Digital Amplification for Protein Detection

Isothermal digital assays using compartmentalized fluid volumes and proximity-induced interactions address the limitations of existing protein detection methods by enabling accurate and efficient protein detection in a single container without wash steps, suitable for point-of-care diagnostics.

JP7734964B2Active Publication Date: 2025-09-08LAMPROGEN INC
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
JP2021516745
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2018-09-26
Filing Date
2019-09-25
Publication Date
2025-09-08
Estimated Expiration
2039-09-25

AI Technical Summary

Technical Problem

Existing digital protein assays face limitations in efficiency and accuracy due to the need for calibration and reliance on temperature-sensitive reactions, and existing isothermal methods require wash steps or bead capture, limiting their applicability and precision.

Method used

The development of isothermal digital assays that perform amplification reactions in a single container without wash steps, using compartmentalized fluid volumes with proximity-induced interactions and optical signals for analyte detection, enabling methods like digital PCR and homogeneous solutions.

Benefits of technology

These assays provide accurate, efficient, and precise protein detection without calibration, suitable for point-of-care diagnostics and personalized medicine, eliminating the need for temperature cycling and wash steps.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007734964000001
    Figure 0007734964000001
  • Figure 0007734964000002
    Figure 0007734964000002
  • Figure 0007734964000003
    Figure 0007734964000003
Patent Text Reader

Abstract

The present disclosure provides methods for measuring the amount of an analyte molecule. In some aspects, the methods involve compartmentalizing a sample with a binding molecule conjugated to a synthetic nucleic acid molecule, such that interaction of the binding molecule with the analyte molecule brings the nucleic acid molecules into proximity. The proximity triggers a reaction in the analyte-containing compartment that results in a light signal, such as fluorescence, that can be counted to determine the amount of analyte present. The present disclosure provides methods, systems, and compositions for performing assays. In various aspects, the present disclosure relates to digital assays, particularly protein assays in certain aspects, that can be performed using amplification reactions and / or in a single step or in a single container.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 62 / 736,972, filed September 26, 2018, which is incorporated herein by reference in its entirety.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on September 24, 2019, is named 39355-701_601_SL.txt and is 2,585 bytes in size. [Background technology]

[0003] Digital assays, in which measurements are based on counting binary yes or no responses, are becoming increasingly important in biology due to their robustness, sensitivity, and accuracy. While analog measurements often require calibration using a running standard, digital measurements do not require calibration and can be faster, easier to perform, more accurate, and more robust than analog measurements.

[0004] Given the limitations inherent in analog assays and the technological limitations of existing digital assays, there is a clear need to provide improved methods and devices for performing digital protein assays. The invention described herein addresses this need and more. Summary of the Invention [Means for solving the problem]

[0005] The present disclosure provides methods, systems, and compositions for performing assays. In various aspects, the present disclosure relates to digital assays, particularly protein assays in certain aspects, that can be performed using an amplification reaction and / or in a single step or in a single container. In some aspects, the amplification reaction is an isothermal amplification reaction. In certain aspects, the isothermal amplification is digital isothermal amplification. In some aspects, the amplification reaction is PCR amplification. In certain aspects, the PCR amplification is digital PCR amplification. In many aspects, the assays disclosed herein are performed without a wash step. The present disclosure further relates to assays that can be performed as homogeneous assays, i.e., assays that do not have reactants attached to a solid support. In many embodiments, homogeneous assays use a homogeneous solution, which can be a solution in which all inputs to a proximity-triggered amplification reaction are smaller than about 50 nm. Optionally, the homogeneous solution can include an analyte and / or an optical probe larger than 50 nm.

[0006] In various aspects, the present disclosure provides a method for digital detection of an analyte. A fluid is divided into multiple compartmentalized fluid volumes to form a homogenous assay, such that some volumes contain the analyte and some do not. An optical signal is elicited in the analyte-containing volume by proximity-induced interactions that include the analyte and components of the compartmentalized volume. The presence of the analyte is detected in the analyte-containing volume based on the optical signal from those volumes. During detection, the fluid in each of the multiple compartmentalized fluid volumes essentially consists of the respective compartmentalized fluid volume produced by the division step and the reaction products produced therefrom.

[0007] That is, after dividing the fluid into each compartmentalized volume, reaction participants are either retained in the fluid in each volume or consumed to produce reaction products, but are not removed, and no additional reaction products or participants are added. On the other hand, materials that are not substantially involved in the reaction can be added or removed. For example, some liquid can be evaporated or added.

[0008] In many embodiments, the analyte is a protein.

[0009] In many embodiments, each fluid volume of the plurality of compartmentalized fluid volumes comprises a first probe and a second probe. The first probe comprises a first binding moiety configured to bind to an analyte, the first binding moiety binding to a first nucleic acid molecule. The second probe comprises a second binding moiety configured to bind to the analyte, the second binding moiety binding to a second nucleic acid molecule. In many embodiments, a proximity-induced interaction occurs between the first probe and the second probe upon binding to the analyte, triggering an amplification reaction. The optical signal can be a fluorescent signal triggered by the amplification reaction in the analyte-containing volume.

[0010] In many embodiments, the first and second nucleic acids are DNA strands, for example, each can be a single DNA strand, optionally conjugated to other nucleic acid molecules.

[0011] In some embodiments, the method can include counting the number of volumes where fluorescence is produced, thereby generating an analyte count for the sample. For example, the analyte count can be generated based on Poisson statistics.

[0012] In some embodiments, the amplification reaction is an isothermal reaction. In certain embodiments, the isothermal amplification is digital isothermal amplification. In some embodiments, the amplification reaction is PCR amplification. In certain embodiments, the amplification reaction is digital PCR amplification. In some embodiments, the method is performed without a ligase.

[0013] In some embodiments, while detecting the presence of an analyte using an optical signal, each of the multiple compartmentalized volumes comprises a respective compartmentalized fluid volume and reaction products produced therefrom produced by the dividing step. That is, the detection step is performed on the same compartmentalized volume of fluid produced in the dividing step. For example, dividing the fluid can maintain each fluid volume as a closed system. In some embodiments, the fluid is divided into multiple closed containers, and each fluid volume is contained within a single container throughout the remainder of the method until the analyte is detected using an optical signal.

[0014] In many embodiments, the method is performed without a wash step. In some embodiments, the light signal is an absorbance signal or a luminescence signal.

[0015] In some embodiments, at least one of the proximity-induced interaction and the amplification reaction is an isothermal reaction. In certain embodiments, the proximity-induced interaction is an isothermal reaction. In certain embodiments, the amplification reaction is an isothermal reaction. In certain embodiments, the isothermal reaction is digital isothermal amplification. In some embodiments, the amplification reaction is a PCR reaction. In certain embodiments, the amplification reaction is a digital PCR reaction. In many embodiments, both the proximity-induced interaction and the amplification reaction are isothermal reactions.

[0016] In many embodiments, the proximity-induced interaction is a strand-displacement interaction. In some embodiments, prior to the proximity-induced interaction, the second nucleic acid molecule binds to a non-extendable blocker oligonucleotide. The proximity-induced interaction involves an interaction between the first and second nucleic acids that displaces the blocker oligonucleotide into solution, and the amplification reaction involves inducing template polymerization to extend the first nucleic acid molecule after the displacement of the blocker oligonucleotide. The second nucleic acid can be, for example, a template for extension of the first nucleic acid. Each fluid volume can contain a nicking endonuclease configured to cleave the extended first nucleic acid and allow the release of the nicked portion into solution. The nicking endonuclease can be an enzyme, such as a version of Cas9, or a ribozyme or RNA-guided endonuclease. An optical signal can be triggered upon the release of the nicked portion in the analyte-containing volume.

[0017] In some embodiments, the amplification reaction repeatedly extends the first nucleic acid, and the nicking endonuclease repeatedly cleaves the extended first nucleic acid, thereby causing an accumulation of nicked nucleic acid strands. In some embodiments, each fluid volume comprises a plurality of fluorescent moieties configured to bind to the accumulated nicked nucleic acid strands, and fluorescence is induced by binding of the fluorescent moieties to the accumulated nicked nucleic acid strands and by irradiating the plurality of volumes with light resonant with the bound fluorescent moieties, thereby inducing fluorescence from the bound fluorescent moieties.

[0018] In some embodiments, the fluorescent moiety is a dye. In some embodiments, the fluorescent moiety is a protein. In some embodiments, the fluorescent moiety is a polymer dot.

[0019] In some embodiments, each fluid volume contains multiple auxiliary substrates. In some embodiments, each auxiliary substrate comprises an auxiliary nucleic acid strand, and at least some of the auxiliary substrates are bound to an auxiliary non-extendible blocker oligonucleotide. In some embodiments, each auxiliary substrate comprises an auxiliary nucleic acid strand, and none of the auxiliary substrates are bound to an auxiliary non-extendible blocker oligonucleotide. The auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid, thereby displacing the auxiliary non-extendible blocker oligonucleotide and forming an auxiliary nucleic acid complex in solution. The auxiliary nucleic acid complex includes a nicked portion and an auxiliary nucleic acid strand and is configured to extend the nicked portion and repeatedly trigger removal of a portion of the extended nicked portion by a nicking endonuclease or polymerase. The removed extended nicked portion contains a copy of the originally removed nicked portion. This process can produce exponential amplification for the accumulation of nucleic acid products.

[0020] In many embodiments, the amplification reaction is selected from the group consisting of an enzyme-free hairpin assembly reaction, an enzyme-free catalytic hairpin reaction, an enzyme-free hybridization chain reaction, and proximity-guided rolling circle amplification.

[0021] In some embodiments, the amplification reaction is rolling circle amplification, and the second probe comprises a rolling circle amplification substrate bound to a second nucleic acid molecule. The rolling circle substrate comprises a circular nucleic acid strand. The circular nucleic acid strand comprises a first binding site for binding to a first nucleic acid molecule and a second binding site for binding to a second nucleic acid molecule. These sites can optionally overlap partially or entirely; for example, one site can be a subset of the other site. The circular nucleic acid strand can have equal or greater affinity between the first binding site and the first nucleic acid molecule than between the second binding site and the second nucleic acid molecule, thereby facilitating transfer of the circular nucleic acid strand to the first nucleic acid molecule. In some cases, the second binding site comprises one or more mismatched nucleic acids that are not complementary to the corresponding nucleic acids of the second nucleic acid molecule.

[0022] In various aspects, the present disclosure provides a method for digital detection of a protein analyte. A fluid is divided into multiple compartmentalized fluid volumes to form a homogeneous assay, such that some volumes contain the analyte and some do not. Each compartmentalized fluid volume further includes a first probe comprising a first binding moiety bound to a first nucleic acid molecule and a second probe comprising a second binding moiety bound to a second nucleic acid molecule. Each binding moiety is configured to bind to the analyte, e.g., to a different locus on a common protein molecule. Upon binding to the analyte, a proximity-induced interaction occurs between the first and second nucleic acid molecules, resulting in an amplification reaction, resulting in a compartmentalized analyte-containing volume. The presence of the analyte in the analyte-containing volume is detected based on the amplification reaction. In some aspects, the amplification reaction is an isothermal amplification reaction. In certain aspects, the isothermal amplification is digital isothermal amplification. In some aspects, the amplification reaction is PCR amplification. In certain aspects, the amplification reaction is digital PCR amplification.

[0023] In some embodiments, detection is performed by illuminating the plurality of compartmentalized volumes with light and detecting fluorescence from the compartmentalized analyte-containing volumes.

[0024] In some aspects, the dividing step includes placing each compartmentalized fluid volume in a respective one of the plurality of containers, and each compartmentalized fluid volume can remain in its respective container until the detecting step is performed.

[0025] In many embodiments, proximity-induced interaction induces an amplification reaction in which a second nucleic acid molecule is elongated.In some embodiments, the second nucleic acid molecule is elongated using the first nucleic acid as a template.In some cases, the first nucleic acid molecule binds to a rolling circle substrate before proximity-induced interaction, and the proximity-induced interaction induces the elongation of the second nucleic acid molecule using the rolling circle substrate as a template.

[0026] In many embodiments, the first nucleic acid binds to the extendible substrate prior to the proximity-induced interaction, which releases the extendible substrate into solution. In some embodiments, the release of the extendible substrate triggers an exponential amplification reaction.

[0027] In some embodiments, the proximity-induced interaction triggers a hairpin assembly reaction. In some embodiments, the proximity-induced interaction generates a catalytic surface comprised of portions of the first and second nucleic acid molecules. In some cases, the fluid comprises an auxiliary substrate bound to an auxiliary non-extendible blocker oligonucleotide, and the catalytic surface displaces the auxiliary non-extendible blocker oligonucleotide, thereby triggering an amplification reaction involving the auxiliary substrate. In some cases, the fluid comprises a rolling circle substrate bound to an auxiliary non-extendible blocker oligonucleotide, and the catalytic surface displaces the auxiliary non-extendible blocker oligonucleotide, thereby triggering an amplification reaction involving the rolling circle substrate. In some cases, the fluid comprises a plurality of folded hairpin molecules, and the catalytic surface catalyzes the unfolding of at least one of the plurality of folded hairpin molecules.

[0028] In various aspects, a method for detecting the presence of an analyte in a fluid via strand displacement amplification is provided. A first probe and a second probe are provided in a solution. The first probe comprises a first binding moiety configured to bind to the analyte, the binding moiety being conjugated to a first nucleic acid molecule. The second probe comprises a second binding moiety configured to bind to the analyte, the binding moiety being conjugated to the first nucleic acid molecule. The second nucleic acid molecule is bound to a non-extendable blocker oligonucleotide. The non-extendable blocker oligonucleotide is displaced into the solution by proximity-induced interaction between the first and second probes, which can occur when each binds to a single analyte. Templated polymerization is induced to extend the first nucleic acid molecule, and this extension is used to trigger an optical signal used to detect the analyte in the fluid. In some aspects, the optical signal is fluorescent.

[0029] In many embodiments, displacing the non-extendable blocker oligonucleotide comprises binding the first nucleic acid molecule to a second nucleic acid molecule. Further, extending the first nucleic acid molecule can comprise using the second nucleic acid molecule as a template. In some embodiments, a nicking endonuclease configured to cleave the extended first nucleic acid and release the nicked portion into solution is provided in the fluid.

[0030] In some embodiments, the fluid contains multiple auxiliary substrates. In some embodiments, each auxiliary substrate comprises an auxiliary nucleic acid strand, and at least some of the auxiliary substrates are bound to an auxiliary non-extendible blocker oligonucleotide. In some embodiments, each auxiliary substrate comprises an auxiliary nucleic acid strand, and none of the auxiliary substrates are bound to an auxiliary non-extendible blocker oligonucleotide. The auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid, thereby displacing the auxiliary non-extendible blocker oligonucleotide and forming an auxiliary nucleic acid complex in solution that includes the nicked portion and the auxiliary nucleic acid strand. The auxiliary nucleic acid complex is configured to extend the nicked portion and repeatedly induce removal of portions of the extended nicked portion using a nicking endonuclease or a polymerase, wherein the removed extended nicked portion comprises a copy of the originally removed nicked portion. For example, a nicking endonuclease can cleave the extended nicked portion, which can be removed into solution by a polymerase that performs additional extension.

[0031] In many embodiments, the analyte is a protein. In various embodiments, the nucleic acid molecule is DNA.

[0032] In various aspects, the present disclosure provides a composition for use in detecting an analyte. The composition comprises a solution containing a first probe comprising a first binding moiety bound to a first nucleic acid molecule and a second probe comprising a second binding moiety bound to a second nucleic acid molecule. Each of the first and second binding moieties is configured to bind to an analyte. The second nucleic acid molecule is also bound to a non-extensible blocker oligonucleotide. The first and second nucleic acid strands comprise corresponding sections of nucleic acid, such that when the first and second probes are brought into proximity by binding to the analyte, the non-extensible blocker oligonucleotide is displaced into solution by a proximity-induced interaction between the first and second probes. Furthermore, participants in the proximity-induced interaction are not directly or indirectly bound to a solid support.

[0033] In many embodiments, the solution further comprises a polymerase for extending the first nucleic acid upon displacement of the non-extendible blocker oligonucleotide by proximity-induced interaction. In some embodiments, the solution further comprises a nicking endonuclease configured to cleave the nicked portion of the extended first nucleic acid and release the nicked portion into the solution. The solution can further comprise a fluorescent moiety configured to fluoresce in response to nucleic acid accumulation when irradiated. In some embodiments, the fluid further comprises a plurality of auxiliary substrates. In some embodiments, each auxiliary substrate comprises an auxiliary nucleic acid strand, and at least some of the auxiliary substrates are bound to an auxiliary non-extendible blocker oligonucleotide. In some embodiments, each auxiliary substrate comprises an auxiliary nucleic acid strand, and none of the auxiliary substrates are bound to an auxiliary non-extendible blocker oligonucleotide. The auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid, thereby displacing the auxiliary non-extendible blocker oligonucleotide and forming an auxiliary nucleic acid complex comprising the nicked portion and the auxiliary nucleic acid strand in the solution. The auxiliary nucleic acid complex is configured to extend the nicked portion and repeatedly trigger removal of portions of the extended nicked portion by a nicking endonuclease or polymerase, where the removed extended nicked portion can comprise a copy of the originally removed nicked portion.

[0034] In various aspects, the present disclosure provides a system for digital detection of an analyte. The system includes a plurality of fluid volumes, each arranged in a plurality of compartments. Some of the plurality of fluid volumes are compartmentalized non-analyte-containing volumes, and others are compartmentalized analyte-containing volumes. Each fluid volume includes a first probe including a first binding moiety configured to bind to the analyte, the first binding moiety conjugated to a first nucleic acid molecule. Each fluid volume further includes a second probe including a second binding moiety configured to bind to the analyte, the second binding moiety conjugated to a second nucleic acid molecule. The system further includes a light source configured to illuminate the fluid volumes within the compartments and induce fluorescence in response to an amplification reaction triggered by proximity-induced interaction between the first probe and the second probe. In some aspects, the amplification reaction is an isothermal amplification reaction. In certain aspects, the isothermal amplification is digital isothermal amplification. In some aspects, the amplification reaction is PCR amplification. In certain aspects, the amplification reaction is digital PCR amplification. The interaction occurs when the first and second probes bind to the analyte in solution within the compartment.

[0035] In many embodiments, the system further includes a detector configured to detect fluorescence from the compartmentalized analyte-containing volume and generate a count of the analyte sample based on the detection of the fluorescence.

[0036] In many embodiments, the amplification reaction comprises templated polymerization or cascade dequenching reaction. In some embodiments, the amplification reaction comprising templated polymerization or cascade dequenching reaction is an isothermal amplification reaction. In certain embodiments, the amplification reaction comprising templated polymerization or cascade dequenching reaction is digital isothermal amplification. In some embodiments, the amplification reaction comprising templated polymerization or cascade dequenching reaction is PCR amplification. In certain embodiments, the amplification reaction comprising templated polymerization or cascade dequenching reaction is digital PCR amplification.

[0037] In many embodiments, the proximity induced interaction is a strand displacement interaction. In many embodiments, the proximity induced interaction is selected from the group consisting of an enzyme-free hairpin assembly reaction, an enzyme-free catalytic hairpin reaction, an enzyme-free hybridization chain reaction, and proximity induced rolling circle amplification.

[0038] In some embodiments, the system is configured to divide a fluid to generate multiple fluid volumes. The system can be further configured to maintain each of the multiple fluid volumes as an essentially closed fluid system upon dividing the fluid until detecting the induction of fluorescence. An essentially closed fluid system can allow for the addition or removal of substances not critical to the interaction or reaction, such as, for example, gain or loss of fluid through addition or evaporation. Alternatively, the essentially closed fluid system can be completely closed, maintaining the original fluid components of each volume and any reaction products.

[0039] In some aspects, the system may include fluid compartments that are essentially closed except that certain reaction products, such as nucleotide triphosphates, are allowed to flow in and out of individual compartments. In such embodiments, when used as a digital assay for analyte detection, neither the analyte nor the reaction products (e.g., nucleic acid strands produced by an amplification reaction) should be able to move between compartments.

[0040] In various embodiments, methods for analyte detection are provided. A fluid is provided containing an analyte, a first probe, and a second probe. The first probe comprises a first binding moiety conjugated to a first DNA molecule. The second probe comprises a second binding moiety conjugated to a second DNA molecule. Each of the first and second binding moieties is configured to bind to the analyte. The second DNA molecule comprises an RNA polymerase binding site and binds to a blocker oligonucleotide that blocks the RNA polymerase binding site. The first and second binding moieties can bind to a common molecule of the analyte, thereby bringing the first and second probes into close proximity. A proximity-induced interaction occurs between the DNA molecules of the probes, resulting in displacement of the blocker oligonucleotide into the solution. The RNA polymerase then induces transcription of RNA from the second DNA molecule, and the presence of the analyte in the fluid is detected based on the transcription. In many embodiments, transcription of the RNA induces the generation of an optical signal, such as fluorescence, used for detection. In some embodiments, fluorescence is induced by the accumulation of RNA.

[0041] In some embodiments, the transcribed RNA is further amplified using nucleic acid sequence-based amplification. In some embodiments, the method is performed using a homogeneous assay. For example, the method can be a digital assay.

[0042] In various embodiments, a composition for detecting an analyte is provided. The composition includes a homogeneous fluid containing a first probe and a second probe. The first probe is configured to bind to the analyte and includes a first binding moiety that binds to a first DNA molecule. The second probe is configured to bind to the analyte and includes a second binding moiety that binds to a second DNA molecule. The second DNA molecule includes an RNA polymerase binding site, and the second DNA molecule is bound to a blocker oligonucleotide that blocks the RNA polymerase binding site. The fluid further includes an RNA polymerase and a fluorescent moiety. The first and second binding DNA molecules are configured to generate a proximity-based interaction when the first and second binding moieties are brought into proximity upon binding to a common molecule of the analyte. The proximity-based interaction displaces the blocker oligonucleotide into solution, allowing the RNA polymerase to transcribe RNA using the second DNA molecule as a template.

