Systems and methods for classifying particles
The microfluidic system addresses the inefficiencies of existing methods by controlling fluid flow through multiple conduits to sort particles at high rates, achieving efficient and rapid enrichment of target DNA molecules with minimal loss and buffer usage.
Patent Information
- Application Number
- JP2023530741
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-09-28
- Filing Date
- 2021-11-30
- Publication Date
- 2025-09-05
- Estimated Expiration
- 2041-11-30
AI Technical Summary
Existing methods for enriching target DNA molecules or sorting particles with positive optical signals are time-consuming and result in low yields due to the need for manual operation or FACS sorting, which leads to significant particle loss and high buffer usage.
A microfluidic system with a cartridge and instrument that controls fluid flow through multiple conduits, including a detection zone, to sort particles at high rates with minimal loss by varying flow rates in response to detected positive particles, using a pneumatic system with replaceable cartridges.
Enables the sorting of up to 50 million particles in less than two hours with a positive-to-negative particle ratio of 1:10 million to 1:1000, minimizing buffer usage and reducing particle loss, while allowing for high-throughput sorting of rare positive particles.
Smart Images

Figure 0007734312000007 
Figure 0007734312000008 
Figure 0007734312000009
Abstract
Description
[Technical Field]
[0001] The present invention relates to a system for sorting particles (e.g., droplets) by optically detectable properties. The system comprises a microfluidic device capable of sorting particles and an instrument that drives fluid through the microfluidic device and causes sorting events in response to optical signals emitted by the particles.
[0002] The present invention also relates to methods for enriching or isolating nucleotide fragments that contain known nucleotide sequence elements.
[0003] The present invention further relates to a kit comprising a plurality of microfluidic devices and a plurality of fluids configured for use with the microfluidic devices to sort emulsion droplets. [Background technology]
[0004] European Patent EP 3314012 B1 describes a highly effective in vitro method for enriching one or more target DNA molecules from a sample of mixed DNA molecules. The method relies on separating the DNA sample into a large number of particles (droplets) and physically selecting the droplets based on the optical signal emitted by the droplets. Physical selection can be achieved by using a manually operated microfluidic chip or by using a fluorescence activated cell sorter (FACS). In either case, the selection is time-consuming and results in a relatively small number of signal-positive droplets.
[0005] To improve the enrichment yield, we set out to develop an automated system capable of scanning and selecting very large numbers of particles in a relatively short time while avoiding the sample particle loss inherent in FACS sorting.
[0006] It has previously been reported that various types of particles (cells, droplets, droplet-borne particles, etc.) can be sorted by various types of microfluidic devices. Exemplary devices or methods are described in EP 3302801; US 10,697,007; US 8,691,164 and US 8,623,295.
[0007] However, none of these appear to provide for classification of very large numbers of particles in a relatively short time while avoiding the use of large amounts of buffers required for particle spacing necessary to obtain effective classification. Summary of the Invention
[0008] The solution is reached by recognizing that the particle (droplet) population inherent in the method of EP 3314012 B1 is characterized by very few positive particles among very many negative particles.
[0009] Other particle populations, such as fetal cells in a blood sample from a pregnant woman, are characterized by very few positive particles among many more negative particles.
[0010] Recognizing this, the inventors of the present invention have solved the problem of separating a relatively small number of fluorescent positive particles from a large number of negative particles by means of a system for sorting particles in a liquid medium, the system comprising a microfluidic device (cartridge) comprising at least one microfluidic sorting unit, at least one detection zone, and an apparatus for controlling the flow of fluid through the cartridge.
[0011] The present invention provides a method for detecting a particle with a positive particle to negative particle ratio (or expected ratio) of about 1:10 million (mio, 10 6 ) to about 1:100, specifically in the range of about 1:1 million to about 1:1000.
[0012] FIG. 11 illustrates a system of the present invention.
[0013] In one embodiment, the system includes multiple (e.g., eight) individual sorting units and is designed to vary the flow rate through the sorting units in response to detecting positive particles in the sample supply conduit upstream of the sorting junction, minimizing particle loss during sorting and minimizing buffer usage while still allowing for up to 50 million (50×10) sorting. 6 ) can be classified in less than two hours.
[0014] Thus, according to a first aspect of the present invention, there is provided a system for sorting various types of particles, including droplets, in a liquid medium, comprising a cartridge and an apparatus: the cartridge comprises at least one microfluidic sorting unit, the unit comprising (i) at least one sample supply conduit [1] for supplying a sample fluid (the sample fluid comprising a mixture of positive and negative particles to be sorted) to a sorting junction, (ii) at least one microfluidic sorted positive particle conduit [4] for removing fluid comprising positive particles from the sorting junction, and (iii) at least one microfluidic waste conduit [5] for removing waste fluid comprising negative particles from the sorting junction, the unit being characterized in that at least three microfluidic conduits (i), (ii) and (iii) meet at the sorting junction; - said cartridge further comprises at least one detection zone for detecting positive particles in the sample supply conduit (i) upstream of the sorting junction; - The instrument controls the flow of fluid through at least one microfluidic sorting unit and regulates the flow rate of particles in the sample supply conduit in response to detecting positive particles in the supply conduit upstream of the sorting junction.
[0015] A second aspect of the present invention is a separate microfabricated sorting device (cartridge) that fits within but is removable from the instrument. The cartridge comprises at least one microfluidic sorting unit that is an integral part of a sorting lane
[15] . Typically, a cartridge comprises two or more sorting lanes, each comprising a well / reservoir sized to contain all of the extrusion fluid, spacer fluid, sample of suspended particles, waste particles, and sorted positive particles required for sorting. In accordance with a third aspect of the present invention, an instrument is provided that is capable of controlling the flow of fluid through at least one microfluidic sorting unit and that comprises an optical system that, in response to detecting positive particles in the supply conduit upstream of the sorting junction, governs the flow rate of particles in the sample supply conduit, forming two linear (or oblong) detection zones, i.e., upstream and downstream detection zones.
[0016] According to a fourth aspect of the present invention, there is provided a method for classifying particles, comprising using a system, the method comprising the steps of: i. providing a sample fluid containing particles; ii. providing a microfluidic cartridge according to the second aspect comprising a supply well or reservoir with a volume of extrusion fluid, a supply well or reservoir with a volume of spacer fluid, and a supply well or reservoir with a volume of particle sample fluid; iii. inserting the cartridge into the device; iv. Initiating classification on the instrument; and v. After sorting is completed, transferring the sorted positive particles into an appropriate container.
[0017] According to a fifth aspect of the present invention, there is provided a method for in vitro enrichment of one or more target nucleic acid molecules from a sample of mixed nucleic acid molecules, the method comprising the steps of: i. providing a liquid sample of mixed nucleic acid molecules comprising at least one or more specific target nucleic acid molecules and at least one reagent for specifically detecting at least one of said target nucleic acid molecules; ii. forming an emulsion from the liquid sample, the emulsion comprising a plurality of double emulsion droplets, each of the double emulsion droplets comprising a mixed nucleic acid molecule; iii. incubating the emulsion droplets to obtain a specific detectable reaction within the droplets containing at least one specific target nucleic acid molecule; iv. loading the reacted droplets into a system for sorting droplets according to any of the preceding aspects; v. sorting the microdroplets by using the system; vi. collecting the sorted droplets in a suitable container and coalescing the sorted droplets; and vii. Subjecting the coalesced and selected droplets from step vi to a general amplification procedure.
[0018] According to a sixth aspect of the present invention, there is provided a kit for sorting droplets and / or for concentrating one or more target DNA molecules in vitro, the kit comprising: a) at least one cartridge according to the second aspect; b) at least one gasket for at least one cartridge to an instrument of a system for sorting particles, in particular a system according to the first aspect, to obtain the necessary gap-free connection between the opening of the cartridge and the corresponding opening of the instrument; and c) one or more vials of extrusion buffer and space buffer in amounts sufficient to perform the number of sorts supplied by the one or more cartridges of the kit.
[0019] The present invention relates to various aspects, including the apparatus and methods described above and below. Each aspect may provide one or more of the benefits and advantages described in connection with one or more of the other aspects. Each aspect may have one or more embodiments having all or only some of the features corresponding to the embodiments described in connection with one or more of the other aspects and / or disclosed in the appended claims.
[0020] Other systems, methods, and features of the invention will be, or will become, apparent to one with skill in the art upon examination of the following figures and detailed description. It is intended that all such additional systems, methods, and features be included within this description, be within the scope of the invention, and be protected by the accompanying claims.
