Method for calibrating nucleic acid library seeding efficiency in a flow cell
The method addresses the inefficiencies in determining polynucleotide seeding in flow cells by using labeling agents and supernatant analysis to accurately assess seeding efficiency, enhancing sequencing consistency in patterned flow cells.
Patent Information
- Application Number
- JP2022580775
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-07-02
- Filing Date
- 2021-07-02
- Publication Date
- 2025-08-13
- Estimated Expiration
- 2041-07-02
AI Technical Summary
Existing methods for determining polynucleotide seeding efficiency in flow cells are inadequate, particularly in patterned flow cells, as the number of clusters does not directly correlate with the number of seeded polynucleotides due to issues like polyclonality, pre-amplification replication, and library adsorption in interstitial regions.
A method is provided to assess seeding efficiency by seeding a flow cell with polynucleotides, contacting it with a labeling agent, and determining the amount of label present, or by amplifying and quantifying the supernatant using qPCR or droplet PCR, and re-seeding the supernatant in a second flow cell to count clusters.
This method allows for a more accurate determination of seeding efficiency by accounting for polynucleotides that remain in the bulk solution, improving the consistency and quality of sequencing results in patterned flow cells.
Smart Images

Figure 0007723021000001 
Figure 0007723021000002 
Figure 0007723021000003
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 047,817, filed July 2, 2020, the disclosure of which is incorporated herein by reference.
[0002] The present disclosure provides a method for calibrating polynucleotide seeding efficiency in a flow cell. [Background technology]
[0003] A flow cell for sequencing is a glass slide containing a small fluidic channel through which polymerase, dNTPs, and buffers can circulate. The glass inside the channel is decorated with short oligonucleotides complementary to adapter sequences on the target nucleic acid. The adapter-containing target nucleic acid is diluted and hybridized to these oligonucleotides, temporarily immobilizing individual DNA strands on the flow cell ("polynucleotide seeding"). The library strands are then amplified using, for example, a "bridge-PCR" strategy using cycles of primer extension followed by chemical denaturation. Through the in situ amplification process, strands are amplified by thousands. The target nucleic acid is hybridized to the flow cell at low molar amounts (6-20 pM). This allows for large physical separation between template DNA strands. At the end of amplification, small clusters of identical DNA remain as molecules immobilized on a 2D surface and can be sequenced en masse. Summary of the Invention
[0004] The efficiency of polynucleotide seeding in a flow cell is typically determined by counting the final number of clusters. The present disclosure provides a new and improved method for determining the efficiency of polynucleotide seeding in a flow cell.
[0005] The present disclosure provides a method for assessing the seeding efficiency of a flow cell with polynucleotides, comprising: seeding the flow cell with polynucleotides for at least 1 minute; and (i) contacting the flow cell with a labeling agent that binds to or incorporates into the seeded polynucleotides and determining the amount of label present in the flow cell, thereby determining the seeding efficiency; or (ii) collecting the supernatant and quantifying the polynucleotides in the supernatant using step (a) or (b): (a) amplifying the polynucleotides in the supernatant using qPCR and / or droplet PCR, or (b) re-seeding the supernatant using a second flow cell and counting clusters generated after bridge amplification of the polynucleotides; and (c) determining the seeding efficiency of the flow cell by comparing the number of polynucleotides quantified in the supernatant with the number of polynucleotides used to seed the flow cell. In one embodiment, the labeling agent comprises a labeled dNTP that is incorporated into the seeded polynucleotides by a polymerase. In another embodiment, the labeling agent comprises a labeled nanoparticle or a labeled dendrimer that binds to a complementary oligonucleotide on the seeded polynucleotide. In yet another embodiment, the labeling agent comprises a labeled adapter or a labeled complementary oligonucleotide for the seeded polynucleotide. In yet another embodiment, the labeling agent comprises a labeled structure grown from the end of the seeded polynucleotide. In another or further embodiment, the label is a luminescent or fluorescently detectable label.
[0006] In one embodiment, the method determines seeding efficiency by looking at polynucleotides that are not captured on the surface and remain in the bulk seeding solution. More detailed information about the seeding process can be determined by collecting and analyzing the supernatant from the flow cell channel at the end of the seeding process. The methods disclosed herein are particularly useful for verifying seeding on patterned flow cells, where the number of clusters does not directly correlate with the number of polynucleotides seeded due to, but not limited to, (1) polyclonality, (2) pre-amplification replication, and (3) library adsorption in the interstitial regions between wells.
[0007] In certain embodiments, the present disclosure provides a method for evaluating the seeding efficiency of a flow cell with polynucleotides, the method comprising: seeding a flow cell with polynucleotides for at least 1 minute and collecting the supernatant; quantifying the polynucleotides in the supernatant by using steps (a) or (b), where (a) comprises amplifying the polynucleotides in the supernatant using qPCR and / or droplet PCR, or (b) comprises re-seeding the supernatant using a second flow cell and counting clusters generated after bridge amplification of the polynucleotides; and determining the seeding efficiency of the flow cell by comparing the number of polynucleotides quantified in the supernatant with the number of polynucleotides used to seed the flow cell. In a further embodiment of any of the embodiments disclosed herein, one channel of the flow cell is evaluated for polynucleotide seeding efficiency. In a further embodiment of any of the embodiments disclosed herein, two or more channels of the flow cell are evaluated for polynucleotide seeding efficiency. In a further embodiment of any of the embodiments disclosed herein, the flow cell comprises a plurality of primers bound to the surface of the flow cell. In a further embodiment of any embodiment disclosed herein, the bound primers include a P5 primer having the sequence of SEQ ID NO: 1 and / or a P7 primer having the sequence of SEQ ID NO: 2. In a further embodiment of any embodiment disclosed herein, the plurality of primers are randomly bound to the surface of the flow cell. In a further embodiment of any embodiment disclosed herein, the plurality of primers are bound to specific regions of the flow cell. In a further embodiment of any embodiment disclosed herein, the plurality of primers are bound to the surface of an array of wells patterned on the surface of the flow cell. In a further embodiment of any embodiment disclosed herein, the flow cell is used in a next-generation sequencing device. In a further embodiment of any embodiment disclosed herein, the polynucleotide comprises an adapter. In a further embodiment of any embodiment disclosed herein, the adapter is bridge PCR compatible.In further embodiments of any of the embodiments disclosed herein, the polynucleotides comprise a DNA library. In further embodiments of any of the embodiments disclosed herein, the DNA library is generated using a library preparation kit. In further embodiments of any of the embodiments disclosed herein, the DNA library is prepared according to a method comprising: (A) simultaneously fragmenting and priming isolated DNA using transposomes; (B) amplifying the fragmented DNA using reduced-cycle PCR, wherein the PCR amplification primers comprise index and adapter sequences; and (C) washing and pooling the amplified DNA fragments to form a DNA library. In another or further embodiments disclosed herein, the transposomes are linked to beads. In another or further embodiments disclosed herein, the DNA library is generated from genomic DNA isolated from a human subject. In another or further embodiments disclosed herein, the polynucleotides are plated on a flow cell for 5 to 60 minutes. In another or further embodiments disclosed herein, the polynucleotides are plated on a flow cell for 10 to 40 minutes. In another or further embodiment disclosed herein, the qPCR involves using a double-strand binding dye that allows for quantification of double-stranded amplification products based on the level of fluorescence. Examples of double-strand binding dyes include, but are not limited to, SYBR® Green I, BRYT Green® Dye, PicoGreen, YOYO-1 iodide, and SYBR® Gold. In another or further embodiment disclosed herein, the qPCR involves a sequence-specific probe labeled with a fluorescent reporter and a quencher molecule that binds to the DNA template. In another or further embodiment disclosed herein, the quencher molecule is a dark quencher that absorbs light across multiple wavelengths and does not emit light. Examples of dark quenchers include, but are not limited to, Dabsyl, Black Hole quencher, Iowa Black FQ, Iowa Black RQ, IRDye QC-1, and Qxl quencher.In another or further embodiment disclosed herein, the second flow cell used to quantify the polynucleotides in the supernatant is different from the flow cell seeded with the polynucleotides. In another or further embodiment disclosed herein, the second flow cell provides up to 12 Gb of sequence data per run, and the flow cell seeded with the polynucleotides provides up to 120 Gb of sequence data per run. In another or further embodiment disclosed herein, the method is performed multiple times using flow cells seeded with the same concentration of polynucleotides but for the same seeding time length. In another or further embodiment disclosed herein, the seeding efficiency of the flow cell with polynucleotides is evaluated over time at various time points.
