Promoter for specific expression of genes in cells expressing glial fibrillary acidic protein

A nucleic acid sequence targeting GFAP-expressing cells provides high-level, cell-type specific gene expression, addressing the limitations of existing technologies by ensuring efficient and targeted gene delivery and function in mammalian cells.

JP7712218B2Active Publication Date: 2025-07-23NOVARTIS FORSCHUNGSSTIFTUNG ZWEIGNIEDERLASSUNG FRIEDRICH MIESCHER INSTITUTE FOR BIOMEDICAL RESEARCH
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2021576472
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-06-25
Filing Date
2020-06-23
Publication Date
2025-07-23
Estimated Expiration
2040-06-23

AI Technical Summary

Technical Problem

Existing gene expression technologies lack the ability to achieve high-level, cell-type specific expression of recombinant genes in mammalian cells, particularly those that utilize endogenous regulatory elements effectively.

Method used

A nucleic acid sequence, specifically designed to drive gene expression only in cells expressing glial fibrillary acidic protein (GFAP), which can be operably linked to a gene of interest and integrated into an expression cassette or vector, ensuring high specificity and efficiency in target cell types.

Benefits of technology

The nucleic acid sequence enables robust and specific gene expression in GFAP-expressing cells, facilitating targeted gene delivery and function, particularly for therapeutic applications using halorhodopsin or channelrhodopsin, with measurable outputs via electrical or visual methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007712218000003
    Figure 0007712218000003
  • Figure 0007712218000004
    Figure 0007712218000004
  • Figure 0007712218000005
    Figure 0007712218000005
Patent Text Reader

Abstract

The present invention provides an isolated nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 1400 bp having at least 80% identity to said sequence of SEQ ID NO:1, which specifically confers expression in cells expressing the gene glial fibrillary acidic protein when operably linked to a nucleic acid sequence encoding said gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to nucleic acid sequences that specifically effect the expression of genes in cells that express glial fibrillary acidic protein.

Background Art

[0002] For expression purposes, recombinant genes are usually transfected into target cells, cell populations or tissues as cDNA constructs in the context of an active expression cassette that enables transcription of the heterologous gene. DNA constructs are recognized by the cellular transcription machinery in a process that involves the activity of many trans-acting transcription factors (TFs) in cis-regulatory elements such as enhancers, silencers, insulators and promoters (collectively referred to herein as "promoters").

[0003] Gene promoters are involved at all levels of their regulation and function as determinants in gene transcription by incorporating the effects of DNA sequence, transcription factor binding and epigenetic features. These determine, for example, the strength of transgene expression encoded by a plasmid vector and the one or more cell types in which the transgene is expressed.

[0004] The most common promoters used to drive heterologous gene expression in mammalian cells are the human and mouse cytomegalovirus (CMV) major immediate early promoters. These confer strong expression and have proven to be robust in several cell types. Other viral promoters such as the SV40 early promoter and the Rous sarcoma virus (RSV) long terminal repeat (LTR) promoter are also frequently used in expression cassettes.

[0005] Instead of a viral promoter, a cellular promoter can also be used. Among known promoters, there are those from housekeeping genes that encode cellular transcripts that are transcribed in large amounts, such as beta-actin, elongation factor 1-alpha (EF-1 alpha), or ubiquitin. Compared to viral promoters, eukaryotic gene expression is complex and requires the precise coordination of many different factors.

[0006] One aspect regarding the use of endogenous regulatory elements for transgene expression is the production of stable mRNA, and that expression can occur in the natural environment of the host cell where trans-acting transcription factors are provided accordingly. Since the expression of eukaryotic genes is controlled by a complex mechanism of cis- and trans-acting regulatory elements, most cellular promoters lack detailed functional characterization. Part of the eukaryotic promoter is usually located immediately upstream of the transcribed sequence and functions as the transcription start point. The core promoter directly surrounds the transcription start site (TSS) that is sufficient to be recognized by the transcription machinery. The proximal promoter includes the region upstream of the core promoter and contains the TSS and other sequence features required for transcriptional regulation. Transcription factors bind to regulatory motifs in the promoter and enhancer sequences and thereby act sequence-specifically by activating chromatin and histone modifying enzymes that change their positions to allow nucleosome structure and ultimately the initiation of transcription. The identification of functional promoters depends mainly on the presence of related upstream or downstream enhancer elements. Another important aspect regarding the use of endogenous regulatory elements for transgene expression is that some promoters can act in a cell-specific manner and result in the expression of the transgene in a defined type of cell or in a specific subset of cells depending on the promoter.

Summary of the Invention

Problems to be Solved by the Invention

[0007] Accordingly, there is a need for new sequences suitable for expressing recombinant genes at high expression levels in mammalian cells in a cell-type specific manner.

Means for Solving the Problems

[0008] The inventors have unexpectedly created a promoter that drives gene expression only in cells that express glial fibrillary acidic protein.

[0009] The nucleic acid sequence of the sequence of the present invention is as follows:

Chemical formula

[0010] Accordingly, the present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO: 1 or a nucleic acid sequence of at least 1400 bp having at least 70% identity with the nucleic acid sequence of SEQ ID NO: 1, wherein the isolated nucleic acid molecule specifically effects expression in a cell expressing glial fibrillary acidic protein of the gene operably linked to the nucleic acid sequence encoding the gene. In some embodiments, the nucleic acid sequence is at least 1400 bp and has at least 80% identity with the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least 1400 bp and has at least 85% identity with the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least 1400 bp and has at least 90% identity with the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least 1400 bp and has at least 95% identity with the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least 1400 bp and has at least 96% identity with the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least 1000 bp and has at least 97% identity with the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least 1400 bp and has at least 98% identity with the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least 1400 bp and has at least 99% identity with the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the nucleic acid sequence is at least 1400 bp and has 100% identity with the nucleic acid sequence of SEQ ID NO: 1. The identity is the identity of the sequences of the molecules over overlapping segments. The nucleic acid molecules of the invention having the above identity herein can have a length of at least 1400 bp, at least 1450 bp, at least 1500 bp, at least 1550 bp, at least 1600 bp, at least 1650 bp, at least 1700 bp, at least 1750 bp, at least 1800 bp, at least 1850 bp, at least 1900 bp, at least 1950 bp, at least 1980 bp, at least 1990 bp, at least 2000 bp.

[0011] The isolated nucleic acid molecule of the present invention may further include a minimal promoter, such as the SV40 minimal promoter, for example the SV40 minimal promoter or examples such as those used in ATCCTCACATGGTCCTGCTGGAGTTAGTAGAGGGTATATAATGGAAGCTCGACTTCCAGCTATCACATCCACTGTGTTGTTGTGAACTGGAATCCACTATAGGCCA (SEQ ID NO: 2).