[0021] [Brief description of the drawing] The drawings illustrate the design and practicality of the embodiments. These drawings are not necessarily drawn to scale. The drawings may depict only typical embodiments and therefore should not be considered limiting of the scope of the invention. [Brief explanation of the drawings]
[0022] [Figure 1] Schematic diagram of a classification junction of the present invention, with arrows indicating the direction of fluid flow. [Figure 2] Schematic diagram of one embodiment of the central part of a classification unit of the present invention. Arrows indicate the direction of fluid flow. Particles are represented by black spheres. The dashed box indicates the downstream detection zone. [Figure 3] Schematic of one embodiment of a sorting lane pair and associated inlet and outlet orifices / ports. Two detection zones are also shown. [Figure 4]Figure 4A: A close-up of an embodiment of a feed conduit pair upstream of the sorting junction, showing the short and long detection loops used to distinguish the two lanes. Detection zone 1 is also shown. Figures 4B and C illustrate the time interval (time delta) between the first and second detection of positive particles passing through the long and short lanes, respectively. See also Figure 16. [Figure 5] 1 is a close-up view of a preferred embodiment of a pair of classification units showing the second detection zone. The dashed box indicates the downstream detection zone. The use of 1 and 1', for example, is used to indicate similar structures, here the sample supply conduits of two separate classification units of a pair. [Figure 6]
[0033] Figure 6A shows a schematic isometric view of the microfluidic section, and Figure 6b shows a top view of the microfluidic section, in an embodiment where there are four pairs of sorting lanes on one chip. [Figure 7]
[0023] Figure 7a shows a schematic isometric view of the cartridge, Figure 7b shows a top view of the cartridge, and Figure 7c shows a cross-sectional side view along AA of Figure 7b. [Figure 8] Overlay of bright-field and fluorescent images after droplet generation but before classification. A small fraction of the droplets contained fluorescent beads. In this image, only one droplet contained beads, indicated by the arrow. A close-up of this droplet is shown as the inset. [Figure 9] Overlay of bright-field and fluorescence microscopy images of sorted droplets. Arrows point to double emulsion droplets containing beads. Dashed arrows point to double emulsion droplets without beads. [Figure 10] Overview of the System and Method: Arrows indicate the direction of fluid flow within the conduit. [Figure 11] FIG. 1 is a schematic diagram showing that a preferred embodiment of the device can accommodate both single and double emulsion droplet generation cartridges as well as particle sorting cartridges according to the present invention. [Figure 12] Schematic diagram of the main components of the instrument. [Figure 13]1 is a schematic diagram of pressure management components of one embodiment of the device. [Figure 14] A series of magnified photographs of the sorting junction during sorting are shown. The left side of the figure is a micrograph, and the right side is a black-and-white interpretation of the micrograph. Figure 14a illustrates the situation before the gate opens. Figure 14b illustrates the situation as the gate opens. Figure 14c illustrates the droplets being sorted. Figure 14d illustrates the situation as the gate closes again. The arrows indicate the direction of fluid flow within the conduit. Note that meta-cresol purple was added to the droplet sample buffer containing the double emulsion droplets to visualize the operation of the sorting function under bright-field microscopy. Time stamps: Figure 14a 0.780 s; Figure 14b 0.868 s; Figure 14c 1.111 s; and Figure 14d 1.404 s. [Figure 15] Detection of positive droplets using a silicon photomultiplier tube. The graph shows the voltage readout (mV) from the photomultiplier tube (PMT) as a function of time (s). [Figure 16] The figure shows the measured delay times from two lanes of a classification lane pair with different loop lengths. The vertical axis shows the time interval (ms) between the dual peaks. The two boxes show the 75% confidence interval. [Figure 17] Figure 17 illustrates the situation when no positive particles are observed in the upstream detection zone. In this situation, there is no or limited spacer fluid inflow and the fluid velocity in the sample supply conduit is high. Figure 17a is a micrograph of the sorting unit during this stage. Figure 17b is a close-up of the sorting junction, and Figure 17c is a black and white interpretation of the sorting junction. [Figure 18] Figure 18 shows double emulsion droplets produced using the device of the present invention and a double emulsion production cartridge. Figure 18a shows micrographs from six individual preparations. Figure 18b is an enlarged view of the portion shown in Figure 18a. [Figure 19] 1 is an example of a single emulsion droplet produced using the device of the present invention and a single emulsion production cartridge. [Figure 20]A sorting junction with an extrusion buffer inlet is compared to a junction without an extrusion buffer inlet. Figure 20, panels A-D, illustrate a sorting junction with an extrusion buffer inlet. Figure 20, panels E-H, illustrate a sorting junction without an extrusion buffer inlet. Figure 20, panels A and E, illustrate the situation before sorting. Figure 20, panels B and F, illustrate the situation during sorting. Figure 20, panels C and G, illustrate the situation immediately after sorting (post-sorting time point 1). Figure 20, panels D and H, illustrate the situation later after sorting (post-sorting time point 2). P1 indicates the pressure in the extrusion fluid conduit. P2 indicates the pressure in the sample supply conduit. P3 indicates the pressure in the negative particle conduit (waste conduit). P4 indicates the pressure in the positive particle conduit (sorted droplet conduit). Arrows indicate the direction of fluid flow. The shading illustrates the situation when, for example, meta-cresol purple is added to the droplet sample buffer containing the double emulsion droplets in order to visualize the operation of the sorting function under bright-field microscopy. [Figure 21] Actual positive droplet sorting is shown. Panels A, A', and A'' show the situation before sorting. Panels B, B', and B'' show the situation immediately after sorting of positive particles [7], and panels C, C', and C'' show the situation approximately 6 ms after sorting. Panels A, B, and C show actual micrographs. Black arrows point to positive particles, and white arrows point to negative particles. Panels A', B', and C' show highlights of the micrographs, and panels A'', B'', and C'' show line drawings of panels A, B, and C. [Figure 22]Effect of spacer fluid and fluid flow rate. The left side of the figure is a micrograph, and the right side is a black-and-white interpretation of the micrograph. Arrows indicate the direction of fluid flow. Panel A is time-stamped at 1.135 s, Panel B is time-stamped at 2.003 s, Panel C is time-stamped at 4.655 s, and Panel D is time-stamped at 4.770 s. Figure 22, Panel A, illustrates the situation before positive particles are detected in the upstream detection zone. In this situation, a relatively high pressure is applied to the particle sample inlet, and no or very limited pressure is applied to the spacer fluid inlet. As a result, the fluid velocity in the sample supply conduit is high, and very limited spacer fluid flows into the spacer fluid junction. Figure 22, Panel B, illustrates the situation when the pressure is switched to a moderate pressure on the particle sample inlet and a relatively high pressure on the spacer fluid inlet. As a result, the fluid velocity in the sample supply conduit is low, and the spacer fluid flows into the spacer fluid junction significantly. Figure 22, panel C, illustrates the situation just before the pressures on the particle sample inlet and spacer fluid inlet switch to the situation shown in Figure 22, panel D. Figure 22, panel D, illustrates the situation just after the pressures on the particle sample inlet and spacer fluid inlet switch to a relatively high pressure at the particle sample inlet and a relatively low pressure at the spacer fluid inlet, thereby restoring the situation shown in panel A, where there is high fluid velocity in the sample supply conduit and limited spacer fluid flow at the spacer fluid junction. [Figure 23] FIG. 1 is a cross-sectional view of a preferred embodiment of the instrument showing portions of the manifold and cartridge support tray. [Figure 24] FIG. 1 is a perspective view of the manifold and cartridge support tray of a preferred embodiment of the instrument, with a cartridge including a gasket inserted. [Figure 25] 1 is a cross-sectional view showing a portion of the manifold and cartridge support tray with a cartridge inserted, the manifold in a raised configuration that allows cassettes to be loaded and unloaded from the instrument. [Figure 26]1 is a plan view of a preferred embodiment of the instrument showing a portion of the manifold and cartridge support tray with a cartridge inserted, the manifold in a raised configuration; [Figure 27] 1 is a diagram of one embodiment of a pneumatic system, note that the system's directional three-way valve is not shown. [Figure 28] Schematic diagram (piping and fixture diagram) of the pneumatic system shown in Figure 27. [Figure 29] FIG. 1 is a flow diagram illustrating an automatic alignment procedure. [Figure 30] 1 is a schematic diagram of an optical system provided in an optical head. [Figure 31] A diagram illustrating the concept of loop time. Loop time is the time it takes for a droplet to travel from point a to point b. Therefore, the loop time in situation A is a relatively long loop time, while the loop time in situation B is a relatively short loop time. The arrows indicate the direction of flow. [Figure 32] FIG. 1 is a cross-sectional view of one embodiment of the instrument showing the manifold, cartridge support tray, and optical head in the open (unclamped) position. [Figure 33] 1 is a cross-sectional view of one embodiment of a manifold and cartridge support tray with a single emulsion cartridge, including a gasket, inserted, with the assembly in the open (unclamped) position. [Figure 34] 1 is a perspective view of one embodiment of an optical head alignment mechanism showing three actuators; [Figure 35] 3D diagram of an exemplary system according to the present invention, including an instrument for driving fluid through a microfluidic device inserted therein. Panel A shows the instrument in a closed configuration, and panel B shows the instrument in an open configuration. [Figure 36] 1 shows an embodiment of a manifold and cartridge support tray with a cartridge including a gasket inserted, in a closed position with the cartridge clamped to the manifold, Panel A is a perspective view and Panel B is a cross-sectional view. [Figure 37]An example of a signal recorded by the instrument during a sorting cycle. Panels A and B show a 1-second recording, while panels C and D show a 20-second signal recording. The latter shows four successful sorting cycles. Panels A and C show the instrument's valve stage as a function of time in milliseconds; note the different time scales. Each valve can be two-stage (low pressure or high pressure). The curve marked "I." indicates the valve stage, which refers to the pressure in the extrusion buffer
[0608] , spacer buffer
[0612] , and droplet buffer
[0613] conduits. The curve marked "II." indicates the valve stage, which refers to the pressure in the sorting conduit
[0617] . The curve marked "III." indicates the valve stage, which refers to the pressure in the waste conduit
[0618] . Panels B and D show the signal detected by the instrument as a function of valve stage and time; note the two different time scales in B and D. "DZ1" indicates the signal detected by the detector in upstream detection zone 1 [12 / 801]. "DZ2" indicates the signal detected by the detector in downstream detection zone 2 [13 / 802]. DETAILED DESCRIPTION OF THE INVENTION
[0023] [Definition] Prior to the discussion of detailed embodiments of the present invention, definitions of certain terms related to key aspects of the present invention are provided.
[0024] As used herein, the term "amplification" may refer to a reaction that produces multiple copies of at least one segment of a template molecule.
[0025] As used herein, the terms "oil," "emulsion oil," and "carrier fluid" may be used interchangeably with respect to single emulsion droplets. In the case of double emulsion droplets, the carrier fluid is typically an aqueous fluid.
[0026] A "feeding conduit" is a conduit that connects a sample entry well or vessel with a sorting junction (ie, a conduit that extends from a sample entry well to a sorting junction).
[0027] "dMDA" refers to multiple displacement amplification (MDA) technology performed in droplets (Blanco et al (1989) J. Biol. Chem. 264: 8935-40; Zanoli et al (2013) Biosensors 3, 18-43).
[0028] As used herein, the term "droplet" refers to a small, typically spherical, volume of liquid surrounded by an immiscible fluid, such as the continuous phase of an emulsion. Throughout this disclosure, the terms "droplet" and "micro-droplet" are used interchangeably. It refers to droplets that form an emulsion of droplets, each of which is comparable in size to the microfluidic device. The droplets may be spherical or have other shapes depending on the external environment.
[0029] Typically, the droplets have a volume of 1 μL or less, preferably 1 nL or less, for example, 0.0001 nL to 1 nL. Single emulsion droplets are usually larger than double emulsion droplets.
[0030] The term "double emulsion droplet" refers to a water-in-oil-in-water droplet (also known as a w / o / w droplet), which consists of an aqueous droplet inside an oil droplet, i.e., an aqueous core and an oil shell surrounded by an aqueous carrier fluid.
[0031] Preferably, the double emulsion is a monodisperse emulsion, i.e., an emulsion consisting of droplets of approximately equal volume. Typically, the w / o / w droplets have a volume of less than 1000 pL, preferably less than 100 pL. Preferably, the w / o / w droplets have a volume in the range of 0.1 pL to 50 pL, more preferably 0.25 pL to 25 pL, even more preferably 0.5 pL to 10 pL, specifically 1 pL to 5 pL.
[0032] For some applications, such as when mammalian cells are encapsulated within the droplets, w / o / w droplets may have a volume between 3 pL and 500 pL. Preferably, w / o / w droplets have a volume in the range of 5 pL to 200 pL, more preferably 30 pL to 150 pL.
[0033] The term "single emulsion droplet" refers to an isolated portion of an aqueous phase completely surrounded by an oil phase.
[0034] Preferably, the water-in-oil emulsion is a monodisperse emulsion, i.e., an emulsion consisting of droplets of equal volume. Techniques for producing such a homogeneous distribution of diameters are well known to those skilled in the art (see, for example, WO 2004 / 091763).
[0035] The term "downstream" refers to a component or module that is in the direction of fluid flow from a given reference point within a microfluidic system, which in this context is the sorting junction.
[0036] The term "upstream" refers to a component or module that is in the opposite direction to fluid flow from a given reference point in a microfluidic system; in this context, the reference point may be, for example, a spacer fluid junction or a sorting junction.
[0037] "Fluorocarbon oils," perfluorocarbons, or PFCs, are fluorinated organic oils that typically have a density greater than that of water. Examples of usable oils include Fluorinert™ FC-40 (Sigma-Aldrich, St. Louis, Missouri, USA); Krytox™ (Chemours, Wilmington, Delaware, USA); and Novec™ oil (3M Co., Maplewood, Minnesota, USA).
[0038] As used herein, the term "identifying characteristic" refers to any characteristic of an entity that can be used to identify the entity. It can be an optically detectable signal (e.g., a fluorescent signal), or any other signal (e.g., a magnetic or radioactive signal).
[0039] The term "microfabricated" is used to describe a fabrication method that results in a device with one or more fluid conduits or features that are on the microscale.
[0040] Throughout this text, the terms "microfabricated device," "microfluidic device," and "cartridge" are used interchangeably. They can refer to a portion of a system that includes a microfluidic network that can sort a suspension of particles when supplied with the appropriate fluids and given conditions that promote flow through the microfluidic network. They can also refer to a droplet-forming device that includes a microfluidic network and fits within an instrument. Typically, such devices (cartridges) are made from two or more parts made from one or more types of polymers, such as PMMA (poly(methyl methacrylate)), polycarbonate, polydimethylsiloxane (PDMS), COC cyclic olefin copolymers (COC), including TOPAS, COP cyclic olefin polymers (COP), including ZEONOR®, polystyrene (PS), polyethylene, polypropylene, or negative photoresist SU-8. Additionally, cartridges can include parts made from materials including glass, silicon, or other hydrophilic materials.
[0041] The term "microfluidic" refers to a device / unit in which at least a portion of the device / unit has at least one dimension, such as width and / or height, smaller than 1 mm and / or a cross-sectional area smaller than 1 mm. 2 "Microscale" means comprising one or more fluid conduits that are microscale, e.g., smaller than 500 μm, e.g., at least a portion of the fluid conduit network, e.g., a conduit, opening, or junction, may have a smallest dimension, such as a height or width, that is less than 500 μm, e.g., less than 200 μm, e.g., less than 20 μm.
