full Moon BioSystems, and Spring Bioscience).
[0070] Depending on the specific type of biomarker to be detected, the microneedle devices described herein can be combined with a variety of methods known in the art for amplifying and examining molecular entities. Many genomics and proteomics methods are suitable for use in the devices and methods of the present invention for detecting and analyzing protein and nucleic acid biomarkers. For example, PCR can be used to amplify and examine nucleic acid molecules bound to probes on the microneedles. ELISA can be used to analyze peptide or protein biomarkers captured by the microneedle-based devices of the present invention. In addition to biomarker assays by genomics and proteomics platforms, metabolomics, lipidomics, and glycomics methods can also be used to identify and detect biomarkers of other chemical classes. For example, mass spectrometry, chromatography, and nuclear magnetic resonance are useful for detecting and analyzing various biomolecules bound to the microneedles.
[0071] Microneedles for attaching diagnostic probes The present invention provides a microneedle device having a molecular probe covalently attached thereto for in situ detection and collection of biomarkers from a subject. The micro-based device contains one or more microneedles that can be pierced into a mammalian biological barrier such as the skin or mucosa. The microneedles are often non-invasive or minimally invasive. When multiple microneedles are present, the device can also have a planar substrate that supports the microneedles. The substrate can be made of the same material as the material of the microneedles. The substrate can also be made of a different material. The microneedles employed in the present invention typically have a length (height) in the range of 20 μm to 1 mm, preferably in the range of 50 μm to 500 μm. Figure 4 is a schematic view of the surface of a device of the present invention including multiple microneedles. Each "square" within 401 exemplifies an individual microneedle. 401 is a plurality of microneedles on the surface of a device of the present invention, exemplifying microneedles having a needle height ranging from about 400 μm to about 1000 μm. In some embodiments, the needle height is about 20 μm to about 50 μm, about 20 μm to about 100 μm, about 20 μm to about 150 μm, about 20 μm to about 200 μm, about 20 μm to about 250 μm, about 20 μm to about 300 μm, about 20 μm to about 350 μm, about 20 μm to about 400 μm, about 20 μm to about 450 μm, about 20 μm to about 500 μm, about 20 μm to about 550 μm, about 20 μm to about 600 μm, about 20 μm to about 650 μm, about 20 μm to about 700 μm, about 20 μm to about 750 μm, about 20 μm to about 800 μm, about 20 μm to about 850 μm, about 20 μm to about 900 μm, about 20 μm to about 950 μm, or about 20 μm to about 1 mm.In some cases, the height of the microneedle is less than 1 μm, less than 5 μm, less than 10 μm, less than 15 μm, less than 20 μm, less than 25 μm, less than 30 μm, less than 35 μm, less than 40 μm, less than 45 μm, less than 50 μm, less than 75 μm, less than 100 μm, less than 150 μm, less than 200 μm, less than 250 μm, less than 300 μm, less than 500 μm, less than 750 μm, less than 1000 μm, less than 2000 μm, less than 3000 μm, less than 4000 μm, less than 5000 μm, less than 7500 μm, or less than 10000 μm. In some cases, the height of the microneedle is greater than 1 μm, greater than 5 μm, greater than 10 μm, greater than 15 μm, greater than 20 μm, greater than 25 μm, greater than 30 μm, greater than 35 μm, greater than 40 μm, greater than 45 μm, greater than 50 μm, greater than 75 μm, greater than 100 μm, greater than 150 μm, greater than 200 μm, greater than 250 μm, greater than 300 μm, greater than 500 μm, greater than 750 μm, greater than 1000 μm, greater than 2000 μm, greater than 3000 μm, greater than 4000 μm, greater than 5000 μm, greater than 7500 μm, or greater than 10000 μm.
[0072] The needle-shaped microneedle can be an object with a non-sharp tip, but preferably has a sharp tip. In some embodiments, the microneedle has a conical structure with a base diameter generally in the range of 10 μm to 500 μm, preferably in the range of 20 μm to 200 μm. 401 illustrates the surface of a device of the present invention with a plurality of microneedles where the base diameter is less than 10 mm in width. In a device containing a plurality of microneedles, the microneedles can be present in rows on the device. In some embodiments, the rows can be arranged at substantially equal intervals, equal to the interval between the aligned needles. In some embodiments, the rows can also be arranged at irregular intervals.
[0073] The microneedles can have multiple shapes. For example, the microneedles can be circular, conical, triangular, square, rectangular, pentagonal, hexagonal, heptagonal, octagonal, or any other suitable shape. The microneedles can be sharp in some cases, not sharp in some cases, or any combination of these. For example, the device of the present invention including a plurality of sharp microneedles can be used to penetrate the skin of a subject, thereby allowing the probe on the microneedles to contact, for example, an RNA biomarker. Sharp microneedles can be used to disrupt the tissue of a biological sample, such as a layer of cells or the outer membrane of cells. Non-sharp microneedles can be used to contact the surface of the skin of a subject, thereby allowing the microneedles to contact, for example, a cell surface biomarker on the skin. In some cases, the present disclosure presents a microneedle device including microneedles of different shapes (e.g., sharp microneedles and non-sharp microneedles).
[0074] In some embodiments, the device of the present invention includes at least one microneedle, at least 100 microneedles, at least 200 microneedles, at least 300 microneedles, at least 400 microneedles, at least 500 microneedles, at least 600 microneedles, at least 700 microneedles, at least 800 microneedles, at least 900 microneedles, at least 1000 microneedles, at least 1100 microneedles, at least 1200 microneedles, at least 1300 microneedles, at least 1400 microneedles, at least 1500 microneedles, at least 1600 microneedles, at least 1700 microneedles, at least 1800 microneedles, at least 1900 microneedles, at least 2000 microneedles, at least 2100 microneedles, at least 2200 microneedles, at least 2300 microneedles, at least 2400 microneedles, at least 2500 microneedles, at least 2600 microneedles, at least 2700 microneedles, at least 2800 microneedles, at least 2900 microneedles, at least 3000 microneedles, at least 3100 microneedles, at least 3200 microneedles, at least 3300 microneedles, at least 3400 microneedles, at least 3500 microneedles, at least 3600 microneedles, at least 3700 microneedles, at least 3800 microneedles, at least 3900 microneedles, at least 4000 microneedles, at least 4100 microneedles, at least 4200 microneedles, at least 4300 microneedles, at least 4400 microneedles, at least 4500 microneedles, at least 4600 microneedles, at least 4700 microneedles, at least 4800 microneedles,It includes at least 4,900 microneedles, or at least 5,000 microneedles.
[0075] In some embodiments, the device of the present invention includes up to 10,000 microneedles, up to 5,000 microneedles, up to 2,500 microneedles, up to 2,000 microneedles, up to 1,000 microneedles, up to 500 microneedles, up to 400 microneedles, up to 300 microneedles, up to 100 microneedles, up to 90 microneedles, up to 50 microneedles, up to 40 microneedles, up to 30 microneedles, up to 20 microneedles, up to 15 microneedles, up to 10 microneedles, up to 9 microneedles, up to 8 microneedles, up to 7 microneedles, up to 6 microneedles, up to 5 microneedles, up to 4 microneedles, up to 3 microneedles, up to 2 microneedles, or 1 microneedle.
[0076] In some embodiments, the device of the present invention has from about 1 microneedle to about 100 microneedles, from about 1 microneedle to about 200 microneedles, from about 1 microneedle to about 300 microneedles, from about 1 microneedle to about 400 microneedles, from about 1 microneedle to about 500 microneedles, from about 1 microneedle to about 600 microneedles, from about 1 microneedle to about 700, from about 1 microneedle to about 800 microneedles, from about 1 microneedle to about 900 microneedles, from about 1 microneedle to about 1000 microneedles, from about 1 microneedle to about 1100 microneedles, from about 1 microneedle to about 1200 microneedles, from about 1 microneedle to about 1300 microneedles, from about 1 microneedle to about 1400 microneedles, from about 1 microneedle to about 1500 microneedles, from about 1 microneedle to about 1600 microneedles, from about 1 microneedle to about 1700 microneedles, from about 1 microneedle to about 1800 microneedles, from about 1 microneedle to about 1900 microneedles, from about 1 microneedle to about 2000 microneedles, from about 1 microneedle to about 2100 microneedles, from about 1 microneedle to about 2200 microneedles, from about 1 microneedle to about 2300 microneedles, from about 1 microneedle to about 2400 microneedles, from about 1 microneedle to about 2500 microneedles, from about 1 microneedle to about 2600 microneedles, from about 1 microneedle to about 2700 microneedles, from about 1 microneedle to about 2800 microneedles, from about 1 microneedle to about 2900 microneedles, from about 1 microneedle to about 3000 microneedles, from about 1 microneedle to about 3100 microneedles, from about 1 microneedle to about 3200 microneedles, from about 1 microneedle to about 3300 microneedles, from about 1 microneedle to about 3400 microneedlesIncluding from about 1 microneedle to about 3,500 microneedles, from about 1 microneedle to about 3,600 microneedles, from about 1 microneedle to about 3,700 microneedles, from about 1 microneedle to about 3,800 microneedles, from about 1 microneedle to about 3,900 microneedles, from about 1 microneedle to about 4,000 microneedles, from about 1 microneedle to about 4,100 microneedles, from about 1 microneedle to about 4,200 microneedles, from about 1 microneedle to about 4,300 microneedles, from about 1 microneedle to about 4,400 microneedles, from about 1 microneedle to about 4,500 microneedles, from about 1 microneedle to about 4,600 microneedles, from about 1 microneedle to about 4,700 microneedles, from about 1 microneedle to about 4,800 microneedles, from about 1 microneedle to about 4,900 microneedles, or from about 1 microneedle to about 5,000 microneedles.,
[0077] The substrate of the array and the microneedles can be made from a variety of biodegradable or non - biodegradable materials. Examples of materials for the microneedles or the substrate include poly(methyl methacrylate), silicon, silicon dioxide, ceramics, metals (such as stainless steel, titanium, nickel, molybdenum, chromium, and cobalt), and synthetic or natural resin materials. In some embodiments, biodegradable polymers such as polylactic acid, polyglycolide, poly(lactic - co - glycolide), pullulan, caprolactone, polyurethane, or polyanhydride are used. In some other embodiments, non - degradable materials, such as polymers like polycarbonate, polymethacrylic acid, ethylene vinyl acetate, polytetrafluoroethylene, polysulfone, or polyoxymethylene, synthetic or natural resin materials are employed to fabricate the microneedle array. In some embodiments, the materials employed include or are coated with polysaccharides such as hyaluronic acid, pullulan, dextran, dextrin, or chondroitin sulfate. In some cases, the microneedles are made of a thermoplastic polymer.
[0078] The substrate of the array and the microneedles can be made from a variety of thermoplastic polymers. Non - limiting examples of thermoplastic polymers include acrylic polymers such as poly(methyl methacrylate) (PMMA), nylon, polyethylene, polypropylene, polystyrene, polyvinyl chloride, or Teflon. In some cases, the device of the present invention is made of a thermoplastic polymer selected from the group consisting of polycarbonate, poly(methyl methacrylate), polyethylene, and polypropylene.
[0079] Non-limiting examples of non-degradable polymers include, for example, silicone, cross-linked poly(vinyl alcohol) and cross-linked poly(hydroxyethyl methacrylate), ethylene-vinyl acetate, acyl-substituted cellulose acetate, and its alkyl derivatives, partially or fully hydrolyzed ethylene-vinyl acetate copolymers, unplasticized polyvinyl chloride, cross-linked homopolymers and copolymers of polyvinyl acetate, cross-linked polyesters of acrylic acid and / or methacrylic acid, polyvinyl alkyl ethers, polyvinyl fluoride, polycarbonate, polyurethane, polyamide, polysulfone, styrene acrylonitrile copolymer, cross-linked poly(ethylene oxide), cross-linked poly(alkylene), cross-linked poly(vinyl imidazole), cross-linked poly(ester), cross-linked poly(ethylene terephthalate), cross-linked polyphosphazene, and cross-linked chlorosulfonated polyolefin, and hydrogels such as combinations thereof. In some embodiments, the polymer comprises ethylene vinyl acetate.
[0080] Non-limiting examples of biodegradable polymers include polyesters such as 3-hydroxypropionate, 3-hydroxybutyrate, 3-hydroxyvalerate, 3-hydroxycaproate, 3-hydroxyheptanoate, 3-hydroxyoctanoate, 3-hydroxynonanoate, 3-hydroxydecanoate, 3-hydroxyundecanoate, 3-hydroxydodecanoate, 4-hydroxybutyrate, 5-hydroxyvalerate, polylactide or polylactic acid containing poly(d-lactic acid), poly(l-lactic acid), poly(d,l-lactic acid), polyglycolic acid and polyglycolide, poly(lactic acid-co-glycolic acid), poly(lactide-co-glycolide), poly(ε-caprolactone), and polydioxanone. Also, polysaccharides including starch, glycogen, cellulose, and chitin can be used as biodegradable materials.
[0081] 402 illustrates the surface of device 401 of the present disclosure, which includes a plurality of microneedles coupled to at least one type of probe. 402 can be coupled to, for example, polynucleotide probes, peptide probes, protein probes, or any combination thereof. Probes attached to the microneedles on device 402 can be coupled to the microneedles by covalent or non-covalent bonds. In Examples 1 and 2, various methods for covalently coupling probes to the surface are described in more detail.
[0082] The distance between the centers of two microneedles on the device of the present disclosure can be calculated to determine the density of the microneedles within the device. In some embodiments, the center-to-center distance between two microneedles can be less than 1000 μm, less than 900 μm, less than 800 μm, less than 700 μm, less than 600 μm, less than 500 μm, less than 400 μm, less than 300 μm, less than 200 μm, or less than 100 μm. In some embodiments, the center-to-center distance between two microneedles can be 100 μm or less, 200 μm or less, 300 μm or less, 400 μm or less, 500 μm or less, 600 μm or less, 700 μm or less, 800 μm or less, 900 μm or less, or 1000 μm or less.
