Esterase variants and their uses

Abstract

Provided is an esterase variant and its use. The amino acid sequence of the esterase variant has the sequence shown in SEQ ID NO: 1, and the site of amino acid mutation includes the N51G site. The esterase variant realizes the change of protein structure and function, and improves both enzyme specificity and enzyme activity, thereby reducing the amount of enzyme used and reducing the cost of industrial production.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more specifically, to esterase mutants and their uses.

Background Art

[0002] With the development of the pharmaceutical, pesticide, and other fine chemical industries, organic synthesis is increasingly facing greater challenges. First, due to the chiral discrimination ability in organisms, often only one stereoisomer among drug molecules has a therapeutic effect, while the other stereoisomers have no therapeutic effect or even side effects. Second, high-value-added products in small-batch production such as pharmaceuticals have complex and diverse structures. If the production process has chemical and regioselectivity, unnecessary protection and deprotection steps can be omitted (in conventional organic synthesis, it is common to add protection and deprotection steps to compensate for the lack of chemical and regioselectivity of the reaction), and the production process can be greatly optimized, thereby reducing production costs. Therefore, new organic synthesis technologies must have the following several characteristics: high chemical selectivity, regioselectivity, and stereoselectivity; mild reaction conditions; and little environmental pollution caused by the reaction medium and post-treatment. Biocatalytic technology just has these characteristics. Biocatalytic reactions have mild conditions and are generally carried out under neutral and room temperature, or similar conditions. In many cases, since biocatalytic reactions are carried out in the aqueous phase, there is little environmental pollution. Biocatalytic reactions generally have characteristics such as high chemical selectivity, regioselectivity, and stereoselectivity. Therefore, the application of biocatalytic technology in organic synthesis has great scientific significance and practical value.

[0003] Esterase is a general term for a series of enzymes with the ability to hydrolyze ester bonds. It widely exists in animals, plants, and microorganisms. It is a series of hydrolases widely applied in organic synthesis and is also the enzyme most studied in genetic engineering modification. It is divided into eight families and is classified by the types of substrates, namely carboxylic acid esters, thioesters, phosphate monoesters, phosphate diesters, phospholipid sulfates, and sulfate esters. Esterases from different origins have different catalytic characteristics and catalytic activities.

[0004] In Patent (CN105802935B), screening was carried out on deep-sea samples to obtain Pseudomonadaceae oryzihabitans, and the esterase gene PHE14 was obtained. An expression vector was constructed and transformed into an expression strain to obtain recombinant expressed esterase PHE14, which can be used in the production of chiral methyl lactate. In Patent (CN104988165B), the esterase gene est4 was extracted from deep-sea sludge, a genetic engineering strain containing the esterase gene est4 was constructed to realize the heterologous expression of the gene est4, and it has been successfully used in reactions such as the catalytic synthesis of various short-chain terpene esters and the kinetic optical resolution of various aromatic secondary alcohols.

[0005] Wild-type biocatalysts generally have good reactivity and selectivity towards their natural substrates. However, in the case of non-natural substrates, their reactivity, stability, and selectivity are generally not favorable. When applying biocatalysts to organic synthesis, since they are often non-natural substrates, generally, by modifying wild-type enzymes through directed evolution, their reactivity, stability, and selectivity (including chemoselectivity, regioselectivity, and stereoselectivity) towards non-natural substrates can be improved, and thus they can be applied to production.

Prior Art Documents

Patent Documents

[0006]

Patent Document 1

[0007] The present invention provides an esterase variant and its use, aiming to improve enzyme specificity. [Means for Solving the Problems]

[0008] According to one aspect of the present invention for achieving the above object, an esterase variant is provided. The esterase variant has a sequence in which an amino acid mutation occurs in the sequence shown in SEQ ID NO: 1, and the site where the amino acid mutation occurs includes the N51G site.

[0009] Furthermore, the site where the amino acid mutation occurs further includes any one or more of N51G, M52F / L / N / Y / G / W, W115P, T117L / M / F / W / A / I, S140A / G / N / C / T / V / L / P, A142V / L / P / S, V167M, I195L / F / T / V, W196I / L / V, D217M / Q / A / S / G, L231T / I, V267E / C / I / V and S295T / A / Y / F / M / N, where " / " represents "or".