[0042] A "collection orifice" is an orifice through which a sorted positive particle collection well is in fluid communication with a positive particle conduit.
[0043] A "particle" is defined as a discrete unit of matter, including, but not limited to, a droplet or a cell. The term particle includes not only cells but also other particles, such as beads, nuclei, nucleotides, viruses, protein complexes, or proteins, biochemical or chemical compounds, and includes particles contained within droplets. In this context, all droplets are referred to as droplets, whether they are single or double emulsion droplets, large or small, spherical or elongated. Thus, in this patent, the term droplet is used to include spherical droplets, plugs, and slugs.
[0044] The term "positive particle" is used to describe a particle that exhibits, or can be made to exhibit, a selected distinguishing characteristic, whether that characteristic may be optically detectable, for example a specific fluorescent, ultraviolet or color change signal; characteristic light scattering, luminescence or absorption, or even detectable by a signal mediated by a radiological, electromechanical or magnetic source, etc.
[0045] "PCR" refers to the polymerase chain reaction technique, for example as described in US Pat. No. 4,683,195.
[0046] The term "negative pressure" is used to describe a situation in which the pressure exerted on a fluid in a conduit is less than the ambient pressure.
[0047] The term "positive pressure" is used to describe a situation in which the pressure exerted on a fluid in a conduit is greater than the ambient pressure.
[0048] As used herein, the term "reagent" refers to a compound or a set thereof and / or composition that is associated with a sample for performing a specific test on the sample. For example, a reaction reagent may be an amplification reagent, specifically, a primer for amplifying a target nucleic acid, a probe and / or a dye for detecting an amplification product, a polymerase, a nucleotide (e.g., dNTP), magnesium ions, potassium chloride, a buffer, or any combination thereof.
[0049] The term "sample" as used herein is not specifically limited, as long as it contains the specimen to be classified. A sample can be any liquid volume containing a large number of particles. For example, a sample can be a biological sample, such as a biological fluid, a biological entity, or an extract of any such item. Examples of biological fluids include urine, blood, plasma, serum, saliva, semen, feces, sputum, cerebrospinal fluid, tears, mucus, amniotic fluid, etc. A biological entity refers to a cell or a collection of cells, including bacteria and viruses.
[0050] As used herein, the term "loop time" is the time it takes for a particle to travel from a point in the inlet arm of a detection loop to a corresponding point in the outlet arm of the detection loop. This concept is illustrated in Figure 31, where loop time is the time it takes for a particle to travel from point a to point b in the detection loop.
[0051] "XdropSort": Throughout this text, the XdropSort system, device, sorting cartridge or method may be used to refer to a preferred embodiment of the system, device, sorting cartridge, or method of sorting by using the system.
[0052] Similarly, "Xdrop" can be used to refer to preferred embodiments of either the single emulsion generating cartridge (Samplix Item No. CA20100) or the double emulsion generating cartridge (Samplix Item No. CA10100).
[0053] The term "XY plane" refers to the plane indicated by the XYZ coordinate system of FIG.
[0054] The term "negative carrier particles" refers to particles that do not contain sample and are not detectable by the detection system of the present invention. One example of such a negative carrier particle is an oil-in-water droplet. Another example is a water-oil-water droplet, where the internal aqueous phase does not contain a compound that generates a signal in the system.
[0055] [Detailed explanation] The present invention will now be described more fully hereinafter with reference to the accompanying drawings, in which exemplary embodiments of the invention are shown. The present invention may, however, be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art. Like reference numerals refer to like elements throughout. Like elements will therefore not be described in detail with respect to the description of each figure.
[0056] According to the present invention, it is possible to design a functional sorting junction where three microfluidic conduits meet at the sorting junction. The inventors have found that a junction with at least four microfluidic conduits provides more effective sorting and significantly lower loss of positive particles. Therefore, preferably, the present invention relates to an embodiment where four microfluidic conduits meet at the sorting junction [8], and at least one of said conduits supplies extrusion fluid [3] into the sorting junction. See Figure 1.
[0057] The extrusion fluid may be supplied at a variable positive pressure, which has the important function of minimizing possible "back" flow of negative particles from the negative particle conduit (waste) into the positive particle conduit (sorted positive particles). See Example 7. The sorting function may be further enhanced by applying variable negative pressure to the sorted positive particle conduit [4] and waste conduit [5], both of which are carefully controlled by the instrument.
[0058] The present invention is primarily concerned with the classification of particle populations characterized by a low to very low ratio of positive particles to the total number of particles (positive particle frequency).
[0059] Therefore, many approaches have been taken to achieve classification of very large numbers of particles in a relatively short time.
[0060] One approach would be to load particles at a high concentration into the sample supply conduit [1]. However, the inventors have recognized that to achieve effective sorting at the junction point [2], the particles should be spaced so that they pass primarily one by one through the detection zone and into the sorting junction [2]. In a preferred embodiment, this is achieved by designing one or more microfluidic sorting units with spacer fluid conduits and spacer fluid junctions located upstream of the sorting junction point to supply a spacer fluid into the fluid of particles to be sorted. See Example 8.
[0061] The spacer fluid can be supplied at a variable positive pressure that is carefully monitored and controlled by the instrument.
[0062] Figure 2 is a schematic diagram of one embodiment of the central part of the sorting unit [9], showing the upstream spacer fluid conduit
[11] and the spacer fluid junction
[10] . Arrows indicate the direction of fluid flow. Particles are indicated by black ovals.
[0063] The system is designed to detect positive particles at a detection zone located downstream of the spacer fluid junction
[10] . The dotted line
[13] indicates the location of this detection zone in one embodiment. The function of this downstream detection zone
[13] is to trigger a classification event at the junction point [2] in response to detecting a positive particle within the detection zone.
[0064] The positive particles may be detected based on any distinguishing characteristic, but preferably the distinguishing characteristic of the positive particles may be detected optically.
[0065] In a preferred embodiment, detection of positive particles refers to a laser-induced fluorescence signal.
[0066] To facilitate a system with replaceable single-use cartridges, a system in which both the laser and fluorescent signal detection systems are part of the instrument is preferred.
[0067] The passage of particles one by one with sufficient space between them to allow efficient sorting, caused by air pressure applied to the spacer fluid inlet
[18] in response to detecting a positive particle upstream of the sorting junction (see Figure 22), would lead to unacceptably long sorting times unless other measures were taken.
[0068] This obstacle was overcome using an instrument that controls the fluid flow through the microfluidic sorting unit and governs the particle flow rate in the supply conduit in response to detecting a positive particle in the supply conduit upstream of the sorting junction. The innovative concept is that after detecting a positive particle in the detection zone upstream of the sorting junction, the particle flow rate in the sample supply conduit is reduced only temporarily.
[0069] Depending on the specific embodiment, the particle flow rate in the supply conduit is temporarily reduced for a short time after detecting positive particles upstream of the sorting junction. In most embodiments, this time is significantly shorter than 5 seconds, for example, less than 1 s or 500 ms, or even less than 50 ms, followed immediately by an increase in the flow rate. See Examples 4, 5, and 8.
[0070] The spacer fluid introduced into the sample supply conduit is supplied at a variable positive pressure, which comprises a significant portion of the critical variation in flow rate through the sorting unit and is carefully monitored and controlled by the instrument.
[0071] This results in effective sorting of a large number of particles. For embodiments in which the cartridge has eight sorting lanes, the calculated sorting capacity of the system can exceed 28,000 particles / second. The data presented in Example 5 indicate that even higher sorting rates can be expected for particle populations characterized by relatively few positive particles among many negative particles.
[0072] Although the switching frequency of a pneumatic sorting system is lower than that obtainable with, for example, dielectrophoresis devices or optical tweezers, there are significant advantages to a system in which the sorting event is driven by air pressure.
[0073] One advantage is that the system may include simpler cartridges with no moving parts or built-in actuators, leaving it open to instruments based on standard components such as commercially available valves and pumps.
[0074] The pneumatic sorting system is also advantageous because it can accommodate low-cost sorting cartridges with no moving components, and therefore a single-use cartridge design that does not require extensive cleaning of the instrument between different runs. Furthermore, it can be assembled from standard components, thereby reducing costs.
[0075] In a preferred embodiment, the system includes a low-cost cartridge that is removable from the instrument and is adapted for single use. Such a cartridge is designed to ensure minimal to no carryover or contamination of the instrument, and may obsolete the time-consuming wash cycles known from, for example, FACS sorters.
[0076] To minimize carryover or contamination of the instrument, the cartridge may be provided with a set of wells large enough to contain all fluids necessary for sorting, including sample, waste, buffer and the entire volume of sorted positive particles.
[0077] One embodiment of such a cartridge is illustrated in Figure 7. In a preferred embodiment, the cartridge comprises two or more sorting lanes, which may be arranged in pairs.
[0078] Figure 3 shows one design of a classification lane pair
[14] . Importantly, the figure also shows that in this preferred embodiment, each one of the detection zones comprises portions of two separate particle supply conduits of a sorting lane pair.
[0079] The embodiment shown in Figure 3 also shows that the inlets from the extrusion fluid well, spacer fluid well and suspended particle well may be equipped with filters
[22] to prevent dust and the like from entering the microfluidic system.
[0080] Several types of filters can serve this purpose, but pillar filters are preferred, for example those with a distance between the perimeters of the pillars of 15 to 100 μm, and the cross section of each pillar can be any shape, such as circular, square, triangular kite, or trapezoidal.
[0081] The paired configuration of sorting lanes has the important advantage that one detection zone can be designed to detect signals from two separate droplet sorting lanes.
[0082] In the preferred situation where positive particle detection refers to a laser-induced fluorescent signal and both the laser and fluorescent signal detection system are part of the instrument (see Figure 32), the mere physical extent of the optics of the laser and signal detection system can be a challenge to miniaturizing the microfluidic portion of the system. Specifically, in embodiments with multiple (e.g., eight) individual sorting units, size is important. Pairing the sorting lanes saves space by allowing one laser and detection system to monitor two separate droplet sorting lanes. Furthermore, dual-lane detection zones also enable simpler and less expensive instruments. To further simplify and even reduce the cost of the instrument, more parallel sorting lanes can be pneumatically connected to the same pressure source (see Figures 27 and 28).
[0083] As shown in Figure 3, each pair of sorting lanes comprises two separate detection zones: one upstream detection zone
[12] located upstream of the spacer fluid inlet
[10] for detecting droplets before they reach the sorting junction [2], and the other downstream detection zone
[13] located downstream of the spacer fluid inlet for detecting positive droplets before they enter the sorting junction [2]. Further details can be seen in Figure 5.
[0084] An upstream detection zone is used to detect positive particles, and in response to detection, the instrument a) temporarily adjusts downward the flow rate through the sorting unit; and b) determines which lane the positive signal came from.
[0085] Distinguishing which lane a positive signal comes from is provided by a design in which each of the two sample supply conduits is equipped with a detection loop, and the two detection loops can be of different lengths.
[0086] The principle for the identification is illustrated in FIG. Briefly, particles flow from the two sample supply conduits [1] of a classification lane pair into an upstream detection zone
[12] . The instrument applies pressure to force particles into both conduits at (approximately) equal flow rates. As a result of the different lengths of the two detection loops [23 and 24], the time difference between the first (downward) and second (upward) pass through the detection zone is different for the two loops (longer and shorter). The time difference between a particle detected on its first (entering the detection zone) and second (exiting the detection zone) pass can be referred to as the "loop time delta."
[0087] This difference in "loop time delta" is used to determine whether a particle is observed on the long or short side of the detection loop, as illustrated in Figures 4B and 4C, while the "loop time", i.e., the time it takes a particle to travel from a point in the inlet arm of the detection loop to a corresponding point in the outlet arm of the detection loop, is illustrated in Figure 31 and is used to align the sorting cartridge
[25] /
[0201] and the optical head
[1201] .
[0088] In a typical embodiment, this information is used to slow the fluid flow in the sorting lane where positive particles are detected, while the opposite lane (where no particles are detected) continues to operate at its initial high speed without any changes.