[0083] The microneedles of the present disclosure can include a plurality of different diameters or base widths. The shape of the base of the microneedle can be, for example, circular, rectangular, triangular, square, pentagonal, hexagonal, heptagonal, or other geometric shapes. The microneedles of the present disclosure can have a diameter or base width of 500 μm or less, 400 μm or less, 300 μm or less, 200 μm or less, 100 μm or less, 50 μm or less, 40 μm or less, 30 μm or less, 20 μm or less, 10 μm or less, 1000 nm or less, 900 nm or less, 800 nm or less, 700 nm or less, 600 nm or less, 500 nm or less, 400 nm or less, 300 nm or less, 200 nm or less, or 100 nm or less.
[0084] The probe can be attached to the microneedle by covalent or non-covalent bonding at multiple different depths within the microneedle. 403 illustrates a microneedle having a height of 600 μm and a width of 200 μm. 404 illustrates a microneedle having a height of 600 μm and a width of 200 μm and a probe attached by covalent bonding at a depth of 10 μm. 405 illustrates a microneedle having a height of 600 μm and a width of 200 μm and a probe attached by covalent bonding at a depth of 500 μm. In some cases, the depth of the probe within the microneedle can be used to determine the depth within the tissue at which a biomarker can be found. In some cases, a device comprising a plurality of microneedles with a plurality of probes attached at different depths of different microneedles can be used to determine where within the tissue a biomarker can be found. For example, the device can be used to determine the size or depth of a lesion such as a cancerous lesion.
[0085] The depth of the probe can be about 10 μm, about 20 μm, about 30 μm, about 40 μm, about 50 μm, about 60 μm, about 70 μm, about 80 μm, about 90 μm, about 100 μm, about 110 μm, about 120 μm, about 130 μm, about 140 μm, about 150 μm, about 160 μm, about 170 μm, about 180 μm, about 190 μm, about 200 μm, about 210 μm, about 220 μm, about 230 μm, about 240 μm, about 250 μm, about 260 μm, about 270 μm, about 280 μm, about 290 μm, about 300 μm, about 310 μm, about 320 μm, about 330 μm, about 340 μm, about 350 μm, about 360 μm, about 370 μm, about 380 μm, about 390 μm, about 400 μm, about 410 μm, about 420 μm, about 430 μm, about 440 μm, about 450 μm, about 460 μm, about 470 μm, about 480 μm, about 490 μm, about 500 μm, about 510 μm, about 520 μm, about 530 μm, about 540 μm, about 550 μm, about 560 μm, about 570 μm, about 580 μm, about 590 μm, about 600 μm, about 610 μm, about 620 μm, about 630 μm, about 640 μm, about 650 μm, about 660 μm, about 670 μm, about 680 μm, about 690 μm, about 700 μm, about 710 μm, about 720 μm, about 730 μm, about 740 μm, about 750 μm, about 760 μm, about 770 μm, about 780 μm, about 790 μm, about 800 μm, about 810 μm, about 820 μm, about 830 μm, about 840 μm, about 850 μm, about 860 μm, about 870 μm, about 880 μm, about 890 μm, about 900 μm, about 910 μm, about 920 μm, about 930 μm, about 940 μm, about 950 μm, about 960 μm, about 970 μm, about 980 μm, about 990 μm, or about 1000 μm.
[0086] Optionally, the microneedle device of the present invention can include an applicator unit that can be used to apply the device to a subject. The applicator unit can control various application parameters such as the speed at which the array is applied, the force with which the array is applied, and / or the angle at which the array impacts the subject's tissue (e.g., skin). In addition, the applicator can assist in manipulating or otherwise moving the array from a storage unit to the subject. In some embodiments, the applicator can be a single-use disposable tool that is used as either a storage unit or an application tool. Examples of suitable applicators and methods of applying microneedle arrays are disclosed in U.S. Patent Nos. 6,293,925 (Safabash et al.), 6,743,211 (Prausnitz et al.), 6,881,203 (Delmore et al.), and 6,855,131 (Trautman et al.), and U.S. Patent Application Publications 2004 / 0181203 (Cormier et al.), 2002 / 0032415 (Trautman et al.), and 2002 / 0087182 (Trautman et al.). The applicator unit can have a plurality of different shapes. In some embodiments, the applicator unit can be, for example, linear, triangular, rectangular, or disk-shaped. In some embodiments, the applicator unit is a pen applicator.
[0087] A microneedle array for conjugating a diagnostic probe can be readily fabricated using materials and methods well known in the art for fabricating an array with a microprotrusion structure. See, for example, U.S. Patent Nos. 7,416,541, 7,332,197, 6,663,820, 6,503,231, U.S. Patent Application Publication No. 2010 / 0106105, and European Patent Application Publication No. 2119469A. For example, the microneedle array can be fabricated using a wet etching process or a dry etching process using a silicon substrate, precision machining processes (such as electrical discharge machining, laser machining, dicing, thermoembossing, and injection molding) using a metal or a resin, and mechanical cutting. Such processing methods form the needle portion and the support portion into one component. Examples of methods for hollowing out the needle portion include methods of performing secondary processing, such as using laser machining, after preparing the needle portion. In some cases, the microneedles of the present disclosure can be solid (not hollow) microneedles. In some cases, the microneedles of the present disclosure can be etched to increase the surface area of the microneedles.
[0088] In some cases, multiple methods for destroying cells may be required to make biomarkers accessible to the probe. Cells can be destroyed by disrupting the extracellular matrix or by disrupting the cell membrane. The device of the present disclosure, for example, can cause cell destruction when at least one microneedle contacts and punctures a biological sample, such as human skin.
[0089] Multiple cells in situ or ex vivo can be destroyed by a substance. Accordingly, the present invention further provides a composition comprising a plurality of microneedles coated with a substance capable of destroying the extracellular matrix. In some cases, the substance is an enzyme. Any of several enzymes including, but not limited to, serine proteases, thiol proteases, and MMPs may be useful in this process. Non-limiting examples of enzymes that can be used to destroy cells and tissues are papain, hyaluronidase, streptokinase, streptodornase, trypsin, chymotrypsin, alpha-chymotrypsin, alpha-amylase, DNase, collagenase, the protease stylain, lysozyme, lipase, zymolase, cellulase, mutanolysin, or glycanase. In some examples, the enzyme is hyalurodinase.
[0090] Further methods of destroying cells and tissues can include, for example, sonication, electroporation, cryogenic pulverization, physical disruption by pressure, crushing, detergent-based cell lysis, or mechanical shearing of tissues, for example, by a homogenizer. For example, the extracellular matrix or cell membrane can be destroyed by ultrasonic energy or by an electric potential. Also, the application of a solvent to a biological sample can be used to make biomarkers available for hybridization with a probe.
[0091] The devices of the present disclosure can disrupt biological tissue in a minimally invasive manner, either in situ or ex vivo. For example, the microneedles of the present disclosure can be brought into contact with the outer skin in the eye of a subject. The microneedles can gently disrupt the membranes of the cell layers in the outer skin of the eye, thereby allowing access of biomarkers within the eye to the probes within the microneedles. In some embodiments, the methods and devices of the present disclosure can be applied to the identification and characterization of biomarkers from tissues that require care or are surgically inaccessible. For example, the biomarker is present within the eye or within the brain. In some embodiments, the methods and devices of the present disclosure are applied to the in situ characterization of biomarker from biological samples that cannot be made available for surgical excision in a biopsy, such as a biomarker from certain brain tumors.
[0092] Probe conjugation and assays for amplifying and detecting biomarkers Microneedles conjugated with probes
[0093] Multiple probes can be attached to the microneedles of the present disclosure. In some cases, the probes include polynucleotides (e.g., DNA, RNA, cDNA, cRNA, etc.). Polynucleotide probes are often designed to bind or hybridize to specific polynucleotide biomarkers. The present disclosure also presents methods and devices for detecting peptide biomarkers or protein biomarkers. In these embodiments, the probes attached to the microneedles can specifically recognize and specifically bind to the target peptides or target proteins. The probe can be any substance capable of binding to a specific peptide biomarker or protein biomarker. The probe can be, for example, a protein (e.g., an antibody, an antigen, or a fragment thereof), a carbohydrate, or a polynucleotide. The polynucleotide can possess sequence specificity for the biomarker.
[0094] The probes used depend on the biomarker or biomarkers to be detected. Thus, depending on the nature and number of biomarkers to be detected, the number of probes immobilized on the microneedle can be 2, 3, 4, 5, 6, 7, 8, 9, 10 or more. In some cases, the total number of probes within the microneedle can be from about 1 probe to about 1,000 probes, from about 1 probe to about 10,000 probes, from about 1 probe to about 100,000 probes, from about 1 probe to about 1,000,000 probes, from about 1 probe to about 10,000,000, from about 1 probe to about 100,000,000 probes, from about 1,000 probes to about 10,000 probes, from about 1,000 probes to about 100,000 probes, from about 1,000 probes to about 1,000,000 probes, from about 1,000 probes to about 10,000,000, from about 1,000 probes to about 100,000,000 probes, from about 10,000 probes to about 100,000 probes, from about 10,000 probes to about 1,000,000 probes, from about 10,000 probes to about 10,000,000, from about 10,000 probes to about 100,000,000 probes, from about 100,000 probes to about 1,000,000 probes, from about 100,000 probes to about 10,000,000, from about 100,000 probes to about 100,000,000 probes, from about 1,000,000 probes to about 10,000,000, from about 1,000,000 probes to about 100,000,000 probes, or from about 10,000,000 probes to about 100,000,000 probes.
[0095] In some cases, the total number of probes within the microneedles is at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 12, about 14, about 16, about 18, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 600, about 700, about 800, about 900, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10000, about 12000, about 14000, about 16000, about 18000, about 20000, about 30000, about 40000, about 50000, about 60000, about 70000, about 80000, about 90000, about 100000, about 200000, about 300000, about 400000, about 500000, about 600000, about 700000, about 800000, about 900000, about 1,000,000, about 2,000,000, about 3,000,000, about 4,000,000, about 5,000,000, about 6,000,000, about 7,000,000, about 8,000,000, about 9,000,000, about 10,000,000, about 20,000,000, about 30,000,000, about 40,000,000, about 50,000,000, about 60,000,000, about 70,000,000, about 80,000,000, about 90,000,000, or about 100,000,000 probes.
[0096] In some cases, the total number of probes within the microneedle is less than about 1 probe, less than about 2 probes, less than about 3 probes, less than about 4 probes, less than about 5 probes, less than about 6 probes, less than about 7 probes, less than about 8 probes, less than about 9 probes, less than about 10 probes, less than about 12 probes, less than about 14 probes, less than about 16 probes, less than about 18 probes, less than about 20 probes, less than about 25 probes, less than about 30 probes, less than about 35 probes, less than about 40 probes, less than about 45 probes, less than about 50 probes, less than about 60 probes, less than about 70 probes, less than about 80 probes, less than about 90 probes, less than about 100 probes, less than about 150 probes, less than about 200 probes, less than about 250 probes, less than about 300 probes, less than about 350 probes, less than about 400 probes, less than about 450 probes, less than about 500 probes, less than about 600 probes, less than about 700 probes, less than about 800 probes, less than about 900 probes, less than about 1000 probes, less than about 1100 probes, less than about 1200 probes, less than about 1300 probes, less than about 1400 probes, less than about 1500 probes, less than about 2000 probes, less than about 2500 probes, less than about 3000 probes, less than about 3500 probes, less than about 4000 probes, less than about 4500 probes, less than about 5000 probes, less than about 6000 probes, less than about 7000 probes, less than about 8000 probes, less than about 9000 probes, less than about 10000 probes, less than about 12000 probes, less than about 14000 probes, less than about 16000 probes, less than about 18000 probes, less than about 20000 probes, less than about 30000 probes, less than about 40000 probes, less than about 50000 probes, less than about 60000 probes, less than about 70000 probes, less than about 80000 probes, less than about 90000 probes, less than about 100000 probes, less than about 200000 probes, less than about 300000 probes, less than about 400000 probes, less than about 500000 probes, less than about 600000 probes, less than about 700000 probes, less than about 800000 probes, less than about 900000 probes, less than about 1,000,000 probes, less than about 2,000,000 probes, less than about 3,000,000 probes, less than about 4,000,000 probes, less than about 5,000,000 probes, less than about 6,Less than 000,000 probes, less than about 7,000,000 probes, less than about 8,000,000 probes, less than about 9,000,000 probes, less than about 10,000,000 probes, less than about 20,000,000 probes, less than about 30,000,000 probes, less than about 40,000,000 probes, less than about 50,000,000 probes, less than about 60,000,000 probes, less than about 70,000,000 probes, less than about 80,000,000 probes, less than about 90,000,000 probes, or less than about 100,000,000 probes.,
[0097] In addition, probes for biomarkers can be immobilized onto a plurality of microneedles within the devices of the present disclosure, as further described herein, particularly for detecting low concentrations of biomarkers. In some cases, a single microneedle includes a plurality of different probes capable of binding to or detecting the same biomarker. In some cases, a single microneedle includes at least two different probes for the same biomarker, at least three different probes for the same biomarker, at least four different probes for the same biomarker, at least five different probes for the same biomarker, at least six different probes for the same biomarker, at least seven different probes for the same biomarker, at least eight different probes for the same biomarker, at least nine different probes for the same biomarker, at least ten different probes for the same biomarker, at least eleven different probes for the same biomarker, at least twelve different probes for the same biomarker, at least thirteen different probes for the same biomarker, at least fourteen different probes for the same biomarker, at least fifteen different probes for the same biomarker, at least sixteen different probes for the same biomarker, at least seventeen different probes for the same biomarker, at least eighteen different probes for the same biomarker, at least nineteen different probes for the same biomarker, at least twenty different probes for the same biomarker, at least twenty-one different probes for the same biomarker, at least twenty-two different probes for the same biomarker, at least twenty-three different probes for the same biomarker, at least twenty-four different probes for the same biomarker, at least twenty-five different probes for the same biomarker, at least twenty-six different probes for the same biomarker, at least twenty-seven different probes for the same biomarker, at least twenty-eight different probes for the same biomarker, at least twenty-nine different probes for the same biomarker, at least thirty different probes for the same biomarker, at least forty different probes for the same biomarker, at least forty-one different probes for the same biomarker, at least forty-two different probes for the same biomarker, at least forty-three different probes for the same biomarker, at least forty-four different probes for the same biomarker, at least forty-five different probes for the same biomarker, at least forty-six different probes for the same biomarker, at least forty-seven different probes for the same biomarker, at least forty-eight different probes for the same biomarker, at least forty-nine different probes for the same biomarker, or at least fifty different probes for the same biomarker. In some cases, the same microneedle includes more than 50 different types of probes for the same biomarker.