[0010] Furthermore, the sites where amino acid mutations occur are any combination mutation sites including N51G+T117M+S140G, N51G+T117M+S140N, N51G+T117M+S140C, N51G+T117M+S140T, N51G+T117M+S140A, N51G+T117M+A142V, N51G+T117M+A142P, N51G+T117M+A142S, N51G+T117M+A142L, N51G+T117M+D217Q, N51G+T117M+D217A, N51G+T117M+D217S, N51G+T117M+D217G, N51G+T117M+L231I, N51G+T117M+S140C+M52F, N51G+T117M+S140C+M52L, N51G+T117M+S140C+M52N, N51G+T117M+S140C+M52Y, N51G+T117M+S140C+M52G, N51G+T117M+S140C+M52W, N51G+T117M+S140C+I195F, N51G+T117M+S140C+I195L, N51G+T117M+S140C+I195T, N51G+T117M+S140C+I195V, N51G+T117M+S140C+D217S, N51G+T117M+S140C+L231I, N51G+T117M+S140C+V267I, N51G+T117M+S140C+I268V, N51G+T117M+S140C+S295F, N51G+T117M+S140C+S295M, N51G+T117M+S140C+S295N, N51G+T117M+S140C+S295G, N51G+T117M+S140C+S295D.

[0011] According to another aspect of the present invention, a DNA molecule is provided. The DNA molecule encodes the esterase variant.

[0012] According to another aspect of the present invention, a recombinant plasmid is provided. Any of the above DNA molecules is ligated to the recombinant plasmid.

[0013] Furthermore, the recombinant plasmid is pET-22a(+), pET-22b(+), pET-3a(+), pET-3d(+), pET-11a(+), pET-12a(+), pET-14b, pET-15b(+), pET-16b(+), pET-17b(+), pET-19b(+), pET-20b(+), pET-21a(+), pET-23a(+), pET-23b(+), pET-24a(+), pET-25b(+), pET-26b(+), pET-27b(+), pET-28a(+), pET-29a(+), pET-30a(+), pET-31b(+), pET-32a(+), pET-35b(+), pET-38b(+), pET-39b(+), pET-40b(+), pET-41a(+), pET-41b(+), pET-42a(+), pET-43a(+), pET-43b(+), pET-44a(+), pET-49b(+), pQE2, pQE9, pQE30, pQE31, pQE32, pQE40, pQE70, pQE80, pRSET-A, pRSET-B, pRSET-C, pGEX-5X-1, pGEX-6p-1, pGEX-6p-2, pBV220, pBV221, pBV222, pTrc99A, pTwin1, pEZZ18, pKK232-8, pUC-18 or pUC-19.

[0014] According to another aspect of the present invention, a host cell is provided. The host cell contains any of the above recombinant plasmids.

[0015] Furthermore, the host cell includes a prokaryotic cell or a eukaryotic cell. Preferably, the prokaryotic cell is an E. coli BL21 cell or an E. coli DH5α competent cell, and the eukaryotic cell is yeast.

[0016] According to another aspect of the present invention, a method for producing a chiral acid is provided. The method includes a step of performing a catalytic reaction on an ester compound using an esterase, and the esterase is any of the above esterase mutants.

[0017] Furthermore, the ester compound is

Chemical formula

[0018] Furthermore, the pH of the catalytic reaction of the esterase mutant is 8.5 to 9.0, and the reaction temperature is 30 to 35 °C. [Advantages of the Invention]

[0019] The esterase mutants of the present invention are obtained by mutating the esterase shown in SEQ ID NO: 1 by site-directed mutagenesis to change its amino acid sequence and realize the change of the protein structure and function. Furthermore, by the method of directed screening, the esterase with the mutation site is obtained. Therefore, these esterase mutants have the advantage that the enzyme specificity is greatly improved, and the enzyme activity is also improved accordingly. This greatly reduces the amount of enzyme used and reduces the cost of industrial production. [Modes for Carrying Out the Invention]

[0020] If there is no contradiction, the examples of the present application and the features of the examples can be combined with each other. Hereinafter, the present invention will be described in detail using examples.