[0089] An optional design in which the supply conduit with the short detection loop is equipped with an additional loop
[34] makes the total length of the pair of particle supply conduits the same.
[0090] Figure 3 also shows the location and extent of the downstream detection zone
[13] in one embodiment of the present invention. Figure 5 is an enlarged view of this portion of the cartridge in the most preferred embodiment.
[0091] The function of the downstream detection zone
[13] is twofold. The downstream detection zone may also serve to: 1) trigger a sorting event at the junction point [2] in response to detecting a positive particle entering this detection zone through the sample supply conduit [1 and 1'], and 2) detect whether a correct sorting has occurred. The time difference between the particle being detected the first time (on its way into the downstream detection zone) and the second time (on its way out of the detection zone) in the case of a successful sorting can be used to identify a successful sorting event and may provide other valuable data as well. For example, it may be used to quantify the amount of various compounds (e.g., specific nucleic acids) in a sample.
[0092] Sorting speed is of paramount importance to the present invention. Configuring the sorting lanes in pairs allows for cartridge embodiments with multiple (e.g., eight) individual sorting units. One embodiment is shown in Figures 6 and 7, where the cartridge comprises eight sorting lanes configured in four pairs. A system with such a cartridge can sort over 28,000 particles per second.
[0093] The system can be used to sort many types of discrete units of matter, such as droplets and cells (including eukaryotic cells such as mammalian cells), and other particles (including viruses, protein complexes, or proteins, and particles contained in droplets).
[0094] A particularly preferred embodiment is a system specifically adapted for sorting droplets, which may be single or double emulsion droplets, both those that encapsulate specific materials such as cells and those that do not.
[0095] In either case, the droplet emulsion is formed in a separate operation before the droplets are loaded into the system for sorting.
[0096] There are many methods and devices for forming single or double emulsion droplets. Two particularly relevant approaches for forming either single or double emulsion droplets are described in PCT / EP2020 / 052409 and PCT / EP2020 / 052400. In both PCT / EP2020 / 052409 and PCT / EP2020 / 052400, the system for producing droplets refers to single-use cartridges and devices, all of which are currently sold and commercially available by Samplix (Herlev, Denmark). The Xdrop device (item number IN00100, Samplix, Herlev, Denmark) is designed to perform this task in combination with either a single emulsion production cartridge (Samplix item number CA20100) or a double emulsion production cartridge (Samplix item number CA10100).
[0097] To further improve the use of the present invention in certain embodiments, the device of the present invention, in addition to fitting to and controlling and driving fluids through cartridges, also fits to and controls and drives fluids through cartridges designed to produce single emulsion droplets, such as those described in PCT / EP2020 / 052409 and PCT / EP2020 / 052400 and sold by Samplix (Herv, Denmark). This "multi-purpose" functionality is further illustrated in Figure 11 and Example 5.
[0098] Some important embodiments of the system as presented in the examples are systems and methods related to sorting double emulsion droplets. In such systems, both the preferred extrusion fluid and the spacer fluid are aqueous.
[0099] In a preferred embodiment of the present invention, the cartridge (see Figures 6 and 7) comprises at least eight sorting lanes arranged in four pairs. To minimize loss of sorted droplets and facilitate recovery, the sorted positive particle collection well
[29] has a sloping bottom with the collection well orifice located at the bottom of said collection well.
[0100] Generally, the fluid conduits of the sorting junction [8] are microscale, i.e. the conduits comprise portions that are less than 200 μm wide and less than 200 μm deep, preferably less than 100 μm wide and less than 100 μm deep, or even less than 50 μm wide and less than 50 μm deep.
[0101] To ensure that the cartridge is inserted correctly into the device, the cartridge may be designed asymmetrically so that it only fits into the device when inserted correctly, see FIG.
[0102] A preferred embodiment of the instrument portion of the system is shown in Figure 35. Panel A shows the instrument with the door 1504 closed. Panel B shows the instrument with the door open, the drawer pulled out, and an XdropSort Cartridge 25 / 0201 inserted into the Cartridge Support Tray 108.
[0103] The instrument may comprise an optical head forming an integral unit (see FIG. 32)
[1201] . The optical head comprises an optical system forming two linear detection zones, called upstream and downstream detection zones, or DZ1 and DZ2. The optical head further comprises the optics and detectors necessary for the detection of positive particles.
[0104] Alternatively, particles can be detected by any type of light in the detection zone, with positive particles preferably being detected by a laser-induced fluorescence signal.
[0105] To save space and miniaturize the optical system, the instrument may be equipped with an optical head in which the fluorescent signals emitted from positive particles in both the upstream and downstream detection zones are collected through at least one same single lens, see Figure 30.
[0106] In a preferred embodiment, laser light at approximately 488 nm is directed through a light guide 1205 to two lens systems 1206, each of which projects a line of laser light of approximately 250 x 2000 μm onto the microfluidic section, forming two detection zones 0801 and 0802. Filters ensure that light of wavelengths other than approximately 488 nm is attenuated.
[0107] This arrangement allows for a single collection lens for both detection zones. The detector filter
[1203] passes 515 nm light and reduces light at other wavelengths.
[0108] The cartridge is made of precision molded plastic, but the optical system and cartridge need to be aligned before each run. Therefore, the instrument may be equipped with an alignment system that aligns the cartridge with the optical system.
[0109] Alignment can be achieved by an alignment system with three actuators that moves the optical head in the XY plane, thereby aligning the optical system with the cartridge (see Figures 32 and 34).
[0110] User convenience has been a major consideration in the development of the device, and therefore in the preferred embodiment the alignment system automatically aligns the optical head with the cartridge. The algorithm that governs this is illustrated in the flow diagram of Figure 29.
[0111] Central to the alignment process is the concept of "loop time," shown in Figure 31. Simply put, "loop time" is the time it takes for a droplet to travel from "point a" in the inlet portion of the detection loop
[24] to "point b" in the outlet portion of the detection loop. The detection zone
[12] is designed to allow for an approximation of the loop time. The sensitivity of the optical system can be (automatically) adjusted to detect all particles in the sample. It can be seen that the loop time in situation A is a relatively long loop time, while the loop time in situation B is a relatively short loop time. Alignment then occurs by aligning the optical head with the cassette until the loop times in at least two lanes (typically lane 1 (or 2) and lane 7 (or 8)) are both within preselected limits.
[0112] The instrument controls the flow of fluid through at least one microfluidic sorting unit by a pneumatic system operating at both variable positive and variable negative pressures. In a preferred embodiment, the pneumatic system is connected to the microfluidic system of the sorting cartridge
[0201] via a manifold
[0106] (see Figure 27). A gasket
[0202] ensures that the connection is airtight when the cartridge and gasket are inserted into the cartridge support tray
[0108] and the instrument is in the closed configuration (Figure 35). In this configuration, the cartridge is airtightly clamped to the manifold.
[0113] In the closed configuration, as shown in FIG. 36, the manifold is lowered onto the gasket of the cartridge, clamping the cartridge to the manifold.
[0114] To direct the flow of fluid through a microfluidic device inserted within the instrument, the pneumatic system of the instrument comprises a set of directional control valves capable of applying a high variable positive pressure or a low variable positive pressure to the fluid within the microfluidic device, and another set of directional control valves capable of applying a variable negative pressure or ambient pressure to the fluid within the microfluidic device.
[0115] Figure 28 illustrates one embodiment of the pneumatic system. Three inlets on the cartridge (see, e.g., Figure 3): particle sample inlet
[19] , spacer fluid inlet
[18] , and extrusion fluid inlet
[17] ) are operably connected via a manifold to a pressure system consisting of six different positive pressures (see Figure 28). One set of three pressure conduits operates at relatively high pressures (e.g., 600-1800 mbarg). The other set of three pressure conduits operates at relatively low pressures (e.g., 100-500 mbarg). The specific pressures in all six pressure conduits are precisely regulated by six electronic pressure regulators
[0606] connected to a pressurized air reservoir
[0605] .
[0116] In this embodiment, the inlets for the extrusion fluid
[0608] /
[17] , spacer buffer
[0612] /
[18] and droplet buffer / particle sample
[0613] /
[19] are supplied at either high or low pressure and are controlled by a set of 3 / 2-way valves.
[0117] The outlets for the classified positive particles
[0617] /
[20] and the waste
[0618] /
[21] can be subjected to two different pressures: ambient pressure (0 bar) or a moderate negative pressure (e.g., -100 to -400 mbarg), also controlled by a set of 3 / 2-way valves. The negative pressure valve is also controlled by a signal from the detection system.
[0118] This configuration (also illustrated in Figure 13) provides significantly faster response times compared to configurations in which the pressure to the various ports of the sorting cartridge is regulated by a pressure regulator. Example 9 describes the concentration of positive droplets using a preferred embodiment of the instrument and particle sorting cartridge. The instrument and cartridge may be referred to as the XdropSort instrument and cartridge, while the entire system may be referred to as the XdropSort system.
[0119] Interestingly, the XdropSort instrument and cartridge can also sort cells in single-cell suspensions that are not encapsulated within droplets (including eukaryotic cells, e.g., mammalian cells) (see Example 10).
[0120] The above-described system is specifically designed for sorting particles, specifically droplets, by a method comprising the following steps: 1) supplying a sample of particles, which can be, for example, double emulsion droplets; 2) preparing a microfluidic cartridge by pipetting volumes of extrusion fluid, spacer fluid, and particle sample into three associated supply wells of the microfluidic cartridge; 3) inserting the cartridge into the instrument; 4) setting the instrument and starting sorting; and 5) after sorting is complete, transferring the sorted positive particles into an appropriate container and discarding the cartridge.
[0121] An overview of the method is shown in FIG.
[0122] To obtain the benefits of this system, it is recommended that the instrument be configured to temporarily reduce the particle flow rate in response to a positive signal being detected by the instrument at the upstream detection zone
[12] of the cartridge.
[0123] The transient reduction in flow rate can last from 2 to 0.1 seconds, as shown in Examples 3, 4, and 7. The optimal time for the transient reduction in flow rate depends on the viscosity of the particle sample and needs to be established experimentally.
[0124] Experiments have shown that the method can be further improved if the spacer fluid delivered through the spacer fluid junction contains negative carrier droplets or particles. Negative carrier droplets or particles may also be added to any well of the cartridge to fill cavities and surfaces, thereby reducing the loss of positive droplets or particles. In one embodiment, between 1 and 20 μL of negative carrier droplets are added to at least one sorted particle outlet of the cartridge.
[0125] One of the main applications of the system is its use in an in vitro method for concentrating one or more target molecules from a mixed sample, comprising the following steps: 1) providing a sample of mixed molecules and contacting it with a reagent for specifically detecting at least one of the target molecules; 2) forming a suspension of particulate matter containing the mixed molecules from the sample; 3) incubating the suspension to obtain a specific reaction in the particles containing one or more specific target molecules that is detectable by the device of the invention; 4) loading the reacted particles into the system; 5) sorting the particles using the system of the invention; and 6) collecting the sorted positive particles in an appropriate container for further analysis.
[0126] A particularly preferred embodiment of the in vitro enrichment method relates to the enrichment of one or more target DNA molecules from a sample of mixed nucleic acid molecules and comprises the following steps: 1) providing a liquid sample of mixed nucleic acid molecules comprising one or more specific target DNA molecules and a reagent for specifically detecting at least one of the target DNA molecules; 2) forming an emulsion of a plurality of double emulsion droplets from the liquid sample, each of the emulsion droplets comprising a mixed nucleic acid molecule; 3) incubating the emulsion droplets to obtain a specific detectable reaction within the droplets comprising one or more specific target nucleic acid molecules; 4) loading the reacted droplets into a system for sorting droplets; 5) sorting the microdroplets using the system of the present invention; 6) collecting the sorted droplets in an appropriate container and combining the sorted droplets; and 7) subjecting the combined droplets selected from step 6) to a general amplification procedure.