[0098] In some cases, the same microneedle contains a plurality of different probes. The different probes may be specific to the same biomarker or may be specific to different biomarkers. The microneedle can contain at least 2 different probes, at least 10 different probes, at least 100 different probes, at least 200 different probes, at least 300 different probes, at least 400 different probes, at least 500 different probes, at least 600 different probes, at least 700 different probes, at least 800 different probes, at least 900 different probes, at least 1,000 different probes, at least 1,100 different probes, at least 1,200 different probes, at least 1,300 different probes, at least 1,400 different probes, at least 1,500 different probes, at least 1,600 different probes, at least 1,700 different probes, at least 1,800 different probes, at least 1,900 different probes, at least 2,000 different probes, at least 2,100 different probes, at least 2,200 different probes, at least 2,300 different probes, at least 2,400 different probes, at least 2,500 different probes, at least 2,600 different probes, at least 2,700 different probes, at least 2,800 different probes, at least 2,900 different probes, at least 3,000 different probes, at least 3,100 different probes, at least 3,200 different probes, at least 3,300 different probes, at least 3,400 different probes, at least 3,500 different probes, at least 3,600 different probes, at least 3,700 different probes, at least 3,800 different probes, at least 3,900 different probes, at least 4,000 different probes, at least 4,100 different probes, at least 4,200 different probes, at least 4,300 different probes, at least 4,400 different probes, at least 4,500 different probes, at least 4,600 different probes, at least 4,700 different probes, at least 4,800 different probes, at least 4,900 different probes, at least 5,000 different probes, at least 5,100 different probes, at least 5,200 different probes, at least 5,300 different probes, at least 5,400 different probes, at least 5,500 different probes, at least 5,600 different probes, at least 5,700 different probes, at least 5,800 different probes, at least 5,900 different probes, at least 6,000 different probes, at least 6,100 different probes, at least 6,200 different probes, at least 6,300 different probes, at least 6,400 different probes, at least 6,500 different probes, at least 6,600 different probes, at least 6,700 different probes, at least 6,800 different probes, at least 6,900 different probes, at least 7,000 different probes, at least 7,100 different probes, at least 7,200 different probes, at least 7,300 different probes, at least 7,400 different probes, at least 7,500 different probes, at least 7,600 different probes, at least 7,700 different probes, at least 7,800 different probes, at least 7,900 different probes, at least 8,000 different probes, at least 8,100 different probes, at least 8,200 different probes, at least 8,300 different probes, at least 8,400 different probes, at least 8,500 different probes, at least 8,600 different probes, at least 8,700 different probes, at least 8,800 different probes, at least 8,900 different probes, at least 9,000 different probes, at least 9,100 different probes, at least 9,200 different probes, at least 9,300 different probes, at least 9,400 different probes, at least 9,It may include 500 different probes, at least 9,600 different probes, at least 9,700 different probes, at least 9,800 different probes, at least 9,900 different probes, or at least 10,000 different probes. The microneedles may have less than 2 different probes, less than 10 different probes, less than 100 different probes, less than 200 different probes, less than 300 different probes, less than 400 different probes, less than 500 different probes, less than 600 different probes, less than 700 different probes, less than 800 different probes, less than 900 different probes, less than 1,000 different probes, less than 1,100 different probes, less than 1,200 different probes, less than 1,300 different probes, less than 1,400 different probes, less than 1,500 different probes, less than 1,600 different probes, less than 1,700 different probes, less than 1,800 different probes, less than 1,900 different probes, less than 2,000 different probes, less than 2,100 different probes, less than 2,200 different probes, less than 2,300 different probes, less than 2,400 different probes, less than 2,500 different probes, less than 2,600 different probes, less than 2,700 different probes, less than 2,800 different probes, less than 2,900 different probes, less than 3,000 different probes, less than 3,100 different probes, less than 3,200 different probes, less than 3,300 different probes, less than 3,400 different probes, less than 3,500 different probes, less than 3,600 different probes, less than 3,700 different probes, less than 3,800 different probes, less than 3,900 different probes, less than 4,000 different probes, less than 4,100 different probes, less than 4,200 different probes, less than 4,300 different probes, less than 4,400 different probes, less than 4,500 different probes, less than 4,600 different probes, less than 4,700 different probes, less than 4,800 different probes, less than 4,900 different probes, less than 5,000 different probes, 5,It may include fewer than 100 different probes, fewer than 5,200 different probes, fewer than 5,300 different probes, fewer than 5,400 different probes, fewer than 5,500 different probes, fewer than 5,600 different probes, fewer than 5,700 different probes, fewer than 5,800 different probes, fewer than 5,900 different probes, fewer than 6,000 different probes, fewer than 6,100 different probes, fewer than 6,200 different probes, fewer than 6,300 different probes, fewer than 6,400 different probes, fewer than 6,500 different probes, fewer than 6,600 different probes, fewer than 6,700 different probes, fewer than 6,800 different probes, fewer than 6,900 different probes, fewer than 7,000 different probes, fewer than 7,100 different probes, fewer than 7,200 different probes, fewer than 7,300 different probes, fewer than 7,400 different probes, fewer than 7,500 different probes, fewer than 7,600 different probes, fewer than 7,700 different probes, fewer than 7,800 different probes, fewer than 7,900 different probes, fewer than 8,000 different probes, fewer than 8,100 different probes, fewer than 8,200 different probes, fewer than 8,300 different probes, fewer than 8,400 different probes, fewer than 8,500 different probes, fewer than 8,600 different probes, fewer than 8,700 different probes, fewer than 8,800 different probes, fewer than 8,900 different probes, fewer than 9,000 different probes, fewer than 9,100 different probes, fewer than 9,200 different probes, fewer than 9,300 different probes, fewer than 9,400 different probes, fewer than 9,500 different probes, fewer than 9,600 different probes, fewer than 9,700 different probes, fewer than 9,800 different probes, fewer than 9,900 different probes, or fewer than 10,000 different probes.,
[0099] In some cases, multiple probes are identical (e.g., identical copies of the same polynucleotide or antibody). In some embodiments, a microneedle can be associated with multiple copies of the same probe (e.g., 2, 5, 10, 50, 100, 1000, 5000, 7500, 10000, or more than 50000 copies of the same probe). For example, a microneedle can include multiple copies of a polynucleotide probe designed to hybridize to the same polymorphism or biomarker. In some cases, a microneedle can include multiple copies of an antibody probe designed to bind to the same epitope.
[0100] In some cases, the microneedles contain polynucleotide probes. The probes can be designed to detect different biomarkers associated with the same disease, disorder, or condition. In some cases, a first probe recognizes a polymorphism (e.g., a DNA polymorphism, an RNA polymorphism) associated with a disease, and a second probe recognizes a different polymorphism associated with the same disease. For example, a first DNA probe on a microneedle can be designed to detect a first polymorphism of an RNA biomarker associated with onchocerciasis, a skin condition. A second DNA probe on the microneedle can be designed to detect a second polymorphism of the RNA biomarker associated with onchocerciasis. The polymorphism can be, for example, a single nucleotide polymorphism (SNP). Genetic mutations and genomic mutations can include a single SNP or multiple SNPs. SNPs can occur at a single locus or at multiple loci. It is predictable that an individual carrying a specific SNP allele at one locus may also carry a specific SNP allele at other loci. The correlation of SNPs can result in an association between alleles that confer a predisposition to a disease or condition in an individual. In some cases, different polynucleotide probes are designed to detect different biomarkers associated with different conditions. For example, one probe can detect a biomarker of a disease, while another probe can detect a housekeeping gene or a housekeeping gene product. In some cases, the microneedles are attached to a polynucleotide, a polypeptide, or a mixture of a polynucleotide and a polypeptide.
[0101] The microneedles can also be associated with a plurality of different protein probes or antibody probes. For example, a first antibody probe on the microneedle can be designed to detect, for example, a first epitope of an antigen associated with skin cancer. A second antibody probe can be designed to detect a second epitope associated with the antigen. Or, in some cases, the second antibody probe can detect an epitope associated with a different skin condition.
[0102] In some cases, the present disclosure presents a microneedle device that includes a set of microneedles, with each microneedle in the set including the same probe or set of probes. In some embodiments, the same probe is attached to multiple microneedles of the device. The same probe can be attached to, for example, about 1% of the microneedles, about 5% of the microneedles, about 10% of the microneedles, about 15% of the microneedles, about 20% of the microneedles, about 25% of the microneedles, about 30% of the microneedles, about 35% of the microneedles, about 40% of the microneedles, about 45% of the microneedles, about 50% of the microneedles, about 55% of the microneedles, about 60% of the microneedles, about 65% of the microneedles, about 70% of the microneedles, about 75% of the microneedles, about 80% of the microneedles, about 85% of the microneedles, about 90% of the microneedles, about 95% of the microneedles, or about 100% of the microneedles. In some embodiments, the same probe can be attached to 5% or less of the microneedles, 10% or less of the microneedles, 15% or less of the microneedles, 20% or less of the microneedles, 25% or less of the microneedles, 30% or less of the microneedles, 35% or less of the microneedles, 40% or less of the microneedles, 45% or less of the microneedles, 50% or less of the microneedles, 55% or less of the microneedles, 60% or less of the microneedles, 70% or less of the microneedles, 75% or less of the microneedles, 80% or less of the microneedles, 85% or less of the microneedles, 90% or less of the microneedles, 95% or less of the microneedles, or 99% or less of the microneedles.
[0103] In some cases, the set of microneedles can include at least one microneedle attached to a first probe and at least one microneedle attached to a second probe different from the first probe. For example, as described herein, the first probe can be a polynucleotide or polypeptide (e.g., an antibody, a protein) that specifically binds to a biomarker of a disease or disorder, and the second probe can be a polynucleotide or polypeptide that specifically binds to a different biomarker associated with the same disease or disorder. In some cases, the first probe can be a polynucleotide or polypeptide (e.g., an antibody, a protein) that specifically binds to a biomarker of a disease or disorder, and the second probe can be a polynucleotide or polypeptide that specifically binds to a different biomarker associated with a different disease, disorder, or condition. In some cases, the different diseases, conditions, or disorders are associated with the same organ. For example, the first probe can be associated with a first disease, disorder, or condition associated with the skin, and the second probe can be associated with a second disease, disorder, or condition associated with the skin or the eye. In some cases, the device can include an array of microneedles, and each microneedle includes a probe that detects a biomarker associated with a different disease, disorder, or condition associated with the same organ. The array of microneedles can include 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 75, 100, 150, 200, 500, or more than 1000 microneedles associated with different diseases, disorders, or conditions. In some cases, the different diseases, disorders, or conditions are associated with different organs (e.g., more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 organs).
[0104] In some cases, the microneedle device includes a plurality of arrays of microneedles, and the plurality of arrays of microneedles are often suitable for multiplex reactions. In some cases, the plurality of arrays are two or more arrays of microneedles, including arrays designed to detect different biomarkers. In some cases, the first array of microneedles can be designed to detect biomarkers associated with a disease, disorder, or condition, and the second array of microneedles can be designed to detect different biomarkers associated with the same disease, disorder, or condition. In some cases, the first array of microneedles can be designed to detect biomarkers associated with a disease, disorder, or condition, and the second array of microneedles can be designed to detect different biomarkers associated with a different disease, disorder, or condition. In some cases, the first array of microneedles can be designed to detect multiple biomarkers associated with a disease, disorder, or condition, and the second array of microneedles can be designed to detect multiple biomarkers associated with a different disease, disorder, or condition. In some cases, the second array of microneedles can be designed to detect a control biomarker (e.g., a housekeeping gene), whether it is a positive control or a negative control.
[0105] In some cases, the methods and devices presented herein can be used to perform multiplex reactions, with or without the use of fluorescence. For example, each microneedle containing a unique PCR reagent (e.g., a unique probe or primer) can be inserted into its own cavity (e.g., a cavity punctured by a needle). The PCR reaction can be run, and the sample can be analyzed for various biomarkers. In some cases, the multiplex reaction is performed with fluorescently labeled probes or probes that emit different optical signals. In some cases, fluorescence is not used.
[0106] The microneedle devices described herein can include any number of probes, and the probes are often attached to a plurality of needles within the device. The probes can be the same or different. Additionally, probes for biomarkers can be immobilized to a plurality of microneedles within the devices of the present disclosure, particularly for detecting low concentrations of biomarkers. In some cases, the total number of probes within the microneedle device can be from about 1 probe to about 1,000 probes, from about 1 probe to about 10,000 probes, from about 1 probe to about 100,000 probes, from about 1 probe to about 1,000,000 probes, from about 1 probe to about 10,000,000 probes, from about 1 probe to about 100,000,000 probes, from about 1,000 probes to about 10,000 probes, from about 1,000 probes to about 100,000 probes, from about 1,000 probes to about 1,000,000 probes, from about 1,000 probes to about 10,000,000 probes, from about 1,000 probes to about 100,000,000 probes, from about 10,000 probes to about 100,000 probes, from about 10,000 probes to about 1,000,000 probes, from about 10,000 probes to about 10,000,000 probes, from about 10,000 probes to about 100,000,000 probes, from about 100,000 probes to about 1,000,000 probes, from about 100,000 probes to about 10,000,000 probes, from about 100,000 probes to about 100,000,000 probes, from about 1,000,000 probes to about 10,000,000 probes, from about 1,000,000 probes to about 100,000,000 probes, or from about 10,000,000 probes to about 100,000,000 probes.
