Oligonucleotides for detecting potato cyst nematodes

The RNA-based RT-PCR method with Gp-specific primers addresses the inefficiencies of existing detection methods by enabling rapid and cost-effective detection of live potato cyst nematodes, enhancing the accuracy of control programs.

JP7737140B2Active Publication Date: 2025-09-10NAT AGRI & FOOD RES ORG
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2021199384
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-12-08
Publication Date
2025-09-10
Estimated Expiration
2041-12-08

AI Technical Summary

Technical Problem

Current methods for detecting live potato cyst nematodes, such as the cup testing method and reverse transcription real-time PCR, are time-consuming and lack specificity, leading to underestimation of control efficacy due to the detection of dead nematodes and high running costs.

Method used

A method using RNA-based RT-PCR with Gp-specific primers designed to target the Y45F10D.4 gene, incorporating a 500-bp intron between forward and reverse primers to prevent genomic DNA amplification, allowing for efficient detection of live Gp.

Benefits of technology

Enables rapid and specific detection of live potato cyst nematodes, reducing costs and improving the accuracy of control efficacy evaluation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007737140000004
    Figure 0007737140000004
  • Figure 0007737140000005
    Figure 0007737140000005
  • Figure 0007737140000001
    Figure 0007737140000001
Patent Text Reader

Abstract

To provide a method that can efficiently detect only living potato cyst nematodes (Globodera pallida), an important potato pest.SOLUTION: Provided is a method for detecting living potato phyllocyst nematodes, comprising performing an amplification reaction of a target nucleic acid region of Potato cyst nematode by RT-PCR using a potato phyllocyst nematode-specific primer set designed on the sequence of Y45F10D.4 gene of potato phylocyst nematode.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a method for detecting live potato white cyst nematodes, which are important pests of potatoes, for example. [Background technology]

[0002] Emergency control of the potato white cyst nematode (Globodera pallida; hereafter sometimes referred to as "Gp") is currently being carried out in Abashiri City, Shari Town, and other areas. After each year's control, the Plant Protection Station conducts a survey to evaluate the effectiveness of the control and determine whether to continue or terminate the control program for the following year. This survey is conducted using the cup examination method, but the lengthy period of time, more than two months, presents a problem. While molecular biological detection methods using DNA have been developed, DNA can be detected even in dead plants, leading to an underestimation of the effectiveness of the control. Therefore, there is a need for a method that can efficiently detect and evaluate only living plants.

[0003] Conventional techniques for detecting only live nematode individuals in soil include the following two methods. One is the cup testing method (Non-Patent Documents 1 and 2), which, as mentioned above, is currently being implemented in emergency control of Gp. This method involves filling a transparent plastic cup with field soil, planting seed potatoes of a potato variety resistant to the potato cyst nematode (Globodera rostochiensis; hereafter sometimes referred to as "Gr"), and then examining the outside of the cup for the presence or absence of cysts that form on the surface of the roots after approximately 70 days of cultivation. However, the cup testing method has the drawbacks of taking a long time (approximately 70 days) to obtain results, and being somewhat insensitive because cysts that form inside the cup cannot be seen.

[0004] The other method is one that detects mRNA. This method takes advantage of the fact that gene expression (mRNA synthesis) is a phenomenon specific to living cells and the fact that RNA is easily degradable, and is applied to the detection and evaluation of living individuals. A method for detecting living Gp by reverse transcription real-time PCR using Gp mRNA as a template has been reported (Non-Patent Documents 3 and 4). However, the reverse transcription real-time PCR method developed so far also detects closely related species such as Gr and Globodera ellingtonae, resulting in low specificity (Non-Patent Document 3). Furthermore, the use of fluorescent dye probes results in high running costs (Non-Patent Documents 3 and 4). [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] A simple method for detecting and estimating the density of potato cyst nematodes using plastic cups, Hokkaido Agricultural Research Information, 2007 (http: / / www.naro.affrc.go.jp / org / harc / seika / h19 / 304.html) [Non-patent document 2] Imashiro, T. (2017). Emergency control of potato white cyst nematode. Plant Protection 71(7), 484-486. [Non-patent document 3] Mimee, B., Soufiane, B., Dauphinais, N., & Belair, G. (2017). A qRT-PCR method to evaluate viability of potato cyst nematode (Globodera spp.). Canadian Journal of Plant Pathology, 39(4), 503-513. [Non-patent document 4] Beniers, JE, Been, TH, Mendes, O., van Gent-Pelzer, MP, & van der Lee, TA (2014). Quantification of viable eggs of the potato cyst nematodes (Globodera spp.) using either trehalose or RNA-specific Real-Time PCR. Nematology, 16(10), 1219-1232. Summary of the Invention [Problem to be solved by the invention]