[0021] The present invention improves the specificity of esterase by a method of directed evolution and reduces the usage amount of esterase. The sequence of the template amino acid of the present invention (derived from Bacillus sp. 01-855, NCBI sequence number is AY640622, and the reference is https: / / www.ncbi.nlm.nih.gov / nuccore / AY640622) is SEQ ID NO: 1 (MGSNNDNMGKRGGNLMITIPTVHKVSLPNGEVMGYRKRDGGEKTILLVHGNMTSSKHWDLFFETFPASYTLVAIDMRGFGESSYNKRVEGIEDFAQDLKFFVDQLGLNDFTMIGWSTGGAVCMQFEAQYPGYCDKIVLISSASTRGYPFFGTHSDGTPDLNQRLKTVDDIEKDPMRTIPIQQAYDTGNRALLKTIWNSLIYTHNQPEEKRYEAYVDDMMTQRNLADVYHALNTFNISSVTNGLTEGTNQANLIRIPVLVLRGERDLVISKEMTEEIVEDLGTNSTYKELSASGHSPFIDDCDQLTNIITDFLEK), and the corresponding nucleotide sequence is,Array number 2 (ATGGGCAGCAATAACGACAACATGGGTAAACGTGGCGGCAACCTGATGATCACCATCCCGACAGTGCATAAAGTGAGCCTGCCGAATGGCGAAGTGATGGGTTATCGTAAGCGCGACGGCGGTGAAAAAACCATCCTGCTGGTGCACGGCAACATGACCAGCAGCAAACATTGGGACCTGTTCTTCGAGACCTTTCCGGCAAGCTATACACTGGTGGCCATCGATATGCGCGGCTTCGGCGAAAGCAGCTATAACAAACGCGTGGAAGGCATCGAGGACTTTGCCCAGGACCTGAAATTCTTCGTGGATCAGCTGGGCCTGAACGATTTCACCATGATCGGTTGGAGCACAGGCGGCGCCGTGTGTATGCAGTTTGAAGCCCAGTATCCGGGCTACTGCGACAAGATTGTGCTGATTAGCAGCGCAAGCACCCGTGGCTATCCGTTTTTTGGTACCCACAGCGATGGCACCCCGGATCTGAATCAGCGCCTGAAGACCGTGGACGACATCGAAAAAGATCCTATGCGCACCATTCCGATCCAGCAGGCCTACGATACCGGTAACCGCGCCCTGCTGAAAACCATCTGGAATAGCCTGATTTACACCCACAACCAGCCGGAGGAAAAGCGCTATGAGGCCTATGTGGACGACATGATGACCCAGCGTAATCTGGCCGATGTGTATCACGCCCTGAACACATTCAACATTAGCAGCGTGACCAACGGCCTGACCGAGGGCACCAATCAGGCCAACCTGATCCGCATCCCTGTGCTGGTTCTGCGCGGCGAACGCGACCTGGTGATCAGCAAAGAGATGACCGAGGAGATCGTGGAGGATCTGGGCACCAACAGCACCTATAAAGAGCTGAGCGCCAGCGGCCACAGCCCTTTTATCGATGATTGCGACCAGCTGACCAACATCATCACCGATTTTCTGGAGAAATAA).

[0022] First, introduce a mutation site into the esterase by site-directed mutagenesis, detect the specificity for the mutant, and select the mutant with improved specificity. Among them, the mutant N51G has significantly improved specificity compared to the original template. Subsequently, in order to obtain a mutant with improved catalytic activity, N51G is continuously mutated using it as a template.

[0023] Note that site-directed mutagenesis refers to introducing a predetermined change (generally a change showing an advantageous direction) into a target DNA fragment (which may be a genome or a plasmid) by methods such as polymerase chain reaction (PCR), including base addition, deletion, point mutation, etc. Site-directed mutagenesis can rapidly and efficiently improve the properties and characteristics of the target protein expressed by DNA, so it is one of the very useful means in the field of gene research.

[0024] The method of introducing site-directed mutagenesis by PCR using the whole plasmid is a commonly used means at present because it is simple and effective. Its principle is to anneal a pair of primers (forward, reverse) containing the mutation site with the template plasmid and then "circularly extend" it with polymerase (so-called circular extension refers to the cycle of extending the primer according to the template by polymerase, terminating when it returns to the 5' end of the primer after one round, and further extending by repeating heating and annealing). This reaction, different from rolling circle amplification, does not form multiple tandem copies. The extension products of the forward and reverse primers pair after annealing to form an open-circle plasmid with a nick. The extension products are enzymatically cleaved with Dpn I. The plasmid used as the template is usually derived from ordinary Escherichia coli and is modified by dam methylation, so it is sensitive to Dpn I and is cleaved. The plasmid with the mutated sequence synthesized in vitro is not methylated and is not cleaved. Therefore, in the subsequent transformation, the transformation is successful, that is, clones of the mutated plasmid can be obtained. The mutated plasmid is transformed into Escherichia coli cells, and then crude enzyme is obtained by the method of cell disruption by ultrasonic waves.

[0025] In the above, the mutant plasmid must be transformed into E. coli cells and overexpressed in E. coli. Next, crude enzyme is obtained by the method of cell disruption using ultrasonic waves. The optimal conditions for the induced expression of esterase are induction at 25°C with 0.1 mM IPTG for 16 hours.

[0026] By performing computer simulation analysis on the three-dimensional structure of esterase using software, it was discovered that the site where the mutation occurs is located near the substrate-binding site, and there is a possibility that the binding between the substrate and the enzyme is strengthened after the mutation, thus improving the catalytic efficiency.