[0107] In some cases, the total number of probes in the microneedle device is at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 12, about 14, about 16, about 18, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 600, about 700, about 800, about 900, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10000, about 12000, about 14000, about 16000, about 18000, about 20000, about 30000, about 40000, about 50000, about 60000, about 70000, about 80000, about 90000, about 100000, about 200000, about 300000, about 400000, about 500000, about 600000, about 700000, about 800000, about 900000, about 1,000,000, about 2,000,000, about 3,000,000, about 4,000,000, about 5,000,000, about 6,000,000, about 7,000,000, about 8,000,000, about 9,000,000, about 10,000,000, about 20,000,000, about 30,000,000, about 40,000,000, about 50,000,000, about 60,000,000, about 70,000,000, about 80,000,000, about 90,000,000, or about 100,000,000 probes.
[0108] In some cases, the total number of probes in the microneedle device is less than about 1 probe, less than about 2 probes, less than about 3 probes, less than about 4 probes, less than about 5 probes, less than about 6 probes, less than about 7 probes, less than about 8 probes, less than about 9 probes, less than about 10 probes, less than about 12 probes, less than about 14 probes, less than about 16 probes, less than about 18 probes, less than about 20 probes, less than about 25 probes, less than about 30 probes, less than about 35 probes, less than about 40 probes, less than about 45 probes, less than about 50 probes, less than about 60 probes, less than about 70 probes, less than about 80 probes, less than about 90 probes, less than about 100 probes, less than about 150 probes, less than about 200 probes, less than about 250 probes, less than about 300 probes, less than about 350 probes, less than about 400 probes, less than about 450 probes, less than about 500 probes, less than about 600 probes, less than about 700 probes, less than about 800 probes, less than about 900 probes, less than about 1000 probes, less than about 1100 probes, less than about 1200 probes, less than about 1300 probes, less than about 1400 probes, less than about 1500 probes, less than about 2000 probes, less than about 2500 probes, less than about 3000 probes, less than about 3500 probes, less than about 4000 probes, less than about 4500 probes, less than about 5000 probes, less than about 6000 probes, less than about 7000 probes, less than about 8000 probes, less than about 9000 probes, less than about 10000 probes, less than about 12000 probes, less than about 14000 probes, less than about 16000 probes, less than about 18000 probes, less than about 20000 probes, less than about 30000 probes, less than about 40000 probes, less than about 50000 probes, less than about 60000 probes, less than about 70000 probes, less than about 80000 probes, less than about 90000 probes, less than about 100000 probes, less than about 200000 probes, less than about 300000 probes, less than about 400000 probes, less than about 500000 probes, less than about 600000 probes, less than about 700000 probes, less than about 800000 probes, less than about 900000 probes, less than about 1,000,000 probes, less than about 2,000,000 probes, less than about 3,000,000 probes, less than about 4,000,000 probes, less than about 5,000,Less than 000 probes, less than about 6,000,000 probes, less than about 7,000,000 probes, less than about 8,000,000 probes, less than about 9,000,000 probes, less than about 10,000,000 probes, less than about 20,000,000 probes, less than about 30,000,000 probes, less than about 40,000,000 probes, less than about 50,000,000 probes, less than about 60,000,000 probes, less than about 70,000,000 probes, less than about 80,000,000 probes, less than about 90,000,000 probes, or less than about 100,000,000 probes.,
[0109] In some cases, the microneedle device includes at least two different probes for the same biomarker, at least three different probes for the same biomarker, at least four different probes for the same biomarker, at least five different probes for the same biomarker, at least six different probes for the same biomarker, at least seven different probes for the same biomarker, at least eight different probes for the same biomarker, at least nine different probes for the same biomarker, at least ten different probes for the same biomarker, at least eleven different probes for the same biomarker, at least twelve different probes for the same biomarker, at least thirteen different probes for the same biomarker, at least fourteen different probes for the same biomarker, at least fifteen different probes for the same biomarker, at least sixteen different probes for the same biomarker, at least seventeen different probes for the same biomarker, at least eighteen different probes for the same biomarker, at least nineteen different probes for the same biomarker, at least twenty different probes for the same biomarker, at least twenty-one different probes for the same biomarker, at least twenty-two different probes for the same biomarker, at least twenty-three different probes for the same biomarker, at least twenty-four different probes for the same biomarker, at least twenty-five different probes for the same biomarker, at least twenty-six different probes for the same biomarker, at least twenty-seven different probes for the same biomarker, at least twenty-eight different probes for the same biomarker, at least twenty-nine different probes for the same biomarker, at least thirty different probes for the same biomarker, at least forty different probes for the same biomarker, at least forty-one different probes for the same biomarker, at least forty-two different probes for the same biomarker, at least forty-three different probes for the same biomarker, at least forty-four different probes for the same biomarker, at least forty-five different probes for the same biomarker, at least forty-six different probes for the same biomarker, at least forty-seven different probes for the same biomarker, at least forty-eight different probes for the same biomarker, at least forty-nine different probes for the same biomarker, or at least fifty different probes for the same biomarker. In some cases, the same microneedle includes more than 50 different types of probes for the same biomarker.
[0110] In some cases, the microneedle device includes a plurality of different probes. The different probes may be specific to the same biomarker or may be specific to different biomarkers. The microneedle device can include at least two different probes, at least ten different probes, at least one hundred different probes, at least two hundred different probes, at least three hundred different probes, at least four hundred different probes, at least five hundred different probes, at least six hundred different probes, at least seven hundred different probes, at least eight hundred different probes, at least nine hundred different probes, at least one thousand different probes, at least one thousand one hundred different probes, at least one thousand two hundred different probes, at least one thousand three hundred different probes, at least one thousand four hundred different probes, at least one thousand five hundred different probes, at least one thousand six hundred different probes, at least one thousand seven hundred different probes, at least one thousand eight hundred different probes, at least one thousand nine hundred different probes, at least two thousand different probes, at least two thousand one hundred different probes, at least two thousand two hundred different probes, at least two thousand three hundred different probes, at least two thousand four hundred different probes, at least two thousand five hundred different probes, at least two thousand six hundred different probes, at least two thousand seven hundred different probes, at least two thousand eight hundred different probes, at least two thousand nine hundred different probes, at least three thousand different probes, at least three thousand one hundred different probes, at least three thousand two hundred different probes, at least three thousand three hundred different probes, at least three thousand four hundred different probes, at least three thousand five hundred different probes, at least three thousand six hundred different probes, at least three thousand seven hundred different probes, at least three thousand eight hundred different probes, at least three thousand nine hundred different probes, at least four thousand different probes, at least four thousand one hundred different probes, at least four thousand two hundred different probes, at least four thousand three hundred different probes, at least four,400 different probes, at least 4,500 different probes, at least 4,600 different probes, at least 4,700 different probes, at least 4,800 different probes, at least 4,900 different probes, at least 5,000 different probes, at least 5,100 different probes, at least 5,200 different probes, at least 5,300 different probes, at least 5,400 different probes, at least 5,500 different probes, at least 5,600 different probes, at least 5,700 different probes, at least 5,800 different probes, at least 5,900 different probes, at least 6,000 different probes, at least 6,100 different probes, at least 6,200 different probes, at least 6,300 different probes, at least 6,400 different probes, at least 6,500 different probes, at least 6,600 different probes, at least 6,700 different probes, at least 6,800 different probes, at least 6,900 different probes, at least 7,000 different probes, at least 7,100 different probes, at least 7,200 different probes, at least 7,300 different probes, at least 7,400 different probes, at least 7,500 different probes, at least 7,600 different probes, at least 7,700 different probes, at least 7,800 different probes, at least 7,900 different probes, at least 8,000 different probes, at least 8,100 different probes, at least 8,200 different probes, at least 8,300 different probes, at least 8,400 different probes, at least 8,500 different probes, at least 8,600 different probes, at least 8,700 different probes, at least 8,800 different probes, at least 8,900 different probes, at least 9,000 different probes, at least 9,100 different probes, at least 9,200 different probes, at least 9,300 different probes, at least 9,It may include 400 different probes, at least 9,500 different probes, at least 9,600 different probes, at least 9,700 different probes, at least 9,800 different probes, at least 9,900 different probes, or at least 10,000 different probes. In some cases, the microneedle device may have less than 2 different probes, less than 10 different probes, less than 100 different probes, less than 200 different probes, less than 300 different probes, less than 400 different probes, less than 500 different probes, less than 600 different probes, less than 700 different probes, less than 800 different probes, less than 900 different probes, less than 1,000 different probes, less than 1,100 different probes, less than 1,200 different probes, less than 1,300 different probes, less than 1,400 different probes, less than 1,500 different probes, less than 1,600 different probes, less than 1,700 different probes, less than 1,800 different probes, less than 1,900 different probes, less than 2,000 different probes, less than 2,100 different probes, less than 2,200 different probes, less than 2,300 different probes, less than 2,400 different probes, less than 2,500 different probes, less than 2,600 different probes, less than 2,700 different probes, less than 2,800 different probes, less than 2,900 different probes, less than 3,000 different probes, less than 3,100 different probes, less than 3,200 different probes, less than 3,300 different probes, less than 3,400 different probes, less than 3,500 different probes, less than 3,600 different probes, less than 3,700 different probes, less than 3,800 different probes, less than 3,900 different probes, less than 4,000 different probes, less than 4,100 different probes, less than 4,200 different probes, less than 4,300 different probes, less than 4,400 different probes, less than 4,500 different probes, less than 4,600 different probes, less than 4,700 different probes, less than 4,800 different probes, less than 4,It may include fewer than 900 different probes, fewer than 5,000 different probes, fewer than 5,100 different probes, fewer than 5,200 different probes, fewer than 5,300 different probes, fewer than 5,400 different probes, fewer than 5,500 different probes, fewer than 5,600 different probes, fewer than 5,700 different probes, fewer than 5,800 different probes, fewer than 5,900 different probes, fewer than 6,000 different probes, fewer than 6,100 different probes, fewer than 6,200 different probes, fewer than 6,300 different probes, fewer than 6,400 different probes, fewer than 6,500 different probes, fewer than 6,600 different probes, fewer than 6,700 different probes, fewer than 6,800 different probes, fewer than 6,900 different probes, fewer than 7,000 different probes, fewer than 7,100 different probes, fewer than 7,200 different probes, fewer than 7,300 different probes, fewer than 7,400 different probes, fewer than 7,500 different probes, fewer than 7,600 different probes, fewer than 7,700 different probes, fewer than 7,800 different probes, fewer than 7,900 different probes, fewer than 8,000 different probes, fewer than 8,100 different probes, fewer than 8,200 different probes, fewer than 8,300 different probes, fewer than 8,400 different probes, fewer than 8,500 different probes, fewer than 8,600 different probes, fewer than 8,700 different probes, fewer than 8,800 different probes, fewer than 8,900 different probes, fewer than 9,000 different probes, fewer than 9,100 different probes, fewer than 9,200 different probes, fewer than 9,300 different probes, fewer than 9,400 different probes, fewer than 9,500 different probes, fewer than 9,600 different probes, fewer than 9,700 different probes, fewer than 9,800 different probes, fewer than 9,900 different probes, or fewer than 10,000 different probes.,
[0111] Probes for detecting various biological markers can be purchased or synthesized according to methods well known in the art. The probes can be designed according to any suitable method. For example, a computerized search program can be used to minimize cross-hybridization and design nucleic acid probes specific for a target biomarker sequence (e.g., mRNA) with similar hybridization efficiency. Such exemplary programs include Oligo 5.0 (National Biosciences Inc.), Primer 3 (MIT), and Array Designer (Telechem International Inc.). The nucleotide probes used in the present method can have any suitable length, for example, from about 15 to about 100 nucleotides. For protein biomarkers, specific probes (antibodies) for detecting the biomarker can also be easily created or purchased. The nucleotide probes or polypeptide probes used in the present method can include a detectable label. Any suitable label can be used. For example, the detectable label can be detected by optical means, magnetic means, mechanical means, spectroscopic means, photochemical means, biochemical means, immunochemical means, radioactive means, or enzymatic means. In some embodiments, the detectable label is a fluorescent label or chemiluminescent label such as GFP; a magnetic moiety; a protein such as avidin, streptavidin; or a peptide tag such as a histidine tag or a FLAG tag.
[0112] The immobilized probes are present on the surface of the microneedle device described herein. The immobilized probes can be attached to the surface of the microneedle by covalent or non-covalent bonds by methods known in the art or by the specific linking methods described in the examples herein. For example, the probe can be conjugated to the microneedle via, for example, biotin-avidin or biotin-streptavidin interactions, protein A interactions, protein G interactions, goat anti-mouse Fc interactions, via amide bonds, or conjugated to the microneedle via any other covalent or non-covalent interaction. The probe can also be covalently attached to the microneedle with an appropriate spacer element between the probe and the microneedle surface, such as poly(ethylene glycol) (PEG), or covalently attached to the microneedle without this. Methods routinely practiced in the art for immobilizing antibody probes or nucleotide probes can be readily adopted and appropriately modified in the practice of the present invention. Such methods are known in the art, for example, Mendoza et al., Biotechniques 27:778-786, 1999; Arenkov et al., Anal. Bio hem. 278:123-131, 2000; Zhu et al., Nat. Ge net. 26:283-289, 2000; MacBeath et al., Sci ence 289:1760-1763, 2000; Jyoung et al., Bi osens. Bioelectron. 21:2315-2319, 2006; L u et al., Anal. Chem. 67:83 87, 1995; Vijayendran et al., Anal. Chem. 73:471-480, 200 1; Nakanishi et al., Anal. Chem. 68:1695-1 700, 1996; Rowe et al., Anal. Chem. 71:433 - 439, 1999; Day et al., Bichem. J. 278:735 - 740, 1991; Fodor et al., Science 251:767 - 773, 1991; Schene et al., Science 270:467 - 470, 1995; Lamture et al., Nucl. Acids Res. 22:2121 - 2125, 1994; Guo et al., Nucl. Acids Res. 22:5456 - 5465, 1994; and are described in PCT International Publications WO00 / 22108, WO01 / 75447, and WO02 / 12891.
