Biomarkers and methods for detecting the presence or absence of X and Y chromosomes in asparagus and sea anemone

Abstract

To provide new biomarker and method for detecting the presence or absence of an X chromosome and a Y chromosome in asparagus and Asparagus kiusianus.SOLUTION: The present invention discloses a method for determining the presence or absence of an X chromosome and a Y chromosome in asparagus or Asparagus kiusianus by using, as indexes, the presence or absence of a polynucleotide not having the base sequence CTAG at positions corresponding to 102-105 or 271-274 positions in SSM01 and the presence or absence of a polynucleotide having the base sequence CTAG at positions corresponding to 102-105 or 271-274 positions in SSM01.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to biomarkers and methods for detecting the presence or absence of X and Y chromosomes in asparagus and sea anemone. [Background technology]

[0002] Asparagus is a dioecious plant, meaning that each individual plant is either male or female. Previously, sex could only be determined by the shape of the flower, which took one to two years to determine. However, it has since become possible to determine sex using DNA markers.

[0003] On the other hand, male asparagus plants are preferred over female plants due to their yield potential. Among male asparagus plants, there are some that rarely bear fruit (intersexual plants), and by crossing supermales obtained from the progeny of these intersexual plants with female plants, all-male varieties are developed, with all progeny being male. Supermales and males are morphologically indistinguishable, and the only way to distinguish between them is to cross them with female plants and sex the resulting progeny. Therefore, even with DNA markers, selecting supermales requires one to two years. To overcome this issue, the RM17 marker was developed in 2018 (Non-Patent Document 1). This is a DNA marker that can distinguish between supermales and males. However, the RM17 marker cannot be used in purple asparagus, and it is unclear whether it can be used in closely related wild species such as Asparagus thunbergii. Therefore, there is a need for the development of a new marker that can be used to select supermales. [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Acta Hort. 1223:51–58 (2018) [Non-patent document 2] Honda H, Hirai A (1990) A simple and efficient method for identification of hybrids using nonradioactive rDNA as probe. Jpn. J. Breed. 40:339-348 Summary of the Invention [Problem to be solved by the invention]

[0005] An objective of the present invention is to provide new biomarkers and methods for detecting the presence or absence of X and Y chromosomes in asparagus and Hamamelis virginiana. [Means for solving the problem]

[0006] Under these circumstances, the present inventors investigated the vast amount of genetic information in asparagus and Hamamelis gracilis through a variety of trial and error methods, and found that in a specific region of asparagus and Hamamelis gracilis, a restriction enzyme XspI cleavage site is present on the Y chromosome, but not on the X chromosome, common to various species and strains. Based on this new finding and conducting further studies, the present inventors came up with the idea of ​​using this region as a biomarker for detecting the presence or absence of both an X chromosome and a Y chromosome, and after further testing, they have completed the present invention.

[0007] Thus, the present invention provides the following: Item 1. A method for determining the presence or absence of an X chromosome and the presence or absence of a Y chromosome in asparagus or Hamamelis virginiana, using the presence or absence of a polynucleotide that does not have the base sequence CTAG at positions corresponding to positions 102 to 105 or 271 to 274 in SSM01 and the presence or absence of a polynucleotide that has the base sequence CTAG at positions corresponding to positions 271 to 274 in SSM01 as indicators for determining the presence or absence of an X chromosome and the presence or absence of a Y chromosome in asparagus or Hamamelis virginiana.

[0008] Item 2. The method according to Item 1, comprising the steps of: extracting from a sample a polynucleotide containing an oligonucleotide corresponding to positions 102 to 105 or 271 to 274 of SSM01; amplifying a region of the polynucleotide containing the oligonucleotide corresponding to positions 102 to 105 or 271 to 274 of SSM01; treating the polynucleotide amplified in the above step with a restriction enzyme that recognizes CTAG; and detecting the amplified polynucleotide and polynucleotides formed by cleavage of the amplified polynucleotide with the restriction enzyme.

[0009] Item 3. The method according to Item 2, wherein the presence of an X chromosome in asparagus or azalea is determined when the amplified polynucleotide that has not been cleaved by a restriction enzyme is detected in the detection step.