[0127] In this method, the nucleic acid molecule is preferably a DNA molecule. The preferred reagents for specific detection are PCR reagents, and the specific detection of said one or more target nucleic acid molecules is carried out by PCR (or reverse transcription PCR), and the preferred method for general amplification procedures is Multiple Displacement Amplification.
[0128] It will be appreciated that the functioning of the present invention is critically dependent on the actual cartridge and reagents used and therefore a kit of parts for carrying out the method is provided.
[0129] In a preferred embodiment, the kit of parts comprises at least one cartridge according to the invention; at least one gasket for a snug fit of the at least one cartridge into the system of the invention, in particular into the pneumatic system of the instrument; and vials of buffer fluid (e.g., extrusion buffer) and / or vials of spacer fluid in an amount sufficient to perform the number of classes supplied by the at least one cartridge of the kit.
[0130] The extrusion buffer and spacer fluid may be the same and may be supplied in one vial.
[0131] Any relevant portions of the above disclosure may be understood in light of the following list of references in combination with the disclosed drawings.
[0132] [1] Sample supply conduit [2] Junction point [3] Extrusion fluid conduit [4] Positive particle conduit (classified positive particles) [5] Negative particle conduit (waste) [6] Negative particles [7] Positive particles [8] Classification Junction [9] Classification unit
[10] Spacer fluid junction
[11] Spacer fluid conduit
[12] Upstream detection zone (Zone 1)
[13] Downstream detection zone (Zone 2)
[14] Classification Lane
[15] Classification lane pair
[16] Classification lane pair
[17] Extrusion fluid inlet
[18] Spacer fluid inlet
[19] Particle sample inlet
[20] Classified positive particle outlet
[21] Waste (negative particle) outlet
[22] Filter
[23] Short detection loop
[24] Long detection loop
[25] Cartridge, isometric view
[26] Extrusion fluid supply well or vessel
[27] Space fluid supply well or vessel
[28] Particle sample supply well or container
[29] Sorted positive particle collection well or container
[30] Waste collection wells or containers
[31] Mounting feature for installing gasket
[32] Alignment function
[33] Microfluidics
[34] Additional loop of sample supply conduit
[35] Particle
[36] Extrusion fluid conduit junction
[37] Three-way valve
[38] Timestamp
[0100] Cross-sectional view showing a portion of the manifold and cartridge support tray. Connector to electrical system
[0102] Mounting section, attaching the manifold to the clamping system
[0103] 3 / 2 valve
[0104] Pressure supply conduit (reservoir)
[0105] Pressure supply conduit (reservoir)
[0106] Manifold
[0107] Pressure supply conduit
[0108] Cartridge support tray
[0200] A perspective view of the manifold and cartridge support tray with the cartridge containing the gasket inserted.
[0201] Classification Cartridge
[0202] gasket
[0203] Clamp motor mounting point
[0204] Cartridge Guide
[0205] Alignment pins that fit into holes in the manifold when the manifold is closed.
[0300] FIG. 10 is a cross-sectional view showing a portion of the manifold and cartridge support tray with a cartridge inserted.
[0400] FIG. 10 is a side view of a manifold and cartridge support tray with cartridges including gaskets.
[0402] Alignment springs. They help the cartridges to go into position in the drawer, making the cartridge position more fixed.
[0500] Pneumatic system diagram
[0501] exhaust silencer
[0502] Pressure Inlet Valve
[0503] pressure relief valve
[0504] Exhaust valve
[0505] Vacuum or Negative Pressure Valve
[0601] filter
[0602] pump
[0603] valve
[0604] Pressure Sensors / Switches
[0605] pressurized air vessel
[0606] Pressure Controller
[0607] Positive pressure control
[0608] Extrusion buffer air pressure
[0609] 3 / 2-way valve
[0610] High pressure adjustment
[0611] Low Pressure Adjustment
[0612] Spacer buffer air pressure
[0613] Droplet buffer air pressure
[0614] vacuum pump
[0615] vacuum container
[0616] vacuum adjustment
[0617] Classifier (vacuum)
[0618] Waste (vacuum)
[0800] Schematic of the optical system forming the two detection zones.
[0801] Detection Zone 1
[0802] Detection Zone 2
[1200] 1 is a cross-sectional view of the manifold, cartridge support tray, and optical head in the open position.
[1201] Optical head
[1202] Collection Lens
[1203] Longpass detection filter and lens system (longpass passes light with wavelengths longer than approximately 515 nm)
[1204] detector
[1205] Laser light supply light guide
[1206] Line-generating lens system and short-pass filter (short-pass passes short-wavelength light below approximately 488 nm)
[1207] Actuator, one of three actuators used to align the optical head with respect to the cartridge inserted into the instrument.
[1208] The part of the withdrawal mechanism used to place the cartridge inside the instrument.
[1300] FIG. 1 is a cross-sectional view of the manifold and cartridge support tray with a single emulsion cartridge including a gasket inserted.
[1301] Single Emulsion Cartridge Holder
[1302] Single Emulsion Cartridge
[1400] A perspective view of the alignment mechanism showing the three actuators. The mechanism is seen from below.
[1401] Optical head support plate
[1402] Motor that operates the drawer mechanism
[1501] Touchscreen
[1502] Start button
[1503] Drawer mechanism
[1504] door
[0133] [Invention shown in the form of an embodiment] Preferred aspects and embodiments of the present invention can be found in the following sections of this specification.
[0134] 1. A system for classifying particles in a liquid medium, comprising: a cartridge comprising at least one microfluidic sorting unit; Here, the unit is (i) at least one sample supply conduit [1] for supplying a sample fluid to the classification junction; The sample fluid comprises a mixture of positive and negative particles to be classified; (ii) at least one microfluidic sorted positive particle conduit [4] for removing fluid containing positive particles from said sorting junction; and (iii) at least one microfluidic waste conduit [5] for removing waste fluid containing negative particles from said sorting junction; Equipped with; said unit being characterized in that at least three microfluidic conduits (i), (ii) and (iii) meet at said sorting junction; the cartridge further comprises at least one detection zone for detecting positive particles in the sample supply conduit (i) upstream of the classification junction; and an apparatus for controlling fluid flow through the at least one microfluidic sorting unit and regulating particle flow rate in the sample supply conduit in response to detecting positive particles in the supply conduit upstream of the sorting junction; Equipped with system.
[0135] 2. The system according to item 1, The at least one microfluidic sorting unit [9] comprises: (iv) at least one extrusion fluid conduit for supplying extrusion fluid to said classification junction [3] Furthermore, The unit is characterized in that at least four microfluidic conduits meet at the sorting junction [2]. system.
[0136] 3. A system according to item 1 or 2, The at least one microfluidic sorting unit [9] comprises: (v) a spacer fluid conduit
[11] and a spacer fluid junction
[10] disposed within the sample supply conduit [1] upstream of the sorting junction [2] for supplying a spacer fluid into the sample fluid containing the particles to be sorted; Further equipped system.
[0137] 4. The system according to item 3, having at least two separate detection zones; an upstream detection zone
[12] located upstream of the spacer fluid junction
[10] for detecting droplets before they reach the spacer fluid junction
[10] ; and A downstream detection zone
[13] is located downstream of the spacer fluid inlet for detecting positive droplets before they enter said sorting junction [2]; system.
[0138] 5. The system according to any one of items 1 to 4, The cartridge is removable from the device. system.
[0139] 6. The system according to any one of items 1 to 5, The cartridge comprises a set of wells or containers for fluids capable of containing the total volume of fluids necessary to accomplish the classification, including the sample fluid, the waste fluid, and the classified positive particle fluid. system.
[0140] 7. The system according to any one of items 3 to 6, means for triggering a sorting event by applying air pressure to a spacer fluid inlet
[18] in response to detecting a positive particle upstream of said sorting junction; system.
[0141] 8. The system according to any one of items 1 to 7, means for temporarily reducing the flow rate of particles in the sample supply conduit for one second or less after detecting a positive particle upstream of the sorting junction; system.
[0142] 9. The system according to any one of items 1 to 8, The instrument includes an optical detector for identifying at least one optical signal characteristic of a positive particle within the at least one detection zone of the cartridge. system.
[0143] 10. The system according to item 9, The at least one detection zone comprises a fluorescence detector for identifying at least one fluorescence signal characteristic of a positive particle. system.
[0144] 11. The system according to item 9 or 10, The at least one detection zone comprises a fluorescence detector for identifying a laser-induced fluorescence signal characteristic of a positive particle. system.
[0145] 12. The system according to any one of items 1 to 11, The at least one detection zone comprises a laser and a fluorescence detector for detecting positive particles. system.
[0146] 13. The system according to any one of items 1 to 12, The particles are droplets system.
[0147] 14. The system according to any one of items 1 to 13, The particles are double emulsion droplets system.
[0148] 15. The system according to any one of items 1 to 14, Both the extrusion fluid and the spacer fluid are aqueous fluids system.
[0149] 16. The system according to any one of items 1 to 15, means for supplying said extrusion fluid at a variable positive pressure; system.
[0150] 17. The system according to any one of items 1 to 16, means for supplying said spacer fluid at a variable positive pressure; system.
[0151] 18. The system according to any one of items 1 to 17, means for applying a variable negative pressure to the sorted positive particle conduit [4] and the waste conduit [5]; system.
[0152] 19. The system according to any one of items 1 to 18, The sorting unit is an integral part of the sorting lane
[15] . system.
[0153] 20. The system according to any one of items 1 to 19, The cartridge is removable from the device and is adapted for single use. system.
[0154] 21. The system according to any one of items 1 to 20, The cartridge comprises two or more sorting lanes system.
[0155] 22. The system according to item 21, The two or more classification lanes are configured in pairs. system.
[0156] 23. The system according to item 21 or 22, The at least one detection zone comprises portions of at least two separate particle supply conduits of a pair of sorting lanes. system.
[0157] 24. The system according to any one of items 21 to 23, Each pair of classification lanes comprises an upstream detection zone
[12] and a downstream detection zone
[13] . system.
[0158] 25. The system according to any one of items 21 to 24, The instrument detects signals from two separate sample supply conduits of a classification lane pair; each of said two sample supply conduits is provided with a detection loop; system.
[0159] 26. The system according to item 25, The two detection loops are of different lengths system.
[0160] 27. The system according to any one of items 1 to 26, The downstream detection zone is designed to allow the instrument to detect whether a correct classification has occurred. system.
[0161] 28. The system according to any one of items 21 to 27, The two or more sorting lanes are at least substantially parallel system.
[0162] 29. The system according to any one of items 21 to 28, The two or more sorting lanes are pneumatically connected to the same pressure source. system.
[0163] 30. The system according to any one of items 1 to 29, The device is designed to fit into the cartridge and to control and drive the fluid through the cartridge, as well as to fit into, control and drive the fluid through cartridges made to produce single emulsion droplets and cartridges made to produce double emulsion droplets. system.
[0164] 31. The system according to any one of items 13 to 30, The droplets to be sorted do not contain cells. system.
[0165] 32. A device comprising at least one microfluidic sorting unit according to any one of items 1 to 31. cartridge.
[0166] 33. The cartridge according to item 32, The cartridge comprises a set of wells or containers for fluids capable of containing the total volume of fluids necessary to accomplish the classification, including the sample fluid, the waste fluid, and the classified positive particle fluid. cartridge.
[0167] 34. A cartridge according to any one of items 32 or 33, The cartridge has at least eight sorting lanes arranged in four pairs. cartridge.
[0168] 35. The cartridge according to any one of items 32 to 34, the well or container for collecting the sorted positive particles has a bottom with a sloping surface; and The orifice of the collection well or vessel is provided at the bottom of the collection well or vessel. cartridge.
[0169] 36. The cartridge according to any one of items 32 to 35, The vessels that meet at the sorting junction [8] have a width of less than 100 μm and a depth of less than 100 μm. cartridge.
[0170] 37. The cartridge according to any one of items 32 to 36, The inlets of the wells or vessels for at least the extrusion fluid, the spacer fluid, and the suspended particle fluid are provided with columnar filters, in particular with a distance between the peripheries of the columns of 15 to 100 μm. cartridge.