[0113] The probe can also be modified with a reactive moiety and attached to the surface of one or more microneedles coated with gold. The reactive moiety can be a thiol group. In some cases, an inorganic salt can be added. Examples of inorganic salts include, but are not limited to, lithium salts, potassium salts, sodium salts, magnesium salts, and calcium salts, often with halide counterions. In some cases, the inorganic salt is sodium chloride. The inorganic salt can preferably be present at a concentration between about 0.1 M and 2.0 M, about 0.2 M and 2.0 M, about 0.2 M and 1.5 M, or about 0.5 M and 1.5 M. In some cases, the concentration of the inorganic salt is less than about 0.1 M, less than about 0.2 M, less than about 0.2 M, less than about 0.3 M, less than about 0.4 M, less than about 0.5 M, less than about 1.0 M, less than about 1.1 M, less than about 1.2 M, less than about 1.3 M, less than about 1.4 M, less than about 1.5 M, less than about 1.6 M, less than about 1.7 M, less than about 1.8 M, less than about 1.9 M, less than about 2.0 M, less than about 2.5 M, less than about 3.0 M, less than about 3.5 M, less than about 4.0 M, or less than about 4.5 M. In some cases, the concentration of the inorganic salt is greater than about 0.1 M, greater than about 0.2 M, greater than about 0.2 M, greater than about 0.3 M, greater than about 0.4 M, greater than about 0.5 M, greater than about 1.0 M, greater than about 1.1 M, greater than about 1.2 M, greater than about 1.3 M, greater than about 1.4 M, greater than about 1.5 M, greater than about 1.6 M, greater than about 1.7 M, greater than about 1.8 M, greater than about 1.9 M, greater than about 2.0 M, greater than about 2.5 M, greater than about 3.0 M, greater than about 3.5 M, greater than about 4.0 M, or greater than about 4.5 M.
[0114] Capture of Biomarker
[0115] Microneedles attached to a probe by covalent or non-covalent bonding can be inserted in situ into biological samples such as human skin, eyes, intraoperative tissues, and skin capillaries. Microneedles attached to a probe by covalent bonding can also be inserted ex vivo into biological samples such as extracted tissues during biopsy. The probe can hybridize or bind to biomarkers for a specified period of time under physiological conditions for the biological sample. A temperature range of about 20 to about 40 degrees Celsius, atmospheric pressure 1, pH 6 to 8, glucose concentration of 1 to 20 mM, atmospheric oxygen concentration, and the gravity on Earth can be examples of physiological conditions for most subjects. The probe can hybridize or bind to a biological sample for at least 1 minute, at least 2 minutes, at least 3 minutes, at least 5 minutes, at least 10 minutes, at least 15 minutes, at least 20 minutes, at least 25 minutes, at least 30 minutes, at least 45 minutes, at least 1 hour, at least 2 hours, at least 3 hours, at least 5 hours, at least 10 hours, or at least 24 hours. In some embodiments, the probe can hybridize to a biological sample for 1 minute or less, 2 minutes or less, 3 minutes or less, 5 minutes or less, 10 minutes or less, 15 minutes or less, 20 minutes or less, 25 minutes or less, 30 minutes or less, 1 hour or less, 2 hours or less, 3 hours or less, 5 hours or less, or 10 hours or less. Microneedles with probes linked by covalent or non-covalent bonding can be removed from the biological sample, for example, human skin. Biomarkers hybridized or bound to the probe can be isolated from the biological sample by removing the microneedles from human skin.
[0116] Detection of Biomarkers
[0117] Some embodiments of the present invention are directed to the detection of polynucleotide biomarkers (e.g., mRNA, DNA). In these embodiments, probes for one or more specific biomarkers (e.g., oligonucleotide probes, polynucleotide probes) can be readily synthesized based on the sequence of the target biomarker. Nucleic acid biomarkers are typically subjected to an amplification reaction (e.g., PCR, reverse transcription PCR) or detected by a labeled tag once they are bound to the probes on the microneedle device of the present invention. The labeled tag can be directly linked to the probe attached to the microneedle, or in some cases, the labeled tag binds to the biomarker after the biomarker has already been captured by the probe attached to the microneedle.
[0118] Many methods routinely practiced in the art can be readily employed to amplify nucleic acid biomarkers obtained from a subject. These include, for example, polymerase chain reaction (PCR) or reverse transcription PCR. See generally, PCR Technology: Principles and Applications for DNA Amplification (ed. H.A. Erlich, Freeman Press, NY, NY, 1992); PCR Protocols: A Guide to Methods and Applications (eds. Innis et al., Academic Press, San Diego, CA, 1990); Mattila et al., Nucleic Acids Res., 19:4967 (1991); Eckert et al., PCR Methods and Applications, 1:17 (1991); PCR (eds. McPherson et al., IRL Press, Oxford); and U.S. Patent No. 4,683,202, each of which is incorporated by reference for all purposes. Other suitable amplification methods include ligase chain reaction (LCR) (see Wu and Wallace, Genomics, 4:560 (1989), Landegren et al., Science, 241:1077 (1988)), transcription amplification (Kwoh et al., Proc. Natl. Acad. Sci. USA, 86:1173 (1989)), as well as self-sustained sequence replication (Guatelli et al., Proc. Nat. Acad. Sci. USA, 87:1874 (1990)) and nucleic acid sequence-based amplification (NASBA). The latter two amplification methods involve isothermal reactions based on transcription that generate both single-stranded RNA (ssRNA) and double-stranded DNA (dsDNA) as amplification products at ratios of about 30 or 100 to 1, respectively. Once amplified, the identity of the captured biomarker can be readily confirmed by standard techniques such as sequencing analysis, electrophoresis, etc.
[0119] In some embodiments of the present invention, PCR is used to detect biomarkers that hybridize to or are otherwise connected to probes. Amplification of the biomarker by PCR can span several orders of magnitude and, in some cases, starting from a single or a few copies of the target, create thousands to millions of copies of a specific DNA sequence. PCR can use thermal cycling, which includes cycles of repeated heating and cooling reactions for DNA melting and enzymatic DNA replication. These thermal cycling operations can physically separate the two strands within the DNA double helix at high temperature in a step called DNA melting. Then, at low temperature, each strand can be used as a template for DNA synthesis by DNA polymerase to selectively amplify the target DNA. The selectivity of PCR can result from the use of primers (short DNA fragments) that are complementary to the DNA region targeted for amplification under specific thermal cycling conditions.
[0120] Primers containing sequences complementary to the target biomarker can be used with DNA polymerase to achieve selective and repeated amplification. As PCR progresses, the DNA produced can be used as a template for replication to initiate a chain reaction in which the DNA template is exponentially amplified. In PCR applications, thermostable DNA polymerases such as Taq polymerase, an enzyme isolated from the originally bacterial Thermus aquaticus, can be employed. This DNA polymerase can enzymatically assemble new DNA strands from nucleotides, for example, using single-stranded DNA as a template and a DNA oligonucleotide (also called a DNA primer) to initiate DNA synthesis.
[0121] The PCR reaction can be carried out directly on the microneedle inserted into the biological sample. For example, the microneedle can be placed in a test tube containing the reagents necessary for the PCR reaction, or it can be placed between two plates (e.g., a slide glass). The biomarker can be detached from the needle and released into the PCR test tube by a plurality of different methods. For example, the microneedle may be heated to release the biomarker from the microneedle, or the biomarker may be spontaneously released from the needle into the PCR solution. The PCR reaction can be carried out as described above, and the PCR product can be analyzed using standard procedures such as electrophoresis, real-time PCR, and other procedures as described in PCR Technology: Principles and Applications for DNA Amplification (edited by H.A. Erlich, Freeman Press, NY, NY, 1992); PCR Protocols: A Guide to Methods and Applications (edited by Innis et al., Academic Press, San Diego, CA, 1990). Different PCR methods such as standard PCR methods and real-time PCR methods can be used to analyze the sample. Real-time PCR (RT-PCR) is a laboratory technique based on PCR, using which targeted DNA molecules can be amplified and quantified simultaneously. By combining real-time PCR with reverse transcription, messenger RNA and non-coding RNA in cells or tissues can be quantified.
[0122] In some embodiments, the device of the present disclosure can be further configured to include at least one compartment capable of performing a PCR reaction. For example, the device of the present disclosure can be configured to include a plurality of microneedles or an array of microneedles and a compartment capable of performing a PCR reaction.
[0123] By means of a PCR reaction, it is also possible to selectively amplify a biomarker hybridized to a specific microneedle, and by means of a PCR reaction, it is also possible to amplify a set of biomarkers hybridized to a plurality of microneedles. For example, 402 illustrates the surface of the device of the present invention, which includes a plurality of microneedles brought into contact with a biological sample. Each "square" within 402 illustrates an individual microneedle, and in this case, each individual microneedle includes at least one probe. Each probe within 402 may or may not hybridize to a biomarker. Each microneedle illustrated by 402 can be placed in a separate PCR test tube, and each PCR product can be analyzed individually. Alternatively, the plurality of microneedles illustrated by 402 can also be placed in the same PCR test tube for simultaneous analysis.
[0124] In some cases, the captured biomarker can be detected by using a labeled probe capable of binding to the captured biomarker. In some cases, the labeled probe binds to the biomarker after the biomarker has already been captured by the probe attached to the microneedle described herein. In some cases, the microneedle is directly attached to a probe tagged with a label designed to change its optical signal (decrease or increase its intensity) when binding to the biomarker.
[0125] The labeled probe may include a label (e.g., fluorophore, radioisotope, etc.) that can emit an optical signal. The fluorescent moiety can be a fluorescent protein such as green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), or variants thereof. In some cases, the labeled probe includes a label that is associated with an increasing or decreasing optical signal when the probe binds to its target. The fluorescent moiety can be an RNA aptamer that binds to a fluorophore. The RNA-fluorophore complex can emit an optical signal across the visible light spectrum (see Paige et al., Science, Vol. 333, p. 6042 (2011)). For example, the "Spinach aptamer sequence" is an RNA mimic of GFP that can be configured to emit a fluorescent optical signal when hybridized to a biomarker.
[0126] In some embodiments, a microneedle including a set of probes non-covalently or covalently attached thereto can be used to detect a biomarker in a subject. For example, the devices of the present disclosure can be brought into contact with the skin of a subject. The device can include a polynucleotide probe that includes an RNA-fluorophore moiety. The RNA-fluorophore moiety can be configured to emit an optical signal, such as a fluorescent signal, when hybridized to a target biomarker.
[0127] Protein biomarkers or peptide biomarkers can be detected and quantified by any of several methods well known to those of ordinary skill in the art for polypeptide detection. These include assay formats such as protein PCR and ELISA. Any of local protein biomarkers and systemic protein biomarkers as well as local peptide biomarkers and systemic peptide biomarkers can be assayed using the microneedle array device of the present invention. Other methods suitable for this purpose include analytical biochemical methods such as electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), high diffusion chromatography, mass spectrometry, or other diverse immunological methods such as fluid precipitation reaction or gel precipitation reaction, immunodiffusion (one - or two - dimensional), immunohistochemistry, affinity chromatography, immunoelectrophoresis, radioimmunoassay (RIA), immunofluorescence assay, Western blotting, dipstick, etc. For a general review of immunoassays, see Methods in Cell Biology, Volume 37: Antibodies in Cell Biology, edited by Asai, Academic Press, Inc. New York (1993); Basic and Clinical Immunology, 7th Edition, edited by Stites & Terr (1991); IMMUNOASSAYS FOR THE 80s, edited by Voller, A. et al., Baltimore: University Park Press (1981); Maggio et al., ENZYME - IMMUNOASSAY, Boca Raton: CRC Press, pages 172 - 176 (1980); and Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology: Practice and Theory of Immunoassays, Volume 15, Elsevier, 1985 should also be referred to. Reagents for performing these assays for any specific protein biomarker or peptide biomarker (e.g., antibody) can be easily obtained from vendors and can also be created by standard and routinely performed techniques (e.g., hybridoma technology for producing monoclonal antibodies).
[0128] The binding interaction between the probe and the biomarker can be detected using a secondary detection reagent such as a secondary antibody. For example, "sandwich ELISA" can be used to detect the binding of the biomarker to the antibody probe. The binding of the biomarker to the probe can be detected using a detection antibody specific for a different epitope of the biomarker. The antibody used in the detection can be of a different isotype than the antibody used as the probe. For example, the antibody probe can be an IgG antibody (including any of the subtypes such as IgG1, IgG2, IgG3, and IgG4), and the secondary antibody can be IgA, IgM. The detection antibody can be conjugated to a detectable label such as a fluorescent moiety or a radioactive label. Antibody-based detection methods such as the enzyme-linked immunosorbent assay (ELISA) method can be used to detect the binding of the probe to the biomarker.
[0129] Protein biomarkers and peptide biomarkers can also be assayed using protein PCR methods. For example, in these applications, one assay suitable for detecting biomarkers is the PCR-ELISA protocol. In the assay, standard immunoassay procedures are employed. A capture antibody is attached to the surface of the micro-needles of the device. Instead of using a reporter enzyme to express an analytical signal, a secondary antibody is fused to a single-stranded oligonucleotide, which can then be amplified using PCR. After insertion and capture of the biomarker, a secondary antibody labeled with an oligonucleotide is added, and then PCR analysis is performed on the conjugated tag to detect the presence of the biomarker.
[0130] Diagnostic applications and related kits The devices and methods described herein are useful for detecting and capturing biomarkers in a variety of diagnostic applications. These include, for example, the diagnosis of skin diseases, the detection of circulating genetic markers, and the detection of protein biomarkers or peptide biomarkers. By way of example, the device can be readily employed for the diagnosis of cutaneous malignant melanoma (CMM) in a subject suspected of having or at risk of developing CMM. In these applications, a probe for a CMM-specific biomarker can be coupled to the micro-needles. A device containing one or more of the micro-needles conjugated with the probe can then be applied directly to all moles (nevi) on the skin of the subject. The device is removed from each nevus, and any biomarker captured by the micro-needles is then assayed either on the device in situ or after separation from the device. The devices of the present disclosure can be used clinically for diagnostic and prognostic applications.
[0131] As another specific application, the devices and methods described herein are also employed in margin detection in skin cancer resection. In these embodiments, the device contains microneedles of different lengths conjugated with probes. Detection and assay of tumor-specific biomarkers by these devices can provide the surgeon with information regarding the degree of tumor infiltration in the dermis, subcutaneous layer, and basal cavity. These applications avoid the repeated histopathological examinations currently required to determine margins during excision of skin tumors. In some cases, the method does not include a skin biopsy.