[0008] In certain embodiments, the present disclosure provides for the use of the methods disclosed herein for engineering a flow cell surface with improved seeding efficiency of polynucleotides.
[0009] The details of one or more embodiments of the disclosure are set forth in the accompanying drawings and the description below. Other features, objects, and advantages will become apparent from the description and drawings, and from the claims. [Brief explanation of the drawings]
[0010] [Figure 1] 1 provides an illustration of the DNA seeding process in a patterned flow cell. Due to the multiple purposes of the DNA molecules, the most effective way to calibrate the seeding process is to collect the supernatant and analyze it. [Figure 2] An embodiment of an experimental workflow is provided that includes the steps of (1) loading a known concentration library into a flow cell, (2) plating the library, and (3) removing the remaining supernatant for quantification. [Figure 3] Two methods for quantifying library plating efficiency are illustrated: (a) qPCR or droplet PCR, and (b) re-plating of the supernatant on a Miseq flow cell. [Figure 4A]Quantification of library seeding using a Miseq flow cell shows that after 5 minutes of seeding, the remaining unseeded library from the patterned flow cell is significantly greater than that from the regular flow cell. [Figure 4B] Quantification of library seeding using a Miseq flow cell shows that after 5 minutes of seeding, the remaining unseeded library from the patterned flow cell is significantly greater than that from the regular flow cell. [Figure 4C] Quantification of library seeding using a Miseq flow cell. The pattern flow cell demonstrates that longer incubation times during seeding can reduce residual unseeded library fragments. [Figure 4D] Quantification of library seeding using a Miseq flow cell. The pattern flow cell demonstrates that longer incubation times during seeding can reduce residual unseeded library fragments. [Figure 5] Supernatant analysis demonstrates the real-time seeding process in patterned (blue dataset) and non-patterned (green dataset). Within the 5-minute seeding period, the majority of the DNA library is seeded in the non-patterned FC lane, leaving very little DNA in the supernatant (green). In the patterned FC lane, approximately 50% of the DNA library is not seeded and remains in the supernatant after 5 minutes (blue). This new tool is useful for monitoring the seeding process over time. [Figure 6A] 10 illustrates a method of the present disclosure for determining flow cell seeding using label capture or assembly, where low flow cell seeding occupancy is determined, followed by further repeated seeding until the desired seeding occupancy is reached. [Figure 6B] 10 illustrates the disclosed method for determining flow cell seeding using label capture or assembly, showing the process where high flow cell seeding occupancy occurs, followed by clustering and sequencing. [Figure 7]Various signal generation strategies that can be used in the methods of the present disclosure are shown (see, eg, Figures 6A-6B).
[0011] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate one or more embodiments of the present disclosure and, together with the detailed description, serve to explain the principles and implementations of the present disclosure. DETAILED DESCRIPTION OF THE INVENTION
[0012] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a flow cell" includes a plurality of such flow cells, reference to "the DNA library" includes reference to one or more DNA libraries, and so forth.
[0013] Also, unless otherwise stated, the use of "or" means "and / or." Similarly, "comprise," "comprises," "comprising," "include," "includes," "including," "have," "haves," and "having" are interchangeable and are not intended to be limiting.
[0014] It is further understood that where the descriptions of various embodiments use the term "comprising," those skilled in the art will understand that in some specific instances, an embodiment can alternatively be described using the phrase "consisting essentially of" or "consisting of."
[0015] Unless otherwise defined, all technical and scientific terms used in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the methods and compositions of this disclosure, exemplary methods, devices, and materials are described herein.
[0016] The term "amplifying" or "amplification" as used herein is intended to mean the process of increasing the number of template polynucleotide sequences by generating copies of the template. The amplification process can be either exponential or linear, but is typically exponential. In exponential amplification, the number of copies made from a template polynucleotide sequence increases at an exponential rate. For example, in an ideal amplification reaction of 30 rounds, one copy of template DNA is generated into 2 copies. 30 or 1,073,741,824 copies. However, bridge amplification as described herein typically does not occur under ideal conditions; a 30-cycle "exponential" reaction may produce only a few hundred to a few thousand copies of the original template, primarily due to the limited local concentration of surface-bound primers and competition with template rehybridization. In linear amplification, the number of copies made from a template polynucleotide sequence increases at a linear rate. For example, in an ideal 4-hour amplification reaction with a copy rate of 2,000 copies per minute, each copy of template DNA produces 480,000 copies.
[0017] The terms "denaturing" and "denaturation" are broad terms that primarily refer to the physical separation of interacting DNA bases within a Watson-Crick DNA duplex of a single-stranded polynucleotide sequence and its complement. These terms also refer to the physical separation of both of these strands. In their broadest sense, these terms refer to a process that creates conditions that allow annealing of another primer oligonucleotide or polynucleotide sequence to one or both of the strands of the duplex.