[0027] According to a typical embodiment of the present invention, an esterase mutant is provided. The esterase mutant has a sequence in which an amino acid mutation occurs in the sequence shown in SEQ ID NO: 1, and the site where the amino acid mutation occurs includes the N51G site.

[0028] Preferably, the site where the amino acid mutation occurs further includes any one or more of N51G, M52F / L / N / Y / G / W, W115P, T117L / M / F / W / A / I, S140A / G / N / C / T / V / L / P, A142V / L / P / S, V167M, I195L / F / T / V, W196I / L / V, D217M / Q / A / S / G, L231T / I, V267E / C / I / V, and S295T / A / Y / F / M / N, where " / " represents "or".

[0029] More preferably, the site where the amino acid mutation occurs is any of the combination mutation sites of N51G+T117M+S140G, N51G+T117M+S140N, N51G+T117M+S140C, N51G+T117M+S140T, N51G+T117M+S140A, N51G+T117M+A142V, N51G+T117M+A142P, N51G+T117M+A142S, N51G+T117M+A142L, N51G+T117M+D217Q, N51G+T117M+D217A, N51G+T117M+D217S, N51G+T117M+D217G, N51G+T117M+L231I, N51G+T117M+S140C+M52F, N51G+T117M+S140C+M52L, N51G+T117M+S140C+M52N, N51G+T117M+S140C+M52Y, N51G+T117M+S140C+M52G, N51G+T117M+S140C+M52W, N51G+T117M+S140C+I195F, N51G+T117M+S140C+I195L, N51G+T117M+S140C+I195T, N51G+T117M+S140C+I195V, N51G+T117M+S140C+D217S, N51G+T117M+S140C+L231I, N51G+T117M+S140C+V267I, N51G+T117M+S140C+I268V, N51G+T117M+S140C+S295F, N51G+T117M+S140C+S295M, N51G+T117M+S140C+S295N, N51G+T117M+S140C+S295G, N51G+T117M+S140C+S295D.

[0030] The esterase variants of the present invention are obtained by mutating the esterase shown in SEQ ID NO: 1 by site-specific mutagenesis to change its amino acid sequence, thereby changing the structure and function of the protein. Furthermore, by the method of directed screening, the esterase having the mutation site is obtained. Therefore, these esterase variants have the advantage that the enzyme specificity is greatly improved, and the enzyme activity is also improved accordingly, thereby greatly reducing the amount of enzyme used and reducing the cost of industrial production.

[0031] According to a typical embodiment of the present invention, a DNA molecule is provided. The esterase encoded by the DNA has improved enzyme activity and enzyme stability, and in the industrial production of amino acids, the addition amount of the enzyme can be reduced, and the difficulty of post-treatment can be alleviated.

[0032] The DNA molecule of the present invention may exist in the form of an "expression cassette". An "expression cassette" refers to a linear or circular nucleic acid molecule that covers DNA and RNA sequences capable of instructing the expression of a specific nucleotide sequence in a suitable host cell. Generally, it contains a promoter operably linked to the target nucleotide, which is optionally operably linked to a termination signal and / or other regulatory elements. The expression cassette may further contain sequences necessary for the correct translation of the nucleotide sequence. The coding region generally encodes the target protein, but in the sense or antisense direction, it also encodes a target functional RNA (e.g., antisense RNA or non-translated RNA). The expression cassette containing the target polynucleotide sequence may be chimeric, which means that at least one of its components is heterologous to at least one of its other components. The expression cassette may be naturally occurring, provided that it is formed from a recombination effective for heterologous expression.

[0033] According to a typical embodiment of the present invention, a recombinant plasmid is provided. The recombinant plasmid contains any of the above DNA molecules. The DNA molecule in the recombinant plasmid is arranged at an appropriate position of the recombinant plasmid, whereby the DNA molecule can be correctly and smoothly replicated, transcribed or expressed.

[0034] When the DNA molecule is defined in the present invention, the modifier "containing" is used, but it does not mean that other sequences unrelated to its function can be unconditionally added to both ends of the DNA sequence. It is known to those skilled in the art that in order to meet the requirements of recombinant operations, it is necessary to add cleavage sites of appropriate restriction enzymes to both ends of the DNA sequence, or to add start codons, stop codons, etc. Therefore, limiting in a closed form cannot surely cover these situations.