[0043] In many embodiments, the composition further comprises one or more moieties selected from the group consisting of reverse transcriptase, RNAse H, nucleotide triphosphates, deoxynucleotide triphosphates, and DNA primers for amplifying the transcribed RNA using nucleic acid sequence-based amplification. For example, the composition can comprise all of the moieties listed above.

[0044] In some embodiments, the fluorescent moiety is a fluorescent dye, a fluorescent nanoparticle, or a fluorescent protein.

[0045] In various aspects, the amplification reactions disclosed herein are attachment reactions that occur in proximity to the analyte. In other aspects, the amplification reactions disclosed herein are separation reactions that occur in solution and not necessarily in proximity to the analyte. In certain aspects, the amplification reactions disclosed herein are partial attachment reactions, where some amplification occurs in proximity to the analyte and some occurs in solution without proximity to the analyte.

[0046] In various aspects, the amplification reactions disclosed herein are polymerization reactions. For example, the amplification reactions can include nucleic acid polymerization, such as DNA or RNA polymerization. In various aspects, the amplification reactions disclosed herein are non-polymerization reactions, such as dequenching reactions. For example, the reaction can include the debinding of self-bound nucleic acid strands or bound strand pairs. In some embodiments, dequenching can include the debinding and assembly of DNA hairpin molecules.

[0047] In various aspects, the detection can be optical detection. In some embodiments, the optical detection can use fluorescence. In some embodiments, the optical detection can use luminescence. In some embodiments, the optical detection can include absorbance detection. In various aspects, the detection of the analyte can include non-optical detection methods.

[0048] In various aspects, the methods and systems disclosed herein can use digital assays for analyte detection, while in other aspects, non-digital (e.g., analog) detection can be used.

[0049] In various embodiments, the amplification reactions disclosed herein proceed as exponential amplification reactions. In other embodiments, the amplification reactions proceed as linear reactions. In some embodiments, the reactions can proceed as substantially linear reactions, i.e., the reaction rate grows similarly or faster than a linear reaction, but slower than an exponential reaction, e.g., with a polynomial growth rate. A substantially linear reaction includes a linear reaction unless otherwise specified.

[0050] In various aspects, the amplification reactions disclosed herein are isothermal reactions. In certain aspects, the isothermal amplification is digital isothermal amplification. In some aspects, the amplification reactions disclosed herein are polymerase chain reaction amplification reactions. In certain aspects, the amplification reaction is digital PCR amplification. The proximity-based interactions disclosed herein are also preferably isothermal reactions. In some embodiments, the proximity-based interactions disclosed herein include digital PCR reactions. In certain embodiments, the proximity-based interaction and amplification reactions are digital isothermal reactions. In some cases, methods and systems perform the and / or interaction steps under isothermal conditions, which are at a substantially constant temperature. A heating step can be performed prior to the isothermal reaction, e.g., by exceeding a temperature threshold to trigger initiation of the reaction. In some cases, methods and systems performing the amplification and / or interaction steps are performed under conditions that include PCR amplification, which is by thermal cycling.

[0051] In various aspects, the binding moieties disclosed herein include antibodies or portions thereof. The antibodies can include an antigen-binding site that binds to an antigen. The analyte can include a site to which the antibody binds, e.g., multiple binding sites, each binding to a specific antibody corresponding to a specific probe.

[0052] In various aspects, the methods and systems disclosed herein detect analytes without requiring a wash step. In various aspects, the proximity-based interaction and amplification reaction are performed in a single container. In various aspects, the methods and systems disclosed herein include only a single step for detection, beginning with a proximity-based interaction between fluidic components (e.g., probes) and proceeding to trigger an amplification reaction that is used to detect the presence of the analyte by optical or other means.

[0053] In various aspects, the methods and systems disclosed herein include a plurality of compartmentalized volumes comprising threshold oligonucleotides. In some aspects, the methods and systems disclosed herein include a plurality of compartmentalized volumes comprising a plurality of auxiliary substrates. In certain aspects, the plurality of auxiliary substrates comprise threshold oligonucleotides. In some aspects, the plurality of compartmentalized fluid volumes comprise a plurality of auxiliary substrates. In certain aspects, the plurality of auxiliary substrates comprise auxiliary substrates that bind to the amplification product oligonucleotides. In some aspects, auxiliary substrates that bind to the amplification product oligonucleotides inactivate them. In certain aspects, inactivating the amplification product oligonucleotides comprises binding to the amplification product oligonucleotides. In some aspects, binding to the amplification product oligonucleotides creates a threshold for exponential growth. In certain aspects, inactivating the amplification product oligonucleotides comprises non-productively extending the amplification product oligonucleotides. In some aspects, non-productively extending the amplification product oligonucleotides creates a threshold for exponential growth. In certain aspects, the plurality of auxiliary substrates comprise auxiliary substrates that bind to the amplification product oligonucleotides to create a threshold for exponential growth. In certain embodiments, the plurality of auxiliary substrates comprises an auxiliary substrate that binds to the amplification product oligonucleotide and inactivates the amplification product oligonucleotide by non-productively extending the amplification product oligonucleotide, creating a threshold for exponential growth.

[0054] This Summary is provided to introduce a selection of concepts in a simplified form that are further described below in the Detailed Description. This Summary is not intended to identify key features of the claimed subject matter, nor is it intended to be used as an aid in determining the claimed subject matter.

[0055] Incorporation by Reference All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0056] The novel features described herein are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which: [Brief explanation of the drawings]

[0057] [Figure 1A] 1 illustrates a method for analyte detection. [Figure 1B] 1 illustrates a composition for the detection of an analyte according to various embodiments. [Figure 1C] 1 shows a general scheme for using proximity-based interactions to detect analytes in fluids. 2 shows an "attachment" detection scheme for analyte detection. [Figure 1D] 1 shows a general scheme for using proximity-based interactions to detect analytes in fluids. 2 shows a "separate" analyte detection scheme. [Figure 2] 1 shows a method for analyte detection using attached strand displacement amplification. [Figure 3] 1 illustrates a method for analyte detection using decoupled exponential amplification in combination with attached strand displacement amplification. [Figure 4] 1 illustrates a method for analyte detection using an attached hairpin assembly reaction. [Figure 5] 1 shows a method for analyte detection using a three-way junction to catalyze a hairpin assembly reaction. [Figure 6] 1 shows a method of analyte detection using a three-way junction to catalyze attached strand displacement amplification. [Figure 7] 1 shows a method for analyte detection using attached rolling circle amplification. [Figure 8]1 shows a method for analyte detection using a three-way junction to activate separate rolling circle amplification. [Figure 9] 1 shows a method for analyte detection using separate strand displacement amplification. [Figure 10] 1 illustrates a method for analyte detection using discrete rolling circle amplification. [Figure 11] A method for analyte detection using strand displacement of a blocking oligonucleotide to trigger RNA polymerization is presented. [Figure 12A] FIG. 1 shows a schematic of an attached strand displacement amplification reaction in which proximity induces strand displacement to generate an active substrate for a polymerase and a nicking endonuclease. [Figure 12B] 1 shows fluorescence over time for the detection of an analyte involving strand displacement amplification. [Figure 12C] 1 shows endpoint fluorescent digital photographs showing the relative fluorescence of samples from strand displacement amplification. [Figure 12D] Shown is fluorescence over time, performed in triplicate experiments with and without target protein in strand displacement amplification. [Figure 12E] Endpoint fluorescence digital photographs showing the relative fluorescence of triplicate samples with and without target protein are shown. [Figure 13A] A schematic diagram of detection using separate exponential amplification combined with attached strand displacement amplification (labeled "EXPAR reaction") is shown, where proximity induces strand displacement to generate active substrates for polymerase and nicking endonuclease, a subsequent reaction that generates exponential growth. [Figure 13B] 1 shows fluorescence over time in the detection of an analyte with EXPAR amplification. [Figure 13C] 1 shows endpoint images of fluorescent droplets generated from a digital isothermal amplification assay. DETAILED DESCRIPTION OF THE INVENTION

[0058] FIELD OF THE DISCLOSURE The present disclosure relates generally to compositions, systems, and methods for detecting analytes, particularly protein analytes, using assays involving proximity-based interactions.

[0059] The most commonly used method for detecting amplified biomarkers in a sample is the polymerase chain reaction (PCR). In this method, DNA is amplified in a temperature-sensitive reaction catalyzed by a DNA polymerase enzyme. In PCR, the sample is typically cycled between two or three temperatures, ranging from approximately 60°C to approximately 95°C, using a thermal cycling device. Using PCR to amplify DNA has led to significant advances in a wide range of fields, from basic biology to clinical diagnostics and forensics. PCR has also been refined to detect DNA within droplets for a "digital" readout, allowing for the absolute quantification or counting of individual nucleic acid molecules. However, while some progress has been made in the digital detection of nucleic acids, there remains a need for the development of techniques for protein detection.

[0060] There is a need for amplification methods for detecting proteins, particularly methods that do not require a wash step. There is a particular need for isothermal amplification methods for detecting proteins, particularly methods that do not require a wash step. Isothermal protein detection has a wide range of applications, including point-of-care diagnostics and personalized precision medicine. Isothermal amplification for protein detection offers at least two substantial advantages over PCR: it does not require precise temperature changes to achieve amplification (i.e., the technique can be performed under isothermal conditions) and it is applicable to protein analytes (PCR is primarily useful for detecting DNA). The isothermal techniques for protein detection disclosed herein provide isothermal amplification-based detection of proteins and can be performed as part of a digital assay.

[0061] The digital assays described herein can include dividing, dispensing, or otherwise separating a sample (or a derivative thereof) into multiple compartmentalized volumes, individually evaluating the multiple compartmentalized volumes for the presence or absence of a detectable signal or code (e.g., detecting a detectable signal or code generated by a fluorescent probe), and assigning a binary value to each evaluated compartmentalized volume. In some cases, values ​​can be assigned to compartmentalized volumes based on the presence, absence, wavelength, intensity, and / or lifetime of the detectable signal or code (or portion thereof) within the compartmentalized volume. The values ​​assigned to the evaluated compartmentalized volumes can be used to determine characteristics of target molecules within each compartmentalized volume. For example, detection or failure to detect a detectable signal (e.g., a detectable code or aspect thereof) within a compartmentalized volume can indicate the presence or absence of a target molecule within the compartmentalized volume and can be used to determine the concentration of the target molecule in the sample. In some cases, detection or failure to detect a detectable signal within a compartmentalized volume can be used to determine the identity or quantity of protein molecules in the sample.

[0062] One reference reports an isothermal digital protein ELISA based on bead capture of the enzyme, beta-galactosidase. However, this type of heterogeneous technique (i.e., one that relies on capture rather than proceeding in solution) has significant limitations. Protein detectors must be washed to remove background analytes, which would result in false-positive signals. This required washing step is a significant drawback. Furthermore, the need for bead capture prevents the technique from being performed in a homogeneous solution, further limiting the technique. The detection techniques disclosed herein can be performed in a mix-and-read manner without the necessary washing steps, and they can be performed in solution without the use of supports such as beads.

[0063] Conventional methods for digital analysis of protein analytes in homogeneous solutions also have several drawbacks compared to the techniques disclosed herein. For example, a technique for detecting certain protein toxins using proximity ligation assays and PCR has been reported. However, this technique is hindered by the need for a step involving controlled temperature changes over a significant range, which prevents isothermal detection of the analyte. Furthermore, this technique requires a centrifugation step, which requires transfer between containers. This prevents this technique from being performed in one pot or in a single step. In contrast, the isothermal techniques disclosed herein enable the detection of protein analytes in an isothermal process and can be performed in a single container without additional steps such as centrifugation.

[0064] Finally, certain techniques have been developed for use in analog assays, such as proximity-induced rolling circle amplification and hairpin assembly reactions. However, these techniques are limited by their reliance on analog solution reactions that require calibration and can be susceptible to errors that are difficult to correct and quantify. For example, uncertainty in amplification efficiency can lead to very large errors when processing reactions that result in exponential growth.

[0065] In some embodiments, polymerase chain reaction amplification (also referred to herein as "PCR amplification," etc.) can be used to detect proteins. In certain embodiments, PCR amplification does not require a wash step. PCR amplification can be achieved using a portable machine, providing an advantageous use of the polymerase chain amplification reaction (also referred to herein as a "PCR amplification reaction," "PCR reaction," etc.) disclosed herein. The PCR amplification for protein detection disclosed herein provides PCR amplification-based detection of proteins and can be performed as part of a digital assay. In some embodiments, the PCR amplification technique comprises digital PCR amplification.

[0066] FIG. 1A illustrates a method 100 for analyte detection. The method can be performed to detect analytes dissolved or dispersed in a fluid. For example, the method can be used to detect proteins in a fluid. Preferably, the method is performed in a homogeneous assay. That is, the method is performed without relying on the attachment of particles to beads or other forms of solid support. This feature provides increased flexibility and efficiency. For example, unlike heterogeneous assays, no wash steps need to be used.

[0067] In step 112, a fluid containing an analyte is provided. Preferably, the analyte is a protein, and the fluid contains many analyte protein molecules. Additional fluid components can be provided that can interact with the analyte and each other through proximity-based interactions. For example, the components can include a first probe and a second probe, each configured to bind to the analyte. In some embodiments, the first probe includes a first binding moiety bound to a first nucleic acid molecule. The first binding moiety can be an antibody with affinity for the analyte. The second probe can similarly include a second binding moiety bound to a second nucleic acid. The second binding moiety can also be an antibody with affinity for the analyte. In some embodiments, the first and second binding moieties are different antibodies configured to bind to different respective portions of a common protein molecule. The fluid components can also include additional reaction components, such as polymerase and endonuclease molecules, and suitable nucleic acid bases for use in nucleosynthesis, as well as non-reactive components, such as solvents (e.g., water), buffers, etc. The first and second nucleic acids are preferably DNA molecules.

[0068] In step 114, the fluid is divided into compartmentalized volumes to generate a digital assay. The compartmentalized volumes can be, for example, droplets or wells each containing a single droplet. Other methods of dividing the fluid can also be used. For example, compartmentalized volumes can be generated in situ by introducing a membrane or other fluidic barrier within a larger fluid volume, thereby dividing the fluid components into the respective compartmentalized volumes. Preferably, the compartmentalized volumes contain a homogenous fluid that undergoes a reaction without relying on the presence of supporting structures such as beads. The fluid can be appropriately diluted so that some compartmentalized volumes contain no analyte and some contain some analyte. If the fluid is homogenous and the analyte is completely diffused throughout the fluid, the division step tends to randomly allocate analyte molecules to each compartmentalized volume. If each compartmentalized volume is similar to the other volumes, the division step typically distributes the analyte among the compartmentalized volumes according to a Poisson distribution. Because digital assays typically rely on distinguishing between volumes containing the analyte and volumes not containing the analyte, the best signal-to-noise ratio can be achieved in assays where a significant fraction of the compartmentalized volumes are expected to be free of the analyte. While the use of the division step 114 is preferred for forming a digital assay, in some embodiments the division step can be omitted. For example, in some embodiments, the method 100 can be performed to generate an analog (i.e., non-digital) measurement in a single fluid volume.

[0069] The various fluid components can be introduced into the fluid prior to the step of adding the analyte to the fluid, or can be introduced simultaneously or later, for example, during the partitioning step 114. In some cases, different components can be added at different times. For example, one or more reagents can be withheld until after the fluid has been partitioned into compartments, allowing reactions to proceed only within the compartmentalized volumes and protecting against cross-contamination.

[0070] In step 116, proximity-based interactions are allowed to occur between the fluid components. The interactions can occur spontaneously, for example, from the presence of the analyte and other fluid components in the solution, or the interactions can be induced. For example, the interactions and / or subsequent amplification reactions (e.g., dequenching or enzymatic amplification) can be induced by raising the temperature of the fluid above a critical temperature. Preferably, the amplification reactions are isothermal. Optionally, the proximity-based interactions are also isothermal. More preferably, all isothermal amplifications are digital isothermal amplifications. An isothermal reaction can be induced by raising the temperature to a certain level, but the temperature does not need to be changed to complete the reaction. As used herein, an isothermal reaction is a reaction that proceeds to completion at a constant temperature. The term "isothermal" characterizes the reaction, but not the conditions under which the reaction occurs. Thus, an isothermal reaction remains isothermal even if the temperature of the system changes as the reaction is carried out, as long as the reaction still occurs if the temperature is held constant. In contrast, polymerase chain reaction (PCR) is not isothermal because it requires multiple cycles at various temperatures to run to completion. On the other hand, amplification reactions and other interactions discussed herein may require temperatures within a certain range and may proceed at slightly different rates as a function of temperature, but are typically isothermal because they do not require temperature changes over the course of the reaction to run to completion. In some embodiments, the amplification reaction is a PCR reaction, and in some embodiments, the amplification reaction is a digital PCR reaction. In certain embodiments, the amplification is a PCR reaction (e.g., a digital PCR reaction) and the proximity-based interaction is an isothermal reaction (e.g., a digital isothermal reaction). As used herein, a PCR reaction is one that runs to completion using thermal cycling to enable different temperature-dependent reactions. In some embodiments, the amplification reaction is selected from the group consisting of an enzyme-free hairpin assembly reaction, an enzyme-free catalytic hairpin reaction, an enzyme-free hybridization chain reaction, and proximity-induced rolling circle amplification.In some embodiments, the amplification reaction comprises an enzyme-free hairpin assembly reaction, an enzyme-free catalytic hairpin reaction, an enzyme-free hybridization chain reaction, and proximity-induced rolling circle amplification, or any combination thereof. In some embodiments, the amplification reaction is selected from the group consisting of a hairpin assembly reaction, a catalytic hairpin reaction, a hybridization chain reaction, and proximity-induced rolling circle amplification. In some embodiments, the amplification reaction comprises a hairpin assembly reaction, a catalytic hairpin reaction, a hybridization chain reaction, and proximity-induced rolling circle amplification, or any combination thereof.

[0071] In certain embodiments, the amplification reaction uses digital isothermal amplification such as NASBA (Nucleic Acid Sequence Based Amplification), LAMP (Loop-mediated AMPlification), SDA (Strand Displacement Amplification), EXPAR (EXPonential Amplification Reaction), and rolling circle amplification (RCA), and the use of an array of digitized volumes is used to perform digital NASBA, digital LAMP, digital SDA, digital EXPAR, and digital rolling circle amplification, as well as digital PCR.

[0072] In some embodiments, a proximity-based interaction involves an interaction between a first and a second nucleic acid molecule bound to a first and a second binding moiety (e.g., an antigen), forming a first and a second probe, respectively, that binds to a protein analyte. Binding of the two probes to a common analyte brings the two probes into close proximity, allowing the nucleic acid strands to interact. In some embodiments, a proximity-based interaction involves a pairing interaction between a first and a second nucleic acid molecule. For example, nucleic acid molecules can pair to allow transcription of RNA, extension of one of the two nucleic acid molecules by a polymerase, or partial pairing of portions of two nucleic acid molecules to form a catalyst. Various ways in which proximity-based interactions can proceed are described in more detail with respect to the remaining figures. In some cases, proximity-based interactions may produce reaction products, such as the accumulation of nucleic acid strands in solution in a fluid. In some cases, these byproducts can interact with other fluid components to produce additional reaction products, for example, in an exponential amplification reaction.

[0073] In step 118, the analyte is detected based on the proximity-based interaction. Optical detection by fluorescence, absorbance, luminescence, or similar methods that generate an optical signal is the preferred detection method. In some embodiments, a fluorescent moiety (e.g., a fluorescent probe such as a dye, nanoparticle, protein, or polymer dot (PDot)) is provided in the fluid, and the fluorescent moiety interacts with the accumulated product of the proximity-based interaction. The fluorescent moiety that interacts with the accumulated product can fluoresce in response to illumination with light of an appropriate wavelength. For example, SyBr Green I (or SyBr Green II or SyBr Gold in the case of single-stranded DNA) can be used to detect DNA molecules accumulated in the solution using standard fluorescence detection. Alternatively, or additionally, other detection mechanisms can be used to detect the analyte. In some embodiments, detection of nucleic acid strands generated or modified by proximity-based interactions can be performed using absorbance detection, colorimetric detection, or various forms of chemical, electrical, or magnetic detection. For example, in some embodiments, an intercalating dye can be used to detect the accumulation of nucleic acid molecules, such as double-stranded DNA generated by a polymerase. In some embodiments, the accumulation of DNA or other nucleic acid products is detected by dyes that interact with single-stranded products through backbone interactions or interactions between the light-up aptamer and its target. In some embodiments, the accumulation of other nucleic acid products, such as DNA, is detected by molecular beacons. In some embodiments, the accumulation of nucleic acid products is detected by the formation of G-quadruplex structures in the product nucleic acid (e.g., DNA), which can then catalyze the production of additional fluorescent or colored products. In some embodiments, the accumulation of nucleic acid products is detected by chemiluminescence or bioluminescence associated with the polymerization of the product or product. In some embodiments, the product is detected by electrochemical changes in the solution, such as changes in capacitance, conductivity, or electron transfer rate.

[0074] In analog assay embodiments, detection can include determining a signal intensity that correlates to the number or concentration of analyte in the fluid. In digital embodiments, detection can include determining which of multiple compartmentalized volumes contain and do not contain analyte. For example, in fluorescence-based embodiments, fluorescence can be detected from one type of volume (e.g., a volume containing analyte) and not from the other type (e.g., a volume not containing analyte). Alternatively, the readout can be reversed if the reaction in the analyte-containing volume serves to quench the fluorescence rather than allow it to emanate. Based on determining which volumes contain analyte, a characteristic of the analyte, such as the total number of analytes, can be measured. This measurement can be performed by comparing the number of volumes containing zero and non-zero analyte to a Poisson distribution. For example, Poisson statistics can be used to generate an average amount of analyte per container. The total number or amount of analyte can be generated by multiplying the number of volumes by this average.