[0012] Also provided is an isolated nucleic acid molecule comprising a sequence that hybridizes under stringent conditions to the isolated nucleic acid molecule of the present invention described above.

[0013] The present invention provides an expression cassette comprising the isolated nucleic acid of the present invention described above, wherein the promoter is operably linked to at least one nucleic acid sequence encoding a gene that is specifically expressed in cells expressing glial fibrillary acidic protein.

[0014] The present invention further provides a vector comprising the expression cassette of the present invention. In some embodiments, the vector is a viral vector.

[0015] The present invention also encompasses the use of the nucleic acid of the present invention, the expression cassette of the present invention, or the vector of the present invention for the expression of a gene in cells expressing glial fibrillary acidic protein.

[0016] The present invention provides a method for expressing a gene in a cell expressing glial fibrillary acidic protein, comprising the step of transfecting the expression cassette of the present invention into an isolated cell, cell line, or cell population (e.g., tissue), wherein the cell is a cell expressing glial fibrillary acidic protein or, if the cell comprises a cell expressing glial fibrillary acidic protein, the gene to be expressed is expressed by the isolated cell, cell line, or cell population. In some embodiments, the isolated cell, cell line, or cell population or tissue is human.

[0017] The present invention also provides isolated cells comprising the expression cassette of the present invention. In some embodiments, the expression cassette or vector is stably integrated into the genome of the cell.

[0018] Typical genes that can be operably linked to the promoter of the present invention are genes encoding halorhodopsin or channelrhodopsin. Therapeutic genes, i.e., genes encoding therapeutic proteins useful for the treatment of pathological conditions, can also be used.

[0019] Furthermore, the present invention provides a kit for expressing a gene in cells expressing glial fibrillary acidic protein, comprising the isolated nucleic acid molecule of the present invention.

Brief Description of the Drawings

[0020] [Figure 1] It is a figure showing a plasmid map of an AAV vector. [Figure 2] It is a figure showing a coronal section before immunohistochemical examination and an enlarged image of a section of a brain injected with the AAV construct from FIG. 1. [Figure 3] It is a figure showing an immunohistochemical examination showing co-labeling of GFP (derived from AAV) stained with a GFAP antibody.

Modes for Carrying Out the Invention

[0021] The inventors have unexpectedly created a promoter that drives gene expression only in cells expressing glial fibrillary acidic protein.

[0022] The nucleic acid sequence of the sequence of the present invention is as follows:

Chemical Formula

[0023] Accordingly, the present invention provides an isolated nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 1400 bp having at least 70% identity with the nucleic acid sequence of SEQ ID NO:1, which specifically effects the expression in cells expressing glial fibrillary acidic protein of the gene operably linked to the nucleic acid sequence encoding the gene. In some embodiments, the cells are in the cortex. In some embodiments, the cells are from a specific animal, for example, mouse cells. In some embodiments, the nucleic acid sequence is at least 1400 bp and has at least 80% identity with the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the nucleic acid sequence is at least 1400 bp and has at least 85% identity with the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the nucleic acid sequence is at least 1400 bp and has at least 90% identity with the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the nucleic acid sequence is at least 1400 bp and has at least 95% identity with the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the nucleic acid sequence is at least 1400 bp and has at least 96% identity with the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the nucleic acid sequence is at least 1000 bp and has at least 97% identity with the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the nucleic acid sequence is at least 1400 bp and has at least 98% identity with the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the nucleic acid sequence is at least 1400 bp and has at least 99% identity with the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the nucleic acid sequence is at least 1400 bp and has 100% identity with the nucleic acid sequence of SEQ ID NO:1. The identity is the identity of the sequences of the molecules over the overlapping segments.The nucleic acid molecules of the present invention having the above identity in this specification can have a length of at least 1400 bp, at least 1450 bp, at least 1500 bp, at least 1550 bp, at least 1600 bp, at least 1650 bp, at least 1700 bp, at least 1750 bp, at least 1800 bp, at least 1850 bp, at least 1900 bp, at least 1950 bp, at least 1980 bp, at least 1990 bp, at least 2000 bp.

[0024] The isolated nucleic acid molecule of the present invention may additionally contain a minimal promoter, such as the SV40 minimal promoter, such as the SV40 minimal promoter or the minimal promoter used in the examples, such as ATCCTCACATGGTCCTGCTGGAGTTAGTAGAGGGTATATAATGGAAGCTCGACTTCCAGCTATCACATCCACTGTGTTGTTGTGAACTGGAATCCACTATAGGCCA (SEQ ID NO: 2).

[0025] Also provided is an isolated nucleic acid molecule comprising a sequence that hybridizes under stringent conditions to the isolated nucleic acid molecule of the present invention described above.

[0026] The present invention also provides an expression cassette comprising the isolated nucleic acid of the present invention described above, wherein the promoter is operably linked to at least a nucleic acid sequence encoding a gene that is specifically expressed in cells expressing glial fibrillary acidic protein.

[0027] The present invention further provides a vector comprising the expression cassette of the present invention. In some embodiments, the vector is a viral vector.

[0028] The present invention also encompasses the use of the nucleic acid of the present invention, the expression cassette of the present invention or the vector of the present invention for the expression of a gene in cells expressing glial fibrillary acidic protein.

[0029] The present invention provides a method for expressing a gene in a cell that expresses glial fibrillary acidic protein, the method comprising the step of transfecting an isolated cell, cell line or cell population (e.g., tissue) with the expression cassette of the present invention, wherein the cell is a cell that expresses glial fibrillary acidic protein or, when the cell contains a cell that expresses glial fibrillary acidic protein, the gene to be expressed is expressed by the isolated cell, cell line or cell population. In some embodiments, the isolated cell, cell line or cell population or tissue is human.

[0030] The present invention also provides an isolated cell comprising the expression cassette of the present invention. In some embodiments, the expression cassette or vector is stably integrated into the genome of the cell.

[0031] Typical genes that can be operably linked to the promoter of the present invention are genes encoding halorhodopsin or channelrhodopsin. Therapeutic genes, i.e., genes encoding therapeutic proteins useful for the treatment of pathological conditions, can also be used.

[0032] Furthermore, the present invention provides a kit for expressing a gene in a cell that expresses glial fibrillary acidic protein, the kit comprising the isolated nucleic acid molecule of the present invention.