[0035] As used herein, the term "plasmid" includes any plasmid, cosmid, phage or binary nucleic acid molecule by Agrobacterium in double-stranded or single-stranded linear or circular form, preferably a recombinant expression plasmid, which may be a prokaryotic expression plasmid or a eukaryotic expression plasmid, but preferably a prokaryotic expression plasmid. In some embodiments, the recombinant plasmid is selected from pET-22a(+), pET-22b(+), pET-3a(+), pET-3d(+), pET-11a(+), pET-12a(+), pET-14b, pET-15b(+), pET-16b(+), pET-17b(+), pET-19b(+), pET-20b(+), pET-21a(+), pET-23a(+), pET-23b(+), pET-24a(+), pET-25b(+), pET-26b(+), pET-27b(+), pET-28a(+), pET-29a(+), pET-30a(+), pET-31b(+), pET-32a(+), pET-35b(+), pET-38b(+), pET-39b(+), pET-40b(+), pET-41a(+), pET-41b(+), pET-42a(+), pET-43a(+), pET-43b(+), pET-44a(+), pET-49b(+), pQE2, pQE9, pQE30, pQE31, pQE32, pQE40, pQE70, pQE80, pRSET-A, pRSET-B, pRSET-C, pGEX-5X-1, pGEX-6p-1, pGEX-6p-2, pBV220, pBV221, pBV222, pTrc99A, pTwin1, pEZZ18, pKK232-8, pUC-18 or pUC-19. More preferably, the recombinant plasmid is pET-22b(+).

[0036] According to a typical embodiment of the present invention, a host cell is provided, which contains any of the above recombinant plasmids. Host cells suitable for the present invention include, but are not limited to, prokaryotic cells or eukaryotic cells. Preferably, the prokaryotic cell is an E. coli BL21 cell or an E. coli DH5α competent cell, and the eukaryotic cell is yeast.

[0037] According to a typical embodiment of the present invention, a method for producing a chiral acid is provided. The method includes a step of performing a catalytic reaction of an ester compound using an esterase, and the esterase is any of the esterase mutants. Since the esterase of the present invention has better specificity or higher enzyme catalytic activity, when producing a chiral acid using the esterase mutant of the present invention, not only can the production cost be reduced, but also the ee value of the obtained amino acid is higher.

[0038] According to a typical embodiment of the present invention, the ester compound is

Chemical formula

Chemical formula

Chemical formula

[0039] Preferably, the pH range of the catalytic reaction of the esterase mutant is 8.5 to 9.0, and the reaction temperature is 30 to 35 °C.

[0040] Hereinafter, the beneficial effects of the present invention will be further described using specific examples.

Chemical formula

[0041] (Example 1) Add 20 mg of substrate 1. The reaction system is 1 mL, the esterase is 2 mg, and it is 0.3 M potassium phosphate buffer (pH 7.5). After reacting at 30 °C for 16 hours, add 50 μL of 6 M HCl to the 1 mL reaction system. The pH is 2 - 3. After mixing uniformly, add 2 mL of ethyl acetate, shake well, then centrifuge at 12,000 rpm for 3 minutes to obtain the supernatant. Add an appropriate amount of anhydrous magnesium sulfate, centrifuge at 12,000 rpm for 3 minutes, obtain the supernatant and perform gas phase detection to detect the conversion rate and e.e. value. For substrate 2 and substrate 3, perform the same reaction and treatment method as that of substrate 1. Refer to Table 1 for the results.

Table 1

[0042] Regarding the magnification of decrease and increase in activity relative to the parent, --- represents a decrease of 10 - 50 times, -- represents a decrease of 5 - 10 times, - represents a decrease of 1 - 5 times, + represents an increase of 1 - 5 times, ++ represents an increase of 5 - 10 times, +++ represents an increase of 10 - 50 times, and ++++ represents an increase exceeding 50 times.

[0043] * indicates that the ee value is less than 0%, ** indicates that the ee value is 0 - 50%, *** indicates that the ee value is 50 - 95%, and **** indicates that the ee value exceeds 95%.

[0044] (Example 2) Add 20 mg of substrate 4. The reaction system is 1 mL, the esterase is 2 mg, and it is 0.3 M potassium phosphate buffer (pH 7.5). After reacting at 30 °C for 16 hours, add 50 μL of 6 M HCl to the 1 mL reaction system. The pH is 2 - 3. After mixing uniformly, add 2 mL of ethyl acetate, shake well, then centrifuge at 12,000 rpm for 3 minutes to obtain the supernatant. Add an appropriate amount of anhydrous magnesium sulfate, centrifuge at 12,000 rpm for 3 minutes, obtain the supernatant and perform gas phase detection to detect the conversion rate and e.e. value. For substrate 5, perform the same reaction and treatment method as that of substrate 4. Refer to Table 2 for the results.

Table 2

[0045] Regarding the magnification of the decrease and increase in activity with respect to the parent body, --- represents a decrease of 10 to 50 times, -- represents a decrease of 5 to 10 times, - represents a decrease of 1 to 5 times, + represents an increase of 1 to 5 times, ++ represents an increase of 5 to 10 times, +++ represents an increase of 10 to 50 times, and ++++ represents an increase exceeding 50 times.