[0132] The methods and devices of the present invention can be used in the diagnosis and / or treatment of skin conditions. These methods can include contacting microneedles with the skin tissue of a subject. The skin condition can be a benign condition, a pre-malignant condition, or a malignant condition. The skin condition can be a healthy condition. Non-limiting examples of skin conditions include skin cancers such as melanoma and basal cell carcinoma; onchocerciasis; lupus; measles; hemangioma; psoriasis; rosacea; seborrheic eczema; vitiligo, leukoderma; warts; necrotizing fasciitis; cutaneous candidiasis; carbuncle; cellulitis; hypohidrosis; impetigo; cutis laxa; decubitus ulcer; erysipelas; dyshidrotic eczema; stomatitis; freckles; herpetic stomatitis; ichthyosis vulgaris; acne; herpes; dermatomyositis; molluscum contagiosum; acrodermatitis; sebaceous cyst; seborrheic keratosis; hair follicle pore; keloid; lichen planus; actinic keratosis; stasis dermatitis; xanthelasma and molluscum; eczema; alopecia areata; pemphigoid; ulcer; or herpes zoster. The methods and devices of the present invention can be used in the diagnosis and treatment of multiple eye conditions such as uveitis, dry eye disease, retinal disease, glaucoma, and inflammatory diseases. The device of the present invention can be used to stage cancer. Cancer can be staged as stage 0, stage I, stage II, stage III, or stage IV.
[0133] The methods and devices of the present invention can also be used, for example, in the diagnosis and / or treatment of eye conditions such as corneal surface inflammation, uveitis, or dry eye disease. These methods can include, for example, contacting a subconjunctival space to bring a microneedle into contact with the eye tissue of a subject. The eye condition can be a benign condition, a pre-malignant condition, or a malignant condition. The eye condition can be a healthy condition. Non-limiting examples of eye conditions include retinoblastoma; cutaneous melanoma or intraocular (ocular) melanoma; retinitis pigmentosa (RP); diabetic retinopathy; glaucoma (including open-angle glaucoma (e.g., primary open-angle glaucoma), angle-closure glaucoma, and secondary glaucoma (e.g., pigmentary glaucoma, pseudoexfoliative glaucoma, and glaucoma resulting from trauma and inflammatory diseases)), retinal detachment, age-related macular degeneration or other macular diseases, age-related macular degeneration, photoretinopathy, surgically induced retinopathy, toxic retinopathy, retinopathy of prematurity, retinopathy resulting from eye trauma or infiltrative lesions, hereditary retinal degeneration, surgically induced retinopathy, toxic retinopathy, retinopathy resulting from eye trauma or infiltrative lesions. Specific and exemplary genetic conditions of interest include, but are not necessarily limited to, Bardet-Biedl syndrome; congenital cataract; cone dystrophy or cone-rod dystrophy; congenital stationary night blindness; macular degeneration; optic atrophy; symptomatic or systemic retinopathy; and Asher syndrome.
[0134] The methods and devices of the present invention can be used to monitor the expression of biomarkers in surgical or cosmetic procedures. Using the devices and methods of the present disclosure, biopsies of delicate tissues such as, for example, eye tissue or brain tissue can be performed. In some cases, the microneedle device can be brought into contact with the tissue or biological sample of a subject during an intraoperative procedure. The tissue or biological sample can be obtained from an organ selected from the group consisting of the brain, heart, breast, liver, pancreas, spleen, bladder, stomach, lung, uterus, cervix, prostate, kidney, intestine, appendix, and colon. In further cases, the microneedle can be brought into contact with the margin of a tumor before or after removing the tumor from the subject.
[0135] As a further example of the diagnostic applications of the present invention, the methods and devices described herein can also be used in the detection of systemic and circulating gene biomarkers in a subject's body fluid (e.g., blood stream). Many diseases (e.g., Down syndrome) are known to have gene (e.g., mRNA) biomarkers that circulate in the blood. By extending the length of the microneedles within the device of the present invention and penetrating and approaching skin or subcutaneous capillaries, it is possible to specifically bind a probe for a biomarker to such a biomarker. Also, any other nucleic acid biomarker known to be present in the blood can be detected in a similar manner. For example, the microneedles on the device of the present disclosure can penetrate the subject's skin in situ and contact the subject's skin capillaries. Skin capillaries may be the narrowest blood vessels in the subject's body, and the inner membrane of a skin capillary may be about one cell layer thick. The device of the present disclosure can penetrate the membrane of one or more skin capillaries when the device is brought into contact with the subject's skin. In some embodiments, the device of the present disclosure can be utilized to examine biomarkers circulating in the blood stream without collecting a blood sample from the subject. In some cases, the device of the present disclosure can detect fetal or maternal biomarkers of a condition, including biomarkers associated with pregnancy. In some cases, the device of the present invention can detect biomarkers circulating in the blood stream, such as proteins, hormones, vitamins, cofactors, or polynucleotides.
[0136] Non-limiting examples of genetic conditions that can be diagnosed by the methods and devices of the present invention based on polynucleotide biomarkers include cystic fibrosis; Duchenne muscular dystrophy; hemochromatosis; Tay-Sachs disease; Prader-Willi syndrome; Angelman syndrome; neurofibromatosis; phenylketonuria; Canavan disease; celiac disease; acid beta-glucosidase deficiency; Gaucher disease; Charcot-Marie-Tooth disease; color blindness; cri du chat syndrome; polycystic kidney disease; acrocephaly; familial adenomatous polyposis; adrenal disorders; amyotrophic lateral sclerosis (ALS); Alzheimer's disease; Parkinson's disease; anemia; ataxia; ataxia telangiectasia; autism; bone marrow disorders; Bonnevie-Ullrich syndrome; brain disorders; von Hippel-Lindau disease; congenital heart disease; Crohn's disease; dementia; myotonic dystrophy; Fabry disease; fragile X syndrome; galactosemia; hereditary emphysema; retinoblastoma; Pendred syndrome; Asherman syndrome; Wilson disease; neuropathy; Huntington's disease; immune system disorders; gout; X-linked spinal muscular atrophy; learning disabilities; Li-Fraumeni syndrome; lipase D deficiency; Lou Gehrig's disease; Marfan syndrome; metabolic disorders; Niemann-Pick disease; Noonan syndrome; osteogenesis imperfecta; Peutz-Jeghers syndrome; Pfeiffer syndrome; porphyria; progeria; Rett syndrome; tuberous sclerosis; language communication disorders; spinal muscular atrophy; Treacher Collins syndrome; trisomy; and monosomy.
[0137] In some cases, the probes of the present invention can be used to detect the status of the immune system. The devices of the present invention can be used in allergy tests to confirm or prevent allergies. In some cases, the devices of the present invention can be used to analyze an allergy panel. Non-limiting examples of immune disorders include HIV, diabetes, Parkinson's disease, Alzheimer's disease, rheumatoid arthritis, lupus, cancer, multiple sclerosis, inflammatory bowel disease, psoriasis, scleroderma, autoimmune thyroid disease, vasculitis, pernicious anemia, severe combined immunodeficiency (SCID), DiGeorge syndrome, hyperimmunoglobulin E syndrome, unclassified immunodeficiency, chronic granulomatous disease, Wiskott-Aldrich syndrome, autoimmune lymphoproliferative syndrome (ALPS), hyper IgM syndrome, leukocyte adhesion deficiency (LAD), NEMO (NF-κB essential modifier) disorder, selective immunoglobulin A deficiency, X-linked agammaglobulinemia, X-linked lymphoproliferative disease, ataxia telangiectasia, seasonal allergies, mastocytosis, perennial allergies, anaphylaxis, food allergies, allergic rhinitis, and atopic dermatitis.
[0138] In some embodiments, the devices and methods of the present invention can be used to diagnose a variety of biomarkers associated with multiple cancers.Non-limiting examples of cancer include acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancer, AIDS-related lymphoma, anal cancer, appendiceal cancer, astrocytoma, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, ependymoma, medulloblastoma, primitive neuroectodermal tumor of the supratentorial region, brain tumors such as optic pathway and hypothalamic glioma, breast cancer, bronchial adenoma, Burkitt lymphoma, cancer of unknown primary origin, central nervous system lymphoma, cerebellar astrocytoma, cervical cancer, childhood cancer, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myeloproliferative disorders, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, ependymoma, esophageal cancer, Ewing sarcoma, germ cell tumor, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, glioma, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular (liver) cancer, Hodgkin lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell carcinoma, Kaposi sarcoma, kidney cancer, laryngeal cancer, lip and oral cavity cancer, liposarcoma, liver cancer, lung cancers such as non-small cell lung cancer and small cell lung cancer, lymphoma, leukemia, macroglobulinemia, malignant fibrous histiocytoma / osteosarcoma of bone, medulloblastoma, melanoma, mesothelioma, metastatic squamous neck cancer of unknown primary origin, oral cavity cancer, multiple endocrine neoplasia syndrome, myelodysplastic syndrome, myeloid leukemia, nasal and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin lymphoma, non-small cell lung cancer, oral cavity cancer, oropharyngeal cancer, osteosarcoma / malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, pancreatic cancer, pancreatic islet cell cancer, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germ cell tumor, pituitary adenoma, pleuropulmonary blastoma, plasma cell tumor, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma, renal pelvis and ureteral transitional cell carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, skin cancer, skin Merkel cell carcinoma, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, stomach cancer, T-cell lymphoma, throat cancer, thymoma, thymic carcinoma, thyroid cancer, trophoblastic tumor (gestational), cancer of unknown primary site, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenström macroglobulinemia, and Wilms tumor may be included.
[0139] The devices of the present disclosure can also be used for independent diagnostic methods and can also be used as secondary diagnostic methods to provide information about therapeutic treatments. The microneedles and methods of the present disclosure result in minimally invasive, rapid, and accurate diagnostic and treatment methods. Additionally, the devices and methods disclosed herein can provide portable, painless, and inexpensive diagnostics to multiple subjects. The subjects of the present invention can be subjects of any age, including, for example, elderly adults, adults, youths, adolescents, children, infants, and neonates. The subjects of the present invention can be mammals, birds, fish, reptiles, or amphibians. Non-limiting examples of subjects include humans, primates, dogs, cats, horses, pigs, and mice.
[0140] Subjects can provide multiple biological samples for analysis by the microneedles of the present invention. Analysis of biological samples from subjects can be performed in situ or ex vivo. For example, in situ analysis can include bringing the microneedles of the present invention into direct contact with the skin of the subject. Ex vivo analysis can include bringing the microneedles of the present invention into contact with a biopsy tissue. In some embodiments, for biomarker analysis by the microneedles and methods of the present invention, a biological sample of about 1 mg, about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 7 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, or about 100 mg is required.
[0141] In some embodiments, the methods and microneedles of the present invention require a biological sample of about 1 mg to about 5 mg or less, about 1 mg to about 10 mg or less, about 1 mg to about 20 mg or less, about 1 mg to about 30 mg or less, about 1 mg to about 40 mg or less, about 1 mg to about 50 mg or less, about 50 mg to about 60 mg or less, about 50 mg to about 70 mg or less, about 50 mg to about 80 mg or less, about 50 mg to about 90 mg or less, about 50 mg to about 100 mg or less, about 100 mg to about 1 gram or less, about 100 mg to about 2 grams or less, about 100 mg to about 3 grams or less, about 100 mg to about 4 grams or less, about 100 mg to about 5 grams or less, about 100 mg to about 6 grams or less, about 100 mg to about 7 grams or less, about 100 mg to about 8 grams or less, about 100 mg to about 9 grams or less, about 100 mg to about 10 grams or less, about 1 gram to about 2 grams or less, about 1 gram to about 3 grams or less, about 1 gram to about 4 grams or less, about 1 gram to about 5 grams or less, about 1 gram to about 6 grams or less, about 1 gram to about 7 grams or less, about 1 gram to about 8 grams or less, about 1 gram to about 9 grams or less, or about 1 gram to about 10 grams or less.
[0142] In some embodiments, additional assays are used to validate a diagnosis made based on the identification of biomarkers identified by the microneedles and methods of the present disclosure. Non-limiting examples of assays that can validate biomarkers include: a) assays that assess the interaction of a protein with DNA, such as DNase footprinting assays and gel shift assays; b) assays that assess the integrity of RNA molecules, such as nuclear run-on assays; c) endpoint assays that can quantitatively or qualitatively measure the final result of an assay; d) reaction rate assays that assess the reading of data points at multiple time intervals and can compare the reaction rates of biological processes; e) semi-quantitative assays that yield a readout that can be quantified in a given context, such as Western blot assays, clotting assays, and aggregation assays; f) immunoassays that assess the response of antigen-antibody binding-type reactions; g) enzyme activity assays that examine function and activity; h) colony formation assays that can examine the ability of cells to proliferate and differentiate; i) counting assays such as flow cytometry assays; and j) multiple PCR assays, such as real-time PCR.
[0143] Furthermore, the methods of the present disclosure can further include detecting one or more biomarkers from a reference tissue obtained from a subject. For example, the method can include detecting biomarkers from a sample tissue and a reference tissue. The reference tissue can be a benign tissue. In some cases, the reference tissue is a tissue derived from the same organ or region as the sample tissue. In some cases, the sample tissue includes tissue suspected of having a disease or disorder (e.g., a malignant tumor), and the reference tissue includes tissue of the same organ that is known not to have the disease or disorder. In some cases, the biomarker levels detected in the sample tissue can be further compared to the biomarker levels detected in the reference tissue.
[0144] In some cases, the devices of the present disclosure can be used to remove tumors and / or identify tumor margins during surgery. The devices of the present invention can be used to characterize tissues and tissue margins of different shapes, either in situ or ex vivo. For example, in Mohs skin cancer surgery, where tissue is typically removed, sectioned, and evaluated by histological methods, the devices of the present invention could be used to analyze the margins of a tumor. In some cases, the devices of the present invention can be used to identify cancer metastases by analyzing tissue margins.