[0075] Method 100 can be performed by a system configured to perform a digital assay. The system can divide a fluid into multiple fluid volumes, each disposed in multiple compartments. For example, in some embodiments, the system can include an array of wells, droplets, or other compartmentalized volumes, each of which can be deposited with a portion of an analyte-containing fluid. The fluid within the compartmentalized volumes can contain one or more first and second probes, as well as appropriate additional components, such as a polymerase, an endonuclease, or a base pair, to support an amplification reaction and subsequent detection. Preferably, the system optically detects the presence of the analyte in the wells, such as by inducing and measuring fluorescence or by measuring a change in absorbance. Alternatively or additionally, the system can use methods such as chemical or electrical detection to determine which wells contain the analyte. The system can further generate a measurement of the analyte, such as an analyte count or analyte concentration, based on the detection of the analyte in the wells.

[0076] For example, a system can include a computer-controlled digital assay system that automatically partitions an analyte-containing fluid into multiple compartmentalized fluid volumes and controls reaction conditions (e.g., temperature) to promote proximity-based interactions in the analyte-containing volumes. The system can then detect (e.g., using fluorescence or other detection) which volumes contain the analyte and which do not. Based on this measurement, the system can generate a count of the number of analyte molecules present in the fluid. For example, using Poisson statistics, a measurement of the fraction of analyte-free volume x and the fraction of analyte-containing volume (1-x) can be correlated to the total fraction of analyte -ln(x), where ln is the natural logarithm, or the total number of analytes -ln(x)*N, where N is the number of volumes. The system can include a processor that executes instructions to control each step performed by the digital assay system, including the calculations necessary to generate the analyte count. The number of volumes (e.g., the number of wells) can be selected to provide a desired level of precision in the overall measurement. For example, the fluid can be divided into 10 or more, 20 or more, 50 or more, 100 or more, 200 or more, 500 or more, 1000 or more, 10,000 or more, or 100,000 or more volumes, with more volumes providing progressively greater precision. Although non-uniform divisions are possible and can be considered statistically, it is preferred that the fluid be divided evenly.

[0077] FIG. 1B illustrates a composition 120 for analyte detection according to various embodiments. The composition 120 can include a fluid having various fluid components. For example, the composition can be an aqueous solution. Preferably, the composition is a homogeneous fluid. That is, the various fluid components involved in reactions within the fluid are not attached to macroscopic structures, such as beads, that may require washing steps before or during the detection process. The fluid components can include various biomolecules and structures, depending on the particular detection method used. For example, the detection methods discussed in FIGS. 2-11 employ various proximity-based analyte detection methods, and the fluid components can be appropriately selected to implement any one or more of the illustrated methods.

[0078] The exemplary composition 120 includes various components, which are shown in a similar format in the remaining figures for ease of illustration. For example, the composition 120 includes an analyte 122, which can be any of a variety of biological structures to which other biomolecules can bind, such as protein molecules, protein complexes, metabolites, carbohydrates, lipid structures, drugs, viruses, nucleic acid structures, or even larger structures such as bacteria or other cells. The composition further includes a binding moiety 124, which includes a binding site for binding to a given location (e.g., an epitope) on the analyte 122. For example, the binding moiety 124 can be an antibody or portion thereof, and the analyte 122 can comprise an antigen that matches the antibody so that the binding moiety 124 targets and binds to the analyte 122. Furthermore, the analyte 122 can include multiple sites to which different antibodies can bind; by simultaneously binding to appropriate sites (e.g., different epitopes) on a common analyte, the antibodies can bring themselves (and other molecules to which they attach) into proximity to induce proximity-based interactions. The composition further includes a nucleic acid molecule 126, such as a strand of DNA or RNA. Nucleic acid molecule 126 is shown with a dot at its 5' end and an arrow at its 3' end, indicating the direction in which the molecule can be polymerized using a polymerase. A binding moiety and a nucleic acid molecule can be linked together to form probe 128, which can be used to induce a proximity-based interaction with another probe when bound to an analyte. When two nucleic acid molecules engage in a proximity-based interaction, they can form a double-stranded nucleic acid complex, such as double-stranded DNA complex 130. In double-stranded DNA complex 130, only portions of the two DNA molecules are shown bound together (e.g., via base pairing). The remaining portions of the DNA molecules can be separated, for example, by attachment to respective binding moieties attached to different sites on the analyte. Some embodiments include a "blocker" 132 that can bind to the nucleic acid molecule and inhibit polymerization, transcription, or binding. The blocker can be a non-extendable oligonucleotide, which can be formed by including a modification at its 3' end.For example, blocker 132 can have an inverted 3' end or another similar modification such that templated extension by a polymerase is inhibited at that end. Blocker 132 can have an inverted 3' end or another similar modification, alone or in combination, such that endonuclease nicking or templated extension by a polymerase is inhibited at that end. Other modifications that can prevent extension include dideoxy bases, phosphate modifications, extension mismatches, or other modifications that inhibit one or more enzymes required for amplification. Blockers can contain multiple complementary bases to another nucleic acid molecule such that the blocker binds to the nucleic acid molecule, resulting in an inactivated complex. Additional fluid components that can optionally be included in the composition are shown in Figures 2-11 below.

[0079] 1C and 1D show two general schemes for using proximity-based interactions to detect analytes in fluids.

[0080] 1C illustrates an "attached" detection scheme 140 for analyte detection. In the attached detection scheme 140, a first probe 142 and a second probe 144 each bind to a common analyte 141. This brings the two probes into close proximity and allows them to undergo proximity-based interactions with each other. The two probes contain nucleic acid molecules that interact to form a nucleic acid complex 146. This complex then participates in further reactions. For example, one of the nucleic acid molecules that form the complex can be extended by a polymerase, ultimately resulting in a further reaction that generates a detectable signal that the analyte is present in the fluid.

[0081] FIG. 1D illustrates an alternative "separate" analyte detection scheme 150. Similar to detection scheme 140, in detection scheme 150, first probe 152 and second probe 154 each bind to a common analyte 151 and then undergo proximity-based interactions to form complex 156. However, whereas complex 146 of attached scheme 140 participates in a further amplification reaction, the formation of complex 156 instead triggers a reaction away from the analyte. For example, the formation of complex 156 can remove an active nucleic acid strand 158 from one of the first and second probes, which can then form an active complex with other fluid components, resulting in an amplification reaction in solution away from the analyte. In many embodiments, the separation reaction is used as part of an exponential amplification reaction.

[0082] In addition to the strictly "attached" and "separate" schemes described above, some schemes employ "partially attached" reactions, in which amplification occurs involving the attached complex, while other parts of the reaction occur away from the analyte in solution. For example, many of the attached reactions described herein can be used to generate free nucleic acid strands that can interact with other substrates in solution to trigger an exponential amplification reaction.

[0083] Figures 2-11 illustrate in more detail how various proximity-based interactions can be used in accordance with the methods disclosed herein to generate analyte measurements. Each of the processes illustrated in Figures 2-11 can be performed under isothermal conditions (e.g., using an isothermal assembly and amplification reaction) and can be performed in either a single fluid solution (e.g., as an analog assay) or multiple compartmentalized solution volumes (e.g., as a digital assay). Alternatively, each of the processes illustrated in Figures 2-11 can be performed under conditions that include PCR amplification (e.g., using a thermal cycling assembly and a PCR amplification reaction such as digital PCR) and can be performed in either a single fluid solution (e.g., as an analog assay) or multiple compartmentalized fluid volumes (e.g., as a digital assay).

[0084] FIG. 2 illustrates a method 200 of analyte detection using attached strand displacement amplification. The method can be performed in a fluid, for example, in each of a plurality of compartmentalized fluid-containing volumes. An analyte 201 is provided in the fluid. For example, the analyte can be a protein molecule. Method 200 can be characterized as an "attached" method in that it involves a reaction (an amplification reaction) occurring in a complex attached to the analyte.

[0085] The fluid can further include a first probe 210 and a second probe 220. The first probe includes a first binding moiety 212 bound to a first interactive moiety that includes a first nucleic acid molecule 214. The first binding moiety 212 can be, for example, an antibody or portion thereof having a binding site for binding to the analyte 201. The first nucleic acid molecule 214 is bound to a non-extendable blocker oligonucleotide 216. The first nucleic acid molecule 214 and the non-extendable blocker oligonucleotide 216 can be, for example, DNA molecules bound together by base-pairing interactions. The non-extendable blocker oligonucleotide 216 can include a modification to its 3' end (e.g., an inverted 3' end) such that templated extension by a DNA polymerase is inhibited at that end (as well as the 5' end, which is not naturally extended by a DNA polymerase). When the first nucleic acid molecule 214 is attached at its 3′ end to the first binding moiety 212 , polymerization can be inhibited for both the first nucleic acid molecule 214 and the non-extendible blocker oligonucleotide 216 .

[0086] The second probe 220 can include a second binding moiety 222 and a second interacting moiety that includes a second nucleic acid molecule 224. The second binding moiety 222 can be, for example, an antibody or portion thereof having a binding site for binding to the analyte 201. The second nucleic acid molecule 224 can be, for example, a DNA molecule and can be attached to the binding moiety 222 at its 5' end. Thus, the second nucleic acid molecule 224 can be extended by a polymerase (e.g., a DNA polymerase) when provided with an appropriate template.

[0087] In a first step 202, a first probe 210, a second probe 220, and an analyte 201 are each provided together in a fluid. The first and second probes each bind to a common analyte molecule 201, and this binding brings the two probes into close proximity, allowing the interactive portions of the probes to interact.

[0088] This interaction occurs in a second step 204, in which the first nucleic acid molecule 214 and the second nucleic acid molecule 224 interact to form a complex 230. The first and second nucleic acid molecules may contain multiple complementary base pairs, for example, such that they can interact when brought into close proximity to form the double-stranded nucleic acid complex 230. The interaction may displace the non-extendable blocker oligonucleotide 216, which may then be released into solution as waste. The remaining complex 230 may contain a mismatch in the lengths of the two nucleic acid molecules. That is, the first nucleic acid molecule 214 may extend beyond the corresponding portion of the second nucleic acid molecule 224 to which it is complementary, thereby providing a template for base-pair polymerization that allows the second nucleic acid molecule 224 to be extended.

[0089] The formation of a nucleic acid complex between first and second nucleic acid molecules 214 and 224 can set up repeatable cycles of nucleic acid amplification. The start of such a cycle is shown in step 206. The first and second nucleic acid molecules 214 and 224 remain bound to binding moieties 212 and 222, respectively, which in turn remain bound to analyte 201. The ends of binding moieties 212 and 222 are shown in dotted lines in step 206 but are omitted from the figures in the remainder of the illustrated amplification process steps.

[0090] The amplification process proceeds from step 206 to step 207 by the binding of a polymerase, such as a DNA polymerase, to complex 230. The polymerase extends second nucleic acid molecule 224 using first nucleic acid molecule 212 as a template. Extension can continue, for example, until the 5' end of first nucleic acid molecule 212 is reached.

[0091] The extension of second nucleic acid molecule 224 in step 207 can be followed in step 208 by binding of a nicking endonuclease to the extended portion of the second nucleic acid molecule. For example, the extended portion of the second nucleic acid molecule can include a plurality of base pairs that form a binding site for an endonuclease configured to cleave the second nucleic acid molecule at point 252. In some embodiments, point 252 is at or near the original 3' end of second nucleic acid molecule 224. The action of the endonuclease produces a nicked nucleic acid molecule 254.

[0092] In step 209, the nicked nucleic acid molecule 254 is released into solution, generating a nucleic acid complex that can undergo another templated extension by the action of a polymerase. This extension returns the process to step 207, allowing the cycle to repeat. In some embodiments, the release of the nicked nucleic acid molecule 254 is mediated by extension by a polymerase. The repeated action of this nucleic acid amplification cycle can result in an accumulation of nicked nucleic acid molecules 254 in solution, which can be used for detection. For example, fluorescence imaging can be used to detect the accumulation of nicked nucleic acid molecules by providing a fluorescent moiety in the fluid that fluoresces when irradiated with light of an appropriate wavelength in the presence of (e.g., upon binding to) the nicked nucleic acid molecule.

[0093] Because the amplification process 200 relies on the presence of the analyte 201 to run to completion (by bringing the first and second probes into proximity via binding to a common analyte, thereby initiating a proximity-based interaction), the generation of nicked nucleic acid molecules 254 in solution indicates the presence of the analyte. Thus, the presence or absence of fluorescence (or other property) based on the accumulation or non-accumulation of nicked nucleic acid molecules in solution can detect which fluid volumes contain or do not contain the analyte. Thus, using method 200 as part of a digital assay can generate a measurement of the number of nucleic acid molecules in a fluid, and correspondingly, other properties such as analyte concentration. Alternatively, process 200 can be used to perform an analog measurement of the analyte. The rate of generation of nicked nucleic acid molecules 254 in solution increases with the number of analyte particles present in the solution. Therefore, measuring the amount of nicked nucleic acid generated (e.g., by measuring fluorescence intensity, measuring the time to reach a given intensity, etc.) can be used to generate an analog measurement of the amount of analyte in the fluid. Measurement can include, for example, comparing the measured signal to a calibrated scale to determine the measured amount of analyte.

[0094] FIG. 3 illustrates a method 300 of analyte detection using attached strand displacement amplification. The method can be performed in a fluid, for example, in each of a plurality of compartmentalized fluid-containing volumes. An analyte 301 is provided in the fluid. For example, the analyte can be a protein molecule. Method 300 involves a reaction (an amplification reaction) that occurs in a complex attached to the analyte, but can be characterized as a "partially attached" method in that the attached reaction triggers a further reaction step that occurs in solution.

[0095] The fluid may further comprise a first probe 310 and a second probe 320. The first probe comprises a first binding moiety 312 bound to a first interaction moiety comprising a first nucleic acid molecule 314. The first binding moiety 312 may be, for example, an antibody or a portion thereof having a binding site for binding to the analyte 301. The first nucleic acid molecule 314 may comprise three consecutive nucleic acid sequences. * , 2 * , 1 * where array x * indicates a sequence complementary to sequence x. A first nucleic acid molecule 314 is bound to a non-extensible blocker oligonucleotide 316. The first nucleic acid molecule 314 and the non-extensible blocker oligonucleotide 316 are bound by base pairing interactions, e.g., base pair sequence 3 on the blocker to base pair sequence 3 on the first nucleic acid molecule. * The non-extendable blocker oligonucleotide 316 may comprise a modification to its 3' end (e.g., an inverted 3') such that templated extension by a DNA polymerase is inhibited at that end (as well as the 5' end, which is not naturally extended by a DNA polymerase). When the first nucleic acid molecule 314 is bound to the first binding moiety 312 at its 3' end, polymerization can be inhibited for both the first nucleic acid molecule 314 and the non-extendable blocker oligonucleotide 316.

[0096] The second probe 320 can include a second binding moiety 322 and a second interacting moiety that includes a second nucleic acid molecule 324. The second binding moiety 322 can be, for example, an antibody or a portion thereof having a binding site for binding to the analyte 301. The second nucleic acid molecule 324 can be, for example, a DNA molecule and can be attached to the binding moiety 322 at its 5' end. Thus, the second nucleic acid molecule 324 can be extended by a polymerase (e.g., a DNA polymerase) when an appropriate template is provided. Furthermore, the second nucleic acid molecule 324 can be a nucleic acid molecule that is a nucleotide sequence that is a nucleotide sequence of the first nucleic acid molecule. * It can contain a base pair sequence 3 complementary to:

[0097] In a first step 302, a first probe 310, a second probe 320, and an analyte 301 are each provided together in a fluid. The first and second probes each bind to a common analyte molecule 301, and this binding brings the two probes into close proximity, allowing the interactive portions of the probes to interact.

[0098] This interaction occurs in a second step 304, where a first nucleic acid molecule 314 and a second nucleic acid molecule 324 interact to form a complex 330. The first and second nucleic acid molecules have their respective complementary sequences 314 and 324. * and 3, such that when in close proximity they interact to form a double-stranded nucleic acid complex 330 while retaining the non-extendible blocker oligonucleotide 316 from its binding to the same 3 of the first nucleic acid molecule. * The non-extendable blocker oligonucleotide 316 can then be released into solution as waste. The remaining complex 330 can contain a mismatch in the length of the two nucleic acid molecules. That is, the first nucleic acid molecule 314 binds to the base pair sequence 3 of the second nucleic acid molecule 324 to which it is complementary. * and the first nucleic acid molecule has * An array followed by a 1 *The first nucleic acid molecule 314 further comprises a continuation of that strand in the form of a sequence. Thus, the first nucleic acid molecule 314 provides a template that allows base pair polymerization to extend the second nucleic acid molecule 324 into regions 2 and 1. Optionally, the length and sequence of domain 3 can be substantially or completely identical to domain 1. Optionally, domain 3 on the second nucleic acid molecule can initially comprise fewer or more base pairs than the sequence of domain 3 on the first nucleic acid molecule. For example, the second nucleic acid molecule can initially comprise region 3, followed by part of region 2, or part but not all of region 1. The non-extendable blocker oligonucleotide 316 can also vary in length and can comprise more or less than region 3. This variability can vary the strength of proximity-based interactions between the first and second nucleic acid molecules compared to the non-extendable blocker oligonucleotide, which can be used to increase or decrease reaction rates (e.g., to reduce reaction rates generated by accidental collisions of the first and second probes in solution). Furthermore, both the first nucleic acid and the second nucleic acid strand can contain multiple nucleic acids between the identified region and the binding moiety. These additional nucleic acids do not need to undergo pairing interactions and can therefore vary freely and may contain complementary or non-complementary base pair sequences.

[0099] The fluid further comprises an auxiliary complex 332 comprising an auxiliary substrate 334 optionally bound to an auxiliary non-extendible blocker oligonucleotide 336. In some embodiments, the auxiliary substrate is bound to the auxiliary non-extendible blocker oligonucleotide 336. In some embodiments, the auxiliary substrates each comprise an auxiliary nucleic acid strand, and none of the auxiliary substrates is bound to the auxiliary non-extendible blocker oligonucleotide 336. The auxiliary substrates 334 are contiguous nucleic acid sequences 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 1 * , 2 * , 1 * , 2 * , such that the co-substrate 334 is at least partially similar to the first nucleic acid 314. In some embodiments, the two are identical. In such cases, the additional two of the first nucleic acid molecule *The moiety bridges the gap between the two probes that bind to the analyte, thereby avoiding participating in base pairing with a second nucleic acid molecule during a proximity-based interaction. One or both strands of the co-substrate can be modified (e.g., with an inverted 3') to prevent polymerase extension of the co-substrate.

[0100] The complex 330 and co-substrate 334 can participate in repeated cycles of amplification, the product of which can induce more co-substrate to participate in the amplification reaction cycle, exponentially increasing the production of nucleic acid strands in solution. The process can begin with the formation of complex 330 shown in step 304. A second nucleic acid molecule 324 is extended by a polymerase using the first nucleic acid as a template to reach the configuration shown in step 306. The complex is shown partially dotted because a similar process occurs involving co-substrate 334, which will be described later. Extension of the second nucleic acid generates a binding site for a nicking endonuclease, similar to the site discussed with respect to FIG. 2, for example. The nicking endonuclease binds to the extended complex and nicks the extended portion of the second nucleic acid at point 354, allowing the nucleic acid strand after that point to be released into solution. The extension of the second nucleic acid used the first as a template, so that the nicked extension 338 has nucleic acid sequences 2 and 1, respectively, reading 5' to 3', which are the first three * 2 of the first nucleic acid molecule after pairing with the 3 sequence of the second nucleic acid molecule * and 1 * (The second nucleic acid molecule is complementary to one of the first nucleic acid molecules.) * (Although the nicked portion 338 may interact with the nicked portion 338 sequence, this arrangement results in the alignment of the 5' and 3' ends of the first and second nucleic acid molecules, respectively, preventing further polymerization. Eventually, random thermal separation and migration brings the appropriate portions of the first and second nucleic acid molecules into contact in the appropriate configuration, a process that proceeds relatively quickly if the molecules are in close proximity.) After the nicked portion 338 has been transferred to solution, the complex 330 can be extended again, repeating the cycle in step 306.

[0101] Furthermore, nicked portion 338 released into solution may eventually collide with auxiliary complex 332. Nicked portion 338 has sequences 2 and 1, read from its 5' end, complementary to sequences 2 and 1 of auxiliary substrate 334, read from its 3' end. Nicked portion 338 can therefore pair with auxiliary substrate 334 at one end (and in the middle, for the same reasons discussed above for the first and second nucleic acid molecules; such pairing is a temporary dead end and requires thermal re-equilibration). When nicked portion 338 binds to auxiliary substrate 334, it displaces auxiliary non-extendible blocker oligonucleotide 336 into solution, forming an active complex in step 309. In step 305, the active complex comprising nicked portion 338 and auxiliary substrate 334 is extended by a polymerase using auxiliary substrate 334 as a template. This produces an extended nicked portion similar to the extended second nucleic acid strand, as shown in step 206. The two complexes differ in the dotted region. The extended nicked substrate has a 2,1,2,1 sequence that reads 5' to 3' and pairs with the complementary sequence of the auxiliary substrate, while the second nucleic acid has a portion that does not pair with the first nucleic acid, followed by a 3,2,1 sequence. In step 307, a nicking endonuclease binds to the active complex and nicks the extended nicked portion, generating an identical copy of the nicked portion, which is released into solution in step 308 or during subsequent polymerase activity. The active complex can then continue cycling in step 306, while the newly released nicked portion brings yet another auxiliary complex to form another active complex, which then enters the cycle. This process can grow exponentially, adding more and more complexes to the cycle and generating exponentially more nicked portions.