[0033] As used herein, the term "promoter" refers to any cis-regulatory element, such as an enhancer, silencer, insulator, and promoter. A promoter is a region of DNA that is generally located upstream (towards the 5' region) of a gene where transcription is required. A promoter enables proper activation or repression of the gene it controls. In the context of the present invention, a promoter results in specific expression in cells that express glial fibrillary acidic protein of a gene operably linked thereto. "Specific expression" of an exogenous gene, also referred to as "expression only in a certain type of cell", means that at least more than 75%, preferably more than 85%, more than 90% or more than 95% of the cells expressing the exogenous gene of interest are of a defined type, i.e., cells expressing glial fibrillary acidic protein in this case.

[0034] An expression cassette is typically introduced into a vector that facilitates entry of the expression cassette into a host cell and maintenance of the expression cassette in the host cell. Such vectors are commonly used and well known to those skilled in the art. A number of such vectors are commercially available, for example, from Invitrogen, Stratagene, Clontech, etc., and are described in a number of guides, such as Ausubel, Guthrie, Strathem, or Berger, etc. (all cited above). Such vectors typically include a promoter, a polyadenylation signal, etc., together with a multiple cloning site and additional elements, such as an origin of replication, a selectable marker gene (e.g., LEU2, URA3, TRP1, HIS3, GFP), a centromere sequence, etc.

[0035] Viral vectors, such as AAV, PRV, or lentivirus, are suitable for targeting and delivering genes to cells that express glial fibrillary acidic protein using the promoters of the present invention.

[0036] The output of the cells can be measured using electrical methods, such as multi-electrode arrays or patch-clamps, or visual methods, such as detection of fluorescence.

[0037] A method of using the nucleic acid sequence of the present invention, the method comprising contacting a cell expressing glial fibrillary acidic protein, which expresses one or more transgenes under the promoter of the present invention, with a test compound and comparing at least one output of the cell expressing glial fibrillary acidic protein obtained in the presence of the test compound with the same output obtained in the absence of the test compound, can be used to identify a therapeutic agent for the treatment of neuropathy or a disorder involving cells expressing glial fibrillary acidic protein.

[0038] Furthermore, a method of using the promoter of the present invention, the method comprising contacting a cell expressing glial fibrillary acidic protein, which expresses one or more transgenes under the control of the promoter of the present invention, with a drug and comparing at least one output obtained after contact with the drug with the same output obtained before said contact with the drug, can also be used for in vitro testing of vision restoration.

[0039] Channelrhodopsin is a subfamily of opsin proteins that function as light-gated ion channels. These function as sensory photoreceptors in unicellular green algae, controlling phototaxis, i.e., movement in response to light. When expressed in the cells of other organisms, they enable the use of light to control intracellular acidity, calcium influx, electrical excitability, and other cellular processes. At least three of the following "natural" channelrhodopsins are currently known: Channelrhodopsin-1 (ChR1), Channelrhodopsin-2 (ChR2), and Volvox Channelrhodopsin (VChR1). Furthermore, there are also some modified / improved versions of these proteins. All known channelrhodopsins are non-specific cation channels that conduct H+, Na+, K+, and Ca2+ ions.

[0040] Halorhodopsin is a light-driven ion pump specific for chloride ions and is found in phylogenetically ancient "bacteria" (archaea) known as halophilic bacteria. It is a seven-transmembrane protein of the rhodopsin family, homologous to the light-driven proton pump bacteriorhodopsin, and similar in tertiary structure (but not in primary sequence structure) to vertebrate rhodopsin, a pigment that senses light in the retina. Halorhodopsin also shares sequence similarity with channelrhodopsin, a light-driven ion channel. Halorhodopsin contains the essential photo-isomerizable vitamin A derivative all-trans retinal. Halorhodopsin is one of the few membrane proteins with a known crystal structure. Halorhodopsin isoforms can be found in multiple species of halophilic bacteria, for example, H. salinarum and N. pharaonis. Very ongoing research is exploring these differences and using them to separately analyze the photoperiod and pump characteristics. After bacteriorhodopsin, halorhodopsin may be the best-studied type I (microbial) opsin. The peak absorbance of the halorhodopsin-retinal complex is approximately 570 nm. In recent years, halorhodopsin has become a tool in optogenetics. Just as channelrhodopsin-2, a blue-light-activated ion channel, unlocks the ability to activate excitable cells (e.g., neurons, muscle cells, pancreatic cells, and immune cells) with short pulses of blue light, halorhodopsin unlocks the ability to silence excitable cells with short pulses of yellow light. Thus, halorhodopsin and channelrhodopsin together enable multicolor optical activation, silencing, and desynchronization of neural activity, creating a powerful neuroengineering toolbox.

[0041] In some embodiments, the promoter is part of a vector targeted to the cerebral cortex that expresses at least one reporter gene detectable in cells that express the glial fibrillary acidic protein for survival.

[0042] Viral vectors suitable for the present invention are well known in the art. For example, AAV, PRV or lentivirus are suitable for targeting and delivering genes to cells that express glial fibrillary acidic protein.

[0043] The output of the transfected cells can be measured using well-known methods, for example, electrical methods such as using a multi-electrode array or patch clamp or visual methods such as using fluorescence detection. In some cases, the inner limiting membrane is removed by microsurgery of the inner limiting membrane. In other cases, the recording is achieved through slices made in the inner limiting membrane.

[0044] As used herein, the term "animal" is used herein to include all animals. In some embodiments of the present invention, the non-human animal is a vertebrate. Examples of animals are humans, mice, rats, cows, pigs, horses, chickens, ducks, geese, cats, dogs, etc. The term "animal" also includes individual animals at all stages of development, including the embryonic and fetal stages. A "genetically modified animal" is any animal that has been directly or indirectly altered or contains one or more cells carrying the introduced genetic information by means of intentional genetic manipulation at the cellular level, such as targeted recombination, microinjection or infection with a recombinant virus. The term "genetically modified animal" does not include classical crossing or in vitro fertilization, but rather means an animal in which one or more cells have been altered or have received a recombinant DNA molecule. This recombinant DNA molecule can be specifically targeted to a defined locus, randomly integrated into the chromosome, or it can be extrachromosomal replicating DNA. The term "germline genetically modified animal" refers to a genetically modified animal in which the genetic change or genetic information has been introduced into the germline cells, thereby conferring the ability to transmit the genetic information to its offspring. If such offspring actually possess some or all of the change or genetic information, they are likewise genetically modified animals.

[0045] The altered or introduced genetic information can be foreign to the species of animal to which the recipient belongs or only foreign to a particular individual recipient, or it can be genetic information already possessed by the recipient. In the last case, the altered or introduced gene may be expressed differently from the natural gene or not expressed at all.

[0046] The genes used to alter the target gene can be obtained by a wide range of techniques, including, but not limited to, isolation from genomic resources, preparation of cDNA from isolated mRNA templates, direct synthesis, or combinations thereof.