[0018] As used herein, the term "flow cell" is intended to mean a chamber having a surface through which one or more fluid reagents can flow. Generally, a flow cell has at least one inlet opening and at least one outlet opening to facilitate fluid flow. Examples of flow cells and associated fluid systems and detection platforms that can be readily used in the methods of the present disclosure are described, for example, in Bentley et al., Nature 456:53-59 (2008), WO 04 / 018497, U.S. Pat. No. 7,057,026, WO 91 / 06678, WO 07 / 123744, U.S. Pat. No. 7,329,492, U.S. Pat. No. 7,211,414, U.S. Pat. No. 7,315,019, U.S. Pat. No. 7,405,281, and U.S. Patent Application Publication No. 2008 / 0108082, each of which is incorporated herein by reference.
[0019] In some embodiments, the flow cell can accommodate an array. Arrays used in nucleic acid sequencing often have a random spatial pattern of nucleic acid features. For example, the HiSeq™ or MiSeq™ sequencing platforms available from Illumina Inc. (San Diego, Calif.) utilize flow cells in which nucleic acid arrays are formed by random seeding followed by bridge amplification. However, patterned arrays can also be used for nucleic acid sequencing or other analytical applications. Exemplary patterned arrays, their fabrication methods, and their uses are described in U.S. Patent Application Publication Nos. 13 / 787396, 13 / 783043, 13 / 784368, 2013 / 0116153 A1, and 2012 / 0316086 A1, each of which is incorporated herein by reference. The features of such patterned arrays can be used to capture single nucleic acid template molecules to seed the subsequent formation of homogeneous colonies, e.g., via bridge amplification. Such patterned arrays are particularly useful for nucleic acid sequencing applications.
[0020] As used herein, the term "isothermal" refers to a process in which the temperature of a system or device remains constant, i.e., ΔT = 0. This occurs when the system / device is in contact with an external thermal reservoir (e.g., a heater, heat bath, thermoelectric controller (TEC), etc.) and actions or changes occur within the system / device at a rate that allows the system / device to continuously adjust to the temperature of the reservoir through heat exchange.
[0021] As used herein, the terms "polynucleotide" or "nucleic acid" refer to deoxyribonucleic acid (DNA); however, where appropriate, those skilled in the art will recognize that the systems and devices herein can also be utilized with ribonucleic acid (RNA). These terms should be understood to include, as equivalents, analogs of either DNA or RNA made from nucleotide analogs. As used herein, these terms also encompass cDNA, which is complementary or copy DNA produced from an RNA template, for example, by the action of reverse transcriptase.
[0022] A "primer oligonucleotide" or "primer" is an oligonucleotide sequence capable of specifically annealing to a single-stranded polynucleotide sequence to be amplified under conditions encountered in the primer annealing step of each cycle of an isothermal amplification reaction. Generally, an amplification reaction requires at least two amplification primers, often designated "forward" and "reverse" primers. In certain embodiments, the forward and reverse primers may be identical. A primer oligonucleotide may contain a "template-specific portion," which is a sequence of nucleotides capable of annealing to a primer-binding sequence in a single-stranded polynucleotide molecule to be amplified during the annealing step (or its complement, when the template is considered single-stranded). The primer-binding sequence is generally a known sequence and, therefore, is specifically complementary to sequences within known sequence-1 and known sequence-2 of the single-stranded polynucleotide molecule. The length of the primer-binding sequence need not be the same as that of known sequence-1 or -2 and may be shorter, e.g., 16-50 nucleotides, 16-40 nucleotides, or 20-30 nucleotides. The optimal length of the primer oligonucleotide depends on many factors, and generally the primer is long enough (complex) so that the possibility of annealing to sequences other than the primer binding sequence is very low. In certain embodiments, the "primer oligonucleotide" is bound to the surface of the flow cell in a random manner (non-patterned flow cell) or to a specific region of the flow cell, such as the surface of a well (patterned flow cell). In further embodiments, the primers bound to the flow cell include P5 and / or P7 primers having the following sequences: P5: 5'AATGATACGGCGACCACCGA 3' (SEQ ID NO: 1) P7: 5'CAAGCAGAAGACGGCATACGAGAT 3' (SEQ ID NO: 2)
[0023] The polynucleotide molecules to be amplified are typically in single-stranded form, such as ssDNA or RNA, or in double-stranded DNA (dsDNA) form (e.g., genomic DNA fragments, PCR, and amplification products, etc.). Thus, single-stranded polynucleotides can be the sense or antisense strand of a polynucleotide duplex. Methods for preparing single-stranded polynucleotide molecules suitable for use in the disclosed systems / devices using standard techniques are known in the art. For example, single-stranded polynucleotides from a complex mixture of polynucleotides can be generated by heating or treatment with hydroxide, followed by dilution. The exact sequence of the primary polynucleotide molecule is generally not critical to the present disclosure and can be known or unknown. Single-stranded polynucleotide molecules can represent genomic DNA molecules (e.g., human genomic DNA), including both intron and exon sequences (coding sequences), as well as non-coding regulatory sequences such as promoter and enhancer sequences. In certain embodiments, the amplified polynucleotide molecules comprise a DNA library. In further embodiments, the DNA library is generated using a library preparation kit. In still further embodiments, the library preparation kit is from Illumina, Inc. (e.g., AmpliSeq™ kit, COVIDSeq™ kit, Illumina DNA prep kit, Illumina RNA prep kit, Nextera™ kit, SureCell WTA™ kit, TruSeq™ kit, and TruSight™ kit).
[0024] As used herein, "solid-phase amplification" refers to a nucleic acid amplification reaction carried out on the surface of a channel of a flow cell such that, upon formation, all or a portion of the amplification product is immobilized on a solid support.
[0025] During nucleic acid amplification using the systems / devices described herein, primers for solid-phase amplification are immobilized to the solid support of the flow cell by covalent attachment at or near the 5' end of the primer, leaving the template-specific portion of the primer free to anneal to its cognate template and the 3' hydroxyl group free for primer extension. The attachment chemistry selected depends on the nature of the solid support and any functionalization or derivatization applied to it. The primer itself may contain a moiety that may be a non-nucleotide chemical modification to facilitate attachment. The primer may contain a sulfur-containing nucleophile, such as a phosphorothioate or thiophosphate, at the 5' end. In the case of a solid-supported polyacrylamide hydrogel, this nucleophile may bind to a bromoacetamide group present in the hydrogel. For example, primers may be attached to the solid support via a 5' thiophosphate attachment to a hydrogel composed of polymerized acrylamide and N-(5-bromoacetamidylpentyl)acrylamide (BRAPA).