[0010] Item 4. The method according to Item 2 or 3, wherein the presence of a Y chromosome in asparagus or sea buckthorn is determined when the amplified polynucleotide cleaved by a restriction enzyme is detected in the detection step.

[0011] Item 5. A biomarker for detecting both the presence or absence of an X chromosome and the presence or absence of a Y chromosome in asparagus or Hamatamabouki, comprising a polynucleotide containing an oligonucleotide corresponding to positions 102 to 105 or 271 to 274 in SSM01.

[0012] Item 6. The biomarker according to Item 5, wherein the length of the polynucleotide is 100 bp to 500 bp.

[0013] Item 7. The biomarker according to Item 5 or 6, for use in the method according to any one of Items 1 to 4. [Effects of the Invention]

[0014] The present invention provides new biomarkers and methods for detecting the presence or absence of X and Y chromosomes in asparagus and Hamatamabouki. Therefore, the present invention makes it possible to determine whether the sex chromosomes of asparagus and Hamatamabouki are XX, XY, or YY types, and can be used to select super-males (YY type). [Brief explanation of the drawings]

[0015] [Figure 1] Electrophoresis results (asparagus varieties) in the examples are shown. [Figure 2] 1 shows the results of electrophoresis (purple asparagus variety) in an example. [Figure 3] The results of electrophoresis in the example (Hamatamabouki) are shown below. [Figure 4] Electrophoresis results (Asparagus maritimus) in an example are shown. [Figure 5] The nucleotide sequences of SSM01 in each chromosome of asparagus (variety name: Mary Washington 500W) are shown below. MW_X: X chromosome; MW_Y: Y chromosome. [Figure 6] The base sequences of SSM01 in each chromosome of asparagus (variety Gijnlim) are shown below. Gm_X: X chromosome; Gm_Y: Y chromosome. [Figure 7] The base sequences of SSM01 in each chromosome of purple asparagus (cultivar Purple Passion) are shown below. Pas_Y: Y chromosome; Pas_X: X chromosome. [Figure 8] The SSM01 base sequence for each chromosome of purple asparagus (variety Pacific Purple) is shown below. Pfc Y PP-m*: Y chromosome of one individual; Pfc X PP-m: X chromosome; Pfc Y PP-m: Y chromosome of another individual. [Figure 9] The base sequences of SSM01 in each chromosome of Hamatamabouki are shown below. AK_X: X chromosome; AK_Y: Y chromosome. DETAILED DESCRIPTION OF THE INVENTION

[0016] In the present invention, unless otherwise specified, the term "gene" includes not only structural genes that define the primary structure of proteins, tRNA, rRNA, etc., but also regions on nucleic acids that have specific control functions, such as promoters and operators. Therefore, in the present invention, unless otherwise specified, the term "gene" refers to regulatory regions, coding regions, exons, and introns without distinction.

[0017] As used herein, "nucleic acid" is synonymous with nucleotide, oligonucleotide, and polynucleotide, and may be DNA, RNA, or a DNA-RNA hybrid. These may be double-stranded or single-stranded. When referring to a nucleic acid molecule having a certain sequence, unless otherwise specified, this also encompasses nucleic acid molecules (or nucleotides, oligonucleotides, and polynucleotides) having a complementary sequence. When referring to a sequence, this also encompasses a complementary sequence, unless otherwise specified. These nucleic acid molecules may be circular or linear, and may be synthetic or of biological origin.