[0102] Repeated cycles result in the accumulation of more and more nucleic acid molecules 338 in solution, which can be used for detection. For example, a light signal can be generated based on the accumulation. In many embodiments, fluorescence imaging can be used to detect the accumulation of nucleic acid molecules (e.g., nicked double-stranded or single-stranded nucleic acid molecules) by providing a fluorescent probe (e.g., a dye or protein) in the fluid that fluoresces upon irradiation with light of an appropriate wavelength in the presence of (e.g., when bound to) the nucleic acid molecule. Because the amplification process 300 relies on the presence of analyte 301 to run to completion (by bringing the first and second probes into proximity via binding to a common analyte, thereby initiating a proximity-based interaction and further triggering activation of the auxiliary complex), the generation of nucleic acid molecules 338 in solution indicates the presence of the analyte. Thus, the presence or absence of fluorescence (or other property) based on the accumulation or non-accumulation of nucleic acid molecules in solution can detect which fluid volumes contain or do not contain the analyte. Thus, using method 300 as part of a digital assay can generate a measure of the number of nucleic acid molecules in a fluid, and correspondingly, other properties, such as analyte concentration. Alternatively, process 300 can be used to perform an analog measurement of an analyte. The rate of production of nucleic acid molecules 338 in a solution increases with the number of analyte particles present in the solution. Therefore, measuring the amount of nucleic acid produced (e.g., by measuring fluorescence intensity, measuring the time to reach a given intensity, etc.) can be used to generate an analog measurement of the amount of analyte in the fluid. Measurement can include, for example, comparing the measured signal to a calibrated scale to determine the measured amount of analyte.

[0103] FIG. 4 illustrates a method 400 of analyte detection using an attached hairpin assembly reaction. The method can be performed in a fluid, for example, in each of a plurality of compartmentalized fluid-containing volumes. An analyte 401 is provided in the fluid. For example, the analyte can be a protein molecule. Method 200 can be characterized as an "attached" method in that it involves a reaction (assembly reaction) occurring on a complex attached to the analyte.

[0104] The fluid can further include a first probe 410 and a second probe 420. The first probe includes a first binding portion 412 bound to a first interaction portion that includes a first nucleic acid molecule 414. The first binding portion 412 can be, for example, an antibody or portion thereof having a binding site for binding to the analyte 401. The first nucleic acid molecule 414 can include a sequence of base pairs configured to bind in a hairpin configuration. For example, the first portion 411 can include multiple base pairs complementary to the second portion 413, with a non-complementary region between the two such that the first and second portions bind together in a hairpin shape. Because the first nucleic acid molecule is bound to itself, pairing with a complementary hairpin molecule 432 in solution is inhibited. In some embodiments, the 3' end of the first nucleic acid molecule binds to the binding portion, thereby inhibiting polymerization. However, because method 400 does not require polymerization and therefore can be performed in the absence of a polymerase, the 5' and 3' ends shown in Figure 4 can vary at will. However, for consistency with the drawing, the first portion of the first nucleic acid molecule will be referred to as 3' portion 411 and the second portion will be referred to as 5' portion 413.

[0105] The second probe 420 can include a second binding moiety 422 and a second interacting portion that includes a second nucleic acid molecule 424. The second binding moiety 422 can be, for example, an antibody or portion thereof having a binding site for binding to the analyte 401. The second nucleic acid molecule 424 can be, for example, a DNA molecule and can be bound to the binding moiety 422 at its 5' end. The second nucleic acid molecule 424 can include a base pair sequence complementary to the base pair sequence of the first nucleic acid molecule for at least a portion of the second nucleic acid molecule, for example, the 3' portion 411 corresponding to the self-binding portion of the first nucleic acid molecule. However, the second nucleic acid molecule can also include a portion toward the 3' end that is not complementary to the first nucleic acid molecule, such that when paired together, the two molecules bind to each other only at the center of each strand, with one end of each bound to a respective binding moiety and one end of each thermally free to move.

[0106] In a first step 402, a first probe 410, a second probe 420, and an analyte 401 are each provided together in a fluid. The first and second probes each bind to a common analyte molecule 401, and this binding brings the two probes into close proximity, allowing the interactive portions of the probes to interact.

[0107] This interaction occurs in a second step 404, in which the 3' position 411 of the first nucleic acid molecule 414 and the second nucleic acid molecule 424 interact to form a complex 430. The first and second nucleic acid molecules can contain multiple complementary base pairs that form their respective complementary sequences, such that when brought into close proximity, they interact to form a double-stranded nucleic acid complex in portions of the two molecules, while unfolding the first nucleic acid from its closed hairpin configuration. The 5' portion 413 of the first nucleic acid molecule 414 is then free to move in solution (optionally, as is the remaining sequence at the end of the second nucleic acid molecule 424). Because the 5' portion 413 of the first nucleic acid molecule was complementary to the 3' portion 411, it has matching base pairs with those of the second nucleic acid molecule 412 (the match need not be perfect, but the two sequences should be substantially identical so that each binds sufficiently to the 3' portion 411).

[0108] The fluid further contains a plurality of free hairpin molecules, including hairpin molecule 432. Hairpin molecules 432 contain a sequence of base pairs at each end that are complementary to each other, similar to the corresponding ends of first nucleic acid molecule 414, but in reverse order, with the 3' end of hairpin molecule 432 complementary to a portion of the first nucleic acid molecule near the hairpin turn. Because free hairpin 432 contains a 3' end that is reverse complementary to 5' end 411 of the first nucleic acid molecule, the two can combine to unfold free hairpin 432 and form bimolecular hairpin complex 440.

[0109] In step 408, a second free hairpin molecule 434, containing a reverse-complementary end to the 5' end of the bimolecular hairpin complex 440, is pulled from solution, unfolds through base-pairing interactions, and binds to the complex, forming a trimolecular hairpin complex 450. The end of this new complex is then reverse-complementary to a second molecule, the first free hairpin 432, allowing for another unfolding and further extension of the complex. This process can continue indefinitely as a runaway hairpin assembly reaction, even if the original binding to the analyte is broken. Similar analytical techniques can then be used to detect the assembly reaction in the analyte-containing volume using fluorescence or other imaging, in a manner similar to that described above for Figures 2 and 3, to determine properties such as the number or concentration of the analyte. For example, a fluorescent moiety may be included in the fluorescence of the solution in the presence of an unfolded hairpin but not in the presence of a folded hairpin. Fluorescence is thus quenched while the hairpin remains folded, but the hairpin assembly reaction causes a cascade dequenching of fluorescence as many hairpins unfold.

[0110] FIG. 5 illustrates a method 500 of analyte detection using a three-junction to catalyze a hairpin assembly reaction. The method can be performed in a fluid, e.g., in each of a plurality of compartmentalized fluid-containing volumes. An analyte 501 is provided in the fluid. For example, the analyte can be a protein molecule. Method 500 can be characterized as a "separate" method in the sense that a proximity-based interaction occurs while the fluidic component is attached to the analyte, but the interaction is used to generate a catalyst for a reaction occurring in solution separate from the junction. Additionally, method 500 does not require an enzyme; thus, for example, there is no need for nucleic acid polymerization.

[0111] The fluid can further include a first probe 510 and a second probe 520. The first probe includes a first binding moiety 512 bound to a first interactive portion comprising a first nucleic acid molecule 514. The first binding moiety 512 can be, for example, an antibody or portion thereof having a binding site for binding to the analyte 501. The second probe includes a second binding moiety 522 bound to a second nucleic acid molecule 524. The second binding moiety 522 can be, for example, an antibody or portion thereof having a binding site for binding to the analyte 501.

[0112] In a first step 502, a first probe 510, a second probe 520, and an analyte 501 are each provided together in a fluid. The first and second probes each bind to a common analyte molecule 501, and this binding brings the two probes into close proximity, allowing the interactive portions of the probes to interact.

[0113] This interaction occurs in a second step 504, where a first nucleic acid molecule 514 and a second nucleic acid molecule 524 interact to form a complex 530. The first and second nucleic acid molecules can, for example, contain multiple complementary base pairs for a portion of each molecule such that when they are brought into close proximity, they can interact to form a double-stranded nucleic acid complex 530. The remaining non-complementary portions of the first and second nucleic acids can then form a catalytic surface 532 with which other nucleic acid molecules can interact.

[0114] As an example of such a catalytic interaction, in step 506, catalytic surface 532 of complex 530 can catalyze the unfolding of first hairpin molecule 534 and second hairpin molecule 536 provided in solution. Catalysis can occur through base pairing between the portions of the first and second nucleic acid molecules forming catalytic surface 532 and one or both portions of the hairpin molecules. These unfolded hairpin molecules can have complementary base pair sequences to form a double-stranded nucleic acid complex in step 508. Steps 506 and 508 can be repeated as catalytic surface 532 catalyzes the unfolding of additional pairs of hairpin molecules, resulting in the depletion of hairpin molecules from solution and the accumulation of nucleic acid double strands. Fluorescence or other imaging can then be used to detect the accumulation of these double strands in the analyte-containing volume in a manner similar to that described above for FIGS. 2 and 3, and similar analytical techniques can be used to determine characteristics such as the number or concentration of the analyte. Thus, unfolding of the hairpin can be detected by cascade dequenching of fluorescence similar to that discussed above with respect to FIG.

[0115] FIG. 6 illustrates a method 600 of analyte detection using a three-way junction to catalyze attached strand displacement amplification. The method can be performed in a fluid, e.g., in each of a plurality of compartmentalized fluid-containing volumes. An analyte 601 is provided in the fluid. For example, the analyte can be a protein molecule. Method 600 can be characterized as an at least partially attached method in the sense that a proximity-based interaction occurs while the fluidic components are attached to the analyte, and the interaction polymerizes in an amplification reaction while the analyte is attached. As discussed below, the amplification reaction can optionally include an exponential amplification reaction that proceeds separately from the analyte.

[0116] The fluid can further include a first probe 610 and a second probe 620. The first probe includes a first binding moiety 612 bound to a first interactive portion comprising a first nucleic acid molecule 614. The first binding moiety 612 can be, for example, an antibody or portion thereof having a binding site for binding to the analyte 601. The second probe includes a second binding moiety 622 bound to a second nucleic acid molecule 624. The second binding moiety 622 can be, for example, an antibody or portion thereof having a binding site for binding to the analyte 601.

[0117] In a first step 602, a first probe 610, a second probe 620, and an analyte 601 are each provided together in a fluid. The first and second probes each bind to a common analyte molecule 601, which brings the two probes into close proximity and allows the interactive portions of the probes to interact. Also in solution is a co-substrate 634 bound to a co-extendible blocker oligonucleotide 636. The co-substrate 634 binds to and inhibits polymerization. The co-substrate 634 includes a first portion complementary to a sequence at or near the end of a first nucleic acid molecule, and the co-substrate includes a second portion complementary to a sequence at the end of a second nucleic acid molecule. The non-extendible blocker oligonucleotide 636 is complementary to and can bind to at least a portion of the first and second portions of the co-substrate 634. Thus, the first or second nucleic acid molecule can contain a sequence that competes with the blocker for binding to a portion of the co-substrate, but the blocker can bind more strongly (e.g., to a more complementary nucleic acid) than either the first or second nucleic acid molecule, and therefore, all molecules are in solution, making it unlikely that the blocker will be dislodged without binding to the analyte.

[0118] However, once the first and second probes bind to the analyte, this relationship can change due to proximity-based interactions between the first and second nucleic acid molecules. This interaction occurs in a second step 604, in which the first nucleic acid molecule 614 and the second nucleic acid molecule 624 interact to form a complex 630. The first and second nucleic acid molecules can, for example, contain multiple complementary base pairs in a portion of each molecule so that they can interact to form the double-stranded nucleic acid complex 630 when brought into proximity. The remaining non-complementary portions of the first and second nucleic acids can then form a catalytic surface 632 with which other nucleic acid molecules can interact. The portions of the first and second nucleic acid molecules that form the catalytic surface 632 can include portions complementary to the first and second portions of the co-substrate. While neither portion individually may be sufficient to reliably overcome the binding of the blocker 636 to the co-substrate 634, together the two nucleic acid molecules can form a catalytic surface that binds the co-substrate strongly enough to reliably displace the blocker. This displacement occurs in step 606, releasing blocker 636 into solution.

[0119] This forms an active complex 640 where the 3' end of the second nucleic acid molecule can be extended using the auxiliary substrate as a template. The extended portion can be nicked by a nicking endonuclease using a process similar to that shown in FIG. 2, releasing the nicked portion into solution. In some embodiments, the nicking endonuclease comprises an sgRNA-guided CRISPR-Cas9. In some embodiments, this process is simply repeated, with the nicked portion accumulating in solution at a near-linear rate. Alternatively, the auxiliary substrate can be configured to participate in an exponential amplification reaction. For example, the auxiliary substrate can be configured to read a base pair pattern similar to that shown in FIG. 3, e.g., from 5' to 3', to identify region 1. * , 2 * , 1 * , 2 *The first and second nucleic acid portions can then provide complementary sequences 1 and 2, respectively, forming catalytic surface 632. Nicked extensions into solution can be copies of this surface, having the sequences 1, 2 from 5' to 3'. The nicked portions can act as freely moving catalytic surfaces, displacing blockers from additional co-substrates in solution, then extending and nicking to generate further nicked portions with the same 1, 2 sequence. This process can then resemble the process shown in Figure 3, resulting in an exponentially growing accumulation of nicked portions in solution.

[0120] Whichever amplification method is selected, fluorescence or other imaging can then be used to detect the amplification reaction in the analyte-containing volume in a manner similar to that described above for Figures 2 and 3, and similar analytical techniques can be used to determine characteristics such as, for example, the number or concentration of the analytes.

[0121] In some embodiments of the present disclosure, the fluid volume includes a plurality of auxiliary substrates. In certain embodiments, at least some of the auxiliary substrates are bound to auxiliary non-extendible blocker oligonucleotides. In some embodiments, none of the auxiliary substrates are bound to auxiliary non-extendible blocker oligonucleotides. In some embodiments, the fluid volume includes a nicking endonuclease configured to cleave the extended nucleic acid, and the auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended nucleic acid. In some embodiments, the plurality of auxiliary substrates includes an auxiliary substrate designed to bind to and inactivate the extended nicked portion of the nucleic acid. In certain embodiments, the auxiliary substrate designed to bind to the extended nicked portion of the nucleic acid inactivates it by unproductively extending it, creating a threshold for exponential growth. An auxiliary substrate designed to bind to and inactivate the extended nicked portion of the nucleic acid (referred to herein as a "threshold oligonucleotide" and a "leakage threshold oligonucleotide") can be added to any of the fluid volumes disclosed herein. The leakage threshold oligonucleotide can react with and inactivate the product, suppressing spontaneous exponential initiation in the absence of the target protein.

[0122] In some embodiments of the present disclosure, the fluid volume comprises a plurality of auxiliary substrates. In certain embodiments, at least some of the auxiliary substrates are bound to the auxiliary non-extendible blocker oligonucleotides. In some embodiments, none of the auxiliary substrates are bound to the auxiliary non-extendible blocker oligonucleotides. In some embodiments, the fluid volume comprises an amplification reaction (e.g., from digital isothermal amplification or digital EXPAR or digital PCR) that generates amplification product oligonucleotides. In some embodiments, the plurality of auxiliary substrates comprise auxiliary substrates designed to bind to and inactivate amplification product oligonucleotides (or product oligonucleotides). In certain embodiments, the auxiliary substrates are designed to create a growth threshold by binding to and inactivating the amplification product oligonucleotides. In certain embodiments, the auxiliary substrates are designed to create an exponential growth threshold by binding to and inactivating the amplification product oligonucleotides. In certain embodiments, the auxiliary substrates are designed to bind to and inactivate the amplification product oligonucleotides, thereby creating a growth threshold. In certain embodiments, the auxiliary substrates are designed to bind to and inactivate the amplification product oligonucleotides, thereby creating a growth threshold. In certain embodiments, the auxiliary substrates are designed to bind to and inactivate the amplification product oligonucleotides, thereby creating a growth threshold. Auxiliary substrates (referred to herein as "threshold oligonucleotides" and "leakage threshold oligonucleotides") designed to bind to amplification product oligonucleotides can be added to any of the fluid volumes disclosed herein. The leakage threshold oligonucleotides can react with and inactivate product oligonucleotides to prevent spontaneous initiation in the absence of target. The leakage threshold oligonucleotides can react with and inactivate product oligonucleotides to prevent spontaneous initiation and exponential growth in the absence of target.

[0123] In some aspects, the plurality of auxiliary substrates comprises auxiliary substrates that bind to and inactivate amplification product oligonucleotides. In some aspects, the plurality of auxiliary substrates comprises auxiliary substrates that bind to and inactivate product oligonucleotides. In certain embodiments, the plurality of auxiliary substrates comprises auxiliary substrates that bind to amplification product oligonucleotides to create a growth threshold. In certain embodiments, the plurality of auxiliary substrates comprises auxiliary substrates that bind to amplification product oligonucleotides to create a threshold for exponential growth. In certain embodiments, the plurality of auxiliary substrates comprises auxiliary substrates that bind to amplification product oligonucleotides to inactivate them by non-productively extending them, creating a growth threshold. In certain embodiments, the plurality of auxiliary substrates comprises auxiliary substrates that bind to amplification product oligonucleotides to inactivate them by non-productively extending them, creating a threshold for exponential growth. Auxiliary substrates that bind to amplification product oligonucleotides (referred to herein as "threshold oligonucleotides" and "breakthrough threshold oligonucleotides") can be added to any of the fluid volumes disclosed herein.

[0124] 7 illustrates a method 700 of analyte detection using attached rolling circle amplification. The method can be performed in a fluid, for example, in each of a plurality of compartmentalized fluid-containing volumes. An analyte 701 is provided in the fluid. For example, the analyte can be a protein molecule. Method 700 can be characterized as an "attached" method in that it involves a reaction (an amplification reaction) occurring on a complex attached to the analyte.

[0125] The fluid can further include a first probe 710 and a second probe 720. The first probe includes a first binding moiety 712 bound to a first interaction portion that includes a first nucleic acid molecule 714. The first binding moiety 712 can be, for example, an antibody or portion thereof having a binding site for binding to an analyte 701. The first nucleic acid molecule 714 is bound to a rolling circle substrate 738 (e.g., a circular nucleic acid molecule). The first nucleic acid molecule 714 and the rolling circle substrate 738 can be, for example, DNA molecules bound together by base-pairing interactions. The rolling circle substrate 738 can include multiple nucleic acids that are stranded together to form a loop. The loop lacks an end, thereby inhibiting extension by a DNA polymerase. The rolling circle substrate 738 includes a first binding site 734 that is complementary to a first binding sequence 716 on the first nucleic acid molecule. Polymerization of the first nucleic acid molecule 714 can similarly be inhibited if the first nucleic acid molecule 714 is attached to the first binding moiety 712 at its 3' end or if the first nucleic acid molecule is modified to prevent extension (e.g., by an inverted nucleotide).

[0126] The second probe 720 can include a second binding moiety 722 and a second interacting moiety that includes a second nucleic acid molecule 724. The second binding moiety 722 can be, for example, an antibody or portion thereof having a binding site for binding to the analyte 701. The second nucleic acid molecule 724 can be, for example, a DNA molecule and can be attached to the binding moiety 722 at its 5' end. Thus, the second nucleic acid molecule 724 can be extended by a polymerase (e.g., a DNA polymerase) when an appropriate template is provided.

[0127] In a first step 702, a first probe 710, a second probe 720, and an analyte 701 are each provided together in a fluid. The first and second probes each bind to a common analyte molecule 701, and this binding brings the two probes into close proximity, allowing the interactive portions of the probes to interact.

[0128] This interaction occurs in a second step 704, in which the first nucleic acid molecule 714 transfers the rolling circle substrate 738 to the second nucleic acid molecule 724. The second nucleic acid molecule has a base pair sequence complementary to the second binding portion 736 of the rolling circle substrate 738, which may wholly or partially overlap with the binding portion 734. In some embodiments, the second nucleic acid molecule 724 can have a higher affinity for the second binding portion 736 than the first nucleic acid molecule 714 has for the first binding portion 734. In alternative embodiments, the second nucleic acid has a similar or even weaker affinity to the first nucleic acid and relies on thermal equilibrium to ultimately transfer the rolling circle substrate. Affinity can be varied, for example, by having complementary base pair sequences of different lengths or by including some mismatched base pairs in one or both nucleic acid molecules. Upon binding to the rolling circle substrate, the second nucleic acid molecule 724 can be extended from its 3' end using the rolling circle substrate as a template.

[0129] Polymerization continues in step 706, eventually extending the second nucleic acid molecule 724 to form a loop complementary to the rolling circle substrate 738. The reaction can continue to extend the 3' end of the second nucleic acid molecule, optionally rewinding the second nucleic acid molecule and removing the polymerization site 728 for further extension. As the process continues, the second nucleic acid molecule becomes larger and larger. The generation of this large strand can be detected using fluorescence or other imaging. Because the reaction tends to be complete only in the analyte-containing volume, such volumes can therefore be detected in a similar manner as described above for Figures 2 and 3, and similar analytical techniques can be used to determine characteristics such as the number or concentration of analytes.

[0130] FIG. 8 illustrates a method 800 of analyte detection using a three-way junction to activate separate rolling circle amplification. The method can be performed in a fluid, for example, in each of a plurality of compartmentalized fluid-containing volumes. An analyte 801 is provided in the fluid. For example, the analyte can be a protein molecule. Method 800 can be characterized as an "attached" method in that it involves a reaction (an amplification reaction) occurring in a complex attached to the analyte.

[0131] The fluid can further include a first probe 810 and a second probe 820. The first probe includes a first binding moiety 812 bound to a first interactive portion that includes a first nucleic acid molecule 814. The first binding moiety 812 can be, for example, an antibody or portion thereof having a binding site for binding to the analyte 801. The second probe includes a second binding moiety 822 bound to a second nucleic acid molecule 824. The second binding moiety 822 can be, for example, an antibody or portion thereof having a binding site for binding to the analyte 801.