[0047] The type of target cells for transgene introduction is ES cells. ES cells can be obtained from preimplantation embryos cultured in vitro and can fuse with embryos (Evans et al. (1981), Nature 292:154-156; Bradley et al. (1984), Nature 309:255-258; Gossler et al. (1986), Proc. Natl. Acad. Sci. USA 83:9065-9069; Robertson et al. (1986), Nature 322:445-448; Wood et al. (1993), Proc. Natl. Acad. Sci. USA 90:4582-4584). The transgene can be efficiently introduced into ES cells by DNA transfection or retrovirus-mediated transduction using standard techniques such as electroporation. The resulting transformed ES cells can then be combined with morulae by aggregation or injected into blastocysts from non-human animals. Subsequently, the introduced ES cells colonize the embryo and contribute to the germ cell line of the resulting chimeric animal (Jaenisch (1988), Science 240:1468-1474). The use of gene-targeted ES cells in the generation of gene-targeted genetically modified mice was described in 1987 (Thomas et al. (1987), Cell 51:503-512) and has been reviewed elsewhere (Frohman et al. (1989), Cell 56:145-147; Capecchi (1989), Trends in Genet. 5:70-76; Baribault et al. (1989), Mol. Biol. Med. 6:481-492; Wagner (1990), EMBO J. 9:3025-3032; Bradley et al. (1992), Bio / Technology 10:534-539).

[0048] Techniques are available that use targeted homologous recombination to insert specific changes into chromosomal alleles to inactivate any gene region or alter it to any desired mutation.

[0049] As used herein, "targeted gene" is a DNA sequence that is introduced into the germ line of a non-human animal by human intervention, including, but not limited to, the methods described herein. Targeted genes of the invention include DNA sequences designed to specifically alter cognate endogenous alleles.

[0050] In the present invention, "isolated" refers to a material that has been removed from its original environment (e.g., the natural environment if it occurs naturally), and thus has been "artificially" altered from its natural state. For example, an isolated polynucleotide can be part of a vector or composition of matter or can be contained within a cell and still be "isolated" because the vector, composition of matter, or particular cell is not the original environment of the polynucleotide. The term "isolated" does not refer to genomic libraries, cDNA libraries, total cellular RNA preparations, mRNA preparations, genomic DNA preparations (including those separated by electrophoresis and transferred onto a blot), sheared total cellular genomic DNA preparations, or other compositions in which the art has not demonstrated the distinguishing characteristics of the polynucleotide / sequence of the present invention. Further examples of isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or (partially or substantially) purified DNA molecules in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention. However, nucleic acids contained within clones that are members of a library (e.g., genomic or cDNA library) that have not been isolated from other members of the library (e.g., in the form of a homogeneous solution containing that clone and other members of the library), or within chromosomes removed from cells or cell lysates (e.g., "chromosome spreads" such as in a karyotype), or within preparations of randomly sheared genomic DNA or genomic DNA digested with one or more restriction enzymes are not "isolated" in the present invention. As further discussed herein, isolated nucleic acid molecules according to the present invention can be produced naturally, recombinantly, or synthetically.

[0051] "Polynucleotide" can be composed of single-stranded DNA and double-stranded DNA, DNA that is a mixture of single-stranded and double-stranded regions, single-stranded RNA and double-stranded RNA, and RNA that is a mixture of single-stranded and double-stranded regions, and hybrid molecules that can be single-stranded, or more typically double-stranded, or a mixture of single-stranded and double-stranded regions and contain DNA and RNA. Furthermore, a polynucleotide can be composed of triple-stranded regions containing RNA or DNA or both RNA and DNA. A polynucleotide can also contain one or more modified bases or a DNA or RNA backbone that has been modified for stability or for other reasons. Examples of "modified" bases include, for example, tritylated bases and unusual bases such as inosine. Various modifications can be made to DNA and RNA; thus, "polynucleotide" encompasses chemically, enzymatically, or metabolically modified forms.

[0052] The expression "a polynucleotide encoding a polypeptide" encompasses polynucleotides that contain only the coding sequence for that polypeptide as well as polynucleotides that contain additional coding and / or non-coding sequences.

[0053] "Stringent hybridization conditions" refers to overnight incubation at 42°C in a solution containing 50% formamide, 5×SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5×Denhardt's solution, 10% dextran sulfate, and 20 μg / ml denatured, sheared salmon sperm DNA, followed by washing of the filter in 0.1×SSC at approximately 50°C. Changes in the stringency of hybridization and signal detection are primarily achieved through manipulation of the formamide concentration (lower percentages of formamide result in lowered stringency); salt conditions, or temperature. For example, moderately high stringency conditions include overnight incubation at 37°C in a solution containing 6×SSPE (20×SSPE = 3 M NaCl; 0.2 M NaH2PO4; 0.02 M EDTA, pH 7.4), 0.5% SDS, 30% formamide, 100 μg / ml salmon sperm blocking DNA, followed by washing in 1×SSPE, 0.1% SDS at 50°C. In addition, to achieve even lower stringency, the washes performed after stringent hybridization can be done at a higher salt concentration (e.g., 5×SSC). Variations in the above conditions can be achieved through the inclusion and / or substitution of alternative blocking reagents used to suppress background in hybridization experiments. Typical blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations. Inclusion of a defined blocking reagent may require modification of the above hybridization conditions due to compatibility issues.

[0054] The terms "fragment", "derivative", and "analog" when referring to a polypeptide mean a polypeptide that retains either substantially the same biological function or activity as such polypeptide. An analog includes a proprotein that can be activated by cleavage of the proprotein moiety to produce an active mature polypeptide.

[0055] The term "gene" means a segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region "leader and trailer" as well as intervening sequences (introns) between individual coding segments (exons).