[0145] The devices and methods of the present disclosure can be utilized in personalized medicine applications. A subject can provide a clinician with an amount of, for example, a skin sample. The clinician can use the devices of the present disclosure to examine a plurality of biomarkers associated with the subject's skin. The clinician can use the identified biomarkers to determine the predicted efficacy of a treatment in a particular subject. The devices and methods of the present disclosure can also be used to monitor a subject's response to a particular treatment, for example, by monitoring an increase or decrease in biomarker expression. The clinician can utilize an increase or decrease in biomarker expression levels to determine the efficacy of a treatment. The devices of the present invention can be used to quantitatively measure biomarker expression. For example, quantitative PCR can be used to amplify the copy number of a biomarker that hybridizes to a polynucleotide probe on a microneedle. Microneedles that are not in contact with or hybridized to a biological sample can be used as negative controls. Microneedles with a standard control, such as a known amount of a housekeeping gene, can be used as a positive control for the reaction. Quantitative PCR can be performed as described in The PCR Technique: Quantitative PCR, James W. Larrick, June 1997, Eaton Publishing.
[0146] The devices and methods of the present disclosure can be used in bioweapon defense. Bioweapon defense can include detection of the release or dissemination of biological or chemical agents. These agents can be bacteria, viruses, or toxins, and can be in their natural form or in a human-modified form. The devices of the present disclosure can be used to detect multiple biomarkers associated with pathogenic agents that can be used in biological warfare.
[0147] Agents of biological warfare and / or chemical warfare can include any biological entity and / or chemical entity that can be used, for example, as weapons to cause terrorism, chaos, disease, unease, and / or death. Non-limiting examples of chemical and biological agents include anthrax; smallpox; tularemia; avian influenza; plague; HIV; Ebola; foot-and-mouth disease; ricin; neurotoxic organophosphates; cyanides; vesicants (or blister agents) such as mustard gas and lewisite; choking agents such as chlorine and phosgene; nerve agents such as sarin, tabun, soman, and VX; hallucinogens such as BZ; insecticides such as parathion, malathion, and azinphos-methyl; and derivatives or combinations thereof.
[0148] The present invention further provides a kit for performing the diagnostic applications described herein. The kit typically contains a microneedle device that includes one or more microneedles. In some kits, the microneedles are already conjugated with specific probes for detecting one or more biomarkers. In some other kits, probes for detecting one or more biomarkers and reagents for conjugation to those microneedles are provided as separate components. Some kits of the present invention are intended to detect and capture one biomarker specific to a known disease or disorder (e.g., plakophilin-3 mRNA for gastrointestinal cancer). In these kits, the microneedles of the device are usually conjugated or to be conjugated with the same probe molecule (e.g., an oligonucleotide complementary to the target biomarker). Some other kits of the present invention are designed to detect multiple biomarkers involved in one or more diseases or disorders. In these kits, different probes for different biomarkers are conjugated to or supplied for conjugation with the microneedles of the device. In addition to the microneedle device and probes, the kits of the present invention may also include other reagents (e.g., reagents for PCR amplification of the biomarker) for applying the device to a subject and analyzing the captured biomarker. The kit may further contain instructions (e.g., on an instruction sheet within the kit or on the packaging material of the kit) for using the kit to perform the intended diagnostic application.
[0149] The device of the present invention can be packaged as a kit. In some embodiments, the kit includes instructions for the use of the device for treating conditions such as basal cell carcinoma. The documentation can be, for example, a label. The documentation can suggest the conditions and methods for using the microneedles and additional reagents included in the kit. The instructions provide the best guidance for the subject and the attending physician to achieve optimal detection of the biomarker.
[0150] The kits of the present disclosure can include the devices described herein and a set of reagents for polymerase chain reaction. The kits of the present disclosure can include the devices described herein and a set of reagents for ELISA assays. The kits can also be designed to identify specific conditions such as basal cell carcinoma, and can be designed to simultaneously diagnose multiple conditions such as squamous cell carcinoma, Kaposi's sarcoma, melanoma, basal cell carcinoma, and actinic keratosis (a precursor state of squamous cell carcinoma). In some cases, the kits of the present disclosure can include the devices of the present invention and a written material. In some cases, the kits of the present disclosure can include the devices of the present invention, a set of probes, and a set of reagents that can be used to link the probes to the microneedles.
[0151] The kits of the present disclosure can include positive and negative controls. The positive control can be, for example, a sample containing a known biomarker. The positive control can be a polynucleotide of a known sequence, such as a polynucleotide of a known SNP associated with basal cell carcinoma. The negative control can be, for example, a scrambled polynucleotide sequence. In some cases, the kit can include reagents (e.g., polypeptides, polynucleotides) of known concentration or known amount that can be used to generate a calibration curve for quantifying the amount of biomarker present in a tissue or biological sample. Such reagents can also be used with any of the methods presented herein.
[0152] Animal model Many drugs, treatments, and cures for diseases can be developed by using animal models. Animal models can be living animals that are used during the study and exploration of diseases. The development of drugs as medicines can involve the exploration of toxicities and adverse side effects that are not detected in cell assays. Animal models can be used to evaluate the efficacy, absorption, metabolism, distribution, excretion, toxicity, pharmacology, and side effects of pharmacological treatments. Using the devices and methods of the present invention, the responses of biomarkers to pharmacological treatments in animal models can be identified.
[0153] Animal models can provide guidance for selecting pharmacological compounds for further evaluation. Animal models can, for example, provide guidance for pharmacokinetic / metabolism studies in humans. Animal models can be used, for example, to assess absorption, distribution, metabolism, excretion, and toxicity (ADMET) parameters to support an Investigational New Drug (IND) application. Studies in animal models can, for example, result in the selection of compounds that are further evaluated in preclinical and clinical trials.
[0154] Clinical Interventions and Clinical Trials The devices of the present disclosure can be used in clinical trials. For example, the devices of the present disclosure can be used during a surgical procedure to identify biomarkers in tissues that are difficult to reach or in tissues that cannot be excised and removed for biopsy. For example, the devices of the present disclosure can be applied to the detection of biomarkers in cardiovascular tissue, brain tissue, or internal organs that are exposed to a clinician during a surgical procedure. In some cases, the devices of the present invention can prevent medical complications that might otherwise occur when a clinician removes tissue from a subject for biopsy. The devices of the present disclosure can be used, for example, in routine examinations, during surgical procedures, or by the subject at the subject's home. The devices of the present invention can be used, for example, in cardiovascular surgery or eye surgery.
[0155] The devices of the present disclosure can be used in the design of clinical trial protocols. For example, the devices of the present disclosure can be used in conjunction with clinical trials to detect biomarker levels and monitor a subject's response to a pharmacological treatment. The devices of the present disclosure can provide guidelines for preclinical development and the design, conduct, and analysis of clinical trials. The present disclosure presents methods for identifying and quantifying biomarkers that can be selected for the optimal administration of therapeutically effective compounds.
[0156] The devices of the present disclosure can be used in predicting a subject's response to different drug dosages in clinical trials. For example, by monitoring an increase or decrease in biomarker levels, such as biomarkers of retinal diseases in eye tissue, the methods and devices of the present invention can establish the efficacy of pharmacological treatments for retinal diseases. In some cases, clinical trials for therapeutic agents are conducted or altered based on the detection of biomarkers by the devices of the present disclosure. In some cases, the methods and devices of the present disclosure can be used to compare the treatments evaluated in clinical trials against treatments that are known standard of care.
[0157] Clinical trials typically proceed through multiple steps, including preclinical studies, pilot studies, safety screening studies, and efficacy assessment studies. For a drug to be approved and marketed, it often must meet all evaluation criteria, including validation of efficacy within the specified confidence intervals and inclusion of a significant number of individuals to validate the statistical power of the present invention, as specified in the clinical trial protocol. Non-limiting examples of the application of the present invention include monitoring multiple biomarkers throughout the clinical trial period. The devices and methods of the present disclosure can also be used to monitor, at the early stages of clinical trials (preclinical and Phase I stages), how different pharmacological treatments can affect the expression of biomarkers.
[0158] The disclosed devices and methods can also be used to predict changes in basal cellular pathways affected by a pharmacological treatment based on the expression levels of the identified biomarkers. Non-limiting examples of pharmacodynamic and pharmacokinetic parameters of a pharmacological treatment that can affect basal cellular pathways include: a) the amount of drug administered, which can be expressed as dose D; b) the dosing interval, which can be expressed as τ; c) the volume of distribution V d [Here, V d = D / C0]; d) the concentration C0 or C ss [Where, C0 or C ss = D / Vd]; e) the amount of drug in a given plasma volume, which can be expressed as the half-life of the drug, t 1 / 2 [Here, t 1 / 2 =ln(2) / k e ]; f) the rate at which the drug is eliminated from the body, k e [where k e =ln(2) / t 1 / 2 =CL / V d ];g) The injection rate K required to make both sides of the equation equal in [Here, K in =C ss ×CL];h)AUC 0-∞ (Here,
number
number
number
[0159] The following examples are presented for the purpose of further illustrating the present invention and not for the purpose of limiting its scope.
[0160] (Example 1) Detection of ssDNA in solution by a probe immobilized on polycarbonate In this example, polycarbonate functionalized with a DNA probe and its utilization for specifically capturing ssDNA from a solution are described.
[0161] Attachment of the DNA probe to polycarbonate: The polycarbonate surface was first treated with nitric acid, reduced to introduce amino groups, and further attached to a commercially available thiol / amino bifunctional linker using these (Figure 1). Subsequently, DNA with a 3'-thiol modification was coupled to the linker engaged to polycarbonate.
[0162] Visualization of 5’-Cy5 modified DNA attached to polycarbonate: To visualize the DNA on the polycarbonate surface, the DNA was modified with one Cy5 on the 5’ side and thiol on the 3’ side and attached using the chemical reaction described above. Imaging of the monolayer of 5’ Cy5-DNA with a confocal microscope (Figure 2) showed the success of surface functionalization. In vitro capture of ssDNA on polycarbonate modified with specific DNA probes: To examine the ability of the DNA probes attached to polycarbonate to specifically capture (hybridize to) ssDNA from solution, polycarbonate disks were modified with DNA probes complementary to regions of circular single-stranded DNA (ssDNA, approximately 3.4 kb in size). After incubating the modified disks with the ssDNA solution, the disks were washed thoroughly, and the hybridized ssDNA was denatured at high temperature and released from the disks by quantification via quantitative polymerase chain reaction (qPCR). The amount of DNA captured on polycarbonate modified with specific DNA probes was expressed as a ratio to the capture on polycarbonate modified with only the linker (background control) (Figure 1).
[0163] The results obtained from the study are summarized in Table 1. The data indicate that the ssDNA target was successfully enriched on the specific probe at all test ssDNA concentrations (concentrations varied over 6 logs).
[0164]
Table 1
[0165] The materials and methods used in the study are described in detail below.
[0166] Derivatization of Polycarbonate: The polycarbonate was shaken in 30% aqueous HNO3 solution at 65 °C for 30 minutes and then washed thoroughly with water. The polycarbonate treated with nitric acid (Step 1) was immersed in a 10% NaBH4 solution in water, shaken overnight at room temperature, and finally washed thoroughly with water. The amino-modified polycarbonate (Step 2) was immersed in a 6.4 mM Sulfo-GMBS solution (Pierce) in PBS at pH 7.2, shaken for 1.5 hours at room temperature, and finally washed thoroughly with water.
[0167] Deprotection of DNA Thiol Group: DNA with Thiol Modifier C3 S-S at the 3’ end was purchased from IDT. To deprotect the thiol modification, 5 μL of a 100 μM DNA solution in water was treated with 25 μL of 100 mM 2-mercaptoethanol in PBS at pH 8.1 for 30 minutes at room temperature. To purify the deprotected DNA, 600 μL of PN buffer from the Qiagen nucleotide removal kit was added to the reaction mixture, followed by the addition of isopropyl alcohol (250 μL). The solution was applied to the silica column of the Qiagen nucleotide removal kit, washed according to the kit instructions, and then eluted with 35 μL of PBS at pH 7.2. Attachment of DNA to Polycarbonate: The solution of deprotected thiol-modified DNA (Step 4) was immediately applied to the polycarbonate modified with a maleimide linker (Step 3), incubated in a humid atmosphere at 37 °C for 45 minutes, then washed thoroughly with water and dried in air.
[0168] Visualization of Cy5-Modified DNA: A 25-mer DNA modified with one Cy5 at the 5’ end and thiol modification at the 3’ end was attached to the surface of polycarbonate using the chemical reactions described above. After thorough washing with water and drying, the polycarbonate was mounted on a microscope slide and imaged with a confocal microscope using a near-infrared filter. Localizing and imaging the edges of the modified area by the DNA on the surface clearly showed the effect of modification by the Cy5-labeled DNA monolayer.
[0169] Capture of ssDNA on polycarbonate functionalized with a specific DNA probe: Using the procedures described above (Steps 1-4), a DNA probe with a thiol modification on the 3'-side (5'-CAAGTTTGCCTTTAGCGTCAGACTGTATTTTTTTT / ThioMC3 / -3') (SEQ ID NO: 1) was attached to polycarbonate disks. Disks for negative control experiments were modified with linker only (Steps 1-3). The disks were immersed in a solution of circular ssDNA isolated from filamentous phage in 3-fold concentrated SSC buffer (150 mM NaCl, 15 mM sodium citrate) (see Table 1 for DNA concentration) and incubated at 37 °C for 10 minutes. Subsequently, the disks were washed with three washing buffers (Washing buffer 1: 1-fold concentrated SSC + 0.03% SDS; Washing buffer 2: 0.2-fold concentrated SSC, Washing buffer 3: 0.05-fold concentrated SSC). After washing, the disks were immersed in a minimum volume of sterile distilled water, heated at 90 °C for 2 minutes, and then the still warm water was removed from the disks. The ssDNA in the aqueous aliquot was quantified using qPCR with primers specific for the p3 gene of filamentous phage.
[0170] (Example 2) Conjugation of DNA Probe to Stainless Steel Surface In this example, the attachment of a DNA oligomer probe containing a 3'-thiol modification to the surface of gold-coated stainless steel is described. Attachment of DNA probe to gold-coated stainless steel: The gold surface was easily modified by attaching thiolated single-stranded DNA. The sulfur atom of the thiolated DNA forms a covalent bond with gold. Visualization of DNA on gold-coated stainless steel: To visualize DNA on the surface of a gold-coated stainless steel sample, a fill-in PCR reaction was performed using fluorescently labeled dUTP to synthesize the complementary strand of the single-stranded DNA. The resulting double-stranded oligomer contained multiple copies of Chromatide® Alexa Fluor® 488-5-dUTP that fluoresced in the green channel, similar to fluorescein. Fluorescence microscopy confirmed the success of the functionalization of the gold-coated stainless steel surface (Figure 3).