[0046] * indicates that the ee value is less than 0%, ** indicates that the ee value is 0 to 50%, *** indicates that the ee value is 50 to 95%, and **** indicates that the ee value exceeds 95%.

[0047] Continue to perform mutations to increase the ee value of the product, increase the substrate concentration, and reduce the reaction amount.

[0048] (Example 3) Add 33 mg of substrate 1, with a reaction system of 1 mL, 3.3 mg of esterase, 50 μL of N,N-dimethylformamide, and 0.3 M Tris-HCl buffer (pH 8.5). After reacting at 30 °C for 16 hours, add 50 μL of 6 M HCl to the 1 mL reaction system, adjust the pH to 2 - 3, mix uniformly, then add 2 mL of ethyl acetate, shake well, centrifuge at 12000 rpm for 3 minutes, obtain the supernatant, add an appropriate amount of anhydrous magnesium sulfate, centrifuge at 12000 rpm for 3 minutes, obtain the supernatant, and perform gas phase detection to detect the conversion rate and e.e. value. For substrate 2 and substrate 3, perform the same reaction and treatment method as that of substrate 1. Refer to Table 3 for the results.

Table 3

[0049] Regarding the magnification of decrease and increase in activity relative to the parent, --- represents a decrease of 10 to 50 times, -- represents a decrease of 5 to 10 times, - represents a decrease of 1 to 5 times, + represents an increase of 1 to 5 times, ++ represents an increase of 5 to 10 times, +++ represents an increase of 10 to 50 times, and ++++ represents an increase exceeding 50 times.

[0050] * indicates that the ee value is less than 0%, ** indicates that the ee value is 0 to 50%, *** indicates that the ee value is 50 to 95%, and **** indicates that the ee value exceeds 95%.

[0051] (Example 4) 33 mg of substrate 4 was added, with a 1 mL reaction system. The esterase was 3.3 mg, 50 μL of N,N-dimethylformamide, and 0.3 M Tris-HCl buffer (pH 8.5). After reacting at 30 °C for 16 hours, 50 μL of 6 M HCl was added to the 1 mL reaction system, the pH was 2 - 3, and after uniform mixing, 2 mL of ethyl acetate was added. After thorough shaking, centrifugation was performed at 12,000 rpm for 3 minutes to obtain the supernatant. An appropriate amount of anhydrous magnesium sulfate was added, and centrifugation was performed at 12,000 rpm for 3 minutes to obtain the supernatant for gas phase detection. The conversion rate and e.e. value were detected. For substrate 5, the same reaction and treatment method as for substrate 4 were carried out. Refer to Table 4 for the results.

Table 4

[0052] Regarding the magnification of decrease and increase in activity relative to the parent, --- represents a decrease of 10 to 50 times, -- represents a decrease of 5 to 10 times, - represents a decrease of 1 to 5 times, + represents an increase of 1 to 5 times, ++ represents an increase of 5 to 10 times, +++ represents an increase of 10 to 50 times, and ++++ represents an increase exceeding 50 times.

[0053] * indicates that the ee value is less than 0%, ** indicates that the ee value is 0 to 50%, *** indicates that the ee value is 50 to 95%, and **** indicates that the ee value exceeds 95%.

[0054] Further combine beneficial mutation sites to further increase the substrate concentration and reduce the reaction amount.

[0055] (Example 5) Add 50 mg of Substrate 1. The reaction system is 1 mL, the esterase is 5 mg, the N,N-dimethylformamide is 50 μL, and the 0.3 M Tris-HCl buffer (pH 8.5). After reacting at 30 °C for 16 hours, add 50 μL of 6 M HCl to the 1 mL reaction system, adjust the pH to 2 - 3, mix uniformly, then add 2 mL of ethyl acetate, shake well, centrifuge at 12000 rpm for 3 minutes, obtain the supernatant, add an appropriate amount of anhydrous magnesium sulfate, centrifuge at 12000 rpm for 3 minutes, obtain the supernatant and perform gas phase detection to detect the conversion rate and e.e. value. For Substrate 2 and Substrate 3, perform the same reaction and treatment method as that of Substrate 1. Refer to Table 5 for the results.

Table 5

[0056] Regarding the magnification of the decrease and increase in activity relative to the parent, --- represents a decrease of 10 - 50 times, -- represents a decrease of 5 - 10 times, - represents a decrease of 1 - 5 times, + represents an increase of 1 - 5 times, ++ represents an increase of 5 - 10 times, +++ represents an increase of 10 - 50 times, and ++++ represents an increase exceeding 50 times.