[0056] A polypeptide can be composed of amino acids linked to each other by peptide bonds or amino acids linked to each other by modified peptide bonds, i.e., peptide isosteres, and can contain amino acids other than the 20 genetically encoded amino acids. A polypeptide can be modified by either natural processes such as post-translational processing or chemical modification techniques well known in the art. Such modifications are well described in basic textbooks and more detailed monographs as well as numerous research papers. Modifications can occur at any location in the polypeptide, which locations include the peptide backbone, amino acid side chains, and amino or carboxyl termini. It is recognized that the same type of modification can be present in the same or varying degrees at several sites in a given polypeptide. Furthermore, a given polypeptide can contain many types of modifications. Polypeptides can, for example, be branched as a result of ubiquitination, and they can be cyclic, with or without branches. Cyclic, branched, and branched cyclic polypeptides can result from natural post-translational processes or can be produced by synthetic methods.Modifications include, but are not limited to, acetylation, acylation, biotinylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of heme moiety, covalent attachment of nucleotide or nucleotide derivative, covalent attachment of lipid or lipid derivative, covalent attachment of phosphatidylinositol, cross-linking, cyclization, derivatization with known protecting / blocking groups, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, conjugation to antibody molecules or other cell ligands, methylation, myristoylation, oxidation, pegylation, proteolytic processing (e.g., cleavage), phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer RNA-mediated addition of amino acids to proteins, e.g., arginylation and ubiquitination (see, e.g., PROTEINS-STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T.E. Creighton, W.H. Freeman and Company, New York (1993); POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B.C. Johnson, Ed., Academic Press, New York, pgs. I-12 (1983); Seifter et al., Meth Enzymol 182:626-646 (1990); Rattan et al., Ann NY Acad Sci 663:48-62 (1992)).

[0057] A "biologically active" polypeptide fragment refers to a polypeptide that exhibits an activity, which may or may not be dose-dependent, measured in a specific biological assay and that is similar to, but not necessarily identical to, the activity of the original polypeptide, e.g., the activity of the mature form. When dose-dependence exists, it need not be identical to that of the polypeptide, but rather is substantially similar in dose-dependence for a given activity compared to the original polypeptide (i.e., the candidate polypeptide exhibits high activity or activity that is at least about 25-fold less, in some embodiments at least about 10-fold less or at least about 3-fold less than that of the original polypeptide).

[0058] Species homologs can be isolated and identified by generating suitable probes or primers from the sequences provided herein and screening suitable nucleic acid resources for the desired homologs.

[0059] A "variant" refers to a polynucleotide or polypeptide that differs from the original polynucleotide or polypeptide but retains its essential properties. Generally, a variant is overall closely similar to, and in many regions identical to, the original polynucleotide or polypeptide.

[0060] As a practical matter, whether any given nucleic acid molecule or polypeptide is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleotide sequences of the present invention can customarily be determined using well-known computer programs. A preferred method for determining the best overall match between a query sequence (the sequence of the present invention) and a target sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. (1990) 6: 237-245). In sequence alignment, both the query sequence and the target sequence are DNA sequences. RNA sequences can be compared by converting U to T. The result of the global sequence alignment is in terms of percent identity. The preferred parameters used for FASTDB alignment of DNA sequences to calculate percent identity are as follows: matrix = unitary, k-tuple = 4, mismatch penalty = -1, join penalty = -30, randomization group length = 0, cutoff score = 1, gap penalty = -5, gap size penalty = 0.05, window size = 500 or the shorter of the lengths of the target nucleotide sequence. If the target sequence is shorter than the query sequence due to a 5' or 3' deletion rather than an internal deletion, the result must be corrected manually. This is because the FASTDB program does not take into account 5' and 3' truncations of the target sequence when calculating percent identity. For a target sequence truncated at the 5' or 3' end relative to the query sequence, the percent identity is corrected as the percent of all bases of the query sequence by calculating the number of bases of the query sequence at the 5' and 3' of the non-matching / unaligned target sequence. Whether a nucleotide is matched / aligned is determined by the result of the FASTDB sequence alignment. This ratio is then subtracted from the percent identity calculated by the above FASTDB program using the specified parameters to reach the final percent identity score.This corrected score is the one used for the present invention. Only the bases outside the 5' and 3' bases of the target sequence displayed by the FASTDB alignment that are not matched / aligned with the query sequence are calculated for the purpose of manually adjusting the percent identity score. For example, a 90-base target sequence is aligned with a 100-base query sequence to determine percent identity. A deletion occurs at the 5' end of the target sequence, and thus the FASTDB alignment does not show a match / alignment for the first 10 bases at the 5' end. These 10 damaged bases correspond to 10% of the sequence (the number of bases at the unmatched 5' and 3' ends / the total number of bases in the query sequence), and thus 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 bases are completely matched, the final percent identity is 90%. In another example, a 90-base target sequence is compared to a 100-base query sequence. In this case, since the deletion is an internal deletion, there are no bases at either the 5' or 3' of the target sequence that are not matched / aligned with the query. In this case, the percent identity calculated by FASTDB is not manually corrected. Again, only the 5' and 3' bases of the target sequence that are not matched / aligned with the query sequence are manually corrected.

[0061] The amino acid sequence of the target polypeptide is intended to be identical to the query sequence, except that the target polypeptide sequence can contain up to 5 amino acid changes per 100 amino acids of the query sequence, by a polypeptide having an amino acid sequence that is at least, for example, 95% "identical" to the query amino acid sequence of the present invention. In other words, up to 5% of the amino acid residues in the target sequence can be inserted, deleted, or substituted with another amino acid in order to obtain a polypeptide having an amino acid sequence that is at least 95% identical to the query amino acid sequence. These changes to the reference sequence can occur individually or as one or more continuous groups within the reference sequence, anywhere between the amino or carboxy terminal positions of the reference amino acid sequence or between those terminal positions.

[0062] As a practical matter, whether any given polypeptide is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, 99% or 100% identical to, for example, the amino acid sequence shown in the sequence or the amino acid sequence encoded by a deposited DNA clone, is customarily determined using well-known computer programs. A preferred method for determining the best overall match between a query sequence (the sequence of the present invention) and a target sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. (1990) 6:237-245). In a sequence alignment, both the query sequence and the target sequence can be either nucleotide sequences or amino acid sequences. The result of the global sequence alignment is in terms of percent identity. Preferred parameters used for FASTDB amino acid alignment are as follows: matrix = PAM0, k-tuple = 2, mismatch penalty = -1, join penalty = 20, randomization group length = 0, cutoff score = 1, window size = sequence length, gap penalty = -5, gap size penalty = -0.05, window size = the shorter of 500 or the length of the target amino acid sequence. If the target sequence is shorter than the query sequence due to N- or C-terminal deletions rather than internal deletions, the result must be corrected manually. This is because the FASTDB program does not take into account N- and C-terminal truncations of the target sequence when calculating global percent identity. For a target sequence truncated at the N- and C-termini relative to the query sequence, the percent identity is corrected by calculating the number of residues of the query sequence at the N- and C-termini of the target sequence that do not match / align with the corresponding target residues as a percentage of the total bases of the query sequence. Whether a residue is matched / aligned is determined by the result of the FASTDB sequence alignment. This ratio is then subtracted from the percent identity calculated by the above FASTDB program using the defined parameters to reach the final percent identity score.This final percent identity score is the one used for the present invention. Only the residues at the N and C termini of the target sequence that are not matched / aligned with the query sequence are considered for the purpose of manually adjusting the percent identity score. It is only the query residue positions outside the outermost N and C terminal residues of the target sequence. Only the residue positions outside the N and C termini of the target sequence displayed in the FASTDB alignment that are not matched / aligned with the query sequence are corrected manually. No other manual corrections should be made for the present invention.