[0026] Briefly, for isothermal amplification, double-stranded "adapter" sequences are ligated to each end of the DNA segment to be amplified (e.g., randomly fragmented genomic double-stranded DNA). The DNA-adapter molecules are then flowed into a flow cell, where they randomly attach to the surface of the flow cell channel to form an array of single molecules. If the ligated adapter sequences contain a moiety for surface attachment, the DNA-adapter sequences can be attached directly to the surface. In such cases, attachment is generally performed with an excess of primers complementary to at least a portion of one of the adapter sequences at each end of the ligated segment. Thus, the array is a lawn of primers suitable for polymerase extension, with a distribution of distinct single molecules suitable for amplification. Optionally, primer attachment can be performed after the formation of a distributed array of single molecules for amplification. The DNA-adapter molecules can be attached in either single-stranded or double-stranded form, although the double-stranded form can be processed to yield free single-stranded molecules suitable for amplification.
[0027] In an alternative embodiment, a surface-bound lawn of primers is prepared on the surface of a flow cell for use in the disclosed system / device, followed by hybridization of DNA-adapter sequences to the surface-immobilized primers to form a single-molecule array of hybridized DNA-adapters. If the lawn of primers is randomly positioned on the surface of the flow cell, the flow cell is an "unpatterned flow cell." If the lawn of primers is organized into an array of wells or similar structures separated from one another (with no primers bound to these interstitial regions), the flow cell is a "patterned flow cell." Cycles of extension using polymerase and dNTPs to copy the hybridized strands, followed by denaturation of the original DNA-adapter sequences, generate the desired array of attached single DNA molecules in single-stranded form, which can then be subjected to cycles of isothermal amplification. Thus, the surface of the flow cell contains a lawn of single-stranded primer sequences, allowing "bridge amplification" to occur. In bridge amplification, when the surface is exposed to conditions suitable for hybridization, single-stranded nucleic acid molecules to be amplified form bridges such that adapter sequences on their free ends hybridize with their complementary single-stranded primer sequences attached to the surface of the flow cell. Nucleotides and DNA polymerase are then transported to the flow cell to create complementary strands of the nucleic acid to be amplified. The created double-stranded sequences are then denatured by flowing them through a denaturing reagent, and the process begins again, thus creating clusters of amplified nucleic acids without changing the temperature of the system during the amplification cycle. In typical embodiments, the majority of the clusters are monoclonal and result from the amplification of a single original nucleic acid sequence.
[0028] Generally, the primer oligonucleotides used to create DNA clusters are single-stranded polynucleotides. They can also contain a mixture of natural and unnatural bases and natural and unnatural backbone linkages, provided that any unnatural modifications do not eliminate their function as primers (i.e., their ability to anneal to a template polynucleotide strand during amplification reaction conditions and act as a starting point for the synthesis of a new polynucleotide strand complementary to the template strand). One of the primers can contain a modification that removes (cleaves) the primer from the surface, allowing the formation of a single-stranded cluster. Such linearized clusters can undergo hybridization with additional primer strands, allowing the sequencing reaction to occur.
[0029] The polynucleotides to be amplified are immobilized in an appropriate ratio to obtain an appropriate density of attached single-stranded polynucleotide molecules and primer oligonucleotides when attached to the solid support of the flow cell ("polynucleotide seeding"). In the case of directly immobilized DNA-adapter sequences, the proportion of primer oligonucleotides in the solution mixture used for the immobilization reaction is higher than the proportion of single-stranded polynucleotide molecules. The immobilization reaction can then obtain a lawn of primers with individual single molecules of DNA-adapter sequences. For hybridized DNA-adapter reactions, the density of the clusters is controlled by the concentration of DNA adapter sequences used to hybridize to the lawn of primers. The ratio of primer oligonucleotides to single-stranded polynucleotide molecules is typically such that, when immobilized on a solid support, the lawn of primer oligonucleotides contains multiple primer oligonucleotides positioned at approximately uniform density across the entire flow cell channel or a defined region, with one or more single-stranded polynucleotide molecules individually immobilized at intervals within the lawn of primer oligonucleotides.
[0030] The distance between individual primer oligonucleotides and single-stranded polynucleotide molecules (and thus the density of primer oligonucleotides and single-stranded polynucleotide molecules) can be controlled by varying the concentration of primer oligonucleotides and single-stranded polynucleotide molecules immobilized on the flow cell surface.
[0031] A well-controlled polynucleotide seeding process can ensure consistency in cluster density and sequencing quality. All types of sequencing flow cells have different channel geometric dimensions, surface primer densities, patterning materials, and binding methods, and all of these factors affect the efficiency with which polynucleotides (e.g., DNA libraries) can be seeded onto a surface. Understanding and optimizing the polynucleotide seeding process is important, especially when polynucleotide input is limited or when concatenated long reads are required. Seeding efficiency should be as close to 100% as possible.
[0032] Once the primer oligonucleotides and single-stranded polynucleotides have been seeded and immobilized on a solid support at an appropriate density, extension products can then be generated by performing cycles of isothermal amplification on the covalently linked single-stranded polynucleotide molecules, such that each colony contains multiple copies of the original immobilized single-stranded polynucleotide molecule (and its complementary sequence). One cycle of amplification consists of the steps of hybridization, extension, and denaturation. Such steps are generally equivalent to conventional nucleic acid amplification procedures, such as PCR, in terms of reagent components (e.g., buffers, etc.). Suitable reagents for amplifying nucleic acids (e.g., hybridization, extension, etc.) are well known in the art. Exemplary reagents are described in more detail below.
[0033] Thus, a neutralization / hybridization buffer can be applied to the single-stranded polynucleotide molecule and a plurality of primer oligonucleotides (the primer oligonucleotides hybridize to and are complementary to a region or template-specific portion of the single-stranded polynucleotide molecule) such that the unbound ends of the surface-bound single-stranded polynucleotide molecule hybridize to the surface-bound primer oligonucleotides to form a complex. This process creates a "bridge" structure. See also WO 0246456, U.S. Patent Application No. 60 / 783,618, WO 9844151, and WO 0018957 for further discussion of bridge amplification.
[0034] Suitable neutralization / hybridization buffers are well known in the art (see Sambrook et al., Molecular Cloning, A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory Press, NY; Current Protocols, eds. Ausubel et al.), as well as the schematic section describing amplification below. Suitable buffers may contain additives such as betaine or organic solvents to normalize the melting temperatures of different template sequences, and detergents. An exemplary hybridization buffer contains 2 M betaine, 20 mM Tris, 10 mM ammonium sulfate, 2 mM magnesium sulfate, 0.1% Triton, 1.3% DMSO, pH 8.8.
[0035] An extension reaction is then carried out by applying an extension solution containing an enzyme having polymerase activity and dNTPs to the bridge complex. The primer oligonucleotide of the complex is extended by sequentially adding nucleotides to generate an extension product complementary to the single-stranded polynucleotide molecule. Suitable extension buffers / solutions are well known in the art (e.g., Sambrook et al., Molecular Cloning, A Laboratory Manual, 3 rdEd., Cold Spring Harbor Laboratory Press, NY; Current Protocols, eds. Ausubel et al.) and the Examples below.