[0171] 38. The cartridge according to any one of items 32 to 37, The cartridge is designed asymmetrically to ensure correct insertion into the instrument. cartridge.
[0172] 39. Part of the system described in any one of items 1 to 31 Equipment.
[0173] 40. The device according to item 39, said instrument comprising an optical head forming an integral unit comprising an optical system forming two linear detection zones, i.e. said upstream and said downstream detection zone; The optical head further comprises the necessary optics and detector for the detection of positive particles; Equipment.
[0174] 41. The device according to item 40, Positive particles are detected by laser-induced fluorescence signals Equipment.
[0175] 42. The device according to item 41, The fluorescent signals emitted from positive particles in both the upstream and downstream detection zones are collected through a single lens system. Equipment.
[0176] 43. The device according to any one of items 39 to 42, The instrument includes an alignment system for aligning the cartridge with the optical system. Equipment.
[0177] 44. The device according to item 43, The alignment system includes three actuators that move the optical head in the XY plane to align the optical system with the cartridge. Equipment.
[0178] 45. The device according to item 44, The alignment system automatically aligns the optical head with the cartridge. Equipment.
[0179] 46. The device according to any one of items 39 to 45, The instrument controls the flow of fluid through the at least one microfluidic sorting unit by a pneumatic system that operates with both variable positive pressure and variable negative pressure. Equipment.
[0180] 47. The device according to item 46, The pneumatic system includes a set of directional control valves that can provide high or low positive pressure to the microfluidic system, and another set of directional control valves that can provide variable negative or ambient pressure to the microfluidic system. Equipment.
[0181] 48. A method for classifying particles comprising the use of a system according to any one of items 1 to 30, comprising the steps of: i. providing a sample fluid containing particles; ii. Providing a microfluidic cartridge according to any one of items 32 to 38, comprising: a supply well or vessel comprising a volume of extrusion fluid; a supply well or vessel comprising a volume of spacer fluid; and a supply well or vessel comprising a volume of said particle sample fluid; iii. Inserting the cartridge into the device according to any one of items 39 to 47; iv. initiating said classification on said device; and v. after said sorting is completed, transferring said sorted positive particles into an appropriate container and discarding said cartridge; A method comprising:
[0182] 49. The method according to item 48, The particle is a cell, including a eukaryotic cell, such as a mammalian cell. method.
[0183] 50. The method according to item 48 or 49, The sample fluid comprises a single cell suspension, e.g., a suspension of unencapsulated cells. method.
[0184] 51. The method according to any one of items 48 to 50, The particles are cells encapsulated within droplets method.
[0185] 52. The method according to any one of items 48 to 51, The particles are double emulsion droplets method.
[0186] 53. The method according to any one of items 48 to 52, The particle flow rate is temporarily reduced in response to a positive signal being detected by the instrument at the upstream detection zone
[12] of the cartridge. method.
[0187] 54. The method according to any one of items 48 to 53, A spacer fluid is supplied into the sample supply conduit through a spacer fluid junction. method.
[0188] 55. The method according to any one of items 48 to 54, Negative carrier particles are added to any well of the cartridge. method.
[0189] 56. An in vitro method for enriching one or more target nucleic acid molecules from a sample of mixed nucleic acid molecules, comprising the steps of: i. providing a liquid sample of mixed nucleic acid molecules comprising at least one or more specific target nucleic acid molecules and at least one reagent for specifically detecting at least one of said target nucleic acid molecules; ii. forming an emulsion from the liquid sample, the emulsion comprising a plurality of double emulsion droplets, each of the double emulsion droplets comprising a mixed nucleic acid molecule; iii. incubating the emulsion droplets to obtain a specific detectable reaction within the droplets containing at least one specific target nucleic acid molecule; iv. Loading the reacted droplets into a system for sorting droplets described in any one of items 1 to 30; v. sorting the microdroplets using the system; vi. collecting the sorted droplets in a suitable container and combining the sorted droplets; and vii. subjecting the coalesced and selected droplets from step vi to a general amplification procedure; A method comprising:
[0190] 57. The method according to item 56, The at least one target nucleic acid molecule is a target DNA molecule. method.
[0191] 58. The method according to item 56 or 57, said at least one reagent for specific detection is a PCR reagent; and Specific detection of said one or more target nucleic acid molecules is performed by PCR. method.
[0192] 59. The method according to any one of items 56 to 58, The general amplification procedure of step (vii) is carried out by multiple displacement amplification method.
[0193] 60. A kit of parts for carrying out any of the methods described in any one of items 48 to 59, comprising: a) at least one cartridge according to any one of items 32 to 38, b) at least one gasket for fitting said at least one cartridge to an instrument of a system for sorting particles, in particular of a system according to any one of items 1 to 31; and c) at least one vial of buffer fluid in an amount sufficient to perform the number of classifications provided by said at least one cartridge; Equipped with kit. [Example]
[0194] Example 1: Concentration using the Xdrop Sort system [Preparation of droplets containing beads] The initial aqueous sample was supplemented with 3 μl (Alignflow™ Flow Cytometry Alignment Beads for Blue Laser, 2.5 μm, ThermoFisher) mixed into the sample reaction mixture. Double emulsion droplets were generated using Xdrop dPCR's proprietary droplet generation technology as described in Madsen et al., 2020 (Human mutation doi: 10.1002 / humu.24063). dPCR droplets were generated on an Xdrop instrument (item number IN00100, Samplix, Herlev, Denmark) using a double emulsion generation cartridge (Samplix item number CA10100) and standard run parameters (generation time 40 min). Following droplet generation, the frequency of beads in the droplets was quantified by FACS analysis. The frequency was determined to be 0.3% (Figure 8). Droplet generation resulted in an approximately 50:50 mixture of double emulsion droplets (water-oil-water) and single emulsion droplets (oil-water). The droplets generated are shown in Figure 8.
[0195] [Classification] A total of 2,725 positive droplets were sorted using the microfluidic device and an earlier version of the instrument that did not allow for alternating fluid flow rates, and therefore could only process at a slow average rate of 42 droplets / second. The total sorting time was 6 hours.
[0196] After sorting, the droplets were collected, and the sorting efficiency was calculated by comparing the number of bead-containing double emulsion droplets with the total number of double emulsion droplets. The purity of the sorted sample (frequency of bead-positive droplets) was 53.8% (number of bead-containing droplets relative to the total number of droplets).
[0197] [Conclusion] Sorting was performed at a low speed (approximately 42 droplets / second) on a preliminary version of the system for a total of 6 hours. During that time, 2,725 droplets were sorted, and the post-sorting purity was calculated to be 53.8%. The frequency of beads in the droplets started at 0.3%, and the sorting procedure resulted in a 180-fold enrichment.
[0198] Example 2: A classification system can classify double emulsion droplets and, using a feedback loop, correct classification can be quantified. In this example, it is demonstrated that the present invention (Xdrop Sort system) can sort double emulsion droplets into 1 / 2 groups based on fluorescence.
[0199] [material and method] Double emulsion droplets containing fluorescently stained DNA were generated using the method described by Madsen et al., 2020 (Human Mutation doi: 10.1002 / humu.24063). Additionally, meta-cresol purple was added to the droplet sample buffer (i.e., the external buffer containing the double emulsion) to allow visualization of the operation of the sorting function under brightfield microscopy.
[0200] Samplix dPCR buffer ( Madsen et al., 2020 ) was used as both the extrusion buffer and the spacer buffer.
[0201] The microfluidic chip (see Figures 2 and 3) contained a particle sample inlet
[19] and sample supply conduit [1]; a spacer fluid inlet
[18] and spacer fluid conduit
[11] ; an extrusion fluid inlet
[17] and extrusion fluid conduit [3]. The chip also contained a sorted positive particle outlet
[20] and positive particle conduit [4]; a negative particle (waste) conduit [5]; and a waste (negative particle) outlet
[21] . The three inlets (particle sample inlet
[19] , spacer fluid inlet
[18] , and extrusion fluid inlet
[17] ) were operably connected to a pressure system consisting of six different positive pressures (0.1 barg to 5 barg). The two outlet conduits (sorted positive particle outlet
[20] and waste (or negative particle) outlet
[21] ) were operably connected to a pressure system consisting of four ambient or negative pressures (-1 barg to 0 barg). Each inlet or outlet was configured to receive two different pressures. Each inlet was pneumatically connected to an electronic 3 / 2-way valve
[37] /
[0609] , as shown in Figures 13 and 28. Two pressure regulators connected to the 3-way valves regulated the pressure in the connected reservoirs, which were inserted between the regulators and the valves (see Figures 13 and 28). The pressure to each inlet was regulated by a valve that received input based on detecting signals at two detection zones. When the valve was activated or deactivated, the pressure supply therefore changed from one pressure reservoir to another. Using valves rather than direct contact to the pressure regulator has the advantage that fewer pressure regulators are needed, as they can be shared between more individual lines, thereby reducing costs. In addition, the response time of the valves can be significantly shorter than the time required for the pressure regulator to reach a new pressure. This is because the valves immediately open to the alternate pressure reservoir without having to measure and adjust the pressure. As can be seen in Figure 14, the single droplet was sorted and the pressure returned to the "waste" setting in less than 1 second.
[0202] Note that the timestamps are: Figure 14a 0.780 seconds; Figure 14b 0.868 seconds; Figure 14c 1.111 seconds; and Figure 14d 1.404 seconds, i.e., a full cycle takes 0.624 seconds.
[0203] The pressure in the extrusion fluid conduit [3] is set to allow a small portion of the extrusion fluid to enter the waste stream, preventing droplets from entering the positive particle conduit (sorted droplet conduit) [4].
[0204] To allow sorting, the pressure in the sorted positive particle outlet
[20] was changed to a relatively low pressure, and the pressure in the negative particle outlet
[21] was changed to a relatively high pressure. The relative pressure in the positive particle conduit (sorted droplets) [4] compared to the pressure in the negative particle conduit (waste) [5] is now lower, allowing flow into the positive particle conduit [4].
[0205] Droplets in the sample delivery conduit [1] were analyzed by illuminating the conduit in the detection zone with a laser line with a peak intensity at 488 nm. The signal from the conduit was detected using a silicon photomultiplier tube with a bandpass filter of 514.5 ± 0.2 nm, and the detector was directed to detect the signal from the circular area overlapping with the laser line. Both the laser and the detector were positioned below the microfluidic conduit. Positive droplets, which contain a greater amount of DNA than negative droplets, emit more fluorescence after being stained with an intercalating dye, resulting in a higher signal. The presence of a signal above a threshold triggered a change in pressure of the valve connected to the negative particle conduit (waste) from approximately -150 mbarg to ambient pressure, and simultaneously triggered a change in pressure of the valve connected to the positive particle conduit (sorted droplet conduit) from ambient to approximately -150 mbarg. Positive pressure was maintained in the sample delivery conduit [1] and the extrusion fluid conduit [3]. After a while, the pressure in the negative particle conduit (waste conduit) [5] and the positive particle conduit (sorted droplet conduit) [4] was returned to "waste mode" by returning the valves to the "waste" position. Droplets resumed flowing into the negative particle conduit (waste conduit) [5]. Because the extrusion fluid continued to supply a small amount of extrusion fluid into the positive particle conduit (sorted droplet conduit) during "waste" mode, the sorted positive droplets continued to flow forward in the positive particle conduit (sorted droplet conduit) [4] to the sorted positive particle outlet
[20] and sorted positive particle collection well or container
[29] .
[0206] The purity of positive droplets before sorting (ratio of positive droplets to total droplets) was determined by cell sorting and was 0.41% (out of 4.1 million total droplets). The droplets are a mixture of double emulsion droplets and oil droplets. In purity calculations, oil droplets are not counted because they do not contain fluorescence.
[0207] The purity of the positively sorted droplets was determined by comparing the fluorescent and bright-field photographs. The number of oil droplets is also not included in the purity calculation based on bright-field photograph analysis. For all droplets detected (100%), a dual peak (two consecutive peaks within a short time interval) was detected, indicating 100% recovery of positive droplets above the detection threshold. Table 1 shows the results of 16 individual sorting events, all with an initial purity of 0.41% before sorting.