[0132] In a first step 802, a first probe 810, a second probe 820, and an analyte 801 are each provided together in a fluid. The first and second probes each bind to a common analyte molecule 801, which brings the two probes into close proximity and allows the interactive portions of the probes to interact. Also present in the solution is a rolling circle substrate 838 bound to a non-extendable blocker oligonucleotide 816. The non-extendable blocker oligonucleotide 816 binds to the rolling circle substrate 838 and inhibits polymerization. The rolling circle substrate 838 includes a first portion complementary to a sequence at or near the end of a first nucleic acid molecule, and the rolling circle substrate 838 includes a second portion complementary to a sequence at the end of a second nucleic acid molecule. The non-extendable blocker oligonucleotide 816 is complementary to and can bind to at least a portion of the first and second portions of the rolling circle substrate 838. Thus, both the first and second nucleic acid molecules can contain sequences that compete with the blocker for binding to a portion of the rolling circle substrate 838, but the blocker can bind more strongly (e.g., to a more complementary nucleic acid) than either the first or second nucleic acid molecule. Thus, all molecules are in solution, and there is little chance of the blocker becoming dislodged without binding to the analyte.

[0133] However, once the first and second probes bind to the analyte, this relationship can change due to proximity-based interactions between the first and second nucleic acid molecules. This interaction occurs in a second step 804, in which the first nucleic acid molecule 814 and the second nucleic acid molecule 824 interact to form a complex 830. The first and second nucleic acid molecules can, for example, contain multiple complementary base pairs in a portion of each molecule so that they can interact to form the double-stranded nucleic acid complex 830 when brought into proximity. The remaining non-complementary portions of the first and second nucleic acids can then form a catalytic surface 832 with which other nucleic acid molecules can interact. The portions of the first and second nucleic acid molecules that form the catalytic surface 832 can include portions complementary to the first and second portions of the rolling circle substrate 838. While neither portion individually may be sufficient to reliably overcome the binding of the blocker 816 to the rolling circle substrate 838, the two nucleic acid molecules together can form a catalytic surface that binds to the rolling circle substrate 838 strongly enough to reliably displace the blocker.

[0134] This displacement occurs in step 806, releasing blocker 816 into solution. This forms an active complex 830, from which the 3' end of the second nucleic acid molecule can be extended using rolling circle substrate 838 as a template. As polymerization continues, it eventually extends second nucleic acid molecule 824 to form a loop complementary to rolling circle substrate 838 (see, e.g., Figure 7, step 706). The reaction can continue to extend the 3' end of the second nucleic acid molecule, optionally unwinding the second nucleic acid molecule and removing the polymerization site for further extension. Once the polymerization process begins, the first nucleic acid molecule no longer needs to remain bound to the rolling circle substrate. In fact, after one rotation of polymerization, the first nucleic acid molecule needs to be separated in order to continue using the rolling circle substrate as a template. Complex 830 can be disassembled if necessary, but once the process has progressed far enough, the configuration of the first and second molecules near the analyte is irrelevant. In fact, the two probes can be freely separated from the analyte while the process continues. As the process continues with the runaway amplification reaction, the second nucleic acid molecule becomes larger and larger. The production of this large strand can be detected using fluorescence or other detection methods (e.g., other optical or non-optical detection methods). Because the reaction tends to go to completion only in the analyte-containing volume, such volumes can therefore be detected in a manner similar to that described above for Figures 2 and 3, and similar analytical techniques can be used to determine characteristics such as, for example, the number or concentration of the analyte.

[0135] FIG. 9 illustrates a method 900 of analyte detection using separate strand displacement amplification. The method can be performed in a fluid, for example, in each of a plurality of compartmentalized fluid-containing volumes. An analyte 901 is provided in the fluid. For example, the analyte can be a protein molecule. Method 900 can be characterized as a "separate" method in that a proximity-based interaction occurs involving a fluid component attached to the analyte, but this interaction only serves to trigger the initiation of an amplification reaction involving a component separate from the analyte.

[0136] The fluid can further include a first probe 910 and a second probe 920. The first probe includes a first binding moiety 912 bound to a first interactive moiety that includes a first nucleic acid molecule 914. The first binding moiety 912 can be, for example, an antibody or portion thereof having a binding site for binding to an analyte 901. The first nucleic acid molecule 914 is bound to an extensible substrate 916. The first nucleic acid molecule 914 and the extensible substrate 916 can be, for example, DNA molecules bound together by base-pairing interactions. The extensible substrate 916 can have its 3' end attached to and bind to the 5' end of the first nucleic acid molecule 914, thus not providing a template for DNA polymerase to function at that end. When the first nucleic acid molecule 914 is bound to the first binding moiety 912 at its 3' end, polymerization can be inhibited for both the first nucleic acid molecule 914 and the extensible substrate 916.

[0137] The second probe 920 can include a second binding moiety 922 and a second interacting moiety that includes a second nucleic acid molecule 924. The second binding moiety 922 can be, for example, an antibody or portion thereof having a binding site for binding to the analyte 901. The second nucleic acid molecule 924 can be, for example, a DNA molecule and can be bound to the binding moiety 922. The second nucleic acid molecule 924 can be inhibited from extension at both ends. The end bound to the binding moiety is naturally inhibited from extension by the binding and can be either the 3' or 5' end. The other end can be the 5' end of the second nucleic acid molecule, free to move in solution, or it can be the 3' end but can be prevented from extension by including a modification to prevent polymerization (e.g., an inverted 3' end).

[0138] The fluid can further include a co-substrate 926 that includes a base-pair sequence complementary to the extendible substrate 916 and a plurality of additional bases located adjacent to the complementary base-pair sequence, such that when the extendible substrate 916 pairs with the corresponding sequence of the co-substrate 926, the extendible substrate 916 can be extended by a polymerase using the co-substrate 926 as a template. In some embodiments, the relative affinities of the co-substrate 926, the extendible substrate 916, the first nucleic acid molecule 914, and the second nucleic acid molecule 924 are selected to inhibit removal of the extendible substrate 916 from the first nucleic acid molecule 914 until it comes into close proximity with the second nucleic acid molecule 924. For example, the extendible substrate 916 substrate can have a greater (or similar) affinity for the first nucleic acid molecule 914 than the co-substrate 926, while the first nucleic acid molecule 914 can have a greater (or similar) affinity for the second nucleic acid molecule 924 than the extendible substrate substrate 916. Affinity can be varied, for example, by varying the length of each matching base pair in each molecule, as well as (optionally) including one or more mismatched base pairs to reduce binding affinity.

[0139] In a first step 902, a first probe 910, a second probe 920, and an analyte 901 are each provided together in a fluid. The first and second probes each bind to a common analyte molecule 901, and this binding brings the two probes into close proximity, allowing the interactive portions of the probes to interact.

[0140] This interaction occurs in a second step 904, in which a first nucleic acid molecule 914 and a second nucleic acid molecule 924 interact to form a complex 930. The first and second nucleic acid molecules can contain multiple complementary base pairs, for example, such that when they are brought into proximity, they can interact to form a double-stranded nucleic acid complex 930. The interaction can displace an extendable substrate 916, which can then be released into solution. The extendable substrate 916 is released into solution and can conjugate with a co-substrate 926 in solution. In step 906, the extendable substrate 916 binds to the co-substrate 926 through complementary base pairing and is subsequently extended by a polymerase (e.g., a DNA polymerase) using the co-substrate 926 as a template. The extended portion can then be nicked by a nicking endonuclease, resulting in the accumulation of nicked nucleic acid portions, similar to the process described in FIG. 2. Furthermore, when multiple co-substrates 926 are present in solution, and when the base pair sequence of the co-substrates 926 includes a repeat sequence complementary to the extendible substrate 916 (e.g., the 1 sequence described with reference to FIG. 3), * , 2 * , 1 * , 2 * sequence, where the extensible substrate 916 has 1, 2 sequences, or more simply 1 * , 1 * sequence and extendible substrate 916 has 1 sequence), the amplification reaction can be expanded to include additional auxiliary substrates in the exponential amplification reaction, similar to the process described for FIG. 3.

[0141] Whichever amplification method is selected, fluorescence or other imaging can then be used to detect the amplification reaction in the analyte-containing volume in a manner similar to that described above for Figures 2 and 3, and similar analytical techniques can be used to determine characteristics such as, for example, the number or concentration of the analytes.

[0142] FIG. 10 illustrates a method 1000 of analyte detection using disaggregated rolling circle amplification. The method can be performed in a fluid, e.g., in each of a plurality of compartmentalized fluid-containing volumes. An analyte 1001 is provided in the fluid. For example, the analyte can be a protein molecule. Method 1000 can be characterized as a "disaggregated" method in that a proximity-based interaction occurs involving a fluid component attached to the analyte, but this interaction only serves to trigger the initiation of an amplification reaction involving a component disaggregated from the analyte.

[0143] The fluid can further include a first probe 1010 and a second probe 1020. The first probe includes a first binding moiety 1012 bound to a first interactive moiety that includes a first nucleic acid molecule 1014. The first binding moiety 1012 can be, for example, an antibody or a portion thereof having a binding site for binding to the analyte 1001. The first nucleic acid molecule 1014 is bound to an extensible substrate 1016. The first nucleic acid molecule 1014 and the extensible substrate 1016 can be, for example, DNA molecules bound together by base-pairing interactions. The extensible substrate 1016 can attach and bind at its 3' end to the 5' end of the first nucleic acid molecule 1014, thus not providing a template for DNA polymerase to function at that end. When the first nucleic acid molecule 1014 is bound to the first binding moiety 1012 at its 3' end, polymerization can be inhibited for both the first nucleic acid molecule 1014 and the extensible substrate 1016.

[0144] The second probe 1020 can include a second binding moiety 1022 and a second interacting moiety that includes a second nucleic acid molecule 1024. The second binding moiety 1022 can be, for example, an antibody or portion thereof having a binding site for binding to the analyte 1001. The second nucleic acid molecule 1024 can be, for example, a DNA molecule and can be bound to the binding moiety 1022. The second nucleic acid molecule 1024 can be inhibited from extension at both ends. The end bound to the binding moiety is naturally inhibited from extension by the binding and can be either the 3' or 5' end. The other end can be the 5' end of the second nucleic acid molecule, free to move in solution, or it can be the 3' end but can be prevented from extension by including a modification to prevent polymerization (e.g., an inverted 3' end).

[0145] The fluid can further include a rolling circle substrate 1038 that includes a base-paired sequence complementary to the extendible substrate 1016 and a plurality of additional bases located adjacent to the complementary base-paired sequence, such that when the extendible substrate 1016 pairs with the corresponding sequence of the rolling circle substrate 1038, the extendible substrate 1016 can be extended by a polymerase using the rolling circle substrate 1038 as a template. In some embodiments, the relative affinities of the rolling circle substrate 1038, the extendible substrate 1016, the first nucleic acid molecule 1014, and the second nucleic acid molecule 924 are selected to inhibit removal of the extendible substrate 1016 from the first nucleic acid molecule 1014 until it comes into close proximity with the second nucleic acid molecule 1024. For example, the extendible substrate 1016 substrate can have a greater (or similar) affinity for the first nucleic acid molecule 1014 than for the rolling circle substrate 1038, while the first nucleic acid molecule 1014 can have a greater (or similar) affinity for the second nucleic acid molecule 1024 than for the extendible substrate 1016. Affinity can be varied, for example, by varying the length of each of the matching base pairs in each molecule, as well as (optionally) by including one or more mismatched base pairs to reduce binding affinity.

[0146] In a first step 1002, a first probe 1010, a second probe 1020, and an analyte 1001 are each provided together in a fluid. The first and second probes each bind to a common analyte molecule 1001, and this binding brings the two probes into close proximity, allowing the interactive portions of the probes to interact.

[0147] This interaction occurs in a second step 1004, in which the first nucleic acid molecule 1014 and the second nucleic acid molecule 1024 interact to form a complex 1030. The first and second nucleic acid molecules can include a plurality of complementary base pairs 1032, for example, such that when they are brought into proximity, they can interact to form the double-stranded nucleic acid complex 1030. The interaction can displace the extendible substrate 1016, which can then be released into solution. The extendible substrate 1016 is released into solution and can conjugate with a rolling circle substrate 1038 in solution. After being released from the first nucleic acid molecule, the extendible substrate 1016 can conjugate with the rolling circle substrate 1038 in solution. The extendible substrate 1016 binds to the rolling circle substrate 1038 through complementary base pairing and is subsequently extended by a polymerase (e.g., a DNA polymerase) using the rolling circle substrate 1038 as a template.

[0148] Polymerization continues in step 1006, eventually extending the extendible substrate 1016 to form a loop complementary to the rolling circle substrate 1038. The reaction can continue to extend the 3' end of the second nucleic acid molecule, optionally unwinding the extendible substrate 1016 and removing the polymerization site 1028 for further extension. As the process continues, the extendible substrate 1016 becomes larger and larger. The generation of this large strand can be detected using fluorescence or other imaging. Because the reaction tends to go to completion only in the analyte-containing volume, such volumes can therefore be detected in a similar manner as described above for Figures 2 and 3, and similar analytical techniques can be used to determine characteristics such as, for example, the number or concentration of analytes.

[0149] 11 illustrates a method 1100 for analyte detection using strand displacement of a blocking oligonucleotide to induce RNA polymerization. The method can be performed in a fluid, for example, in each of a plurality of compartmentalized fluid-containing volumes. An analyte 1101 is provided in the fluid. For example, the analyte can be a protein molecule. Method 1100 can be characterized as an "attached" method in that it involves a reaction (RNA polymerization) occurring in a complex attached to the analyte.

[0150] The fluid can further include a first probe 1110 and a second probe 1120. The first probe includes a first binding moiety 1112 bound to a first interactive moiety that includes a first nucleic acid molecule 1114. The first binding moiety 1112 can be, for example, an antibody or portion thereof having a binding site for binding to the analyte 1101. The first nucleic acid molecule 1114 is bound to a blocker oligonucleotide 1116. The first nucleic acid molecule 1114 and the blocker oligonucleotide 1116 can be, for example, DNA molecules bound together by base-pairing interactions. The blocker oligonucleotide 1116 can include a modification to its 3' end (e.g., an inverted 3' end) such that templated extension by a DNA polymerase is inhibited at that end (as well as the 5' end, which is not naturally extended by a DNA polymerase). When the first nucleic acid molecule 1114 is bound at its 3' end to the first binding moiety 1112, polymerization can be inhibited for both the first nucleic acid molecule 1114 and the blocker oligonucleotide 1116. The blocker oligonucleotide 1116 and the first nucleic acid molecule 1114 can collectively constitute an inactive RNA polymerase substrate. For example, the pair of molecules can form a double-stranded DNA complex with modified bases or mismatches, disrupting the polymerase recognition site. Thus, although the fluid can still contain an RNA polymerase, RNA production is inhibited due to inactivation of the polymerase recognition site.

[0151] The second probe 1120 can include a second binding moiety 1122 and a second interacting moiety that includes a second nucleic acid molecule 1124. The second binding moiety 1112 can be, for example, an antibody or portion thereof having a binding site for binding to the analyte 1101. The second nucleic acid molecule 1124 can be, for example, a DNA molecule and can be attached to the binding moiety 1122 at its 5' end.

[0152] In a first step 202, a first probe 1110, a second probe 1120, and an analyte 1101 are each provided together in a fluid along with an RNA polymerase. The first and second probes each bind to a common analyte molecule 1101, and this binding brings the two probes into close proximity, allowing the interactive portions of the probes to interact.

[0153] This interaction occurs in a second step 1104, in which the first nucleic acid molecule 1114 and the second nucleic acid molecule 1124 interact to form a complex 1130. The first and second nucleic acid molecules can contain multiple complementary base pairs, for example, such that when they are brought into close proximity, they can interact to form a double-stranded nucleic acid complex 1130. The interaction can displace the blocker oligonucleotide 1116, which can then be released into solution as waste. The complex containing the blocker 1116 and the first nucleic acid molecule 1114 contains an inactive RNA polymerase substrate, while the new complex 1130 containing the first and second nucleic acid molecules contains an active RNA polymerase substrate.

[0154] In step 1106, RNA polymerase interacts with complexes 1130 in solution in the fluid and transcribes a plurality of RNA molecules 1136. The accumulation of RNA molecules can be detected using techniques such as fluorescence imaging, which can be used to detect the accumulation of RNA strands by providing the fluid with a fluorescent moiety that fluoresces when illuminated with light of an appropriate wavelength in the presence of (e.g., when bound to) an RNA strand.

[0155] Because the amplification process 1100 relies on the presence of analyte 1101 to run to completion (by bringing the first and second probes into proximity via binding to a common analyte, thereby initiating a proximity-based interaction), the generation of RNA strands 1136 in solution indicates the presence of the analyte. Thus, the presence or absence of fluorescence (or other property) based on the accumulation or non-accumulation of RNA in solution can detect which fluid volumes contain analyte or not. Thus, using method 1100 as part of a digital assay can generate measurements of the number of nucleic acid molecules in a fluid, and correspondingly, other properties such as analyte concentration. Alternatively, process 1100 can be used to perform an analog measurement of analyte. The rate of RNA generation in solution increases with the number of analyte particles present in the solution. Therefore, measuring the amount of generated RNA (e.g., by measuring fluorescence intensity, measuring the time to reach a given intensity, etc.) can be used to generate an analog measurement of the amount of analyte in the fluid. Measurement can include, for example, comparing the measured signal to a calibrated scale to determine the measured amount of analyte.

[0156] Optionally, the RNA produced by polymerization from the double-stranded DNA complex 1130 can be used to trigger an exponential amplification process, thereby enhancing the signal strength indicative of the presence of the analyte (similar to the types of enhancement applicable to other exponential amplification reactions disclosed herein). For example, an exponential amplification reaction such as nucleic acid sequence-based amplification (NASBA) can be used. Detection mechanisms for digital or analog measurement of exponential reactions, such as those discussed in FIG. 3, can be used to generate a measurement of the amount of analyte in the fluid.

[0157] In some aspects, the systems described herein include a computer including one or more processors and a memory device having executable instructions stored thereon. In some aspects, the computer is used to perform the methods described herein. In various aspects, a computer can be used to implement any of the systems or methods illustrated and described above. In some aspects, the computer includes a processor that communicates with several peripheral subsystems via a bus subsystem. These peripheral subsystems can include storage subsystems, including a memory subsystem and a file storage subsystem, user interface input devices, user interface output devices, and a network interface subsystem.

[0158] In some aspects, a bus subsystem provides a mechanism for allowing various components and subsystems of a computer to communicate with each other as intended. A bus subsystem can include a single bus or multiple buses.

[0159] In some aspects, the network interface subsystem provides an interface to other computers and networks. The network interface subsystem can act as an interface for sending and receiving data from the computer to other systems. For example, the network interface subsystem can be used to connect the computer to the Internet to facilitate communication using the Internet.

[0160] In some embodiments, a computer includes user interface input devices such as a keyboard, pointing devices such as a mouse, trackball, touchpad, or graphics tablet, scanners, barcode scanners, touch screens integrated into the display, voice recognition systems, audio input devices such as microphones, and other types of input devices. In general, use of the term "input device" is intended to encompass all possible types of devices and mechanisms for inputting information into a computer.

[0161] In some aspects, a computer includes a user interface output device such as a display subsystem, a printer, a fax machine, or a non-visual display such as an audio output device. The display subsystem may include a cathode ray tube (CRT), a flat panel device such as a liquid crystal display (LCD), or a projection device. In general, use of the term "output device" is intended to encompass all possible types of devices and mechanisms for outputting information from a computer.

[0162] In some aspects, a computer includes a storage subsystem that provides a computer-readable storage medium for storing basic programming and data constructs. In some aspects, the storage subsystem stores software (programs, code modules, instructions) that, when executed by a processor, provide the functionality of the methods and systems described herein. These software modules or instructions can be executed on one or more processors. The storage subsystem can also provide a repository for storing data used in accordance with the present disclosure. The storage subsystem can include a memory subsystem and / or a storage subsystem.

[0163] In some aspects, the computer includes a memory subsystem that can include several memories, including a main random access memory (RAM) for storing instructions and data during program execution and a read-only memory (ROM) in which fixed instructions are stored. The file storage subsystem provides non-transitory, persistent (non-volatile) storage for program and data files and can include hard disk drives, floppy disk drives and associated removable media, compact disk read-only memory (CD-ROM) drives, optical drives, removable media cartridges, and other similar storage media.

[0164] The computer may be of various types, including a personal computer, a portable computer, a workstation, a network computer, a mainframe, a kiosk, a server, or any other data processing system. Due to the ever-changing nature of computers and networks, the computer descriptions contained herein are intended only as specific examples to illustrate aspects of computers. Many other configurations are possible, having more or fewer components than the systems described herein.

[0165] The specific dimensions of the disclosed apparatus, devices, systems, and any of their components can be readily varied depending on the intended use, as will be apparent to one of ordinary skill in the art in light of the disclosure herein. Furthermore, it is understood that the examples and embodiments described herein are for illustrative purposes only, and that various modifications or changes in light thereof may be suggested to one of ordinary skill in the art, and are within the spirit and scope of this application and the appended claims. Many different combinations of the embodiments described herein are possible, and such combinations are considered part of this disclosure.

[0166] As used herein, A and / or B includes one or more of A or B, as well as combinations thereof, such as A and B.

[0167] All features discussed in connection with any embodiment or embodiments herein can be readily adapted for use in other embodiments and embodiments herein. The use of different terms or reference numbers for similar features in different embodiments does not necessarily imply differences other than those explicitly stated. Accordingly, the present disclosure is not intended to be limited to the embodiments disclosed herein, but rather to be described solely by reference to the appended claims.

[0168] Unless otherwise specified, the presently described methods and processes can be performed in any order. For example, a method reciting steps (a), (b), and (c) can be performed first with step (a), then with step (b), and then with step (c). Alternatively, the method can be performed in a different order, such as first with step (b), then with step (c), and then with step (a). Furthermore, the steps can be performed simultaneously or separately unless otherwise specified.