[0036] Examples of enzymes with polymerase activity that can be used in the disclosed systems / devices include DNA polymerases (Klenow fragment, T4 DNA polymerase) and thermostable DNA polymerases from various thermophilic bacteria (such as Taq, VENT, Pfu, Bst, and Tfl DNA polymerases), as well as their genetically modified derivatives (such as TaqGold, VENT exo, and Pfu exo). Because the amplification reactions performed on the flow cell are isothermal, it is understood that additional and / or alternative DNA polymerases can be used compared to the polymerases used for thermal cycling amplification, and in most embodiments, there is no specific requirement that the polymerase be thermostable. Additionally, while enzymes with strand displacement activity, such as Bst polymerase, perform better in growth effect clusters for sequencing, any DNA polymerase can be used.
[0037] The nucleoside triphosphate molecules used to create DNA clusters are typically deoxyribonucleotide triphosphates, such as dATP, dTTP, dCTP, dGTP, etc. Nucleoside triphosphate molecules can be naturally occurring or non-naturally occurring.
[0038] After the hybridization and extension steps, the support and attached nucleic acid are subjected to denaturing conditions. Suitable denaturing buffers are well known in the art (see, for example, Sambrook et al., Molecular Cloning, A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory Press, NY; Current Protocols, eds. Ausubel et al.). The system / device of the present disclosure generates isothermal nucleic acid amplification, and therefore, the nucleic acid strands herein are not denatured by temperature elevation or manipulation, but rather by other methods (e.g., chemical, physical, etc.). For example, it is known that changes in pH and low ionic strength solutions can denature nucleic acids at substantially isothermal temperatures. Formamide and urea form new hydrogen bonds with the bases of nucleic acids, disrupting the hydrogen bonds that result in Watson-Crick base pairing. These result in single-stranded nucleic acid molecules. Alternatively, strands can be separated by treatment with a low-salt, high-pH (>12) solution or by using chaotropic salts (e.g., guanidinium hydrochloride). In certain embodiments, sodium hydroxide (NaOH) solution is used at a concentration of about 0.25 M to about 0.1 M. In alternative embodiments, 95% formamide in water or 100% formamide is used. Such formamide embodiments offer additional advantages, as hydroxide treatment can damage the surface and, in some cases, result in lower intensity clusters. Like other reagents used, such denaturing reagents are passed through the flow channel.
[0039] After denaturation, two immobilized nucleic acids are present: the first is the original immobilized single-stranded polynucleotide molecule, and the second is its complement extended from one of the immobilized primer oligonucleotides. Further rounds of amplification can then be initiated by subjecting both the original immobilized single-stranded polynucleotide molecule and the immobilized extended primer oligonucleotide (complement) to additional cycles of hybridization, extension, and denaturation on the support. Such further rounds of amplification result in nucleic acid colonies or "clusters" containing multiple immobilized copies of the single-stranded polynucleotide sequence and its complementary sequence. The initial immobilization of the single-stranded polynucleotide molecule means that the single-stranded polynucleotide molecule can only hybridize with primer oligonucleotides located at a distance within the entire length of the single-stranded polynucleotide molecule. Therefore, the boundaries of the formed nucleic acid colonies or clusters are limited to the relatively localized area where the original single-stranded polynucleotide molecule was immobilized. The terms "cluster" and "colony" are used interchangeably herein and refer to distinct sites on a solid support composed of multiple identical immobilized nucleic acid strands and multiple identical immobilized complementary nucleic acid strands. The term "clustered array" or "cluster array" refers to an array formed from such clusters or colonies. In this context, the term "array" should not be understood as requiring an ordered arrangement of the clusters.
[0040] In typical embodiments, the nucleic acid to be amplified is immobilized on the surface of a channel within a flow cell. As used herein, the term "immobilized" is intended to encompass direct or indirect, covalent or non-covalent attachment, unless otherwise indicated explicitly or by context. While covalent attachment is typical in certain embodiments of the invention, all that is generally required is that the molecule (e.g., nucleic acid) remain immobilized or attached to the support under the conditions for which the support is intended to be used, e.g., in amplification applications. Immobilized nucleic acid molecules for amplification can be obtained by directly attaching a suitably modified nucleic acid molecule (either single-stranded or double-stranded) to a suitable reactive surface, or by hybridizing to a surface-immobilized primer, followed by copying the hybridized strand through extension cycles with polymerase and dNTPs. The extended strand or chemically attached double strand can then be subjected to denaturing conditions to generate the desired immobilized single-stranded nucleic acid molecule, which can then be subjected to cycles of isothermal amplification using the instrumentation described herein. The initial step of hybridizing DNA from solution onto the flow cell can be carried out at a higher temperature than the subsequent amplification reaction, which can then be carried out at a substantially isothermal temperature. The hybridization step can also be carried out at the amplification temperature, except that the input nucleic acid strand is supplied to the surface in single-stranded form.
[0041] Some embodiments of preparing a template nucleic acid may include fragmenting the target nucleic acid. In some embodiments, barcoded or indexed adaptors are attached to the fragmented target nucleic acid (e.g., a DNA library). The adaptors may be attached using any number of methods known in the art, such as ligation (enzymatic or chemical), tagmentation, or polymerase extension. In some embodiments, insertion of a transposome containing a discontinuous transposon sequence may result in fragmentation of the target nucleic acid. In some embodiments involving loop transposomes, the target nucleic acid containing the transposon sequence may be fragmented at the fragmentation site of the transposon sequence. Further examples of methods useful for fragmenting target nucleic acids useful for the embodiments provided herein can be found, for example, in U.S. Patent Application Publication No. 2012 / 0208705, U.S. Patent Application Publication No. 2012 / 0208724, and International Patent Application Publication No. 2012 / 061832, each of which is incorporated herein by reference in its entirety.
[0042] The methods of the present disclosure can be performed using a variety of flow cell devices, including flow cell devices manufactured by Illumina, Inc. (e.g., HiSeq, NovaSeq, MiSeq, and NextSeq devices), flow cell devices manufactured by F. Hoffmann-La Roche Ltd. (e.g., GS FLX and GS Junior devices), and flow cell devices manufactured by Life Sciences (e.g., SOLiD / Ion Torrent devices). In certain embodiments, the flow cell device used to perform the methods of the present disclosure is a flow cell device manufactured by Illumina Inc.