[0018] Determining the presence or absence of an X chromosome and a Y chromosome According to the present invention, the presence or absence of an X chromosome and the presence or absence of a Y chromosome in asparagus or Hamatamabouki can be determined by using as an indicator the presence or absence of the nucleotide sequence CTAG at positions corresponding to positions 102 to 105 or 271 to 274 in SSM01. SSM01 is a region named by the present inventors, and specifically refers to the region from positions 3423985 to 3424453 in the nucleotide sequence shown in NCBI accession number NC_033794.1. For example, the nucleotide sequence of the X chromosome of the asparagus cultivar 'Mary Washington 500W' is shown below: CCATTACCTGCAAAGTTTAGGTGGTACAAGGAGTGTATCGATCAATAAAGAAGATAGTTTCACAAAAGGATTGAGCAATTTCATGTGGACAGGTTGTTAATCTATCACACCTACTCATTCAGTCATCAGATCAAGAAA ATGATGCAAATGTAGGCATTGTTCGAGAGTGCTGATGTTGATTAATATTTAGCATGCGATACACGTGAAAACTAAAGGTCAAGAATCATCTGCATCTTGATAAGGATCGATCTCCTCTTAAATTATGGAATGTCTGTT CTCG TGATTTGAAATCTTTCTTAATGACTTCTGCGCACAAACCTACTCCTATATATATGCTTGCACTTGGAGATGAACCGTCCTTAAAGTTTCTGCAGTCCTTCTCTTACTTTACCAGGATAAAGATGTTTCTGATTGGATTCTTCCAGAGTCAGCGGTGGATAAGGGAGATCAAGGCAATTCTAAGGTATGGAGC (SEQ ID NO: 1) The base sequence of the Y chromosome of the asparagus variety 'Mary Washington 500W' is shown below: CCATTCCCTGCAAAGTTTAGGTGGTACAAGGAGTGTATCAATCAATAAAGAAGATAGTTTCACAAAAGGATTGAGCAATTTCACGTGGACAGATTGTTAATCTATCACACCTACTCATTCAGTCATCAGATCAAG AAAATGATGCAAATGTAGGCATTGTTCGAGAGTGCTGATGTTGATTTAGCATGCGATACACGTGAAAACTAAAGGTCAAGAATCATCTGCATTTTGATAAGGATCGATCTCCTCTTAAATTATGGAAGGTCTGTT CTAGTGATTTGAAATCTTTCTTAATGACTTCTGCGCACAAACCTACTCCTATATATATGCTTGCACTTGGAGATGAACCGTCCTTAAAGTTTCTGCAGTCCTTCTCTTACTTTACAAGCTGGATAAAGATGTTTCCGATTGGATTCTTCCAGATTCAGTGGTGGATATGGGAGATCAAGGCAATTCTAAGGTATGGAGC (SEQ ID NO: 2).

[0019] The present inventors have found that the Y chromosomes of asparagus and Hamatamabouki have the nucleotide sequence CTAG in the nucleotide sequence of SSM01, more specifically, at positions corresponding to positions 271 to 274 in the nucleotide sequence of SSM01 (more typically, the nucleotide sequence shown in SEQ ID NO: 2), and that the X chromosomes of asparagus and Hamatamabouki do not have the nucleotide sequence CTAG in the nucleotide sequence of SSM01. Similarly, in purple asparagus, the Y chromosome has the nucleotide sequence CTAG in the nucleotide sequence of SSM01, more specifically, at positions corresponding to positions 271 to 274 in the nucleotide sequence of SSM01 (more typically, the nucleotide sequence shown in SEQ ID NO: 2), and the X chromosome does not have the nucleotide sequence CTAG in the nucleotide sequence of SSM01. However, the present inventors have found that in a very small proportion of purple asparagus individuals, the Y chromosome has the nucleotide sequence CTAG at positions 102 to 105 in the nucleotide sequence of SSM01 (SEQ ID NO: 3).