[0169] The details set forth herein are by way of example and for the sole purpose of illustrative discussion of preferred embodiments of the present disclosure, and are presented for the purpose of providing what is believed to be the most useful and readily understandable explanation of the principles and conceptual aspects of various aspects of the present invention. In this regard, no attempt has been made to show structural details of the invention beyond those necessary for a fundamental understanding of the invention, and the description taken together with the figures and / or examples will make clear to those skilled in the art how several forms of the present invention may be embodied in practice.

[0170] While preferred embodiments of the present disclosure have been shown and described herein, it is to be understood that the present disclosure is not limited to the particular embodiments of the disclosure described, as variations of the particular embodiments can be made and still fall within the scope of the appended claims. It is also to be understood that the terminology used is for the purpose of describing particular embodiments of the present disclosure only, and is not intended to be limiting. Rather, the scope of the present disclosure will be established by the appended claims.

[0171] When a range of values ​​is provided, unless the context clearly dictates otherwise, it is understood that each intervening value between the upper and lower limits of that range, and at any other stated or intervening value within that stated range, to the tenth of the unit of the lower limit, is encompassed within the disclosure provided herein. The upper and lower limits of these smaller ranges may be included in the smaller ranges and are independently encompassed within the invention, subject to any specifically excluded limits in the stated range. Where a stated range includes one or both of the limits, ranges excluding either of both of those included limits are included within the disclosure provided herein.

[0172] All features discussed in connection with one or more embodiments herein can be readily adapted for use in other embodiments and aspects herein. The use of different terms or reference numbers for similar features in different embodiments does not necessarily imply differences other than those explicitly stated. Accordingly, the present disclosure is not intended to be limited to the embodiments disclosed herein, but rather to be described solely by reference to the appended claims. [Example]

[0173] The following examples are included to further illustrate some aspects of this disclosure and should not be used to limit the scope of the invention.

[0174] Example 1 Analyte detection by strand displacement amplification (SDA) This example describes the detection of an analyte in a process corresponding to that described above and shown in Figure 2. The first probe DNA is generated by synthesizing two parts using standard, commercially available DNA synthesis methods. The first strand of DNA, DNA A, serves as the anchor attached to the binding moiety and is a 60-nucleotide long, 3' amine-terminated oligonucleotide. This sequence is synthesized to contain a restriction site for the Nb.BsrDI nicking endonuclease 25 nucleotides from the 5' end. The other strand, which serves as the blocker, is a 30-nucleotide oligonucleotide complementary to nucleotides 30-60 of the anchor. The melting temperatures of the two DNA molecules are significantly higher than 65°C. The blocker is modified at its 3' end with an inverted dT to prevent extension by the polymerase.

[0175] The anchor and blocker are hybridized by placing them at equimolar concentrations of approximately 1 μM in an appropriate buffer (e.g., 40 mM Tris-HCl, 50 mM sodium chloride) and slowly cooling at 0.1°C / sec to 80°C. The two-part complex is then purified by gel electrophoresis to remove any residual unbound single-stranded DNA.

[0176] The second probe DNA is generated by synthesizing a 5' amine-terminated oligonucleotide with a length of 30 nucleotides and the same sequence as the blocker. It is synthesized to hybridize to the same anchor position as the blocker. The second probe DNA strand, DNA B, does not have a significant energy advantage to displace the blocker in solution, and the strand displacement reaction is slow. Therefore, DNA B does not tend to bind to DNA A in solution.

[0177] One antibody, AB A, against the target of interest (e.g., interleukin-2 or IL-2) is chemically linked to DNA A to form the first probe. A second antibody, AB B, is chemically linked to DNA B to form the secondary probe. These two antibodies both bind to IL-2, but to different epitopes. The DNA-antibody conjugate is purified by FPLC or a similar method to remove free DNA.

[0178] The IL-2-containing sample is treated with both DNA-antibody conjugates in a buffer containing Bst Large Fragment polymerase, Nb.BsrDI nicking endonuclease, and appropriate conditions for enzyme activity (e.g., 40 mM Tris-HCl, 5 mM DTT, 50 mM sodium chloride, 10 mM magnesium chloride, pH 8.8 at 25°C, 0.5 mM each of dATP, dCTP, dTTP, and dGTP, and SYBR Green I diluted 1 / 100,000). After an appropriate incubation period of 2 hours, the temperature is raised to 65°C to initiate the reaction.

[0179] The IL-2 antibody binds to IL-2 in solution, bringing DNA A and DNA B into close proximity. DNA B displaces the blocker attached to DNA A, creating an active substrate for Bst Large Fragment polymerase. When polymerization is complete, the newly generated double-stranded DNA product contains a recognition site for the Nb.BsrDI nicking endonuclease. Nb.BsrDI creates a single-strand break that the polymerase can recognize and displace the single-stranded product. Cycling of the endonuclease and polymerase results in the accumulation of single-stranded DNA, which is detected by an increase in fluorescence from SYBR Green I using standard fluorescent detection.

[0180] Example 2 Analyte detection by SDA and exponential amplification reaction (EXPAR) This example describes the detection of an analyte in a process corresponding to that described above and shown in FIG. 3. Synthetic DNA is generated according to the scheme shown in FIG. 3. An efficient EXPAR template having domains 1-2-1 is used; in this specific example, domain 1 is CTCACGCTAC (SEQ ID NO: 1) and domain 2 is GGACGACTC. A threshold oligonucleotide having domain 1 followed by a mismatched base may also be included to inhibit spurious reactions without active substrate. Synthetic DNA having domains as shown in FIG. 3 is linked to each of two respective antibodies to form antibody-DNA conjugates using the process described in Example 1. Each antibody contains a binding site for binding to a different epitope of the target analyte.

[0181] The overall protocol involves diluting a sample into a reaction buffer containing antibody-DNA conjugates. When these conjugates bind to the target analyte, they can release the EXPAR initiator, as shown in Figure 3. The EXPAR enzyme, substrate DNA, and intercalating dye are added, and the sample is divided into droplets. The reaction volume is heated to a temperature suitable for polymerase activity. At the activation temperature (55°C for Bst polymerase), the reaction exponentially amplifies the released primers. No digestion or ligation is required, nor is any modification of enzyme conditions (e.g., buffer exchange) necessary.

[0182] More specifically, the antibody is conjugated to DNA according to the protocol described in Example 1 above. The antigen and DNA-modified antibody are mixed at nanomolar concentrations, along with all permutations of control combinations. To each of these samples, a 30 μL volume of the following reaction mixture is added: 6 units of Nt.BstNBI nicking enzyme, 0.9 U of Bst DNA polymerase, 0.24 mM of each dNTP, 3 mM MgCl, 1× Evagreen, 20 mM Tris-HCl, pH 7.9, 15 mM ammonium sulfate, 30 mM KCl, 0.005% Triton® X-100, and 50 nM EXPAR substrate DNA (e.g., an oligonucleotide with the sequence CTCACGCTACGGACGACTCTCTCACGCTAC (SEQ ID NO: 2)). This is a modified version of ThermoPol buffer. Thermopol buffer (20 mM Tris-HCl, 0.1% Triton® X-100, 10 mM (NH4)2SO4, 2 mM MgSO4, 10 mM KCl, pH 8.8 at 25°C) may be a suitable alternative and is provided by Nt.BstNBI. Serial dilutions of EXPAR primer DNA (e.g., oligonucleotide with the sequence GTAGCGTGAG (SEQ ID NO: 3)) from 50 nM to 0.5 pM are prepared. The reaction should then be ramped to 55°C and monitored every minute for 120 minutes.

[0183] Example 3 Analyte detection by enzyme-free catalytic hairpin reaction This example describes the detection of an analyte in a process corresponding to that described above and shown in Figure 5. The first probe DNA is generated by synthesizing oligonucleotides using standard commercially available DNA synthesis methods. The first strand of DNA, DNA A, serves as an anchor attached to the binding moiety and is a 60-nucleotide long 3' amine-terminated oligonucleotide. This sequence is designed to include the binding region for DNA B.

[0184] The second probe DNA is generated by synthesizing a 5' amine-terminated oligonucleotide 30 nucleotides long with a sequence partially complementary to DNA A. The second probe, DNA B, has a very weak binding energy and a melting point near or below room temperature. Therefore, DNA B does not tend to bind to DNA A in solution.

[0185] One antibody, AB A, against the target of interest (e.g., interleukin-2 or IL-2) is chemically linked to DNA A to form the first probe. A second antibody, AB B, is chemically linked to DNA B to form the secondary probe. These two antibodies both bind to IL-2, but to different epitopes. The DNA-antibody conjugate is purified by FPLC or a similar method to remove free DNA.

[0186] Hairpin DNA1 and hairpin DNA2 are designed to form a folded structure. Hairpin DNA2 is synthesized to contain a fluorophore and quencher that function as a molecular beacon. The hairpin oligonucleotides are prepared separately in a reaction buffer (e.g., 40 mM Tris-HCl, 150 mM sodium chloride, 10 mM potassium chloride, pH 8 at 25°C). The hairpin DNAs are annealed by heating at 80°C for 3 minutes and then quickly chilling on ice. Hairpin DNA1 and hairpin DNA2 are then diluted and mixed to a concentration of 200 nM each with 1 nM each of the first and second probes in the reaction buffer. A sample containing IL-2 is then added to this mixture.

[0187] The IL-2 antibody binds to IL-2 in solution, bringing DNA A and DNA B into close proximity. DNA B binds to DNA A, creating an active catalytic complex. The catalytic complex hybridizes to hairpin DNA 1 and can disrupt the double-stranded stem, making a single-stranded region available for hybridization to hairpin DNA 2. Hairpin DNA 2 then binds to hairpin DNA 1, displacing the catalytic complex. This results in the accumulation of double-stranded product, which is detected by increased fluorescence as the fluorophore and quencher in hairpin DNA 2 become separated.

[0188] Example 4 Analyte detection by separate rolling circle amplification reactions This example describes the detection of an analyte in a process corresponding to that described above and shown in Figure 10. The first probe DNA is generated by synthesizing two parts using standard, commercially available DNA synthesis methods. The first strand of DNA, DNA A, serves as an anchor attached to a binding moiety and is a 60-nucleotide long, 3' amine-terminated oligonucleotide. This sequence is synthesized to contain a portion (16 bases) of the circular template viral genome from bacteriophage M13 (M13 DNA). The other strand, the primer, is a 30-nucleotide oligonucleotide complementary to nucleotides 30-60 of the anchor. The melting temperatures of the two DNA molecules are significantly higher than 65°C. The primer binds to DNA A at a position that is inaccessible to extension by polymerase.

[0189] The anchor and primer are hybridized by placing them at equimolar concentrations of approximately 1 μM in an appropriate buffer (e.g., 40 mM Tris-HCl, 50 mM sodium chloride) and slowly cooling at 0.1°C / sec to 80°C. The two-part complex is then purified by gel electrophoresis to remove any remaining unbound single-stranded DNA.

[0190] The second probe DNA, DNA B, is generated by synthesizing a 5' amine-terminated oligonucleotide with a length of 30 nucleotides and the same sequence as the primer. The 3' end is also modified with an inverted base to prevent extension by polymerase. It is synthesized to hybridize to the same anchor position as the primer. The second probe DNA strand, DNA B, does not have a significant energy advantage to displace the blocker in solution, and the strand displacement reaction is slow. Therefore, DNA B does not tend to bind to DNA A in solution.

[0191] One antibody, AB A, against the target of interest (e.g., interleukin-2 or IL-2) is chemically linked to DNA A to form the first probe. A second antibody, AB B, is chemically linked to DNA B to form the secondary probe. These two antibodies both bind to IL-2, but to different epitopes. The DNA-antibody conjugate is purified by FPLC or a similar method to remove free DNA.

[0192] Samples containing IL-2 are treated with 1 nM M13 DNA, Bst Large Fragment polymerase, and both DNA-antibody conjugates in a buffer containing conditions suitable for enzyme activity (e.g., 40 mM Tris-HCl, 5 mM DTT, 50 mM sodium chloride, 10 mM magnesium chloride, pH 8.8 at 25°C, 0.5 mM each of dATP, dCTP, dTTP, and dGTP) and 50 nM molecular beacons designed to bind to the reverse complement of M13 DNA. After an appropriate incubation period of 2 hours, the temperature is raised to 65°C to initiate the reaction.

[0193] The IL-2 antibody binds to IL-2 in solution, bringing DNA A and DNA B into close proximity. DNA B displaces the primer attached to DNA A. This primer then binds to M13 DNA, generating an active substrate for Bst Large Fragment polymerase. As polymerization proceeds, the newly generated rolling-circle DNA product can bind to molecular beacons in solution, which are detected by increased fluorescence using standard fluorescence detection.

[0194] Example 5 Analyte detection by strand displacement amplification (SDA) This example describes the detection of an analyte in a process corresponding to that described above and shown in Figure 2. The first probe DNA was generated by synthesizing two portions using standard commercially available DNA synthesis methods. The first strand of DNA, DNA A, served as an anchor attached to the binding portion and was a 3' biotin-terminated oligonucleotide 60 nucleotides in length and with the sequence CTTTAACTCACACTCACGCTACGGACGACTCTATGATGGTACCTGCTTCTGAATTCTAAA (SEQ ID NO: 4).

[0195] This sequence was synthesized to include a template for the restriction site for the Nb.BstNBI nicking endonuclease 22 nucleotides from the 5' end. The other strand, which served as a blocker, contained the anchor (sequence TTTAGAATTCAGAAGCAGGTACCATCATAGAGTCGTCC * The blocker was a 40-nucleotide oligonucleotide complementary to nucleotides 21-60 of GinvdT (SEQ ID NO: 5). The blocker was a phosphorothioate ( * ) and an inverted dT (invdT) at the 3' end.

[0196] The anchor (1 μM as determined by UV-Vis) and blocker (1.1 μM as determined by UV-Vis) were prepared in an appropriate buffer (in this case, 1× NEB isothermal amplification buffer, composed of 20 mM Tris-HCl, 10 mM (NH4)2SO4, 50 mM KCl, 2 mM MgSO4, and 0.1% Tween® 20, pH 8.8 at 25°C). The mixture was annealed by heating to 80°C and slowly cooling at 0.1°C / sec. The blocker strand was added in 10% molar excess to ensure coverage of all template strands. The two-part complex can be optionally separated by gel electrophoresis to remove any remaining unbound single-stranded DNA.

[0197] The second probe DNA was generated by synthesizing a 39-nucleotide 5' biotin-terminated oligonucleotide with the same sequence as the blocker, minus the modifications (sequence TTTAGAATTCAGAAGCAGGTACCATCATAGAGTCGTCCG (SEQ ID NO: 6)). It was synthesized to hybridize to the same anchor position as the blocker. The second probe DNA strand, DNA B, does not have a significant energy advantage to displace the blocker in solution, and the strand displacement reaction is slow. Therefore, DNA B does not tend to bind to DNA A in solution.

[0198] Both DNA complexes were conjugated to a probe (biotin). The sample could then be assayed for the presence of target protein bound to the probe (avidin). The sample containing 1 μM avidin was added to a reaction buffer containing Bst Large Fragment polymerase, Nb.BsrDI nicking endonuclease, and both DNA-probe complexes under conditions appropriate for enzyme activity (e.g., appropriate buffer as described above, 0.5 mM each of dATP, dCTP, dTTP, and dGTP, and SYBR Green II diluted 1 / 50,000). The temperature was raised to 55°C to initiate the reaction. Control reactions were also prepared in which components of the reaction were omitted (i.e., template, primers, blocker, or avidin were omitted).

[0199] The biotin moiety binds to avidin in solution, bringing DNA A and DNA B into close proximity. DNA B displaces the blocker attached to DNA A, creating an active substrate for Bst Large Fragment polymerase. When polymerization was complete, the newly generated double-stranded DNA product contained a recognition site for the Nb.BstNBI nicking endonuclease. Nb.BstNBI creates a single-strand break, which Bst polymerase recognizes and displaces the single-stranded product. Cycling of the endonuclease and polymerase results in the accumulation of single-stranded DNA. This accumulation is detected by an increase in fluorescence from SYBR Green II using standard fluorescent detection. The results are shown in Figures 12A-E.

[0200] Figure 12A shows a schematic of the reaction in which proximity induces strand displacement to generate active substrates for polymerase and nicking endonuclease. Figure 12B shows fluorescence over time, demonstrating the effect of proximity driven by DNA binding to the protein. Samples were prepared as follows: 1. water only, 2. template only, 3. a positive control (no block) containing template and primers, 4. a negative control representing template block, 5. a negative control + primer representing template block, and 6. an experimental sample containing template block, primers, and target protein. Sample 6, containing template block, primers, and target protein, showed a significant increase in fluorescence over time. Figure 12C shows endpoint fluorescence digital photographs depicting the relative fluorescence of Samples 1–6. The dotted line indicates the location of the null control vial. Figure 12D shows fluorescence over time for triplicate experiments performed with and without target protein. Triplicate samples containing target protein showed increased fluorescence over time when compared to triplicate samples without target protein. Figure 12E shows endpoint digital fluorescence images showing the relative fluorescence of triplicate samples with and without target protein. The digital fluorescence images showed that the triplicate samples with target protein showed increased fluorescence compared to the samples without target protein.

[0201] Example 6 Analyte detection by EXPAR in solutions and droplets This example describes the detection of an analyte in a process corresponding to that described above and shown in Figure 3. The first probe DNA was generated by synthesizing two portions using standard commercially available DNA synthesis methods. The first strand of DNA, DNA A, served as an anchor attached to the binding portion and was a 3' biotin-terminated oligonucleotide 60 nucleotides in length and with the sequence CTTTAACTCACACTCACGCTACGGACGACTCTATGATGGTACCTGCTTCTGAATTCTAAA (SEQ ID NO: 4).

[0202] This sequence was synthesized to include a template restriction site for the Nb.BstNBI nicking endonuclease 22 nucleotides from the 5' end. The other strand, which served as a blocker, was a 32-nucleotide oligonucleotide with complementarity to nucleotides 34-60 of the anchor (sequence TTTAGAATTCAGAAGCAGGTACCATCATTTT InvdT (SEQ ID NO: 7)). The blocker was extended with a mismatched polyT and an inverted dT (invdT) at the 3' end to prevent extension by the polymerase.

[0203] The anchor (1 μM as determined by UV-Vis) and blocker (1.1 μM as determined by UV-Vis) were prepared in an appropriate buffer (in this case, 1× NEB isothermal amplification buffer, composed of 20 mM Tris-HCl, 10 mM (NH4)2SO4, 50 mM KCl, 12 mM MgSO4, and 0.1% Tween® 20, pH 8.8 at 25°C). The mixture was annealed by heating to 80°C and slowly cooling at 0.1°C / sec. The blocker strand was added in 10% molar excess to ensure coverage of all template strands. The two-part complex can be optionally separated by gel electrophoresis to remove any remaining unbound single-stranded DNA.

[0204] The second probe DNA was generated by synthesizing a 5' biotin-terminated oligonucleotide 28 nucleotides in length with the same sequence as the blocker, minus the mismatched polyT and inverted dT modifications (sequence TTTAGAATTCAGAAGCAGGTACCATCAT (SEQ ID NO: 8)). It was synthesized to hybridize to the same anchor position as the blocker. The DNA strand of the second probe, DNA B, did not have a significant energy advantage to displace the blocker in solution, and the strand displacement reaction was slow. Therefore, DNA B did not tend to bind to DNA A in solution.

[0205] Both DNA complexes were conjugated to a probe (biotin). The sample can then be assayed for the presence of a target protein that binds to the probe (avidin). The sample, containing 1 μM avidin, is added to a reaction buffer containing Bst Large Fragment polymerase, Nb.BsrNBI nicking endonuclease, along with both DNA-probe complexes, under conditions appropriate for enzyme activity (e.g., an appropriate buffer as described above, 0.5 mM each of dATP, dCTP, dTTP, and dGTP, and 500 nM hairpin reporter). The hairpin reporter was an oligonucleotide (sequence ATTGTACTCACGCTACTACAAT (SEQ ID NO: 9)) modified with an AlexaFluor® 488 fluorophore at the 5' end and a BHQ-1® quencher at the 3' end. The hairpin reporter is designed to hybridize to the product, adopt a linear conformation, and increase fluorescence. The reaction buffer also contained 50 nM of an auxiliary template oligonucleotide (sequence CTCACGCTACGGACGACTCTCTCACGCTAC (SEQ ID NO: 2)). The auxiliary template is designed to induce exponential growth of the product. A leakage threshold oligonucleotide (sequence TTTTTCTCACGCTAC (SEQ ID NO: 10)) was also included at 10 nM, which reacts with and inactivates the product, preventing spontaneous exponential initiation in the absence of target protein. The temperature was raised to 45°C to initiate the reaction. Control reactions were also prepared in which components of the reaction were omitted (i.e., primers, blockers, or avidin were omitted).

[0206] The biotin moiety bound to avidin in solution, bringing DNA A and DNA B into close proximity. DNA B displaced the blocker attached to DNA A, creating an active substrate for Bst Large Fragment polymerase. When polymerization was complete, the newly generated double-stranded DNA product contained a recognition site for the Nb.BstNBI nicking endonuclease. Nb.BstNBI created a single-strand break, which Bst polymerase recognized and displaced the single-stranded product. Cycling the endonuclease and polymerase resulted in the accumulation of single-stranded DNA. The single-stranded product could then serve as a primer for the auxiliary template. The auxiliary template functioned similarly to the template, catalytically generating single-stranded product DNA with the same sequence. This led to exponential accumulation of product. The product was detected by an increase in fluorescence due to binding between the product and the hairpin reporter.