[0043] A flow cell typically contains one or more fluidic channels. In further embodiments, one, two, three, four, five, six, seven, eight, or more fluidic channels of a flow cell can be evaluated for polynucleotide seeding efficiency using the methods disclosed herein. As previously described herein, primers can be attached or immobilized to the surface of the flow cell. Typically, the primers attached to the flow cell are single-stranded DNA-containing primers containing known sequences. To perform bridge PCR amplification, it is beneficial to have multiple populations (e.g., two, three, four, etc.) of primers with different but known sequences. For example, Illumina flow cells contain P5 (SEQ ID NO: 1) and P7 (SEQ ID NO: 2) primers attached to the surface of the flow cell, allowing for bridge amplification of target polynucleotides. These target polynucleotides are bridge amplified by including adapter sequences at the ends of polynucleotides with sequences complementary to the P5 and P7 primers. Such adapters can be added to the ends of polynucleotides using reduced copy PCR with primers containing the above sequences. These primers may further include barcode or index sequences. Primers can be attached to the surface of the flow cell using standard chemistries, including silane chemistry, or by attachment to a polymer deposited on the flow cell surface (see, e.g., U.S. Patent Application Publication No. 2012 / 0316086 A1 and WO 2017 / 201198 A1). Primers can be attached or immobilized to the surface of the flow cell in a random manner or as an organized array (i.e., a patterned flow cell). For example, the flow cell surface can include an ordered array of micro- or nanowells containing bound, immobilized primers. The polynucleotides used to seed the flow cells described herein can be derived from any source, including a variety of organisms from different phylogenetic kingdoms. For example, the polynucleotides can be fragmented genomic DNA isolated from a human subject. In certain embodiments, the polynucleotides are in the form of a DNA library.The process of creating a DNA library from a genomic DNA source is known in the art, and many library preparation kits are commercially available. In certain embodiments, the library preparation kit is from Illumina, Inc. (e.g., AmpliSeq™ Kit, COVIDSeq™ Kit, Illumina DNA prep Kit, Illumina RNA prep Kit, Nextera™ Kit, SureCell WTA™ Kit, TruSeq™ Kit, and TruSight™ Kit). The steps of the library preparation kit can include: (A) simultaneously fragmenting and priming the isolated DNA using transposomes; (B) amplifying the fragmented DNA using reduced-cycle PCR, where the PCR amplification primers include index and adapter sequences; and (C) washing and pooling the amplified DNA fragments to form a DNA library. The transposomes can be attached to commercially available substrates such as beads. Polynucleotides were analyzed at 10 seconds, 20 seconds, 30 seconds, 40 seconds, 50 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, 30 minutes, 31 minutes, 32 minutes, 33 minutes, 34 minutes, 35 minutes, 36 minutes, 37 minutes, 38 minutes, 39 minutes, 40 minutes, and 41 minutes. The flow cell may be seeded for a defined length of time including any two of the aforementioned time points, including 42 minutes, 43 minutes, 44 minutes, 45 minutes, 46 minutes, 47 minutes, 48 minutes, 49 minutes, 50 minutes, 51 minutes, 52 minutes, 53 minutes, 54 minutes, 55 minutes, 56 minutes, 57 minutes, 58 minutes, 59 minutes, 60 minutes, 90 minutes, 120 minutes, or fractional increments thereof, or a range therebetween (e.g., 5 minutes to 60 minutes, 10 minutes to 40 minutes, etc.).
[0044] Typically, polynucleotide seeding efficiency (e.g., DNA library seeding efficiency) is investigated by counting the final number of clusters to see how many polynucleotides are captured. The present disclosure provides a method for determining seeding efficiency.
[0045] In one embodiment, the present disclosure provides a method for determining polynucleotide seeding efficiency by looking at the polynucleotides that remain in the bulk seeding solution without being captured on the surface. By collecting and analyzing the supernatant from the flow cell channel at the end of the seeding process, more detailed information about the seeding process can be determined. The methods disclosed herein are useful for verifying seeding on patterned flow cells, where cluster number does not directly correlate with, for example, (1) polyclonality, (2) pre-amplification replication, and (3) library adsorption in the interstitial regions between wells (see Figure 1).
[0046] In certain embodiments, the disclosure provides methods for assessing the seeding efficiency of a flow cell with polynucleotides, the method comprising seeding a flow cell with polynucleotides for at least 1 minute and collecting the supernatant; and quantifying the polynucleotides in the supernatant by using step (a) or (b): (a) amplifying the polynucleotides in the supernatant using qPCR and / or droplet PCR, or (b) re-seeding the supernatant using a second flow cell and counting clusters generated after bridge amplification of the polynucleotides; and determining the seeding efficiency of the flow cell by comparing the number of polynucleotides quantified in the supernatant with the number of polynucleotides used to seed the flow cell.
[0047] The supernatant is collected after the seeding process, and the polynucleotides are quantified using the methods disclosed herein, including qPCR or droplet PCR, or by seeding them on a separate flow cell. Real-time polymerase chain reaction (real-time PCR), also known as quantitative polymerase chain reaction (qPCR), is a molecular biology laboratory technique based on polymerase chain reaction (PCR). It monitors the amplification of target DNA molecules during PCR (i.e., in real time), rather than at the end as in conventional PCR. Real-time PCR can be used quantitatively (quantitative real-time PCR) and semi-quantitatively (i.e., above or below a certain amount of DNA molecules) (semi-quantitative real-time PCR). Two common methods for detecting PCR products in real-time PCR are (1) nonspecific fluorescent dyes that intercalate into any double-stranded DNA and (2) sequence-specific DNA probes consisting of oligonucleotides labeled with fluorescent reporters that can only be detected after hybridization of the probe with its complementary sequence. The qPCR reactions described herein can utilize any commercially available thermostable polymerase used in such PCR reactions and can employ either double-strand binding dyes or probe / quencher systems for quantification. Examples of double-strand binding dyes include, but are not limited to, SYBR® Green I, BRYT Green® Dye, PicoGreen, YOYO-1 iodide, and SYBR® Gold. In certain embodiments, the qPCR reactions disclosed herein utilize sequence-specific probes labeled with a fluorescent reporter and a quencher molecule that binds to the DNA template. Typically, the quencher molecule is a dark quencher that absorbs light across multiple wavelengths and does not emit light. Examples of dark quenchers include, but are not limited to, Dabsyl, Black Hole quencher, Iowa Black FQ, Iowa Black RQ, IRDye QC-1, and Qxl quencher.
[0048] In an alternative embodiment, the present disclosure provides that polynucleotides in the supernatant are quantified by counting clusters generated from seeding the supernatant onto another flow cell. For example, supernatant obtained from a HiSeq or NextSeq flow cell (up to 120 Gb of sequence data) can be used with a Miseq flow cell (up to 12 Gb of sequence data) for quantification. Other permutations / combinations of commercially available flow cells are also envisioned using such a process.