[0171] The materials and methods used in the study are described in detail below.
[0172] Deprotection of the DNA thiol group and conjugation to stainless steel: DNA with Thiol Modifier C3 S-S at the 3'-end was purchased from IDT. To deprotect the thiol modification, 5 μL of a 100 pM DNA solution in water was treated with 25 μL of 100 mM 2-mercaptoethanol in PBS at pH 8.1 for 30 minutes at room temperature. To purify the deprotected DNA, PN buffer from a 600 μL Qiagen nucleotide removal kit was added to the reaction mixture, followed by isopropyl alcohol (300 μL). The solution was applied to the silica column of the Qiagen nucleotide removal kit, washed according to the kit instructions, and eluted with 24 μL of TE buffer at pH 7.2 (10 mM Tris; 1 mM EDTA).
[0173] A solution of the deprotected thiol-modified DNA was promptly applied to the gold surface of a stainless steel piece (approx. 5 mm × 2.5 mm). The solution was incubated at 37 °C for 16 - 20 hours in a humid atmosphere, then thoroughly washed with water and dried by ventilation.
[0174] Fill-in reaction for amplifying the fluorescence signal: A 75 bp single-stranded DNA oligo (5’-GCATGCATGCATGCATGCATGCATGCATGCATGCATGCGCCTGTGGGCGACTAAATTCCGTTAAAGCCGGC / ThiolMC3 / -3’) (SEQ ID NO: 2) with thiol derivatization at the 3’ end was attached to the surface of a gold-coated stainless steel sample. After washing and drying, the stainless steel sample was placed in a 0.5 mL test tube. Then, 48.5 pL of dH2O and 1.5 pL of a 10 pM primer complementary to the 3’ end of the thiol-derivatized DNA were added. The mixture was incubated at 55 °C for 2 minutes to allow the primer to anneal to the single-stranded DNA. Then, the mixture was returned to room temperature.
[0175] Then, a fill-in reaction was carried out using Chromatide® Alexa Fluor® 488-5-dUTP purchased from Invitrogen. The following components: 2 pL of 10 mM dNTP mix (dATP, dGTP, dCTP), 7.5 pL of 10× concentration Klenow fragment buffer (New England Biolabs), 9.5 pL of dH2O, 4 pL of 1 mM 488-5-dUTP, and 2 pL of Klenow fragment (New England Biolabs) were added to the mixture from Step 3. The reaction was incubated at 37 °C for 30 minutes. The stainless steel sample was removed from the tab, thoroughly washed with water, and dried by ventilation.
[0176] Visualization of DNA Modified with Chromatide® Alexa Fluor®: Once the stainless-steel sample was dried, it was attached to a microscope slide and imaged using a fluorescence microscope with a green filter. Localizing and imaging the edges of the DNA-modified areas on the stainless steel clearly showed the conjugation of DNA to the gold-coated surface.
[0177] (Example 3) Enhancement of the Binding of Oligonucleotides to the Surface of an Array of Metal Micro-needles To further facilitate the attachment of DNA oligomer probes containing 3'-thiol modifications to the gold-coated stainless-steel surface, an NaCl titration was introduced. By adding increasing concentrations of NaCl, the protocol of Example 2 described above was implemented. The amount of ssDNA coupled to the surface increased proportionally to the amount of NaCl added, and an approximately 10-fold increase was observed at an NaCl concentration of 1 M (Figure 7). Quantification of the DNA bound to the gold surface was determined using the Quanti-iT Green ssDNA Reagent Kit (Invitrogen).
[0178] (Example 4) Diagnostic Methods The misdiagnosis of melanoma is a major concern for dermatologists. The consequences of misdiagnosis can be tragic for patients, costly for insurance companies, and damaging for physicians. Therefore, early detection of melanoma is extremely important. However, the invasive nature of standard biopsy procedures may deter physicians from performing biopsies on tissues with a benign appearance. Figures 5 and 6 illustrate the non-invasive diagnosis of melanoma by the devices and methods of the present disclosure. 501 to 505 will be described in more detail for the surface of 603.
[0179] Figure 5 illustrates the process by which a DNA probe designed to detect melanoma biomarkers hybridizes with a desired biomarker. 501 illustrates a single DNA probe attached to the gold surface of a microneedle. The DNA probe within 501 contains a single nucleotide polymorphism that selectively hybridizes with RNA associated with melanoma. As described in Example 2, the DNA probe within 501 is covalently linked to the gold surface within the microneedle. 505 illustrates brightfield and fluorescence field images of the surface of the device of the present invention, which includes a plurality of microneedles with DNA probes covalently linked thereto. When the device contacts the skin of a subject, the microneedles gently disrupt the membranes of the cells within the contacting skin. This process exposes the probes on the microneedles to intracellular polynucleotide biomarkers, peptide biomarkers, and protein biomarkers. The probes on the microneedles can be hybridized 502 to the biomarkers under in situ physiological conditions for a specified period of time. For example, the probes can be hybridized for about 30 minutes at physiological body temperature (about 37°C). Reverse transcriptase-PCR (RT-PCR) assay 503 can be utilized to convert the hybridized RNA into DNA. Standard PCR protocol 504 can be utilized to amplify the product of 503.
[0180] Figure 6 illustrates an overview of a method of treating with the device of the present invention. 601 illustrates the performance of a visual inspection of the skin of a subject by a clinician. The clinician 601 can determine whether the appearance of the skin 602 or a portion of the skin is healthy or not. The clinician contacts the skin of the subject with the device of the present invention, whereby the probe for the biomarker can be contacted with the skin of the subject in a non-invasive manner. 603 is a schematic diagram of the device surface described in more detail in Figure 5. 604 illustrates a PCR assay performed to amplify the hybridized biomarker. 605 depicts the clinician returning the results of the analysis to the subject.
[0181] (Example 5) In Vivo Test of Modified Polymer Microneedle Array In this example, the detection of mouse actin in vivo using the modified polymer microneedle array described in this application is described. The polycarbonate microneedles were modified with ssDNA probes for mouse actin, and samples of microneedles coupled with ssDNA probes were also coated with hyaluronidase. Mice (n = 4; A / J, Swiss Webster) were treated with ssDNA-modified polycarbonate microneedles. The microneedle array was applied to the shaved hind leg of the mouse using thumb pressure and held in place for approximately 10 seconds. The array was then inverted on a slide, the gap between the needle base and the slide was sealed with oil, and the slide was placed on a heat block at 50 °C for 30 minutes to reverse transcribe the mRNA bound to the array directly to cDNA on the microneedle surface. The reaction mixture was then transferred from the slide to a PCR tube and amplified using conventional PCR methods. The cycling program was as follows: 1 minute at 94 °C; 40 cycles of 15 seconds at 94 °C, 30 seconds at 55 °C, and 60 seconds at 68 °C; 5 minutes at 68 °C. The samples were visualized by gel imaging and quantified using densitometry.
[0182] A significant increase in the amount of mRNA isolated from the microneedles containing the probe was observed. The difference between the sample containing the ssDNA probe and the unmodified microneedle array was about 2 - 3 fold, while the difference between the sample containing both the ssDNA probe and hyaluronidase and the unmodified array was about 8 fold. This also indicates that the microneedles can not only extract the target from the skin, but also that the disruption of the extracellular matrix can result in an increase in yield as a result of facilitating the extraction process. Some enzymes including, but not limited to, serine protease, thiol protease, and MMP may be useful in this process. Further specific examples of enzymes include, but are not limited to, papain, hyaluronidase, streptokinase, streptodornase, trypsin, chymotrypsin, alpha-chymotrypsin, alpha-amylase, DNase, collagenase, and strypsin.
[0183] (Example 6) Isolation of target mRNA from homogenized human skin In this example, the isolation of target mRNA from homogenized human skin is described. Excess human skin containing both cancerous and benign tissue excised during Mohs micrographic surgery was obtained from the Scripps Clinic. The skin was homogenized and total RNA was extracted using the following procedure. The skin was homogenized in RNAlater™ using an MP Biomedical FastPrep-24 and Lysing Matrix D beads (about 30-40 mg of tissue per tube) at a setting of 6.0 for 25 seconds. Total RNA was then isolated from this homogenate using an RNA extraction kit (Qiagen™) according to the manufacturer's instructions. A DNA probe with a sequence complementary to human beta-actin was conjugated to a gold-coated stainless steel microneedle and placed into the RNA solution isolated from the homogenized skin and incubated at room temperature or 37 °C for a period of time. The stainless steel strip was isolated from the solution and the bound mRNA was reverse transcribed into cDNA and then amplified and analyzed using qRT-PCR. As a result, only the microneedles conjugated to the beta-actin probe and then amplified using the appropriate beta-actin probe yielded a measurable amount of target (Figure 8). In this example, non-specific DNA sequences were conjugated to the microneedle surface; for targets other than actin, a BMP-4: Taqman probe was used; and the Actb-human-1: beta-actin sequence was conjugated to the surface of the microneedle.
[0184] (Example 7) Detection of mRNA from a mouse skin mRNA library using a microneedle array In these experiments, the target mRNA was isolated from a mouse skin mRNA library (Zyagen™). The total concentration of mRNA in the pool was 250 μg / mL. Next, a gold-coated stainless steel micro-needle array coupled with ssDNA as a probe was added to the mRNA library (5 μL in 20 μL of water) and incubated at 37 °C for about 10 minutes. Then, the array was gently washed and air-dried for a short time. Next, a reverse transcriptase reaction mix (3 μL of 10× reverse transcriptase buffer, 6 μL of 25 mM MgCl2, 3 μL of 0.1 M DTT, 1.5 μL of RNase OUT™, 13 μL of DEPC water, 2 μL of 10 mM dNTP mix) was added to the tube containing the micro-needle array and incubated at 42 °C for 2 minutes, followed by addition of 1.5 μL of SuperScriptII™ reverse transcriptase to perform cDNA synthesis. The reaction was cycled according to the following program: 50 minutes at 42 °C, 15 minutes at 70 °C, and then on ice for about 15 minutes. Next, RNase H was added to each reaction (1.5 μL) and the reaction was incubated at 37 °C for 20 minutes. Then, TaqMan™ PCR amplification was performed using 1.5 μL of 20× TaqMan™ assay primer and 15 μL of 2× TaqMan™ gene expression mix. The total volume of the reaction was 30 μL. After 4 cycles, 5 μL of the solution was removed and used as a template for TaqMan™ qRT-PCR (40 cycles) performed according to the manufacturer's instructions.
[0185] For the purpose of illustration and example for a clear understanding of the foregoing invention, it has been described in some detail. However, it will be readily apparent to those skilled in the art that certain changes and modifications can be made to the foregoing invention without departing from the spirit or scope of the appended claims, in light of the teachings of the present invention.
[0186] All publications, databases, GenBank sequences, patents, and patent applications cited herein are hereby incorporated by reference in their entirety as if each was specifically and individually indicated to be incorporated by reference.
Claims
**Claim 1**: A device for extracting one or more mRNA biomarkers from in situ tissue of a subject, the device comprising two or more microneedles covalently attached to two or more nucleic acid probes, the two or more nucleic acid probes capable of extracting mRNA related to psoriasis. **Claim 2**: The device according to claim 1, wherein the two or more nucleic acid probes comprise one or more polynucleotides complementary to mRNA. **Claim 3**: The device according to any one of claims 1 to 2, wherein the two or more nucleic acid probes comprise DNA. **Claim 4**: The device according to any one of claims 1 to 3, wherein the two or more nucleic acid probes are 15 to 100 nucleotides in length. **Claim 5**: The device according to any one of claims 1 to 4, wherein the two or more nucleic acid probes are fluorescently labeled. **Claim 6**: The device according to any one of claims 1 to 5, wherein the one or more mRNA biomarkers are detected by polymerase chain reaction (PCR). **Claim 7**: The device according to claim 6, wherein the PCR is quantitative real-time PCR (qRT-PCR). **Claim 8**: The device according to any one of claims 1 to 7, wherein the two or more nucleic acid probes are complementary to different mRNAs. **Claim 9**: The device according to any one of claims 1 to 8, wherein the two or more nucleic acid probes are attached to the two or more microneedles via a linker. **Claim 10**: The device according to claim 9, wherein the linker comprises a bifunctional linker. **Claim 11**: The device according to claim 9, wherein the linker comprises a thiol linker. **Claim 12**: The device according to claim 9, wherein the linker comprises a maleimide linker. **Claim 13**: The device according to any one of claims 1 to 12, wherein the two or more microneedles comprise at least 25 microneedles. **Claim 14**: The device according to claim 13, wherein the two or more microneedles comprise at least 50 microneedles. **Claim 15**: The device according to any one of claims 1 to 14, wherein the center-to-center distance between two adjacent microneedles among the two or more microneedles is less than 1000 μm.
16. The device according to any one of claims 1 to 15, wherein the two or more microneedles are formed on a substrate.
17. The device according to any one of claims 1 to 16, wherein the device is capable of extracting mRNA derived from the skin tissue of the subject.
18. (a) A device according to any one of claims 1 to 17; and (b) A set of reagents for polymerase chain reaction A kit comprising.
19. The kit according to claim 18, wherein the set of reagents comprises a polymerase enzyme, a buffer, and a control sample.
20. Use of a device according to any one of claims 1 to 17, the use comprising extracting mRNA associated with psoriasis.
Citation Information
Patent Citations
Use of polypeptide of nm23 gene family or nucleic acid coding the same for diagnosis or therapy of skin disorder or intestinal injury and use the same for identification of pharmacologically active substance
JP2001322947A
Anti-IL-20 Receptor Antibodies and Binding Partners and Methods of Use in Inflammation
JP2007537993A
Interferon-alpha-inducible pharmacodynamic markers
JP2010527917A
Diagnostic biomarkers for fibrous disorders
JP2012526087A
Analyte detection using a needle projection patch
US20110160069A1