[0208] JPEG0007734312000001.jpg164166
[0209] Example 3: Detection signals from two parallel sorting lines can be distinguished by observing the delay time in the conduit loop region. Figure 15 shows the detection signal obtained using a silicon photomultiplier tube from a positive droplet passing through the downstream detection zone
[13] . The figure shows the voltage output from the photomultiplier tube (PMT) as a function of time. As the positive droplet passed through the detection zone, fluorescence from the droplet was detected. In most cases, a high peak followed by a low peak indicated that the droplet was correctly sorted and re-entered the detection zone through the positive sorting conduit. In one case, only one peak was detected because the droplet was not correctly sorted. This information allowed us to estimate the purity of the sorting efficiency.
[0210] Because lasers and detectors are expensive components, minimizing the number of these components in a system is advantageous. Therefore, a microfluidic device was designed that allows the system to distinguish signals from two different sorting lines by observing the event delay between the droplet's first passage through the upstream detection zone
[12] and its re-entry into the detection zone after passing through the loop (see Figure 4). Because the loops of the two parallel lines have different lengths, the transit time from the first to the second passage is different (see Figure 4a). This can be observed as dual peaks with different time intervals between the peaks from the detector (see Figures 4b and 4c). Figure 16 shows the measured delay times from two lines with different loop lengths, as shown in Figure 4a. The time intervals between the dual peaks from the two conduits are clearly different (the boxes indicate the 75% confidence intervals) and can be used to distinguish whether a particle is passing through the first or second line. In this test, droplets passed through the upstream detection zone at a rate of over 5,000 droplets per second.
[0211] Example 4: Changing the flow rate when droplets are detected allows faster sorting to be achieved. The droplet flow rate in the current system, in which the sample supply conduit [1] is connected to positive pressure at the inlet conduit and negative pressure at the outlet conduit, was determined at a pressure of 1950 mbarg in the droplet inlet conduit, 650 mbarg in the spacer conduit, 325 mbarg in the extrusion buffer conduit, 0 mbarg in the positive classification conduit, and -140 mbarg in the waste conduit. At these pressure settings, a 5 million droplet sample could be processed into the waste conduit in 16 minutes, corresponding to a droplet flow rate of 5200 droplets / second, demonstrating the advantage of operating at both positive and negative pressures at the classification junction. See Figure 17.
[0212] Another advantage of operating with both positive and negative pressure at the gate is that the droplet flow rate can be governed relative to the flow rate in the extrusion buffer conduit. Because the volume in the inlet well containing the droplets
[28] and buffer
[26] and
[27] can be limited, it is advantageous to adjust the relative processing volumes of the two liquids by adjusting the pressures on the two inlet conduits relative to each other.
[0213] Example 5: Increasing the speed when no positive events are detected reduces the total classification time. As described in Example 4, when no sorting was performed and all droplets passed through the negative particle conduit (waste) [5], a maximum flow rate of 5,200 droplets / second was achieved. When positive droplets were detected in the upstream detection zone
[12] , the droplet flow rate was reduced to achieve high sorting efficiency. In response to detecting positive droplets in the upstream detection zone
[12] , the valve controlling the pressure applied to the sample supply conduit [1] was temporarily switched to supply low pressure, rapidly adjusting the droplet flow rate downward. The deceleration time was measured to be approximately 0.8 seconds. The acceleration time to return to the high droplet flow rate was estimated to be 0.1 seconds. The time required to sort the droplets was estimated to be 0.1 seconds, resulting in a total sorting time of approximately 1 second. Depending on the number of positive droplets and the total number of droplets in the sample, a two-speed system would significantly reduce the total sorting time, as shown in Table 2 below.
[0214] JPEG0007734312000002.jpg167166
[0215] Example 6: The device (Xdrop Sort) can also produce single and double emulsion droplets. A double emulsion droplet generation cartridge (item number CA10100, Samplix, Herlev, Denmark) was loaded with sample, oil, and dPCR buffer into six of its eight lines as described in Madsen et al., 2020. A gasket was placed on top of the cartridge, and the assembly was then inserted into the Xdrop Sort instrument. Upon pressing Start, the Xdrop Sort instrument applied pressure to the 6 x 3 wells containing the liquid. The liquid was then forced through the microfluidic emulsion-forming portion of the double emulsion droplet generation cartridge, generating a double emulsion.
[0216] FIG. 18 shows double emulsion droplets generated on six of the six lines loaded using the Xdrop Sort instrument.
[0217] A single-emulsion droplet generation cartridge (item number CA20100, Samplix, Herlev, Denmark) was loaded with sample, oil, and dPCR buffer into eight of its eight lines as described in Madsen et al., 2020. A gasket was placed on top of the cartridge, and the assembly was then inserted into the Xdrop Sort instrument. Upon pressing Start, the Xdrop Sort instrument applied pressure to the eight wells containing the liquid. The liquid was then forced through the microfluidics of the single-emulsion droplet generation cartridge, generating single emulsion droplets.
[0218] FIG. 19 shows an example of a single emulsion droplet generated using the Xdrop Sort instrument.
[0219] Example 7: Extrusion fluid ensures positive droplets are carried away from the sorting junction. Double emulsion droplets containing fluorescently stained DNA were generated using the method of Madsen et al., 2020 (Human Mutation doi: 10.1002 / humu.24063).
[0220] Samplix dPCR buffer ( Madsen et al., 2020 ) was used as both the extrusion fluid and the spacer fluid.
[0221] The microfluidic chip was equipped with a particle sample inlet
[19] , which is the inlet for the sample supply conduit, a spacer fluid inlet
[18] , an extrusion fluid inlet
[17] , a sorted positive particle outlet
[20] , and a waste (negative particle) outlet
[21] (see Figure 3).
[0222] The three inlets were operably connected via corresponding wells, namely, extrusion fluid supply well or vessel
[26] , space fluid supply well or vessel
[27] , particle sample supply well or vessel
[28] , sorted positive particle collection well or vessel
[29] , and waste collection well or vessel
[30] , to a pressure system consisting of six different positive pressures (0.1 barg to 5 barg) and four ambient or negative pressures (-1 barg to 0 barg).
[0223] Each inlet or outlet was arranged to be subjected to two different levels of pressure, as described in Example 2.
[0224] The pressure at the extrusion inlet is set to allow a small portion of the extrusion buffer to enter the waste stream, preventing droplets from entering the "classification" conduit.
[0225] To allow sorting, the pressure in the sorted positive particle outlet
[20] was changed to a relatively low pressure, and the pressure in the negative particle outlet
[21] was changed to a relatively high pressure. The relative pressure in the positive particle conduit (sorted droplets) [4] compared to the pressure in the negative particle conduit (waste) [5] is now lower, allowing flow into the positive particle conduit [4].
[0226] The function of the sorting unit with or without the extrusion fluid conduit junction
[36] at the junction point [2] is diagrammed schematically in Figure 20. The diagram illustrates a situation where the extrusion fluid always flows into the junction, allowing the classified positive particles to move further into the sorting lane (top of the diagram). If a junction without an extrusion buffer system were used instead, the classified positive particles would remain at the gate (the junction point of the positive particle conduit). This significantly increases the risk of the classified positive particles being pulled back into the waste stream (see bottom of the diagram (Figure 20E-H)).
[0227] 21 illustrates real-time sorting of positive droplets in a sorting unit according to the present invention, comprising a junction point with an extrusion fluid conduit junction. The figure shows positive droplets continuing to move into the sorting lane even after they resume flow into the waste conduit. The top and bottom panels are identical except that the droplets are painted solid black and white in the bottom panel. Photographs are taken at 6 ms time intervals.
[0228] Example 8: Speed changes and adding space buffers can be accomplished in less than one second. To achieve fast overall sorting times, it is essential that changes from high to low speed and from low to high speed can be achieved in a short time. To demonstrate fast flow rate changes, the system described in Example 7 was employed.
[0229] Droplets passed through the supply conduit at approximately 5000 droplets / sec. In response to detecting positive particles in the upstream detection zone, the pressure at the sorted positive particle outlet
[20] was changed from a relatively high to a relatively low pressure, and simultaneously the pressure at the spacer fluid outlet was changed from a relatively low to a relatively high level (see Table 4 for example pressures). This resulted in a rapid increase in particle spacing in the downstream portion of the sample supply conduit, as illustrated in panels A and B of Figure 22. Panel A was time-stamped at 1.135 s, and panel B was time-stamped at 2.003 s. The timestamps allowed us to determine exactly when the droplet flow rate reached a slow value of 18 droplets / sec.
[0230] To demonstrate how quickly the flow rate can increase in a short period of time, the pressure was restored to fast flow operation by changing the sorted positive particle outlet from a relatively low pressure to a relatively high pressure and simultaneously changing the pressure of the spacer fluid outlet from a relatively high pressure to a relatively low pressure. This results in an overall higher flow rate in the feed conduit and a lower flow rate in the spacer conduit. Figure 22, panel C, is time-stamped at 4.655 s, and panel D is time-stamped at 4.770 s.
[0231] Table 3 summarizes the results of the speed changes.
[0232] JPEG0007734312000003.jpg77166
[0233] JPEG0007734312000004.jpg155166
[0234] Example 9: Concentration using the Xdrop Sort system [Preparation of droplets] Eight samples of double emulsion droplets were generated using Xdrop dPCR's proprietary droplet generation technology as described in Madsen et al., 2020 (Human mutation doi: 10.1002 / humu.24063). Double emulsion droplets were generated on an embodiment of an instrument according to the present invention, the Xdrop Sort instrument, using a double emulsion generation cartridge (Samplix, item number CA10100) and standard run parameters (generation time 40 minutes).
[0235] Briefly, 40 μL of each of eight samples containing PCR reagents and enzymes, 0.2 μM PCR forward primer (TP53_D_F1) and 0.2 μM PCR reverse primer (TP53_D_R3), both directed against human TP53, and 10 ng human genomic DNA, were loaded into the sample well of the cartridge, oil was loaded into the oil well, and external aqueous buffer was loaded into the buffer well. The cartridge was inserted into the Xdrop Sort instrument, and droplet generation was initiated from the instrument's screen using the double emulsion generation program. The Xdrop Sort instrument then applied positive pressure to the eight lanes, thereby forcing three liquids into the microfluidic structure below the cartridge, producing 8 to 10 million double emulsion droplets per lane. The droplets were collected from the outlet well of the double emulsion droplet generation cartridge and transferred to PCR tubes. The emulsion samples were PCR cycled with the following program: 1× [94°C, 2 min], 40× [(94°C, 3 s), (60°C, 30 s)].
[0236] TP53_D_F1: GGTGTGATGGGATGGATAAA (SEQ ID NO:1) TP53_D_R3: CCCTGCATTTCTTTTGTTTG (SEQ ID NO:2)
[0237] Following droplet generation, the frequency of TP53 PCR-positive droplets was quantified by FACS analysis. The frequency was determined to be approximately 0.01%. Droplet generation resulted in an approximately 50:50 mixture of double emulsion droplets (water-oil-water) and single emulsion droplets (oil-water).
[0238] [Classification] 200 μL double emulsion droplets were fluorescently stained by adding them to a 1 mL solution of external buffer for droplet generation containing 40 μL of SYTO24 dye (Thermo Fisher Scientific) and incubating them in the dark for 5 min.
[0239] An eight-sample sorting cartridge was prepared for sorting two parallel samples by loading 2 μL of fluorocarbon oil-in-water droplets (16 μm diameter) into the outlet well (
[29] Figure 7). These droplets improve the recovery rate of sorted double emulsion droplets by filling the voids and surfaces within the cartridge. 600 μL and 300 μL of external double emulsion droplet buffer were then added to the corresponding input wells of the sorting cartridge. The procedure was repeated for the second sample. Finally, 200 μL of double emulsion sample was added to the particle sample supply well (
[28] Figure 7). Unused lanes were covered with a thin cover film. The cartridge was covered with a rubber gasket
[0202] designed to ensure a pressure seal between the cartridge and the instrument, while still allowing pressure connections between the individual wells of the cartridge and the instrument through dedicated holes in the gasket. Sorting was initiated by pressing the sort button on the instrument screen. Pressure and laser settings were as follows:
[0240] JPEG0007734312000005.jpg68166
[0241] JPEG0007734312000006.jpg91166
[0242] The instrument settings set the limit at which an event is considered a true positive event (positive droplet) and determine the delay from detection in Detection Zone 1 (upstream detection zone) and Detection Zone 2 (downstream detection zone) to the valve response.