[0049] The present disclosure also provides methods for quantifying flow cell seeding via Library-Mediated Fluorophore Capture or Assembly (LMFCA). In the LMFCA methods of the present disclosure, seeding efficiency is measured in the flow cell using a detectable label. For example, the present disclosure provides a method for assessing the seeding efficiency of a flow cell with polynucleotides, comprising seeding the flow cell with polynucleotides for at least 1 minute, detectably labeling the bound / seeded polynucleotides in the flow cell, quantifying the labeled polynucleotides in the flow cell, and, depending on the seeding efficiency, removing the label and reseeding the flow cell (see, e.g., FIG. 6B) or removing the label and proceeding to clusters and / or sequences (see, e.g., FIG. 6A).
[0050] Methods for labeling nucleotides on the flow cell include, but are not limited to, (i) the use of labeled nucleotides and polymerase, (ii) the use of DNA dendrimers or labeled nanoparticles with fluorophore labels and complementary oligos for hybridization to the seeded polynucleotides, (iii) growing labeled structures from the seeded polynucleotides, and (iv) labeled adapters that bind to the seeded polynucleotides (see Figure 7).
[0051] Suitable labels include fluorescent labels, luminescent labels, radioactive labels, chromogenic labels, etc. Typically, the label is fluorescent or luminescent so that it can be detected and quantified using a CCD camera or the like.
[0052] In one embodiment, a flow cell is seeded with a composition comprising a polynucleotide comprising at least one adapter region under conditions and for a desired time suitable to allow the polynucleotide to "seed" onto the flow cell. The polynucleotide may be seeded at 10 seconds, 20 seconds, 30 seconds, 40 seconds, 50 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, 30 minutes, 31 minutes, 32 minutes, 33 minutes, 34 minutes, 35 minutes, 36 minutes, 37 minutes, 38 minutes, 39 minutes, 40 minutes, 41 minutes, or 42 minutes. The flow cell may be seeded for a defined length of time, including any two of the aforementioned time points, including 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 90, 120 minutes, or fractional increments thereof, or a range therebetween (e.g., 5 minutes to 60 minutes, 10 minutes to 40 minutes, etc.). As shown in Figure 6, once the flow cell is initially seeded, it is contacted with a composition that labels the polynucleotides seeded and retained on the flow cell. Typically, the flow cell is washed to remove any unbound polynucleotides before contacting the polynucleotides seeded on the flow cell with the composition that labels them. As depicted in Figure 7, various techniques for labeling polynucleotides bound to the flow cell are depicted. To determine the efficiency of seeding, the flow cell is then imaged, or a selected region of the flow cell is imaged, to determine the amount of label or "signal" (e.g., fluorescence) present. The "signal" is typically compared to a known signal that includes a particular seeding efficiency to determine the experimentally measured seeding efficiency. As shown in Figure 6A, if sufficient seeding is present based on the measured signal, this can indicate specific occupancy of the flow cell or sites on the flow cell. If the flow cell occupancy is the desired amount, the flow cell is processed to induce clustering and / or for sequence analysis.As depicted in Figure 6B, if the seeding efficiency is too low or insufficient based on the measured signal, the recovered unbound polynucleotides from the initial seeding can be used to "re-seed" the flow cell and a signal measurement performed again to determine the seeding efficiency. This process can be repeated until the desired seeding is present on the flow cell for performing clustering and / or sequencing.
[0053] As depicted in Figure 7, labeling of seeded polynucleotides with labeled (e.g., fluorescently labeled) nucleotides can be performed using adapters sufficient to allow binding of a polymerase in the presence of the labeled nucleotides under conditions that extend the complementary strand of the seeded polynucleotide. The labeled complementary strand does not dehybridize until after quantification of the amount of signal in the flow cell. Once signal quantification is complete, the labeled complementary nucleic acid can be removed by heat and / or salt content.
[0054] In another embodiment of FIG. 7, polynucleotides seeded in a flow cell can be labeled, for example, using a labeled structure containing a sequence complementary to an adapter sequence on the seeded polynucleotide. The sequence complementary to the adapter sequence linked to the labeled structure hybridizes to the adapter sequence on the seeded polynucleotide, thus "linking" the labeled structure to the seeded polynucleotide. The labeled structure can be a nanoparticle containing a fluorescent moiety or a dendrimer containing one of many fluorescent moieties. The labeled structure is not removed until after quantification of the amount of signal in the flow cell. Once signal quantification is complete, the labeled structure can be removed, for example, by cleaving the adapter sequence and / or dehybridizing / denaturing oligonucleotides hybridized to the adapter sequence.
[0055] In yet another embodiment of Figure 7, a method for labeling seeded polynucleotides is depicted, including growing a labeled structure from the end of the seeded oligonucleotide. In this embodiment, an oligonucleotide or homologue to an adapter sequence on the seeded polynucleotide binds to the seeded polynucleotide, and an oligonucleotide structure is grown from the adapter, which structure is detectably labeled. The grown structure is not removed until after quantification of the amount of signal in the flow cell. Once signal quantification is complete, the structure can be removed, for example, by cleaving the adapter sequence and / or dehybridizing oligonucleotides hybridized to the adapter sequence.
[0056] In yet another embodiment of Figure 7, labeled adapters can be attached to seeded polynucleotides and then quantified to determine the amount of label, and thereby the amount of seeded polynucleotides in the flow cell. The labeled adapters can be cleaved or removed after the initial chain extension. The labeled adapters contain a sequence complementary to the cognate adapter nucleotide sequence on the polynucleotide or contain a cognate to a binding partner on the polynucleotide (e.g., biotin / streptavidin, etc.). The adapters contain a detectable label, such as a fluorescent label.
[0057] Kits and articles of manufacture are also provided for use in the flow cell applications described herein. Such kits may include a carrier, package, or container compartmentalized to receive one or more containers, such as vials, tubes, etc., each containing one of the separate elements used in the methods described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers may be formed from a variety of materials, such as glass or plastic.
[0058] For example, a container can contain one or more qPCR and / or Miseq reagents described herein. The container optionally has a sterile access port (e.g., the container can be a solution bag or vial with a stopper pierceable by a hypodermic injection needle). Such kits optionally include the reagents with an identifying description or label or instructions for their use in the methods described herein.
[0059] The kit typically includes one or more additional containers, each containing one or more of a variety of materials (such as additional reagents and / or devices, optionally in concentrated form) desirable from a commercial and user perspective for use in the methods described herein. Non-limiting examples of such materials include, but are not limited to, buffers, diluents, filters, needles, syringes, carriers, packages, containers, vials, labels for the vials and / or tubes listing the contents, and / or instructions for use, and package inserts with the instructions. A set of instructions is also typically included.
[0060] An instructional label can be on or associated with a container. A label can be on a container when letters, numbers, or other symbols forming the label are attached, molded, or etched into the container itself, or can be associated with a container when the label is present in a receptacle or carrier that also holds the container, for example, as a package insert. A label can be used to indicate that the contents are to be used in a particular flow cell application. A label can also indicate directions for using the contents, such as the methods described herein.