[0063] Naturally occurring protein variants are called "allelic variants" and refer to one of several alternative forms of a gene that occupies a given locus on an organism's chromosome (Genes 11, Lewin, B., ed., John Wiley & Sons, New York (1985)). These allelic variants can vary at either the polynucleotide level and / or the polypeptide level. Alternatively, non-naturally occurring variants can be produced by mutagenesis techniques or by direct synthesis.

[0064] A "label" refers to an agent that can provide a detectable signal, either directly or through interaction with one or more additional members of a signal production system. Labels that are directly detectable and can be used in the present invention include fluorescent labels. Specific fluorophores include fluorescein, rhodamine, BODIPY, cyanine dyes, and the like.

[0065] A "fluorescent label" refers to any label that has the ability to emit light of one wavelength when activated by light of another wavelength.

[0066] "Fluorescence" refers to any detectable feature of a fluorescent signal, including intensity, spectrum, wavelength, intracellular distribution, and the like.

[0067] "Detecting" fluorescence refers to evaluating the fluorescence of cells using qualitative or quantitative methods. In some embodiments of the present invention, fluorescence is detected in a qualitative manner. In other words, it is whether a fluorescence marker indicating whether a recombinant fusion protein is expressed is present or not. As another example, fluorescence can be measured using, for example, quantitative means such as measuring fluorescence intensity, spectrum or intracellular distribution, enabling statistical comparison of values obtained under different conditions. The level can also be measured using qualitative methods, for example, visual analysis and comparison by a human of samples detected using a plurality of samples, such as a fluorescence microscope or other optical detectors (e.g., an image analysis system, etc.). "Alteration" or "modulation" in fluorescence refers to any detectable difference in the intensity, intracellular distribution, spectrum, wavelength or other aspects of fluorescence under a particular condition compared to another condition. For example, the "alteration" or "modulation" is detected quantitatively and the difference is a statistically significant difference. Any "alteration" or "modulation" in fluorescence can be detected using standard equipment, such as a fluorescence microscope, a CCD or any other fluorescence detector, can be detected using an automated system, such as an integrated system, or can reflect subjective detection of the alteration by a human observer.

[0068] The "green fluorescent protein" (GFP) is a protein composed of 238 amino acids (26.9 kDa), first isolated from Aequorea victoria / Aequorea aequorea / Aequorea forskalea of jellyfish, which emits green fluorescence when exposed to blue light. GFP from A. victoria has a major excitation peak at a wavelength of 395 nm and a minor peak at 475 nm. This emission peak is at 509 nm, which is in the lower green part of the visible spectrum. GFP from Renilla reniformis has a single major excitation peak at 498 nm. Due to the potential of a wide range of usage methods and the developmental demands of researchers, many different mutants of GFP have been genetically engineered. The first major improvement was the single-point mutation (S65T) reported by Roger Tsien in Nature in 1995. This mutation significantly improved the spectral characteristics of GFP, resulting in increased fluorescence, photostability, and a shift of the major excitation peak to 488 nm while maintaining the peak emission at 509 nm. The addition of the 37 °C folding efficiency (F64L) point mutant to this scaffold gave rise to enhanced GFP (EGFP). EGFP is also known as the optical cross-sectional area of 9.13×10-21 m 2 / molecule and has an extinction coefficient (denoted as ε), which is also cited as 55,000 L / (mol·cm). Superfolder GFP, a series of mutations that enable GFP to fold and mature rapidly even when fused to an insufficiently folded peptide, was reported in 2006.

[0069] The "yellow fluorescent protein" (YFP) is a gene mutant of the green fluorescent protein derived from Aequorea victoria. This excitation peak is at 514 nm, and its emission peak is at 527 nm.

[0070] As used herein, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise.

[0071] A "virus" is a submicroscopic infectious agent that cannot grow or reproduce outside a host cell. Each virus particle, or virion, consists of genetic material, DNA or RNA, within a protective protein coat called a capsid. Capsid shapes vary from simple helices and icosahedral (polyhedral or almost spherical) forms to more complex structures with tails or envelopes. Viruses infect cellular life forms and are classified as animal, plant, and bacterial types depending on the type of host they infect.

[0072] As used herein, the term "transsynaptic virus" refers to a virus that can move from one neuron to another intervening neuron across a synapse. Examples of such transsynaptic viruses are rhabdoviruses, such as rabies virus, and alphaherpesviruses, such as pseudorabies virus or herpes simplex virus. As used herein, the term "transsynaptic virus" also encompasses virus subunits and biological vectors that have the ability themselves to move from one neuron to another intervening neuron across a synapse, such as modified viruses that incorporate such subunits and demonstrate the ability to move from one neuron to another intervening neuron across a synapse.

[0073] Transsynaptic movement can be either anterograde or retrograde. During retrograde movement, the virus moves from the postsynaptic neuron to the presynaptic neuron. Thus, during anterograde movement, the virus moves from the presynaptic neuron to the postsynaptic neuron.

[0074] Homologs refer to proteins that share a common ancestor. Analogs have some (more functional rather than structural) similarities that cause them to be included in one class although they do not share a common ancestor (for example, trypsin-like serine proteases and subtilisins are clearly not related and their structures outside the active site are completely different, but they have virtually geometrically identical active sites and are thus considered an example of convergent evolution to analogs).

[0075] There are two subclasses of homologs, orthologs and paralogs. Orthologs are the same gene in different species (for example, cytochrome "c"). Two genes in the same organism cannot be orthologs. Paralogs are the result of gene duplication (for example, hemoglobin beta and delta). If two genes / proteins are homologous and present within the same organism, they are paralogs.