[0057] * indicates that the e.e. value is less than 0%, ** indicates that the e.e. value is 0 - 50%, *** indicates that the e.e. value is 50 - 95%, and **** indicates that the e.e. value exceeds 95%.

[0058] (Example 6) Add 50 mg of substrate 4, with a reaction system of 1 mL, 5 mg of esterase, 50 μL of N,N-dimethylformamide, and 0.3 M Tris-HCl buffer (pH 8.5). After reacting at 30 °C for 16 hours, add 50 μL of 6 M HCl to the 1 mL reaction system, adjust the pH to 2 - 3, mix uniformly, then add 2 mL of ethyl acetate, shake well, centrifuge at 12000 rpm for 3 minutes, collect the supernatant, add an appropriate amount of anhydrous magnesium sulfate, centrifuge at 12000 rpm for 3 minutes, collect the supernatant for gas phase detection, detect the conversion rate and e.e. value. For substrate 5, perform the same reaction and treatment method as for substrate 4. Refer to Table 6 for the results.

Table 6

[0059] Regarding the magnification of decrease and increase in activity relative to the parent compound, --- represents a decrease of 10 - 50 times, -- represents a decrease of 5 - 10 times, - represents a decrease of 1 - 5 times, + represents an increase of 1 - 5 times, ++ represents an increase of 5 - 10 times, +++ represents an increase of 10 - 50 times, and ++++ represents an increase exceeding 50 times.

[0060] * indicates that the ee value is less than 0%, ** indicates that the ee value is 0 - 50%, *** indicates that the ee value is 50 - 95%, and **** indicates that the ee value exceeds 95%.

[0061] (Example 7) Optimize the reaction system according to the reaction conditions. Add 50 mg of substrate 1, with a reaction system of 1 mL, where the esterase (N51G+T117M+S140C+S295N) is 5 mg, 50 μL of N,N-dimethylformamide, and 0.3 M Tris-HCl buffer (pH 8.5). According to the reaction conditions, optimize the reaction system, with different concentrations of co-solvent DMSO (0 - 20%), DMF (0 - 20%), different concentrations of buffer (0.1 - 1 M Tris-HCl pH 8.5), different pH buffers (0.3 M KPB pH 7 - 8, 0.3 M Tris-HCl pH 8 - 9), and reaction temperature (20 - 50 °C). After reacting for 16 hours, add 50 μL of 6 M HCl to the 1 mL reaction system, with the pH being 2 - 3. After mixing uniformly, add 2 mL of ethyl acetate, shake well, then centrifuge at 12,000 rpm for 3 minutes, obtain the supernatant, add an appropriate amount of anhydrous magnesium sulfate, centrifuge at 12,000 rpm for 3 minutes, obtain the supernatant and perform gas phase detection to detect the conversion rate and e.e. value. Refer to Tables 7 - 10 for the results. [Table 7] [Table 8] [Table 9] [Table 10]

[0062] Regarding the magnification of decrease and increase in activity relative to the parent body, --- represents a decrease of 10 - 50 times, -- represents a decrease of 5 - 10 times, - represents a decrease of 1 - 5 times, + represents an increase of 1 - 5 times, ++ represents an increase of 5 - 10 times, +++ represents an increase of 10 - 50 times, and ++++ represents an increase exceeding 50 times.

[0063] * indicates that the ee value is less than 0%, ** indicates that the ee value is 0 - 50%, *** indicates that the ee value is 50 - 95%, and **** indicates that the ee value exceeds 95%.

[0064] In the optimized reaction system, an amplification reaction is carried out with 10 g of the substrate.

[0065] (Example 8) In the optimized reaction system, an amplification reaction is carried out, 10 g of substrate 1 is added, the reaction system is 100 mL, the esterase (N51G+T117M+S140C+S295N) is 250 mg, it is 5 mL of N,N-dimethylformamide, and it is 0.5 M Tris-HCl buffer (pH 9.0). React at 30 °C, collect and detect samples while tracking the reaction time, adjust the pH to about 9.0, when reacting for 50 hours, the conversion rate is 48% and the e.e. value is 98%. Post-treat the reaction sample, add 6 M HCl, adjust the pH to 2 - 3, mix uniformly, then add 200 mL of ethyl acetate, extract, shake well, separate the organic layer, add an appropriate amount of anhydrous sodium sulfate, filter further, perform rotary evaporation treatment on the organic layer, and finally obtain 4.4 g of the sample, the purity is 98%, the e.e. value is 98%, and further nuclear magnetic detection is carried out, and the yield is 45%.