[0020] The base sequence of SSM01 on the Y chromosome of the above purple asparagus individual is as follows: CCATTCCCTGCAAAGTTTAGGTGGTACAAGGAGTGTATCAATCAATAAAGAAGATAGTTTCACAAAAGGATTGAGCAATTTCATGTGGACAGATTGTTAAT CTAGCACACCTACTCATTCAGTCATCAGATCAAGAAAATGATGCAAATGTAGTCATTGTTCGGGAGTGCTGATGTTGATTTAGCATGCGATACACGTGAAAACTAAAGGTCAAGAATCATCTGCATCTTGATACGGATCGATCTCTCTTTAATTATGGAAGGTCTGTTCTCGTGATTTGAAATC TTTCTTAATGACTTCTGCGCACAAACCTACTCCTATATGCTTGCATTTGGAGATGAACTGTCCTTAAAGTTTCTGCAGTCCTTCTCTTACTTTACCAGGATAAAGATGTTTCTGATGGATTCTTCCAAATTCAGCGGTGGATATGGGAGATCAAGGCAATTCTAAGGTATGGAGC (SEQ ID NO: 3) The base sequence of SSM01 on the X chromosome of the purple asparagus individual is as follows: CCATTCCCTGCAAAGTTTAGGTGGTACAAGGAGTGTATCAATCAATAAAGAAGATAGTTTCACAAAAGGATTGAGCAATTTCACGTGGACAGATTGTTAAT CTAT CACACCTACTCATTCAGTCATCAGATCAAGAAAATGATGCAAATGTAGGCATTGTTTGAGAGTGCTGATGTTGATTTAGCATGCGATACACGTGAAAACTAAAGGTCAAGAATCATCTGCATCTTGATAAGGATCGATCTCCTTCTTTAATTATGGAATGTCTGTTCTCGTGATTTGAAATCT TTCTTAATGACTTCTGCGCACAAACCTACTCCTATATGCTTGCATTTGGAGATGAACCGTCCTTAAAGTTTCTGCAGTCCTTCTCTTACTTTACCAGGATAAAGATGTTTCTGATTGGATTCTTCCAGAGTCAGCGGTGGATATGGGAGATCAAGGCAATTCTAAGGTATGGAGC (SEQ ID NO: 4) The presence or absence of the nucleotide sequence CTAG on the X and Y chromosomes is conserved among species and strains belonging to Asparagus and Atractylodes spp., but other sequences may vary (Figure 5). Therefore, in the present invention, "positions corresponding to positions 271 to 274" refers to the four base positions preceding or following positions 271 to 274 in SEQ ID NO: 2, in which one or more bases have been added or deleted above positions 271 to 274. For example, in SEQ ID NO: 1, positions 277 to 280 (underlined) correspond to "positions corresponding to positions 271 to 274 in SSM01." Similarly, "positions corresponding to positions 102 to 105" refers to the four base positions preceding or following positions 102 to 105 in SEQ ID NO: 2, in which one or more bases have been added or deleted above positions 102 to 105.

[0021] Plants that can be measured by the method of the present invention include asparagus and Hamatamabouki. Examples of asparagus include green asparagus and purple asparagus. Asparagus also includes white asparagus, which is obtained by growing the above-mentioned asparagus without exposing it to sunlight, a process known as blanching. The method of the present invention is highly useful because it can determine the presence or absence of X and Y chromosomes not only in green asparagus and white asparagus, but also in purple asparagus. In the present invention, the term "asparagus" includes not only those classified under the scientific name Asparagus officinalis, but also its closely related wild species, such as those classified under the scientific name Asparagus maritimus. In a more specific embodiment, examples of asparagus varieties include 'Mary Washington 500W', 'Pacific 2000', 'JWC1', 'UC157F1', 'Gijnlim', 'Purple Passion', 'Pacific Purple', 'RG Murasaki Mai Luce', 'RG Murasaki Mai First', NJ1064, and 'Erasmus'. Plants that can be subjected to the methods of the present invention include Asparagus kiusianus. Asparagus and Asparagus kiusianus may be genetically modified (by hybridization, genetic recombination, etc.) as long as mutations are not introduced into SSM01, more specifically, at positions 102 to 105 or 271 to 274 of SSM01. Furthermore, as described below, asparagus and Hamatamabouki share the characteristic that the Y chromosome contains the nucleotide sequence CTAG in the nucleotide sequence of SSM01, but the X chromosome does not contain the nucleotide sequence CTAG. Therefore, the method of the present invention can also be applied to hybrids of asparagus and Hamatamabouki. Therefore, in the present invention, "determining the presence or absence of an X chromosome and a Y chromosome in asparagus or Hamatamabouki" also includes genetically modified asparagus or Hamatamabouki, as well as determining the presence or absence of an X chromosome and a Y chromosome in a hybrid of these.

[0022] The sample used in the method of the present invention is not particularly limited as long as it can be used to extract polynucleotides, and examples thereof include pseudo-leaves, leaves, roots, stems, flowers, and seeds of asparagus or scutellaria baicalensis. Pseudo-leaves are preferred because they allow efficient DNA extraction. In a typical embodiment of the present invention, polynucleotides are first extracted from the sample. Polynucleotide extraction can be performed using any method used in the technical field to which the present invention pertains, such as the method described in Non-Patent Document 2.