[0207] The reaction was also enclosed in droplets. After preparing the reaction mixture as described above, the sample and reaction buffer were emulsified in the oil phase (BioRad Droplet Generation Oil for Probes) by rapid vortexing for 30 seconds. This generated water-in-oil droplets containing all reagent components. In some experiments, some droplets contained target molecules, while others did not. The temperature was raised to 45°C to initiate the reaction. The active substrate for Bst Large Fragment polymerase produced fluorescent product within the isolated droplets. Inactive droplets, indicating the absence of active initiator for exponential growth, showed only low levels of fluorescent product. In the limiting case where all droplets contained reaction product, all droplets were fluorescent. The results are shown in Figures 13A-C.

[0208] Figure 13A shows a schematic of the reaction, in which proximity induces strand displacement to generate active substrates for the polymerase and nicking endonuclease, subsequently generating exponential growth. Figure 13B shows the fluorescence detected over time, illustrating the effect of proximity driven by DNA / probe binding to the target molecule (or target protein). Samples were prepared as follows: 1. water only; 2. a positive control (no block) containing template and primers; 3. a negative control representing the template block; 4. a negative control + primer representing the template block; and 5. an experimental sample containing template block, primers, and target protein. The positive control containing template and primers and the experimental sample showed the highest levels of fluorescence over time. Figure 13C shows images of the generated fluorescent droplets surrounding the sample. The top three images show brightfield images of the endpoint, and the bottom three images show fluorescent images of the endpoint. Images show inactive template (left), active template (center), and the limiting case (right) including all droplets containing reaction products. In one embodiment, for example, the following items are provided: (Item 1) 1. A method for digital detection of a protein analyte, comprising: dividing a fluid into a plurality of compartmentalized fluid volumes to form a homogenous assay, wherein some of the plurality of volumes are compartmentalized non-analyte-containing volumes and other of the plurality of volumes are compartmentalized analyte-containing volumes; detecting the presence of an analyte in the compartmentalized analyte-containing volumes based on optical signals from the plurality of compartmentalized volumes; Including, the optical signal is triggered by a proximity-induced interaction in the compartmentalized analyte-containing volume comprising an analyte and a component of the compartmentalized fluid volume; and detecting the presence of the optical signal, wherein the fluid in each of the plurality of compartmentalized fluid volumes consists essentially of the respective compartmentalized fluid volume produced by the dividing step and reaction products produced therefrom. The method. (Item 2) each fluid volume of the plurality of compartmentalized fluid volumes a first probe comprising a first binding moiety configured to bind to the analyte, the first binding moiety binding to a first nucleic acid molecule; a second probe comprising a second binding moiety configured to bind to the analyte, the second binding moiety binding to a second nucleic acid molecule; the proximity-induced interaction occurs between the first probe and the second probe upon binding to the analyte; the proximity induced interaction triggers an amplification reaction; the optical signal is a fluorescent signal induced by the amplification reaction in the analyte-containing volume; The method according to item 1. (Item 3) 3. The method of any one of items 1-2, further comprising counting the number of volumes in which fluorescence is produced, thereby generating an analyte count for the sample. (Item 4) 4. The method of claim 3, wherein the specimen count is generated based on Poisson statistics. (Item 5) 5. The method according to any one of items 2 to 4, wherein the amplification reaction is an isothermal reaction. (Item 6) 6. The method according to any one of items 2 to 5, wherein the amplification reaction is a digital isothermal reaction. (Item 7) 5. The method according to any one of items 2 to 4, wherein the amplification reaction is a polymerase chain reaction. (Item 8) 5. The method according to any one of items 2 to 4, wherein the amplification reaction is a digital polymerase chain reaction. (Item 9) 9. The method according to any one of items 1 to 8, wherein the method is carried out without a ligase. (Item 10) 10. The method according to any one of items 1 to 9, wherein, during detecting the presence of the analyte using the optical signal, each of the plurality of compartmentalized volumes comprises a respective compartmentalized fluid volume produced by the dividing step and a reaction product produced therefrom. (Item 11) 11. The method of any one of items 1 to 10, wherein after dividing the fluid into the plurality of compartmentalized fluid volumes, each fluid volume is contained within a single container throughout the remainder of the method until the detection of the analyte using the optical signal. (Item 12) 12. The method according to any one of items 1 to 11, wherein the method is carried out without a washing step. (Item 13) 13. The method according to any one of items 1 to 12, wherein the optical signal is an absorption signal or a luminescence signal. (Item 14) 14. The method of any one of items 2 to 6 or 8 to 13, wherein both the proximity induced interaction and the amplification reaction are isothermal reactions. (Item 15) 15. The method of any one of items 2 to 6 or 8 to 14, wherein both the proximity induced interaction and the amplification reaction are digital isothermal reactions. (Item 16) 14. The method of any one of items 2 to 4 or 6 to 13, wherein the proximity induced interaction is an isothermal reaction and the amplification reaction is a polymerase chain reaction. (Item 17) 14. The method of any one of items 2 to 4 or 6 to 13, wherein the proximity induced interaction is a digital isothermal reaction and the amplification reaction is a digital polymerase chain reaction. (Item 18) 14. The method according to any one of items 2 to 13, wherein the proximity-induced interaction is a strand displacement interaction. (Item 19) prior to said proximity-induced interaction, said second nucleic acid molecule is bound to a non-extendable blocker oligonucleotide; the proximity induced interaction comprises an interaction between the first and second nucleic acids that displaces a blocker oligonucleotide into solution; the amplification reaction includes inducing template polymerization to extend the first nucleic acid molecule after displacement of a blocker oligonucleotide; each fluid volume comprises a nicking endonuclease configured to cleave the extended first nucleic acid, allowing release of the nicked portion into solution; Item 19. The method of item 18, wherein the fluorescence is induced based on the emission of the nicked moiety within the analyte-containing volume. (Item 20) the amplification reaction repeatedly extends the first nucleic acid, and the nicking endonuclease repeatedly cleaves the extended first nucleic acid, thereby causing an accumulation of nicked nucleic acid strands; each fluid volume containing a plurality of fluorescent moieties configured to bind to the accumulated nicked nucleic acid strands; 20. The method of claim 19, wherein the fluorescence is induced by binding of a fluorescent moiety to the accumulated nicked nucleic acid strands and by illuminating the plurality of volumes with light resonant with the bound fluorescent moieties, thereby inducing fluorescence from the bound fluorescent moieties. (Item 21) each fluid volume containing a plurality of co-substrates, each of said co-substrates containing a co-nucleic acid strand; the auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid, thereby forming an auxiliary nucleic acid complex in solution comprising the nicked portion and the auxiliary nucleic acid strand; 20. The method of claim 19, wherein the auxiliary nucleic acid complex is configured to extend the nicked portion and repeatedly induce removal of portions of the extended nicked portion by the nicking endonuclease or polymerase, wherein the removed extended nicked portion comprises a copy of the originally removed nicked portion. (Item 22) 22. The method of claim 21, wherein at least some of the auxiliary substrates are each bound to an auxiliary non-extendible blocker oligonucleotide. (Item 23) 23. The method of claim 22, wherein the auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid, thereby displacing the auxiliary non-extendable blocker oligonucleotide. (Item 24) 22. The method of claim 21, wherein the plurality of auxiliary substrates comprises an auxiliary substrate designed to bind to the extended nicked portion and inactivate it by non-productively extending it, creating a threshold for exponential growth. (Item 25) 5. The method according to any one of items 2 to 4, wherein the amplification reaction is selected from the group consisting of an enzyme-free hairpin assembly reaction, an enzyme-free catalytic hairpin reaction, an enzyme-free hybridization chain reaction, and proximity-guided rolling circle amplification. (Item 26) the amplification reaction is rolling circle amplification, the second probe comprises a rolling circle amplification substrate comprising a circular nucleic acid strand bound to the second nucleic acid molecule; 26. The method of claim 25, wherein the circular nucleic acid strand comprises a first binding site that binds to the first nucleic acid molecule and a second binding site that binds to the second nucleic acid molecule, and the circular nucleic acid strand has an affinity between the first binding site and the first nucleic acid molecule that is equal to or greater than an affinity between the second binding site and the second nucleic acid molecule. (Item 27) 27. The method of claim 26, wherein the second binding site comprises one or more mismatched nucleic acids that are not complementary to the corresponding nucleic acids of the second nucleic acid molecule. (Item 28) 1. A method for digital detection of a protein analyte, comprising: dividing a fluid into a plurality of compartmentalized fluid volumes to form a homogeneous assay, some of the plurality of volumes being compartmentalized non-analyte-containing volumes and others of the plurality of volumes being compartmentalized analyte-containing volumes, each compartmentalized fluid volume comprising: a first probe comprising a first binding moiety configured to bind to the analyte, the first binding moiety binding to a first nucleic acid molecule; and a second binding moiety configured to bind to the analyte; wherein the second binding moiety binds to a second nucleic acid molecule; said dividing further comprising: triggering an amplification reaction in the compartmentalized analyte-containing volume by proximity-induced interaction between the first nucleic acid molecule and the second nucleic acid molecule; detecting the presence of an analyte in the analyte-containing volume based on the amplification reaction; A method comprising: (Item 29) 29. The method of item 28, wherein the amplification reaction is an isothermal reaction. (Item 30) 29. The method according to item 28, wherein the amplification reaction is a digital isothermal reaction. (Item 31) 29. The method of claim 28, wherein the amplification is a polymerase chain reaction. (Item 32) 29. The method of claim 28, wherein the amplification is a digital polymerase chain reaction. (Item 33) detecting the presence of the analyte illuminating the plurality of compartmentalized volumes with light; detecting fluorescence from the compartmentalized analyte-containing volume; and The method according to items 28 to 32, comprising: (Item 34) 34. The method of any one of items 28 to 33, wherein the dividing step includes placing each compartmentalized fluid volume in a respective one of a plurality of containers, and each compartmentalized fluid volume remains in its respective container until the detecting step is performed. (Item 35) 35. The method of any one of items 28 to 34, wherein the proximity-induced interaction triggers an amplification reaction in which the second nucleic acid molecule is extended. (Item 36) 36. The method of claim 35, wherein the second nucleic acid molecule is extended using the first nucleic acid as a template. (Item 37) 37. The method of claim 36, wherein the first nucleic acid molecule binds to a rolling circle substrate prior to the proximity-induced interaction, and the proximity-induced interaction triggers extension of the second nucleic acid molecule using the rolling circle substrate as a template. (Item 38) 38. The method of any one of items 28 to 37, wherein the first nucleic acid binds to an extensible substrate prior to the proximity-induced interaction, and the proximity-induced interaction releases the extensible substrate into solution. (Item 39) 39. The method of claim 38, wherein release of the extendible substrate triggers an exponential amplification reaction. (Item 40) 40. The method of claim 39, wherein the exponential amplification reaction is an EXPonential Amplification Reaction. (Item 41) 41. The method of any one of items 28 to 40, wherein the proximity-induced interaction triggers a hairpin assembly reaction. (Item 42) 42. The method of any one of items 28 to 41, wherein the proximity-induced interaction generates a catalytic surface consisting of a portion of the first nucleic acid molecule and the second nucleic acid molecule. (Item 43) 43. The method of claim 42, wherein the fluid comprises a co-substrate bound to a co-non-extendible blocker oligonucleotide, and the catalytic surface displaces the co-non-extendible blocker oligonucleotide, thereby triggering an amplification reaction comprising the co-substrate. (Item 44) 43. The method of claim 42, wherein the fluid comprises a rolling circle substrate bound to an auxiliary non-extendible blocker oligonucleotide, and the catalytic surface displaces the auxiliary non-extendible blocker oligonucleotide, thereby triggering an amplification reaction comprising the rolling circle substrate. (Item 45) 43. The method of claim 42, wherein the fluid comprises a plurality of folded hairpin molecules and the catalytic surface catalyzes the unfolding of at least one of the plurality of folded hairpin molecules. (Item 46) 1. A method for detecting the presence of an analyte in a fluid via strand displacement amplification, comprising: providing a first probe in solution in the fluid, the first probe comprising a first binding moiety configured to bind to the analyte, the first binding moiety conjugated to a first nucleic acid molecule; providing a second probe in solution in the fluid, the second probe comprising a second binding moiety configured to bind to the analyte, the second binding moiety conjugated to a second nucleic acid molecule, the second nucleic acid molecule being bound to a non-extensible blocker oligonucleotide; displacing the non-extendable blocker oligonucleotide into solution by proximity induced interaction between the first probe and the second probe; inducing templated polymerization to extend the first nucleic acid molecule; inducing the production of fluorescence upon extension of the first nucleic acid molecule; detecting the analyte in the fluid based on fluorescence; The method comprising: (Item 47) 47. The method of claim 46, wherein displacing the non-extendible blocker oligonucleotide comprises binding the first nucleic acid molecule to the second nucleic acid molecule. (Item 48) 48. The method of claim 47, wherein the second nucleic acid is used as a template to extend the first nucleic acid molecule. (Item 49) 49. The method of claim 48, further comprising providing in the fluid a nicking endonuclease configured to cleave the extended first nucleic acid and enable release of the nicked portion into solution. (Item 50) the fluid comprises a plurality of co-substrates, each of which comprises a co-nucleic acid strand; the auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid, forming an auxiliary nucleic acid complex in solution comprising the nicked portion and the auxiliary nucleic acid strand; 49. The method of claim 48, wherein the auxiliary nucleic acid complex is configured to extend the nicked portion and repeatedly induce removal of portions of the extended nicked portion using the nicking endonuclease, wherein the removed extended nicked portion comprises a copy of the initially removed nicked portion. (Item 51) 51. The method of claim 50, wherein at least some of the auxiliary substrates are each bound to an auxiliary non-extendible blocker oligonucleotide. (Item 52) 52. The method of claim 51, wherein the auxiliary nucleic acid strand is configured to bind to a nicked portion of the extended first nucleic acid, thereby displacing the auxiliary non-extendable blocker oligonucleotide. (Item 53) 51. The method of claim 50, wherein the plurality of auxiliary substrates comprises an auxiliary substrate designed to bind to the extended nicked portion and inactivate it by non-productively extending it, creating a threshold for exponential growth. (Item 54) 54. The method according to any one of items 46 to 53, wherein the analyte is a protein. (Item 55) 54. The method according to any one of items 2 to 53, wherein the first nucleic acid and the second nucleic acid are DNA. (Item 56) 1. A composition for the detection of an analyte, comprising: a first probe comprising a first binding moiety configured to bind to the analyte, the first binding moiety being conjugated to a first nucleic acid molecule; a second probe comprising a second binding moiety configured to bind to the analyte, the second binding moiety being conjugated to a second nucleic acid molecule; a solution comprising the second nucleic acid molecule is bound to a non-extendable blocker oligonucleotide; the first nucleic acid strand and the second nucleic acid strand comprise corresponding sections of nucleic acid, such that when the first probe and the second probe are brought into proximity by binding to the analyte, the non-extendible blocker oligonucleotide is displaced into solution by a proximity-induced interaction between the first probe and the second probe; The composition, wherein no participant in the proximity-induced interaction is bound, directly or indirectly, to a solid support. (Item 57) 57. The composition of claim 56, wherein the solution further comprises a polymerase for extending the first nucleic acid upon displacement of the non-extendible blocker oligonucleotide by the proximity induced interaction. (Item 58) 58. The composition of claim 57, wherein the solution further comprises a nicking endonuclease configured to cleave the nicked portion of the extended first nucleic acid and release the nicked portion into solution. (Item 59) 59. The composition of claim 58, wherein the solution further comprises a fluorescent moiety configured to fluoresce in response to accumulation of nucleic acid when illuminated. (Item 60) the solution further comprises a plurality of co-substrates, each of which comprises a co-nucleic acid strand; the auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid, forming an auxiliary nucleic acid complex in solution comprising the nicked portion and the auxiliary nucleic acid strand; the auxiliary nucleic acid complex is configured to extend the nicked portion and repeatedly induce removal of portions of the extended nicked portion by the nicking endonuclease, the removed extended nicked portion comprising a copy of the originally removed nicked portion; Item 59. The composition according to item 59. (Item 61) 61. The composition of claim 60, wherein at least some of the auxiliary substrates are each bound to an auxiliary non-extendible blocker oligonucleotide. (Item 62) 62. The composition of claim 61, wherein the auxiliary nucleic acid strand is configured to bind to a nicked portion of the extended first nucleic acid, thereby displacing the auxiliary non-extendable blocker oligonucleotide. (Item 63) 61. The composition of claim 60, wherein the plurality of auxiliary substrates comprises an auxiliary substrate designed to bind to the extended nicked portion and inactivate it by non-productively extending it, creating a threshold for exponential growth. (Item 64) 1. A system for digital detection of an analyte, comprising: a plurality of fluid volumes each arranged in a plurality of compartments, some of the plurality of fluid volumes being compartmentalized non-analyte-containing volumes and other of the plurality of fluid volumes being compartmentalized analyte-containing volumes; a first probe in each of the fluid volumes comprising a first binding moiety configured to bind to the analyte, the first binding moiety being conjugated to a first nucleic acid molecule; a second probe in each of the fluid volumes comprising a second binding moiety configured to bind to the analyte, the second binding moiety being conjugated to a second nucleic acid molecule; a light source configured to illuminate the fluid volume within the compartment and to induce fluorescence in response to an amplification reaction triggered by proximity induced interactions between the first probe and the second probe, the interactions occurring upon binding of the first probe and the second probe to the analyte sample in solution within the compartment; The system comprising: (Item 65) Item 65. The system of item 64, wherein the amplification reaction is an isothermal reaction. (Item 66) Item 65. The system of item 64, wherein the amplification reaction is a digital isothermal reaction. (Item 67) 65. The system of item 64, wherein the amplification reaction is a polymerase chain amplification reaction. (Item 68) Item 65. The system of item 64, wherein the amplification reaction is a digital polymerase chain reaction. (Item 69) 69. The system of any one of items 64-68, further comprising a detector configured to detect the fluorescence from the compartmentalized analyte-containing volume and generate a count of the analyte sample based on the detection of fluorescence. (Item 70) 70. The system of any one of items 64 to 69, wherein the amplification reaction comprises templated polymerization. (Item 71) 71. The system of any one of items 64 to 70, wherein the amplification reaction comprises a cascade dequenching reaction. (Item 72) 72. The system according to any one of items 64 to 71, wherein the proximity-induced interaction is a strand displacement interaction. (Item 73) 72. The method of any one of items 64 to 71, wherein the proximity-induced interaction is selected from the group consisting of an enzyme-free hairpin assembly reaction, an enzyme-free catalytic hairpin reaction, and proximity-induced rolling circle amplification. (Item 74) 74. The system of any one of items 64 to 73, wherein the system is configured to divide a fluid to generate the plurality of fluid volumes, and wherein the system is further configured to, upon dividing the fluid, maintain each of the plurality of fluid volumes as an essentially closed fluid system until detecting induction of fluorescence. (Item 75) 1. A method for analyte detection, comprising: providing a fluid containing an analyte; providing a first probe in solution in the fluid, the first probe comprising a first binding moiety configured to bind to the analyte, the first binding moiety conjugated to a first DNA molecule; providing a second probe in solution in the fluid, the second probe comprising a second binding moiety configured to bind to the analyte, the second binding moiety conjugated to a second DNA molecule comprising an RNA polymerase binding site, the second DNA molecule being bound to a blocker oligonucleotide that blocks the RNA polymerase binding site; binding the first binding moiety and the second binding moiety to a common analyte, thereby bringing the first probe and the second probe into close proximity; displacing the blocker oligonucleotide into solution by proximity-induced mutual binding of the first probe and the second probe; using an RNA polymerase to induce transcription of RNA from said second DNA molecule; Inducing the production of fluorescence based on the transcribed RNA; detecting the presence of the analyte in the fluid based on the fluorescence; The method comprising: (Item 76) 76. The method of claim 75, further comprising amplifying the transcribed RNA using nucleic acid sequence-based amplification. (Item 77) 77. The method of any one of items 75 to 76, wherein the analyte is a protein. (Item 78) 78. The method according to any one of items 75 to 77, wherein the method is carried out in a homogeneous assay. (Item 79) 79. The method of claim 78, wherein the method is performed as a digital assay. (Item 80) 1. A composition for the detection of an analyte, comprising: a first probe comprising a first binding moiety configured to bind to the analyte, the first binding moiety being conjugated to a first DNA molecule; a second probe comprising a second binding moiety configured to bind to the analyte, the second binding moiety conjugated to a second DNA molecule comprising an RNA polymerase binding site, the second DNA molecule being bound to a blocker oligonucleotide that blocks the RNA polymerase binding site; RNA polymerase and A fluorescent moiety; a solution comprising the first binding DNA and the second binding DNA molecule are configured to generate a proximity-based interaction when the first binding moiety and the second binding moiety are in proximity upon binding to a common analyte, the proximity-based interaction displacing a blocker oligonucleotide into solution and allowing the RNA polymerase to transcribe RNA using the second DNA molecule as a template. The composition. (Item 81) 81. The composition of claim 80, wherein the fluid further comprises reverse transcriptase, RNAse H, nucleotide triphosphates, deoxynucleotide triphosphates, and DNA primers for amplifying the transcribed RNA using nucleic acid sequence-based amplification. (Item 82) 82. The composition according to any one of items 80 to 81, wherein the fluorescent moiety is a fluorescent dye. (Item 83) 82. The composition according to any one of items 80 to 81, wherein the fluorescent moiety is a fluorescent nanoparticle. (Item 84) 84. The composition according to any one of items 56 to 59 and 80 to 83, further comprising a threshold oligonucleotide. (Item 85) 46. ​​The method of any one of items 1 to 45, wherein the plurality of compartmentalized fluid volumes comprises a plurality of auxiliary substrates. (Item 86) 86. The method of claim 85, wherein the plurality of auxiliary substrates comprises auxiliary substrates that bind to amplification product oligonucleotides. (Item 87) 87. The method of claim 86, wherein the auxiliary substrate that binds to the amplification product oligonucleotide inactivates the amplification product oligonucleotide. (Item 88) 88. The method of claim 87, wherein inactivating the amplification product oligonucleotide comprises non-productively extending the amplification product oligonucleotide. (Item 89) 89. The method of claim 88, wherein non-productively extending the amplification product oligonucleotide creates a threshold for exponential growth. (Item 90) 86. The method of claim 85, wherein the plurality of auxiliary substrates comprises an auxiliary substrate that binds to the amplification product oligonucleotide and inactivates the amplification product oligonucleotide by non-productively extending the amplification product oligonucleotide, creating a threshold for exponential growth. (Item 91) 75. The system of any one of items 64 to 74, wherein the multiple compartmentalized fluid volumes comprise multiple auxiliary substrates. (Item 92) 92. The system of claim 91, wherein the plurality of auxiliary substrates comprises auxiliary substrates that bind to amplification product oligonucleotides. (Item 93) 93. The system of claim 92, wherein the auxiliary substrate that binds to the amplification product oligonucleotide inactivates the amplification product oligonucleotide. (Item 94) 94. The system of claim 93, wherein inactivating the amplification product oligonucleotide comprises non-productively extending the amplification product oligonucleotide. (Item 95) 95. The system of claim 94, wherein non-productively extending the amplification product oligonucleotide creates a threshold for exponential growth. (Item 96) 92. The system of claim 91, wherein the plurality of auxiliary substrates comprises an auxiliary substrate that binds to the amplification product oligonucleotide and inactivates the amplification product oligonucleotide by non-productively extending the amplification product oligonucleotide, creating a threshold for exponential growth.