[0076] "GFAP", which is glial fibrillary acidic protein, is an intermediate filament (IF) protein expressed by a large number of cell types in the central nervous system (CNS), including developing astrocytes and ependymal cells. GFAP has further been found to be expressed in glomeruli collected from rat kidneys and peritumoral fibroblasts, Leydig cells in the testes of both hamsters and humans, human keratinocytes, human osteocytes and chondrocytes, and stellate cells in the pancreas and liver in rats. GFAP is a type III IF protein mapped to 17q21 in humans. GFAP is closely related to vimentin, desmin and peripherin, which are non-epithelial family members that all are involved in the structure and function of the cell's cytoskeleton. GFAP is thought to help maintain the mechanical strength of astrocytes and the shape of cells and is often used as a cell marker. GFAP is involved in a number of important CNS processes, including intercellular communication and function of the blood-brain barrier. GFAP has been demonstrated to play an important role in mitosis by regulating the filament network present within the cell. During mitosis, the amount of phosphorylated GFAP and the movement of this denatured protein to the cleavage furrow increase. Studies have demonstrated that GFAP knockout mice experience multiple degenerative processes, including abnormal myelination of the blood-brain barrier, white matter structure degradation and functional / structural impairment. These data suggest that GFAP is required for a number of extremely important roles in the CNS. GFAP has been proposed to play a role in astrocyte-neuron interactions and intercellular communication. GFAP has further been demonstrated to be important in the repair after CNS injury. More specifically, it is also important in its role in the formation of glial scars in numerous locations throughout the entire CNS, including the eye and the brain.

[0077] CN inflammatory diseases associated with anti-GFAP antibodies have been described, where patients with GFAP astrocytosis have developed meningoencephalomyelitis with inflammation of the meninges, cerebral parenchyma and spinal cord.

[0078] There are multiple disorders associated with inappropriate GFAP regulation, and injury can induce glial cells to react in a harmful way. Gliosis is the result of several neurodegenerative conditions as well as injury that severs nerve substances. The scar is formed by astrocytes that interact with fibrous tissue to re-establish the glial cell boundary around the center of central nervous injury, and is in part induced by up-regulation of GFAP.

[0079] Another condition directly related to GFAP is Alexander disease, a rare genetic disorder. Its symptoms include mental and physical retardation, dementia, brain and head enlargement, spasticity (rigidity of the arms and legs) and seizures. Some GFAP mutations have been proposed to be detrimental to cytoskeleton formation and increased caspase 3 activity that would lead to increased apoptosis of cells carrying these mutations. Thus, GFAP plays an important role in the onset of Alexander disease.

[0080] The expression of some GFAP isoforms has been reported to decrease in response to acute infection or neurodegeneration. Furthermore, a reduction in GFAP expression has also been reported in Wernicke encephalopathy. Gp120, an HIV-1 viral envelope glycoprotein, can directly inhibit the phosphorylation of GFAP, and GFAP levels can be reduced in response to chronic infections by HIV-1, varicella-zoster herpes and pseudorabies. A reduction in GFAP expression has been reported in Down syndrome, schizophrenia, bipolar disorder and depression.

[0081] As used herein, the term "disorder" refers to discomfort, disease, illness, clinical condition or pathological state.

[0082] As used herein, the term "pharmaceutically acceptable carrier" refers to a carrier medium that does not interfere with the biological activity effectiveness of the active ingredient, is chemically inert and is not toxic to the patient to whom it is administered.

[0083] As used herein, the term "pharmaceutically acceptable derivative" refers to any homolog, analog or fragment of an agent that is relatively non-toxic to a subject, such as an agent identified using the screening methods of the present invention.

[0084] The term "therapeutic agent" refers to any molecule, compound or therapeutic that aids in the prevention or treatment of a disorder or a complication of a disorder.

[0085] Compositions containing such agents formulated in a compatible pharmaceutical carrier can be prepared, packaged and labeled for treatment.

[0086] If the complex is water-soluble, it can be formulated in a suitable buffer, such as phosphate-buffered saline or other physiologically compatible solutions.

[0087] Alternatively, if the resulting complex has insufficient solubility in an aqueous solvent, it can be formulated with a nonionic surfactant, such as Tween or polyethylene glycol. Thus, the compound and its physiologically acceptable solvates can be formulated for administration by inhalation or insufflation (either via the oral or nasal cavity) or for oral, buccal, parenteral, rectal administration, or, in the case of tumors, can be directly injected into a solid tumor.

[0088] For oral administration, the pharmaceutical preparation can be in liquid form, such as a solution, syrup or suspension, or can be provided as a drug product for reconstitution with water or other suitable vehicle before use. Such liquid preparations can be prepared by conventional means using pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia gum); non-aqueous vehicles (e.g., almond oil, oily esters or fractionated vegetable oils); and preservatives (e.g., methyl or propyl p-hydroxybenzoates or sorbic acid). The pharmaceutical composition can be prepared by conventional means using pharmaceutically acceptable excipients such as binders (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropylmethylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulfate), and can take the form of, for example, tablets or capsules. Tablets can be coated by methods well known in the art.

[0089] Formulations for oral administration can be suitably formulated to provide for a sustained release of the active compound.

[0090] The compound can be formulated for parenteral administration by injection, for example bolus injection or continuous infusion. Injectable formulations can be provided in unit dosage form, for example in ampoules or in multi-dose containers, together with a preservative added.

[0091] The composition can take the form of, for example, a suspension, solution or emulsion in an oily or aqueous vehicle and can contain formulating agents such as suspending, stabilizing and / or dispersing agents. Alternatively, the active ingredient can be in powder form for constitution with a suitable vehicle, for example sterile pyrogen-free water, before use.

[0092] The compound can also be formulated, for example, for topical application, such as in the form of a cream or lotion.

[0093] In addition to the above formulations, the compound can also be formulated as a depot formulation. Such long-acting formulations can be administered by implantation (e.g., intravitreally, subcutaneously or intramuscularly) or by intravitreal injection.

[0094] Thus, for example, the compound can be formulated with a suitable polymer or hydrophobic material (e.g., as an emulsion in an acceptable oil), or with an ion exchange resin, or as a poorly soluble derivative, such as a poorly soluble salt. Liposomes and emulsions are well-known examples of delivery vehicles or carriers for hydrophilic drugs.

[0095] The composition can, if desired, be provided in a pack or dispenser device containing one or more unit dosage forms containing the active ingredient. The pack can, for example, comprise a metal or plastic foil, such as a blister pack. Instructions for administration can be attached to the pack or dispenser device.

[0096] The invention also provides a kit for carrying out the treatment regimen of the invention. Such a kit contains, in one or more containers, a therapeutically or prophylactically effective amount of the composition in a pharmaceutically acceptable form.

[0097] The composition in the vial of the kit can be in the form of a pharmaceutically acceptable solution, for example, in combination with sterile physiological saline, a dextrose solution or a buffered solution or other pharmaceutically acceptable sterile fluid. Alternatively, the complex can be lyophilized or dried; in which case the kit optionally further comprises a preferably sterile pharmaceutically acceptable solution (e.g., physiological saline, dextrose solution, etc.) for reconstituting the complex in the container to form a solution for injection purposes.