[0023] In the present invention, the method of using extracted polynucleotides to examine the presence or absence of the nucleotide sequence CTAG in SSM01, more specifically the presence or absence of the nucleotide sequence CTAG at positions corresponding to positions 102 to 105 or 271 to 274 of SSM01, is not particularly limited, and examples include a method using a restriction enzyme for the above-mentioned CTAG, a method analyzing the nucleotide sequence of the above-mentioned SSM01, etc. As a simple and highly reproducible method, the method using a restriction enzyme for CTAG is preferred.

[0024] In a preferred embodiment of the present invention, the method next includes a step of amplifying a polynucleotide containing a region corresponding to positions 102 to 105 or 271 to 274 in SSM01 using the polynucleotide extracted as described above as a template. The polynucleotide to be amplified is preferably 100 bp to 500 bp in length, more preferably 300 bp to 500 bp. Furthermore, the polynucleotide to be amplified preferably contains bases 1 to 23 and 446 to 469 in the base sequence of SSM01 (more typically the base sequence shown in SEQ ID NO: 2). Furthermore, examples of polynucleotides to be amplified in the present invention include polynucleotides that anneal (hybridize) to the following nucleic acid molecules (1) and (2): (1) A nucleic acid molecule consisting of the base sequence shown in SEQ ID NO: 5, or a nucleic acid molecule consisting of the base sequence shown in SEQ ID NO: 3 in which one or several (e.g., two, three, etc.) bases have been substituted, deleted, or added. (2) A nucleic acid molecule consisting of the base sequence shown in SEQ ID NO: 6, or a nucleic acid molecule consisting of the base sequence shown in SEQ ID NO: 4 in which one or several (e.g., two, three, etc.) bases have been substituted, deleted, or added.

[0025] In a typical embodiment of the present invention, "annealing" refers to annealing under the following conditions: The annealing conditions (hybridization conditions) may be any conditions that allow amplification of a polynucleotide containing a position corresponding to positions 102 to 105 or 271 to 274 in the base sequence of SSM01, but typically include stringent conditions. Here, "stringent conditions" include, for example, the conditions described in Molecular Cloning: A Laboratory Manual (Sambrook, et al., eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989). Specifically, for example, the conditions include those under which a positive annealing signal is observed when the sample is heated at 42°C in a solution of 6×SSC, 0.5% SDS, and 50% formamide, followed by washing at 68°C in a solution of 0.1×SSC, 0.5% SDS.

[0026] Polynucleotides can be amplified by known methods, such as PCR. Primers used in PCR include, for example, the nucleic acid molecules (1) and (2) described above. PCR conditions are not particularly limited, and conditions used in the technical field to which the present invention pertains can be used as appropriate, or PCR can be performed according to the conditions described in the Examples below.

[0027] In a preferred embodiment of the present invention, the polynucleotide amplified in the above step is then subjected to restriction enzyme treatment. The restriction enzyme is not particularly limited as long as it recognizes and cleaves CTAG, and examples include BfaI, FspBI, MaeI, and XspI, with XspI being preferred. This step can be performed, for example, by using the polynucleotide amplified in the above step and a commercially available restriction enzyme according to the instructions for the commercially available restriction enzyme. For example, the restriction enzyme can be added to the polynucleotide amplified in the above step, and optionally a buffer solution, water, etc., followed by stirring and then leaving the mixture at a constant temperature for a certain period of time. The temperature in this step can be appropriately set within a range in which the restriction enzyme is active, for example, 35 to 38°C, typically 37°C. The time for this step is also not particularly limited, and can be set, for example, within a range of 30 to 180 minutes, preferably 60 to 120 minutes. The buffer used can be a K buffer or the like. For example, a K buffer manufactured by Takara Bio Inc. can be used. The pH of the reaction system is not particularly limited, and can be set, for example, in the range of 7 to 10, preferably 8 to 9. The pH can be adjusted with Tris-HCl or the like. If any polynucleotides containing the base sequence CTAG are present in the reaction system in this step, they will be cleaved by the restriction enzyme. Therefore, by checking for the presence or absence of restriction enzyme cleavage products in the next step, the presence or absence of a Y chromosome can be confirmed. Furthermore, by checking for the presence or absence of polynucleotides that have not been cleaved by the restriction enzyme in the next step, the presence or absence of an X chromosome can be confirmed.