[0066] (Example 9) In the optimized reaction system, an amplification reaction is carried out, 10 g of substrate 4 is added, the reaction system is 100 mL, the esterase (N51G+T117M+S140C+S295N) is 250 mg, it is 5 mL of N,N-dimethylformamide, and it is 0.5 M Tris-HCl buffer (pH 9.0). React at 30 °C, collect and detect samples while tracking the reaction time, adjust the pH to about 9.0, when reacting for 60 hours, the conversion rate is 48% and the e.e. value is 98%. Post-treat the reaction sample, add 6 M HCl, adjust the pH to 2 - 3, mix uniformly, then add 300 mL of ethyl acetate, extract, shake well, separate the organic layer, add an appropriate amount of anhydrous sodium sulfate, filter further, perform rotary evaporation treatment on the organic layer, and finally obtain 4.3 g of the sample, the purity is 98%, the e.e. value is 98%, and further nuclear magnetic detection is carried out, and the yield is 44%.

[0067] The above is not intended to limit the present invention, but is merely a preferred embodiment of the present invention. For those skilled in the art, various corrections and changes may be made to the present invention. Any corrections, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention shall be included in the claims of the present invention.

Claims

**Claim 1** An esterase variant, comprising a sequence in which an amino acid mutation occurs in the sequence shown in SEQ ID NO: 1, wherein the site where the amino acid mutation occurs is any combination mutation site of N51G+T117L, N51G+T117M, N51G+T117A, N51G+D217M, N51G+V267C, N51G+S295T, N51G+S295A, N51G+S295Y, N51G+S295F, N51G+T117M+S140G, N51G+T117M+S140N, N51G+T117M+S140C, N51G+T117M+S140T, N51G+T117M+S140A, N51G+T117M+A142V, N51G+T117M+A142P, N51G+T117M+A142S, N51G+T117M+A142L, N51G+T117M+D217Q, N51G+T117M+D217A, N51G+T117M+D217S, N51G+T117M+L231I, N51G+T117M+S140C+M52F, N51G+T117M+S140C+M52L, N51G+T117M+S140C+M52N, N51G+T117M+S140C+M52Y, N51G+T117M+S140C+M52G, N51G+T117M+S140C+M52W, N51G+T117M+S140C+I195F, N51G+T117M+S140C+I195L, N51G+T117M+S140C+I195T, N51G+T117M+S140C+I195V, N51G+T117M+S140C+D217S, N51G+T117M+S140C+L231I, N51G+T117M+S140C+V267I, N51G+T117M+S140C+I268V, N51G+T117M+S140C+S295F, N51G+T117M+S140C+S295M, N51G+T117M+S140C+S295N, N51G+T117M+S140C+S295G, N51G+T117M+S140C+S295D. **Claim 2** A DNA molecule, characterized by encoding the esterase variant according to Claim 1. **Claim 3** A recombinant plasmid, characterized in that the DNA molecule according to Claim 2 is ligated. **Claim 4** The recombinant plasmid according to claim 3, characterized in that it is pET-22a(+), pET-22b(+), pET-3a(+), pET-3d(+), pET-11a(+), pET-12a(+), pET-14b, pET-15b(+), pET-16b(+), pET-17b(+), pET-19b(+), pET-20b(+), pET-21a(+), pET-23a(+), pET-23b(+), pET-24a(+), pET-25b(+), pET-26b(+), pET-27b(+), pET-28a(+), pET-29a(+), pET-30a(+), pET-31b(+), pET-32a(+), pET-35b(+), pET-38b(+), pET-39b(+), pET-40b(+), pET-41a(+), pET-41b(+), pET-42a(+), pET-43a(+), pET-43b(+), pET-44a(+), pET-49b(+), pQE2, pQE9, pQE30, pQE31, pQE32, pQE40, pQE70, pQE80, pRSET-A, pRSET-B, pRSET-C, pGEX-5X-1, pGEX-6p-1, pGEX-6p-2, pBV220, pBV221, pBV222, pTrc99A, pTwin1, pEZZ18, pKK232-8, pUC-18 or pUC-19.

5. A host cell characterized by containing the recombinant plasmid according to claim 3 or 4.

6. The host cell according to claim 5, characterized by including a prokaryotic cell or a eukaryotic cell.

7. The host cell according to claim 6, characterized in that the prokaryotic cell is an Escherichia coli BL21 cell or an Escherichia coli DH5α competent cell, and the eukaryotic cell is yeast.

8. In a method for producing a chiral acid, comprising the step of performing a catalytic reaction of an ester compound using an esterase, the esterase is the esterase mutant according to claim 1, The ester compound is 【Chemical 1】 and the method is characterized by this.

9. The method according to claim 8, characterized in that the pH of the catalytic reaction of the esterase mutant is 8.5 to 9.0, and the reaction temperature is 30 to 35 °C.

Images