Claims

1. 1. A method for digital detection of a protein analyte, said method comprising: dividing a fluid into a plurality of compartments in a homogeneous assay, wherein some of the plurality of compartments contain compartmentalized non-analyte-containing fluid and other of the plurality of compartments contain compartmentalized analyte-containing fluid; detecting the presence of the analyte in the compartmentalized analyte-containing fluid based on optical signals from the plurality of compartments; Including, the optical signal is triggered by a proximity-induced interaction in the compartmentalized analyte-containing fluid involving the analyte and components of the compartment; during detecting the presence of the optical signal, the fluid in each of the plurality of compartments comprises a respective fluid produced by the dividing step and a reaction product produced therefrom; the proximity induced interaction occurs prior to an isothermal amplification reaction; The proximity induced interaction is a digital isothermal reaction. The method.

2. wherein each fluid in the plurality of compartments is a first probe comprising a first binding moiety configured to bind to the analyte, the first binding moiety being bound to a first nucleic acid molecule; a second probe comprising a second binding moiety configured to bind to the analyte, the second binding moiety being bound to a second nucleic acid molecule; the proximity-induced interaction occurs between the first probe and the second probe upon binding to the analyte; the optical signal is a fluorescent signal induced by the isothermal amplification reaction in the analyte-containing fluid; The method of claim 1.

3. 3. The method of claim 2, further comprising counting the number of compartments in which fluorescence is produced, thereby producing an analyte count.

4. The method of claim 3 , wherein the analyte counts are generated based on Poisson statistics.

5. The method according to any one of claims 1 to 4, wherein the isothermal amplification reaction is a digital isothermal reaction.

6. The method according to any one of claims 1 to 5, wherein the method is carried out without a ligase.

7. 7. The method of claim 1, wherein each of the plurality of compartments comprises the respective fluid produced by the dividing step and reaction products produced therefrom while detecting the presence of the analyte using the optical signal.

8. 8. The method of any one of claims 1 to 7, wherein after the step of dividing the fluid into the plurality of compartments, each fluid is contained within a single container throughout the remainder of the method until the detection of the analyte using the optical signal.

9. The method according to any one of claims 1 to 8, wherein the method is carried out without a washing step.

10. The method of any one of claims 1 or 4 to 9, wherein the optical signal is an absorbance signal or a luminescence signal.

11. The method of any one of claims 2 to 10, wherein the proximity-induced interaction is a strand displacement interaction.

12. prior to the proximity-induced interaction, the second nucleic acid molecule is bound to a non-extendible blocker oligonucleotide; the proximity induced interaction comprises an interaction between the first and second nucleic acid molecules that displaces the blocker oligonucleotide into solution; the isothermal amplification reaction includes inducing template polymerization to extend the first nucleic acid molecule after displacement of the blocker oligonucleotide; each fluid comprises a nicking endonuclease configured to cleave the extended first nucleic acid molecule, allowing release of the nicked portion into solution; The method of claim 2 , wherein the fluorescence is induced based on the emission of the nicked moieties within the analyte-containing fluid.

13. the isothermal amplification reaction repeatedly extends the first nucleic acid molecule, and the nicking endonuclease repeatedly cleaves the extended first nucleic acid molecule, thereby causing an accumulation of nicked nucleic acid strands; each fluid comprising a plurality of fluorescent moieties configured to bind to the accumulated nicked nucleic acid strands; 13. The method of claim 12, wherein the fluorescence is induced by binding of the fluorescent moiety to the accumulated nicked nucleic acid strands and by irradiating the compartment with light that is near-resonant with the bound fluorescent moiety, thereby inducing fluorescence from the bound fluorescent moiety.

14. each fluid contains a plurality of auxiliary substrates, each of which contains an auxiliary nucleic acid strand; the auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid molecule, thereby forming an auxiliary nucleic acid complex in solution comprising the nicked portion and the auxiliary nucleic acid strand; 14. The method of claim 13, wherein the auxiliary nucleic acid complex is configured to extend the nicked portion and repeatedly trigger removal of portions of the extended nicked portion by the nicking endonuclease or polymerase, wherein the removed extended nicked portion comprises a copy of the originally removed nicked portion.

15. 15. The method of claim 14, wherein at least some of the auxiliary substrates are each bound to an auxiliary non-extendible blocker oligonucleotide.

16. 16. The method of claim 15, wherein the auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid molecule, thereby displacing the auxiliary non-extendible blocker oligonucleotide.

17. 17. The method of claim 16, wherein the plurality of co-substrates comprises a co-substrate that can bind to the extended nicked portion and inactivate it by extending it non-productively, creating a threshold for exponential growth.

18. 18. The method of any one of claims 2 to 17, wherein the isothermal amplification reaction is selected from the group consisting of an enzyme-free hairpin assembly reaction, an enzyme-free catalytic hairpin reaction, an enzyme-free hybridization chain reaction, proximity-induced rolling circle amplification, an exponential amplification reaction, a cascade dequenching reaction, and a loop-mediated isothermal amplification reaction.

19. the isothermal amplification reaction is rolling circle amplification, the second probe comprises a rolling circle amplification substrate comprising a circular nucleic acid strand bound to the second nucleic acid molecule; 3. The method of claim 2, wherein the circular nucleic acid strand comprises a first binding site that binds to the first nucleic acid molecule and a second binding site that binds to the second nucleic acid molecule, and the circular nucleic acid strand has an affinity between the first binding site and the first nucleic acid molecule that is equal to or greater than the affinity between the second binding site and the second nucleic acid molecule.

20. 20. The method of claim 19, wherein the second binding site comprises one or more mismatched nucleic acids that are not complementary to the corresponding nucleic acids of the second nucleic acid molecule.

21. 1. A method for digital detection of a protein analyte, comprising: Dividing a fluid into a plurality of compartments in a homogeneous assay, some of the plurality of compartments containing a compartmentalized non-analyte-containing fluid and other of the plurality of compartments containing a compartmentalized analyte-containing fluid, each compartment comprising: a first probe comprising a first binding moiety configured to bind to the analyte, the first binding moiety being attached to a first nucleic acid molecule; and a second probe comprising a second binding moiety configured to bind to the analyte, the second binding moiety being attached to a second nucleic acid molecule; the dividing step further comprising: causing an isothermal amplification reaction in the compartmentalized analyte-containing fluid by proximity-induced interaction between the first nucleic acid molecule and the second nucleic acid molecule; detecting the presence of the analyte in the analyte-containing fluid based on the isothermal amplification reaction; wherein the proximity induced interaction is a digital isothermal reaction.

22. 22. The method of claim 21, wherein the isothermal amplification reaction is a digital isothermal amplification reaction.

23. detecting the presence of the analyte illuminating the plurality of compartments with light; detecting fluorescence from the compartmentalized analyte-containing fluid; and 23. The method of claim 21 or 22, comprising:

24. 24. The method of any one of claims 21 to 23, wherein the step of dividing the fluid into a plurality of compartments comprises placing each compartment in a respective one of a plurality of containers, each compartment remaining in its respective container until the step of detecting the presence of the analyte is performed.

25. The method of any one of claims 21 to 24, wherein the proximity induced interaction triggers an amplification reaction in which the second nucleic acid molecule is extended.

26. 26. The method of claim 25, wherein the second nucleic acid molecule is extended using the first nucleic acid molecule as a template.

27. 27. The method of claim 26, wherein the first nucleic acid molecule is bound to a rolling circle substrate prior to the proximity-induced interaction, and the proximity-induced interaction triggers extension of the second nucleic acid molecule using the rolling circle substrate as a template.

28. 28. The method of any one of claims 21 to 27, wherein the first nucleic acid molecule is bound to an extensible substrate prior to the proximity-induced interaction, and the proximity-induced interaction releases the extensible substrate into solution.

29. 29. The method of claim 28, wherein the release of the extendible substrate occurs prior to the isothermal amplification reaction, and the isothermal amplification reaction is an exponential amplification reaction.

30. The method according to any one of claims 21 to 26, wherein the isothermal amplification reaction is a hairpin assembly reaction.

31. 31. The method of any one of claims 21 to 30, wherein the proximity induced interaction generates a catalytic surface consisting of a portion of the first nucleic acid molecule and the second nucleic acid molecule.

32. 32. The method of claim 31 , wherein the fluid comprises a co-substrate bound to a co-non-extendible blocker oligonucleotide, and the catalytic surface displaces the co-non-extendible blocker oligonucleotide, thereby triggering an isothermal amplification reaction involving the co-substrate.

33. 32. The method of claim 31 , wherein the fluid comprises a rolling circle substrate bound to an auxiliary non-extendible blocker oligonucleotide, and the catalytic surface displaces the auxiliary non-extendible blocker oligonucleotide, thereby triggering an amplification reaction involving the rolling circle substrate.

34. 32. The method of claim 31 , wherein the fluid comprises a plurality of folded hairpin molecules, and the catalytic surface catalyzes the unfolding of at least one of the plurality of folded hairpin molecules.

35. 1. A method for detecting the presence of an analyte in a fluid via strand displacement amplification, comprising: providing a first probe in solution in the fluid, the first probe comprising a first binding moiety configured to bind to the analyte, the first binding moiety being conjugated to a first nucleic acid molecule; providing, in solution in the fluid, a second probe comprising a second binding moiety configured to bind to the analyte, the second binding moiety conjugated to a second nucleic acid molecule, the second nucleic acid molecule being bound to a non-extendible blocker oligonucleotide; displacing the non-extendible blocker oligonucleotide into solution by proximity-induced interaction between the first probe and the second probe; inducing templated polymerization to extend the first nucleic acid molecule; inducing the production of fluorescence based on said extension of said first nucleic acid molecule; detecting the analyte in the fluid based on fluorescence; wherein the proximity induced interaction is a digital isothermal reaction.

36. 36. The method of claim 35, wherein displacing the non-extendible blocker oligonucleotide comprises binding the first nucleic acid molecule to the second nucleic acid molecule.

37. 37. The method of claim 36, wherein extending the first nucleic acid molecule comprises using the second nucleic acid molecule as a template.

38. 38. The method of claim 37, further comprising providing a nicking endonuclease in the fluid configured to cleave the extended first nucleic acid molecule and enable release of nicked portions into solution.

39. the fluid comprises a plurality of co-substrates, each of which comprises a co-nucleic acid strand; the auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid molecule to form an auxiliary nucleic acid complex in solution comprising the nicked portion and the auxiliary nucleic acid strand; 39. The method of Claim 38, wherein the auxiliary nucleic acid complex is configured to extend the nicked portion and repeatedly induce removal of portions of the extended nicked portion using the nicking endonuclease, wherein the removed extended nicked portion comprises a copy of the originally removed nicked portion.

40. 40. The method of claim 39, wherein at least some of the auxiliary substrates are each bound to an auxiliary non-extendible blocker oligonucleotide.

41. 41. The method of claim 40, wherein the auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid molecule, thereby displacing the auxiliary non-extendible blocker oligonucleotide.

42. 42. The method of claim 41 , wherein the plurality of co-substrates comprises a co-substrate capable of binding to the extended nicked portion and inactivating it by extending it non-productively, creating a threshold for exponential growth.

43. The method of any of claims 35 to 42, wherein the analyte is a protein.

44. The method of claim 2 , wherein the first nucleic acid molecule and the second nucleic acid molecule are DNA.

45. 1. A composition for the detection of an analyte, comprising: a first probe comprising a first binding moiety configured to bind to the analyte, the first binding moiety being conjugated to a first nucleic acid molecule; a second probe comprising a second binding moiety configured to bind to the analyte, the second binding moiety being conjugated to a second nucleic acid molecule; a solution comprising the second nucleic acid molecule is attached to a non-extendible blocker oligonucleotide; the first nucleic acid molecule and the second nucleic acid molecule comprise corresponding sections of nucleic acid, such that when the first probe and the second probe are brought into proximity by binding to the analyte, the non-extendible blocker oligonucleotide is displaced into solution by a proximity-induced interaction between the first probe and the second probe; said participants in the proximity-induced interaction are not bound directly or indirectly to a solid support; The composition, wherein the proximity induced interaction is a digital isothermal reaction.

46. 46. ​​The composition of claim 45, wherein the solution further comprises a polymerase for extending the first nucleic acid molecule upon the displacement of the non-extendible blocker oligonucleotide by the proximity induced interaction.

47. 47. The composition of claim 46, wherein the solution further comprises a nicking endonuclease configured to cleave the nicked portion of the extended first nucleic acid molecule and release the nicked portion into solution.

48. 48. The composition of claim 47, wherein the solution further comprises a fluorescent moiety configured to fluoresce in response to nucleic acid accumulation when illuminated.

49. the solution further comprises a plurality of co-substrates, each of which comprises a co-nucleic acid strand; the auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid molecule to form an auxiliary nucleic acid complex in solution comprising the nicked portion and the auxiliary nucleic acid strand; the auxiliary nucleic acid complex is configured to extend the nicked portion and repeatedly induce removal of portions of the extended nicked portion by the nicking endonuclease, the removed extended nicked portion comprising a copy of the originally removed nicked portion; 49. The composition of claim 48.

50. 50. The composition of claim 49, wherein at least some of the co-substrates are each bound to a co-non-extendible blocker oligonucleotide.

51. 51. The composition of claim 50, wherein the auxiliary nucleic acid strand is configured to bind to the nicked portion of the extended first nucleic acid molecule, thereby displacing the auxiliary non-extendible blocker oligonucleotide.

52. 50. The composition of claim 49, wherein the plurality of co-substrates comprises a co-substrate designed to bind to the extended nicked portion and inactivate it by extending it non-productively, creating a threshold for exponential growth.

53. 1. A system for digital detection of an analyte, comprising: a plurality of fluids respectively disposed in a plurality of compartments, some of the plurality of compartments containing compartmentalized non-analyte-containing fluids and other of the plurality of compartments containing compartmentalized analyte-containing fluids; a first probe in each of the compartments comprising a first binding moiety configured to bind to the analyte, the first binding moiety being conjugated to a first nucleic acid molecule; a second probe in each of the compartments comprising a second binding moiety configured to bind to the analyte, the second binding moiety being conjugated to a second nucleic acid molecule; a light source configured to illuminate the compartment and induce fluorescence in response to an amplification reaction triggered by a proximity induced interaction between the first probe and the second probe, the interaction occurring upon binding of the first probe and the second probe to a sample of the analyte in solution within the compartment; and wherein the proximity induced interaction is a digital isothermal reaction.

54. 54. The system of claim 53, wherein the amplification reaction is an isothermal amplification reaction.

55. 54. The system of claim 53, wherein the amplification reaction is a digital isothermal amplification reaction.

56. 54. The system of claim 53, wherein the amplification reaction is a polymerase chain amplification reaction.

57. 54. The system of claim 53, wherein the amplification reaction is a digital polymerase chain amplification reaction.

58. 58. The system of any one of claims 53 to 57, further comprising a detector configured to detect the fluorescence from the compartmentalized analyte-containing fluid and generate a count of the analyte sample based on the detection of fluorescence.

59. The system of any one of claims 53 to 58, wherein the amplification reaction comprises templated polymerization.

60. 60. The system of any one of claims 53 to 59, wherein the amplification reaction comprises a cascade dequenching reaction.

61. 61. The system of any one of claims 53 to 60, wherein the proximity-induced interaction is a strand displacement interaction.

62. 61. The system of any one of claims 53 to 60, wherein the proximity induced interaction is proximity induced rolling circle amplification.

63. 63. The system of any one of claims 53 to 62, wherein the system is configured to divide a fluid to create the plurality of compartments, and wherein the system is further configured, upon dividing the fluid, to maintain each of the plurality of compartments as an essentially closed fluid system until detecting the induction of fluorescence.

64. 1. A method for analyte detection, comprising: providing a fluid containing an analyte; providing a first probe in solution in the fluid, the first probe comprising a first binding moiety configured to bind to the analyte, the first binding moiety being conjugated to a first DNA molecule; providing in solution in the fluid a second probe comprising a second binding moiety configured to bind to the analyte, the second binding moiety conjugated to a second DNA molecule comprising an RNA polymerase binding site, the second DNA molecule being conjugated to a blocker oligonucleotide that blocks the RNA polymerase binding site; allowing the first binding moiety and the second binding moiety to bind to a common analyte, thereby bringing the first probe and the second probe into proximity; displacing the blocker oligonucleotide into solution by proximity induced interactions upon binding of the first probe and the second probe; using an RNA polymerase to induce transcription of RNA from said second DNA molecule; Inducing the production of fluorescence based on the transcribed RNA; detecting the presence of the analyte in the fluid based on the fluorescence; wherein the proximity induced interaction is a digital isothermal reaction.

65. 65. The method of Claim 64, further comprising amplifying the transcribed RNA using nucleic acid sequence-based amplification.

66. 66. The method of claim 64 or 65, wherein the analyte is a protein.

67. 67. The method of any one of claims 64 to 66, wherein the method is carried out in a homogeneous assay.

68. 68. The method of claim 67, wherein the method is performed as a digital assay.

69. 1. A composition for the detection of an analyte, comprising: a first probe comprising a first binding moiety configured to bind to the analyte, the first binding moiety being conjugated to a first DNA molecule; a second probe comprising a second binding moiety configured to bind to the analyte, the second binding moiety being conjugated to a second DNA molecule comprising an RNA polymerase binding site, the second DNA molecule being conjugated to a blocker oligonucleotide that blocks the RNA polymerase binding site; an RNA polymerase; A fluorescent moiety; a homogeneous fluid comprising the first DNA molecule and the second DNA molecule are configured to generate a proximity-induced interaction when the first binding moiety and the second binding moiety are brought into proximity upon binding to a common analyte, the proximity-induced interaction displacing the blocker oligonucleotide into solution and enabling the RNA polymerase to transcribe RNA using the second DNA molecule as a template, and the proximity-induced interaction is a digital isothermal reaction. The composition.

70. 70. The composition of claim 69, wherein the fluid further comprises a reverse transcriptase, RNase H, nucleotide triphosphates, deoxynucleotide triphosphates, and DNA primers for amplifying the transcribed RNA using nucleic acid sequence-based amplification.

71. 71. The composition of claim 69 or 70, wherein the fluorescent moiety is a fluorescent dye.

72. 71. The composition of claim 69 or 70, wherein the fluorescent moiety is a fluorescent nanoparticle.

73. The method of any one of claims 1 to 34, wherein the plurality of compartments comprises a plurality of co-substrates.

74. 74. The method of claim 73, wherein said plurality of auxiliary substrates comprises auxiliary substrates that bind to isothermal amplification product oligonucleotides.

75. 75. The method of Claim 74, wherein the auxiliary substrate that binds to the isothermal amplification product oligonucleotide inactivates the isothermal amplification product oligonucleotide.

76. 76. The method of Claim 75, wherein said inactivating said isothermal amplification product oligonucleotide comprises non-productively extending said amplification product oligonucleotide.

77. 77. The method of claim 76, wherein non-productively extending the isothermal amplification product oligonucleotides creates a threshold for exponential growth.

78. 74. The method of Claim 73, wherein the plurality of auxiliary substrates comprises an auxiliary substrate that binds to and inactivates the amplification product oligonucleotide by non-productively extending the amplification product oligonucleotide, creating a threshold for exponential growth.

79. 64. The system of any one of claims 53 to 63, wherein the plurality of compartments comprises a plurality of auxiliary substrates.

80. 80. The system of claim 79, wherein the plurality of auxiliary substrates comprises auxiliary substrates that bind to amplification product oligonucleotides.

81. 81. The system of claim 80, wherein the auxiliary substrate that binds to the amplification product oligonucleotide inactivates the amplification product oligonucleotide.

82. 82. The system of Claim 81, wherein said inactivating said amplification product oligonucleotide comprises non-productively extending said amplification product oligonucleotide.

83. 83. The system of claim 82, wherein non-productively extending the amplification product oligonucleotide creates a threshold for exponential growth.

84. 80. The system of claim 79, wherein the plurality of auxiliary substrates comprises an auxiliary substrate that binds to the amplification product oligonucleotide and inactivates the amplification product oligonucleotide by non-productively extending the amplification product oligonucleotide, creating a threshold for exponential growth.

Citation Information

Patent Citations

  • immune amplification

    JP2007525174A

  • Method and apparatus for performing digital assays using polydisperse droplets

    JP2017519484A

  • Improved assay method

    JP2017521644A

  • Genetic assays

    US20150038356A1

  • Methods for multiplex imaging using labeled nucleic acid imaging agents

    US20180164308A1