[0028] In a preferred embodiment of the present invention, the sample subjected to the restriction enzyme treatment in the above step is then subjected to confirmation of the presence or absence of polynucleotides cleaved by the restriction enzyme and / or detection (confirmation) of the presence or absence of polynucleotides uncleaved by the restriction enzyme. The presence or absence of polynucleotides cleaved by the restriction enzyme and the presence or absence of polynucleotides uncleaved by the restriction enzyme can be confirmed, for example, by electrophoresis. Because polynucleotides cleaved by the restriction enzyme and polynucleotides uncleaved by the restriction enzyme have significantly different molecular weights, and polynucleotides cleaved by the restriction enzyme are separated into two, the presence or absence of polynucleotides cleaved by the restriction enzyme and the presence or absence of polynucleotides uncleaved by the restriction enzyme can be detected by separating and detecting the polynucleotides in the sample by electrophoresis. When performing electrophoresis, agarose gel, acrylamide gel, or the like can be used as the gel. Examples of the electrophoresis buffer that can be used include TAE buffer, TBE buffer, and TPE buffer. The voltage is not particularly limited, but can be set within the range of, for example, 20 to 150 V, preferably 50 to 100 V.

[0029] The method of the present invention may comprise the steps of determining that the asparagus or the sea buckthorn has an X chromosome if the sample contains a polynucleotide comprising SSM01 or a partial sequence thereof (including positions corresponding to positions 102 to 105 or 271 to 274), which polynucleotide does not have the nucleotide sequence CTAG at positions 102 to 105 or 271 to 274; and determining that the asparagus or the sea buckthorn does not have an X chromosome if the sample does not contain a polynucleotide comprising SSM01 or a partial sequence thereof (including positions corresponding to positions 102 to 105 or 271 to 274), which polynucleotide does not have the nucleotide sequence CTAG at positions 102 to 105 or 271 to 274. The method of the present invention may also include the steps of determining that the asparagus or the sea buckthorn has a Y chromosome if the sample contains a polynucleotide comprising SSM01 or a partial sequence thereof (including positions corresponding to positions 102 to 105 or 271 to 274), which has the nucleotide sequence CTAG at a position corresponding to positions 102 to 105 or 271 to 274; and determining that the asparagus or the sea buckthorn does not have a Y chromosome if the sample does not contain a polynucleotide comprising SSM01 or a partial sequence thereof (including positions corresponding to positions 102 to 105 or 271 to 274), which has the nucleotide sequence CTAG at a position corresponding to positions 102 to 105 or 271 to 274.

[0030] Biomarkers In another embodiment, the present invention provides a biomarker for detecting the presence or absence of both an X chromosome and a Y chromosome in asparagus or sea anemone, the biomarker comprising a polynucleotide containing an oligonucleotide corresponding to positions 102 to 105 or 271 to 274 in SSM01.

[0031] The length of the polynucleotide constituting the biomarker of the present invention is preferably 300 bp to 500 bp. In a preferred embodiment, the polynucleotide constituting the biomarker of the present invention may further comprise, in addition to the oligonucleotide corresponding to positions 102 to 105 or 271 to 274 in SSM01, a nucleic acid molecule consisting of the nucleotide sequence shown in CCATTCCCTGCAAAGTTTAGGTG (SEQ ID NO: 3) or a nucleic acid molecule that anneals to this nucleic acid molecule. Furthermore, in a preferred embodiment, the polynucleotide constituting the biomarker of the present invention may further comprise, in addition to the oligonucleotide corresponding to positions 102 to 105 or 271 to 274 in SSM01, a nucleic acid molecule consisting of the nucleotide sequence shown in CAAGGCAATTCTAAGGTATGGAGC (SEQ ID NO: 4) or a nucleic acid molecule that anneals to this nucleic acid molecule. In the present invention, the polynucleotide constituting the biomarker preferably comprises both a nucleic acid molecule consisting of the nucleotide sequence shown in SEQ ID NO: 3 or a nucleic acid molecule that anneals to this nucleic acid molecule; and a nucleic acid molecule consisting of the nucleotide sequence shown in SEQ ID NO: 4 or a nucleic acid molecule that anneals to this nucleic acid molecule. The biomarkers of the present invention can be used to detect the presence or absence of X and Y chromosomes in asparagus and sea anemone.