[0243] The threshold was adjusted via the instrument's touchscreen
[1501] , and sorting proceeded automatically for 1 hour, sorting a total of 8–10 million droplets per lane. The instrument counted 678 and 1022 positively classified droplets, respectively.
[0244] The droplets were collected from the cartridge after sorting, the collected emulsions were de-emulsified (coalesced) by adding break solution, and the aqueous phase containing the enriched TP53 DNA was used for MDA amplification and qPCR quantification of the enrichment as described in Madsen et al., 2020 (Human mutation doi: 10.1002 / humu.24063). Enrichment of 120-fold and 258-fold was achieved for the two samples, respectively.
[0245] A small portion of the sample was examined under a microscope to confirm correct collection of the positive droplets.
[0246] Example 10: Sorting of mammalian cells using the XdropSort system This example demonstrates that the system can sort cells suspended as single-cell suspensions that are not encapsulated within droplets.
[0247] [method] Ramos B cells were grown at a cell density of 1 × 10 6 The cells were cultured in medium (RPMI-1640 with 20% HI FBS) until they reached a density of 15 × 10 cells / mL. 6Cells were filtered through a 20 μm cell strainer and then centrifuged at 300 × g for 10 minutes. The supernatant was removed, and the cells were resuspended in 320 μl of XdropSorting buffer. 100,000 cells (20 μl) were removed from these suspensions and added to 180 μl of medium and 20 μl of Calcein AM stain (40 nM). The stained cells were kept at 37°C and 5% CO2 for 30 minutes, after which the remaining stain was removed by washing the cells with 1 ml of medium, centrifuging at 300 × g for 10 minutes, and resuspending them in 1 ml of XdropSorting buffer. The stained cells were mixed with unstained cells at a ratio of ~1:10,000.
[0248] The XdropSort cartridge was loaded by adding 2 μL of blank droplets to the positive droplet well, 600 μL of classification buffer to the extrusion fluid supply well
[26] , and 300 μL of classification buffer to the space fluid supply well
[27] . Finally, 150 μL of cell suspension was added to the particle sample supply well
[28] . The instrument was started, and the thresholds were adjusted on the screen to respond to cells but not background in both detection zones 1 and 2. The instrument readout indicated that the instrument had correctly switched the corresponding valves in response to detection. The instrument indicated that 42 positive events were sorted into the positive droplet well. The contents of the positive droplet well were collected with a pipette and transferred to a glass slide.
[0249] [result] FIG. 37 shows an example of a signal recorded by the instrument during a classification cycle.
[0250] Panels B and D depict the signal produced by cells in detection zones 1 and 2, respectively. Panels A and C show the corresponding valve stages.
[0251] First, a cell entered the upstream detection zone 1 (DZ1) and a signal was recorded by the instrument (double peak of the DZ1 signal). After a defined delay, the pressure valve was switched from the high screening pressure to the low sorting pressure (line rising). At this point, the instrument waited to receive a signal from the downstream detection zone 2 (DZ2). When the cell reached DZ2, a signal was recorded, which triggered the sorting (II.) and waste (III.) processes, pulling the cell out of the stream into the positively sorted channel. Due to the channel design, the cell passed through DZ2 twice, which was recorded (second DZ2 peak). This second signal confirmed the successful sorting event.
[0252] After actuation of the classification and waste valves, the classification cycle is complete and the instrument returns to high pressure screening mode (lines I, II, and III descend) to search for the next positive event.
[0253] Under the microscope, approximately 1 fluorescent cell was observed for every 30 non-fluorescent cells, which indicates that the stained cells were enriched approximately 330-fold and successfully sorted, since the concentration of stained cells in the sample was 1:10,000.
Claims
1. 1. A system for classifying particles in a liquid medium, comprising: a cartridge comprising at least one microfluidic sorting unit [9]; wherein the unit is (i) at least one sample supply conduit [1] for supplying a sample fluid to a sorting junction point [2]; The sample fluid comprises a mixture of positive and negative particles to be classified; (ii) at least one microfluidic sorted positive particle conduit [4] for removing fluid containing positive particles from said sorting junction [2]; (iii) at least one microfluidic waste conduit [5] for removing waste fluid containing negative particles from said sorting junction [2]; and (iv) at least one extrusion fluid conduit [3] for supplying extrusion fluid to said sorting junction point [2]; Provided with: The sorting unit [9] is characterized in that at least four microfluidic conduits (i), (ii), (iii) and (iv) meet at the sorting junction point [2]; the cartridge further comprises at least one detection zone for detecting positive particles in the sample supply conduit (i) upstream of the sorting junction; and an apparatus for controlling fluid flow through said at least one microfluidic sorting unit and temporarily reducing the flow rate of particles in said sample supply conduit [1] in response to detecting positive particles in said supply conduit upstream of said sorting junction [2]; Equipped with The particles are double emulsion droplets system.
2. 2. The system of claim 1, The at least one microfluidic sorting unit [9] comprises: (v) a spacer fluid conduit [11] and a spacer fluid junction [10] disposed in the sample supply conduit [1] upstream of the sorting junction point [2] for supplying a spacer fluid into the sample fluid containing the particles to be sorted. Furthermore, The system specifically comprises at least two separate detection zones; an upstream detection zone [12] located upstream of said spacer fluid junction [10] for detecting particles before they reach said spacer fluid junction [10]; and A downstream detection zone [13] is located downstream of the spacer fluid inlet for detecting positive particles before they enter the sorting junction [2]; and The downstream detection zone is specifically designed to allow the device to detect whether a correct classification has been made. system.
3. A system according to any one of claims 1 to 2, The cartridge comprises a set of wells or containers for fluids that can accommodate the total volume of fluids necessary to accomplish the classification, including the sample fluid, the waste fluid, and the classified positive particle fluid. system.
4. A system according to any one of claims 2 to 3, means for triggering a sorting event by applying air pressure to a spacer fluid inlet [18] in response to detecting a positive particle upstream of said sorting junction [2]; and / or means for temporarily reducing the flow rate of particles in the sample supply conduit [1] for a period of one second or less after detecting a positive particle upstream of the sorting junction; system.
5. A system according to any one of claims 1 to 4, Both the extrusion fluid and the spacer fluid are aqueous fluids system.
6. A system according to any one of claims 1 to 5, means for applying a variable negative pressure to the sorted positive particle conduit [4] and the waste conduit [5]; system.
7. A system according to any one of claims 1 to 6, the cartridge comprises two or more sorting lanes; and The two or more classification lanes are configured in pairs, the at least one detection zone specifically comprises portions of at least two separate particle supply conduits of a pair of sorting lanes; and Each pair of classification lanes specifically comprises an upstream detection zone [12] and a downstream detection zone [13]. system.
8. 8. A system according to claim 7, comprising: the instrument detects signals from two separate droplet sample supply conduits of a classification lane pair at the upstream detection zone; and Each of the two sample supply conduits includes a detection loop, and the two detection loops are of different lengths. system.
9. A system according to any one of claims 7 to 8, The two or more sorting lanes are pneumatically connected to the same pressure source. system.
10. A system according to any one of claims 1 to 9, The device is designed to fit into the cartridge and to control and drive the fluid through the cartridge, as well as to fit into, control and drive the fluid through cartridges made to produce single emulsion droplets and cartridges made to produce double emulsion droplets. system.
11. A cartridge comprising at least one microfluidic sorting unit [9] according to any one of claims 1 to 10, The unit comprises: (i) at least one sample supply conduit [1] for supplying a sample fluid to a sorting junction point [2]; The sample fluid comprises a mixture of positive and negative particles to be classified; (ii) at least one microfluidic sorted positive particle conduit [4] for removing fluid containing positive particles from said sorting junction [2]; (iii) at least one microfluidic waste conduit [5] for removing waste fluid containing negative particles from said sorting junction [2]; and (iv) at least one extrusion fluid conduit [3] for supplying extrusion fluid to said sorting junction point [2]; Provided with: The sorting unit [5] is characterized in that at least four microfluidic conduits (i), (ii), (iii) and (iv) meet at the sorting junction point [2]; the cartridge further comprises at least one detection zone for detecting positive particles in the sample supply conduit (i) upstream of the sorting junction; The particles are double emulsion droplets cartridge.
12. A system according to claims 1 to 10, said instrument comprising an optical head forming an integral unit comprising an optical system forming two linear detection zones, i.e. said upstream and said downstream detection zone; the optical head further comprises the necessary optics and detector for the detection of positive particles; The instrument is specifically adapted to detect positive particles by laser-induced fluorescence signals, the instrument is specifically adapted to collect the fluorescent signals emitted from positive particles in both the upstream and downstream detection zones through a single lens system; and The instrument may include an automatic alignment system that aligns the cartridge with the optical system; the alignment system includes three actuators that move the optical head in the XY plane to align the optical system with the cartridge; system.
13. A system according to any one of claims 1 to 10 and 12, comprising: the device controls fluid flow through the at least one microfluidic sorting unit by a pneumatic system that operates under both variable positive and variable negative pressure; The pneumatic system specifically comprises a set of directional control valves capable of supplying high or low positive pressure to the microfluidic system, and another set of directional control valves capable of supplying variable negative or ambient pressure to the microfluidic system. system.
14. A method for classifying particles comprising the use of a system according to any one of claims 1 to 10 and 12 to 13, the particles are double emulsion droplets; The method comprises the steps of: i. providing a sample fluid containing particles; ii. Providing a microfluidic cartridge according to claim 11, comprising: a supply well or vessel comprising a volume of extrusion fluid; a supply well or vessel comprising a volume of spacer fluid; and a supply well or vessel containing a volume of said particle sample fluid; iii. Inserting the cartridge into the device; iv. Initiating said classification on said system; and v. After said sorting is completed, transferring said sorted positive particles into an appropriate container; Including; The particle flow rate is temporarily reduced in response to a positive signal being detected by the instrument at the upstream detection zone [12] of the cartridge. method.
15. 1. An in vitro method for enriching one or more target nucleic acid molecules from a sample of mixed nucleic acid molecules, comprising the steps of: i. providing a liquid sample of mixed nucleic acid molecules, the liquid sample comprising at least one or more specific target nucleic acid molecules and at least one reagent for specifically detecting at least one of said target nucleic acid molecules; ii. forming an emulsion from the liquid sample, the emulsion comprising a plurality of double emulsion droplets, each of the double emulsion droplets comprising a mixed nucleic acid molecule; iii. Incubating the emulsion droplets to obtain a specific detectable reaction within the droplets containing at least one specific target nucleic acid molecule; iv. Loading the reacted droplets into a system for sorting droplets according to any one of claims 1 to 10 and 12 to 13; v. sorting the microdroplets using the system; vi. collecting the sorted droplets in a suitable container and combining the sorted droplets; and vii. subjecting the combined and selected droplets from step vi to a general amplification procedure; A method comprising:
16. A kit of parts for carrying out any of the methods of any one of claims 14 to 15, comprising: a) at least one cartridge according to claim 11; b) at least one gasket for fitting said at least one cartridge to an implement of a system for sorting particles, in particular to an implement of a system according to any one of claims 1 to 10 or 12 to 13; the particles are double emulsion droplets; and c) at least one vial of buffer fluid in an amount sufficient to perform the number of sorts provided by said at least one cartridge; Equipped with kit.
Citation Information
Patent Citations
Method and apparatus for sorting particles
JP2008122396A
Cell sorting system and method
JP2010525325A
Flow control in microfluidic devices
JP2014522989A