[0061] Example Overview of library seeding quantification in a flow cell device. The flow cell was loaded with a known DNA library concentration (see Figure 2). After library seeding, the supernatant was removed from the flow cell lane, and unseeded library fragments were quantified. Two methods were developed to quantify unseeded library fragments from the recovered supernatant (see Figure 3). One method uses qPCR or droplet PCR to determine the unseeded library concentration in the supernatant, while the other method uses an Illumina Miseq flow cell to determine sequencing cluster count results.
[0062] Quantification of library seeding supernatants using Miseq. The results of seeding supernatants recovered from either patterned or regular Hiseq FCs with different seeding times are presented in the Miseq cluster images presented in Figure 4. Within a 5-minute seeding time, there is more DNA in the supernatant recovered from the patterned Hiseq channel, indicating lower seeding efficiency in the patterned Hiseq flow cell compared to the regular, non-patterned flow cell (see Figures 4A-4B). When the library seeding time is extended to 60 minutes, less DNA remains in the supernatant, but there is still a population of DNA fragments that cannot be captured on the surface due to clustering (see Figure 4C). Therefore, the efficiency of the seeding process, including the time criterion, can be determined. Furthermore, seeding efficiencies for patterned and non-patterned flow cells can also be compared, which is not possible using the current method.
[0063] Quantification of library seeding supernatants using qPCR. Quantification of flow cell seeding efficiency was also tested using qPCR. Patterned and non-patterned flow cell lanes were seeded with the same DNA library concentration. Supernatants from different lanes were then collected at specific time points for analysis. qPCR analysis demonstrated that seeding / non-seeding on specific flow cell surfaces can be monitored over time. Furthermore, DNA libraries take longer to be captured by the p5 / p7 surface on patterned flow cells than by the surface of non-patterned flow cells (see Figure 5). Using the aforementioned techniques, surface attraction kinetics can be evaluated to engineer surfaces that provide more efficient polynucleotide seeding on patterned flow cells.
[0064] A number of embodiments of the present disclosure have been described. However, it should be understood that various modifications can be made without departing from the spirit and scope of the present disclosure. Accordingly, other embodiments are within the scope of the following claims.
Claims
1. 1. A method for assessing the efficiency of seeding a flow cell with a polynucleotide, comprising: seeding the flow cell with the polynucleotide for at least 1 minute; The supernatant is collected and subjected to step (a) or (b): (a) amplifying the polynucleotides in the supernatant using qPCR and / or droplet PCR; or (b) quantifying the polynucleotides in the supernatant by using a second flow cell to re-plating the supernatant and counting clusters generated after bridge amplification of the polynucleotides; (c) determining the seeding efficiency of the flow cell by comparing the number of polynucleotides quantified in the supernatant with the number of polynucleotides used to seed the flow cell.
2. The method of claim 1, wherein (i) one channel of the flow cell is evaluated for polynucleotide seeding efficiency, or (ii) two or more channels of the flow cell are evaluated for polynucleotide seeding efficiency.
3. The method of claim 1 or 2, wherein the flow cell comprises a plurality of primers bound to a surface of the flow cell.
4. 4. The method of claim 3, wherein the bound primers comprise a P5 primer having the sequence of SEQ ID NO: 1 and / or a P7 primer having the sequence of SEQ ID NO:
2.
5. The method of claim 3 or 4, wherein the plurality of primers are randomly bound to the surface of the flow cell.
6. The method of claim 3 or 4, wherein the plurality of primers are bound to specific regions of a flow cell.
7. The method of claim 6, wherein the plurality of primers are bound to the surface of an array of wells patterned on the surface of the flow cell.
8. The method of any one of claims 1 to 7, wherein the flow cell is used in a next-generation sequencing device.
9. The method of any one of claims 1 to 8, wherein the polynucleotide comprises an adaptor.
10. 10. The method of claim 9, wherein the adapter is bridge PCR compatible.
11. The method of any one of claims 1 to 10, wherein the polynucleotides comprise a DNA library.
12. The method of claim 11 , wherein the DNA library is generated using a library preparation kit.
13. The DNA library (A) simultaneously fragmenting and priming isolated DNA using transposomes; (B) amplifying the fragmented DNA using reduced cycle PCR, wherein the PCR amplification primers comprise index and adapter sequences; and (C) washing and pooling the amplified DNA fragments to form a DNA library.
14. The method of claim 13 , wherein the transposome is linked to a bead.
15. The method of any one of claims 12 to 14, wherein the DNA library is generated from genomic DNA isolated from a human subject.
16. The method of any one of claims 1 to 15, wherein the polynucleotides are seeded onto the flow cell for 5 to 60 minutes.
17. 17. The method of claim 16, wherein the polynucleotides are seeded onto the flow cell for 10 to 40 minutes.
18. 18. The method of any one of claims 1 to 17, wherein the qPCR comprises a double-strand binding dye that allows quantification of double-stranded amplification products based on the level of fluorescence.
19. 19. The method of claim 18, wherein the double-strand binding dye is selected from SYBR® Green I, BRYT Green® Dye, PicoGreen, YOYO-1 iodide, and SYBR® Gold.
20. 10. The method of claim 1, wherein the qPCR comprises a sequence-specific probe labeled with a fluorescent reporter and a quencher molecule that binds to a DNA template.
21. 21. The method of claim 20, wherein the quencher molecule is a dark quencher that absorbs light across multiple wavelengths and does not emit light.
22. 22. The method of claim 21, wherein the dark quencher is selected from Dabsyl, Black Hole quencher, Iowa Black FQ, Iowa Black RQ, IRDye QC-1, and Qxl quencher.
23. 18. The method of any one of claims 1 to 17, wherein the second flow cell used to quantify the polynucleotides in the supernatant is different from the flow cell in which the polynucleotides are seeded.
24. 24. The method of claim 23, wherein the second flow cell provides up to 12 Gb of sequence data per run and the flow cell seeded with polynucleotides provides up to 120 Gb of sequence data per run.
25. 25. The method of any one of claims 1 to 24, wherein the method is performed multiple times using flow cells seeded with the same concentration of polynucleotide but with different seeding times.
26. 26. The method of claim 25, wherein the efficiency of seeding the flow cell with the polynucleotide is assessed over time over various time points.
27. 10. The method of claim 1, wherein if the seeding efficiency is insufficient, the flow cell is reseeded and the seeding efficiency is measured again.
28. 28. Use of the method of any one of claims 1 to 27 for engineering a flow cell surface with improved seeding efficiency of polynucleotides.
Citation Information
Patent Citations
Column-based separation system, packed column formation method, and sample component purification method
JP2002516167A
Apparatus and method for efficiently capturing nucleic acids
JP2014518639A
Methods for estimating cluster numbers
WO2015189621A1
Methods for optimizing direct targeted sequencing
WO2018161019A1