[0032] The present invention provides new biomarkers and methods for detecting the presence or absence of X and Y chromosomes in asparagus and Hamatamabouki. Therefore, the present invention makes it possible to determine whether the sex chromosomes of asparagus and Hamatamabouki are XX, XY, or YY types, thereby making it possible to determine whether the target asparagus or Hamatamabouki is a male (XY type), a female (XX type), or a super-male (YY type). Therefore, the present invention can be used to select super-males (YY type). In the present invention, the XX, XY, and YY types of sex chromosomes can also be expressed as mm, mM, and MM, respectively.

[0033] Preferred embodiments of the present invention will be specifically described below using examples, but the present invention is not limited to the following examples. [Example]

[0034] Experimental materials Asparagus varieties: 'Mary Washington 500W', 'Pacific 2000', 'JWC1', 'UC157F1', 'Gijnlim' (all males) Purple asparagus varieties: 'Purple Passion', 'Pacific Purple', 'RG Purple Mai Luce', 'RG Purple Mai First', NJ1064 (all male), 'Erasmus' (all male) Wild relative of asparagus: Asparagus maritimus Hamatamabouki: Asparagus kiusianus Total DNA extraction method Five to ten pseudoleaf leaves were collected from each individual plant, and total DNA was extracted according to the method of Honda and Hirai (1990). Six hundred microliters of DNA extraction buffer (10 ml of 1 M Tris·HCl (pH 8.0), 10 ml of 0.5 M EDTA (pH 8.0), 2.9 g of NaCl, and 1 μl of HO) / 100 ml were mixed by inversion, and 300 μl of this mixture was added to a sample tube. Zirconia beads were added and the leaves were crushed on a shaker. After crushing, the remaining 300 μl of the DNA extraction buffer and mercaptoethanol mixture and 40 μl of 20% SDS were added to the sample tube, mixed by inversion, and incubated at 65°C for 10 minutes. 200 μl of 5M potassium acetate solution (60 ml of 5M potassium acetate, 11.5 ml of glacial acetic acid, HO) / ​​100 ml) was added, mixed by inversion, left to stand on ice for 20 minutes, and then centrifuged at 14,500 rpm (4°C) for 20 minutes. The supernatant was filtered through Miracloth and transferred to a new tube. 400 μl of isopropanol was added, mixed by inversion, left to stand at -20°C for 20 minutes, and then centrifuged at 13,000 rpm (4°C) for 15 minutes. The supernatant was discarded, and the tube was placed upside down on a paper towel with the lid open and left to stand for 10 minutes. 5-1 140 μl of TE buffer (5 ml of 1 M Tris HCl (pH 8.0), 2 ml of 0.5 M EDTA (pH 8.0), HO) / ​​100 ml) was added and mixed thoroughly by vortexing. The pellet was completely dissolved and then centrifuged at 14,000 rpm (4°C) for 10 minutes. The supernatant was transferred to a new tube, and 15 μl of 3 M sodium acetate solution and 100 μl of isopropanol were added. The mixture was mixed by inversion and left to stand at -20°C for 20 minutes, after which it was centrifuged at 14,000 rpm (4°C) for 10 minutes. The supernatant was discarded, and 300 μl of 70% ethanol was added, mixed thoroughly by vortexing, and then centrifuged at 14,000 rpm (4°C) for 5 minutes. The supernatant was discarded, and the tube was placed upside down on a paper towel with the lid open to air dry. It was then dried using a vacuum pump for 10 minutes, after which it was dissolved in 100 μl of TE buffer.

[0035] *Honda H, Hirai A (1990) A simple and efficient method for identification of hybrids using nonradioactive rDNA as probe. Jpn. J. Breed. 40:339-348 Primer sequence information (5'-3') SSM01_Fw: CCATTCCCTGCAAAGTTTAGGTG SSM01_Rev: GCTCCATACCTTAGAATTGCCTTG PCR reaction PCR was performed using the total DNA as a template and the SSM01 marker. The reaction mixture was prepared as follows.