[0098] In another embodiment, the kit further includes a needle or syringe, preferably packaged in a sterile form, and / or a packaged alcohol pad for injecting the complex. Instructions for administration of the composition by a clinician or patient may optionally be included.

[0099] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, but the preferred methods and materials are described below. In case of conflict, the present specification, including definitions, will control. Further, the materials, methods, and examples are illustrative only and not intended to be limiting.

Examples

[0100] Production of AAV The inventors generated an AAV vector comprising the promoter of SEQ ID NO: 1 followed by the sequence of GFP later. This was generated into AAV (serotype AAV2 / 1) using a standard protocol. A titer of 2.08×10 12 was generated and used for injection.

[0101] Virus injection; Mice were anesthetized with a mixture of fentanyl (0.05 mg / kg), medetomidine (0.5 mg / kg), and midazolam (5 mg / kg), and the virus was injected at a depth of 500 microns (3 - 4 injections per mouse, approximately 100 - 150 nL per injection). After anesthesia, the mice were returned to their home cages. Tissues were collected and fixed overnight in 4% PFA.

[0102] Immunohistochemistry; PFA-fixed tissues were made into 75-micron sections by a vibratome (Figure 2). The sections were incubated in a block (PBS containing 10% normal goat serum (NGS) and 0.1% Triton X) at room temperature for 2 hours. This was followed by 5 consecutive washes with PBS for 10 minutes each, and then incubation with the primary antibody GFAP (MAB360 - Merck) (1:500 (in PBS, 0.1% Triton X, 1% NGS)) on a shaker at 4°C for 4 days. The sections were washed again 5 times and incubated overnight with the secondary antibody anti-mouse 568 on a shaker at 4°C. After an additional 5 washes, the sections were mounted on slides with a mounting agent and visualized by confocal microscopy. The inventions described in the original claims of the present application are listed below. [Invention 1] An isolated nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID NO: 1, or at least 1400 bp of a nucleic acid sequence having at least 80% identity with the said sequence of SEQ ID NO: 1, which brings about specific expression of an exogenous gene in cells expressing glial fibrillary acidic protein when the nucleic acid sequence encoding the exogenous gene is operably linked to the said isolated nucleic acid molecule. [Invention 2] The isolated nucleic acid molecule according to Invention 1, further comprising a minimal promoter, for example the minimal promoter of SEQ ID NO: 2. [Invention 3] An isolated nucleic acid molecule comprising a sequence that hybridizes under stringent conditions with the isolated nucleic acid molecule according to Invention 1 or 2. [Invention 4] An expression cassette comprising the isolated nucleic acid according to Invention 1 or 2 as an element for promoting gene expression in a defined cell, wherein the isolated nucleic acid is operably linked to at least a nucleic acid sequence encoding a gene that is specifically expressed in cells expressing glial fibrillary acidic protein. [Invention 5] A vector comprising the expression cassette according to Invention 4. [Invention 6] The vector according to Invention 5, which is a viral vector. [Invention 7] Use of the nucleic acid according to Invention 1 or 2, the expression cassette according to Invention 4 or the vector according to Invention 5 for the expression of a gene in cells expressing glial fibrillary acidic protein. [Invention 8] A method for expressing a gene in cells expressing glial fibrillary acidic protein, comprising the step of transfecting an isolated cell, cell line or cell population with the expression cassette according to Invention 4, wherein the said cells are cells expressing glial fibrillary acidic protein, or when the said cells comprise cells expressing glial fibrillary acidic protein, the said gene to be expressed is specifically expressed by the said isolated cell, the said cell line or the said cell population. [Invention 9] An isolated cell comprising the expression cassette according to Invention 4 or the vector according to Invention 5. [Invention 10] The cell according to Invention 9, wherein the said expression cassette or vector is stably integrated into the genome of the said cell. [Invention 11] The product of the gene is a photosensitive molecule, such as halorhodopsin or channelrhodopsin, the isolated nucleic acid molecule according to Invention 1 or 2, the expression cassette according to Invention 4, the vector according to Invention 5, the use according to Invention 7, the method according to Invention 8, or the cell according to Invention 9. [Invention 12] A kit for expressing a gene in a cell expressing glial fibrillary acidic protein, comprising the isolated nucleic acid molecule according to Invention 1 or 2.

Claims

**Claim 1** An isolated nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID NO: 1, or comprising or consisting of a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 1, which results in specific expression of an exogenous gene in cells expressing glial fibrillary acidic protein when the nucleic acid sequence encoding the exogenous gene is operably linked to the isolated nucleic acid molecule. **Claim 2** The isolated nucleic acid molecule according to claim 1, further comprising the minimal promoter of SEQ ID NO:

2. **Claim 3** The isolated nucleic acid molecule according to claim 1 or 2, wherein the product of the gene is a light-sensitive molecule, such as halorhodopsin or channelrhodopsin. **Claim 4** An expression cassette comprising the isolated nucleic acid molecule according to any one of claims 1 to 3 as an element for promoting gene expression in a specified cell, wherein the isolated nucleic acid molecule is operably linked to at least a nucleic acid sequence encoding a gene that is specifically expressed in cells expressing glial fibrillary acidic protein. **Claim 5** A vector comprising the expression cassette according to claim 4. **Claim 6** The vector according to claim 5, which is a viral vector. **Claim 7** A composition for use in a method of expressing a gene in cells expressing glial fibrillary acidic protein, the composition comprising the isolated nucleic acid molecule according to any one of claims 1 to 3, the expression cassette according to claim 4, or the vector according to claim 5. **Claim 8** A composition for use in a method of expressing a gene in cells expressing glial fibrillary acidic protein, wherein the composition comprises the expression cassette according to claim 4, the method comprises the step of transfecting an isolated cell, cell line or cell population with the expression cassette according to claim 4, and when the cell is a cell expressing glial fibrillary acidic protein or the cell comprises a cell expressing glial fibrillary acidic protein, the gene to be expressed is specifically expressed by the isolated cell, the cell line or the cell population. the composition. **Claim 9** An isolated cell comprising the expression cassette according to claim 4 or the vector according to claim 5. **Claim 10** The cell according to claim 9, wherein the expression cassette or vector is stably integrated into the genome of the cell. **Claim 11** A kit for expressing a gene in a cell that expresses glial fibrillary acidic protein, the kit comprising the isolated nucleic acid molecule according to any one of claims 1 to 3.

Citation Information

Patent Citations

  • Transgenic mouse expressing green fluorescent protein in astrocytes

    WO2000002997A2

  • Human dickkopf-related protein and nucleic acid molecules and uses therefor

    WO2000052047A2

  • Synp160, a promoter for the specific expression of genes in rod photoreceptors

    WO2017093934A1