[0036] [Table 1]

[0037] The reaction mixture was thoroughly mixed, placed in a thermal cycler, and subjected to PCR under the following conditions.

[0038] [Table 2]

[0039] Restriction enzyme digestion The PCR product amplified using the SSM01 primer was subjected to restriction enzyme digestion using the restriction enzyme XspI. The reaction solution was prepared as follows.

[0040] [Table 3]

[0041] The reaction mixture was thoroughly stirred and placed in an incubator at 37°C for 90 minutes.

[0042] Agarose gel electrophoresis After restriction enzyme treatment, the entire reaction mixture was electrophoresed on a 1.0% agarose gel containing ethidium bromide, the DNA was confirmed on a UV transilluminator, and the gel was photographed with a digital camera.

[0043] Experimental results The experimental results are shown in Figures 1 to 4. In all asparagus cultivars (Figure 1), purple asparagus cultivars (Figure 2), Hamatamabouki (Figure 3), and Asparagus maritimus (Figure 4), two bands derived from XspI-cleaved SSM01 and one band derived from uncleaved SSM01 were detected in male individuals. Specifically, in all asparagus cultivars 'Mary Washington 500W', 'Pacific 2000', 'JWC1', 'UC157F1', and 'Gijnlim', SSM01 on the Y chromosome was cleaved at positions corresponding to positions 271 to 274 in male individuals. In the purple asparagus cultivars 'Purple Passion,' 'RG Murasaki Mai Luce,' 'RG Murasaki Mai First,' 'NJ1064' (all male), and 'Erasmus' (all male), SSM01 on the Y chromosome was disrupted at positions 271-274 in all males (Fig. 1). In the purple asparagus cultivar 'Pacific Purple,' SSM01 on the Y chromosome was also disrupted with XspI in males, but the disruption occurred not only at positions 271-274 (PP-m males) but also at positions 102-105 (PP-m* males) (Fig. 2). In males of Asparagus kiusianus, a wild relative of asparagus, SSM01 on the Y chromosome was also disrupted at positions 271-274 (Fig. 3). In Asparagus maritimus, a wild species closely related to asparagus, SSM01 on the Y chromosome was cleaved at positions corresponding to 102-105 in male individuals (Fig. 4). In addition, in female individuals of all the above varieties, only one band derived from SSM01 that was not cleaved with XspI was detected, and the two bands derived from SSM01 that was cleaved with XspI were not detected.

Claims

1. A method for determining the presence or absence of an X chromosome and a Y chromosome in asparagus or Hamamelis virginiana, using as indicators the presence or absence of a polynucleotide that does not have the nucleotide sequence CTAG at positions corresponding to positions 102 to 105 or positions 271 to 274 in the region of positions 3423985 to 3424453 in the nucleotide sequence shown in NCBI Accession No. NC_033794.1, and the presence or absence of a polynucleotide that has the nucleotide sequence CTAG at positions corresponding to positions 271 to 274 in the region of positions 3423985 to 3424453 in the nucleotide sequence shown in NCBI Accession No. NC_033794.

1.

2. The method of claim 1, comprising the steps of: extracting from a sample a polynucleotide containing an oligonucleotide corresponding to positions 102 to 105 or 271 to 274 of the region of positions 3423985 to 3424453 of the nucleotide sequence shown in NCBI Accession No. NC_033794.1; amplifying a region in the polynucleotide containing the oligonucleotide corresponding to positions 102 to 105 or 271 to 274 of the region of positions 3423985 to 3424453 of the nucleotide sequence shown in NCBI Accession No. NC_033794.1; treating the polynucleotide amplified in the above step with a restriction enzyme that recognizes CTAG; and detecting the amplified polynucleotide and polynucleotides formed by cleavage of the amplified polynucleotide with the restriction enzyme.

3. 3. The method according to claim 2, wherein the presence of an X chromosome in asparagus or sea buckthorn is determined when the amplified polynucleotide that has not been cleaved by a restriction enzyme is detected in the detection step.

4. 4. The method according to claim 2 or 3, wherein the presence of a Y chromosome in asparagus or sea buckthorn is determined when the amplified polynucleotide cleaved by a restriction enzyme is detected in the detection step.

Images