[0006] In view of the above-mentioned circumstances, an object of the present invention is to provide a method capable of efficiently detecting only live potato cyst nematodes (Gp). [Means for solving the problem]

[0007] To solve this problem, we conducted extensive research and developed a method for detecting live nematodes using RNA. We selected sequences from various gene regions to ensure high species specificity. Furthermore, we designed primers to include an approximately 500-bp intron between the forward and reverse primers to prevent amplification of the target gene from genomic DNA. This eliminated the need for genomic DNA degradation during RNA extraction, further improving efficiency and reducing costs. As a result of our research, we selected Gp-specific primers based on the Y45F10D.4 gene sequence of the potato white cyst nematode (Gp). We then performed RT-PCR using these primers to specifically detect Gp RNA, thereby efficiently detecting only live Gp. This finding led to the completion of the present invention.

[0008] That is, the present invention includes the following. [1] A primer set for specifically detecting viable Gp by amplifying a Gp-specific nucleotide sequence by RT-PCR, comprising the following primers (1) and (2): (1) a primer consisting of the nucleotide sequence set forth in SEQ ID NO: 1; and (2) A primer consisting of the base sequence set forth in SEQ ID NO: 2. [2] A kit for detecting live Gp by RT-PCR, comprising the primer set described in [1]. [3] A method for detecting viable Gp, comprising a step of carrying out an RT-PCR amplification reaction of a target nucleic acid region of Gp using the primer set according to [1] or the kit according to [2]. [4] The method described in [3], wherein the RT-PCR is reverse transcription real-time PCR (RT-qPCR) using the intercalator method. [Effects of the Invention]

[0009] According to the present invention, live potato white cyst nematodes (Gp), which are a serious pest of potatoes, can be detected simply and specifically. [Brief explanation of the drawings]

[0010] [Figure 1-1]The figure shows the alignment of the Y45F10D.4 gene of the potato white cyst nematode (Gp) and its related species, as well as the annealing positions of the primers according to the present invention. From top to bottom, the following sequences are shown: the genomic DNA sequence of the Y45F10D.4 gene of G. pallida, the cDNA sequence of the gene of G. pallida, the cDNA sequence of the gene of G. rostochiensis, the cDNA sequence of the gene of G. ellingtonae (G. ellingtonae), and the cDNA sequence of the gene of G. tabacum (G. tabacum). The solid line indicates the annealing position of primer Y45_0803_F1 (bases 46 to 65 in the figure), and the dashed line indicates the annealing position of primer Y45_0715_R4 (bases 952 to 970). The fourth base from the 3' end of primer Y45_0715_R4 is originally A, but was intentionally replaced with T to reduce primer dimers and improve specificity. [Figure 1-2] This is a continuation of Figure 1-1. DETAILED DESCRIPTION OF THE INVENTION

[0011] The present invention will be described in detail below.

[0012] The primer set of the present invention includes a pair of primers that selectively hybridize with a base sequence specific to the potato white cyst nematode (Globodera pallida; Gp), and is used to amplify the Gp-specific base sequence by reverse transcription-polymerase chain reaction (RT-PCR) and specifically detect viable Gp.

[0013] FIG. 1 shows the alignment of the Y45F10D.4 gene of Gp and its related species, as well as the annealing positions of the primers according to the present invention. The Y45F10D.4 gene encodes an enzyme involved in iron-sulfur cluster formation in vivo. In the present invention, Gp-specific primers were designed to sandwich an approximately 500-bp intron between the forward and reverse primers in the sequence of the Gp Y45F10D.4 gene to prevent amplification from genomic DNA, which is also detected in dead Gp. RT-PCR using the designed primers allows for specific detection of Gp RNA (mRNA), and surviving Gp can be specifically detected from the RNA derived from living Gp.

[0014] The primer set according to the present invention comprises the following pair of Gp-specific primers: (1) a primer (forward primer Y45_0803_F1) containing or consisting of the nucleotide sequence (CAAAAATGACCCATCGGTTG) set forth in SEQ ID NO: 1; and (2) A primer (reverse primer Y45_0715_R4) containing or consisting of the nucleotide sequence (GCAATGAATGCAACGTTCG) set forth in SEQ ID NO: 2.

[0015] Alternatively, the primer set of the present invention may alternatively include primers having a base sequence in which one or several (e.g., 1 to 10, 1 to 5, 1 to 3, preferably 1 or 2) bases have been deleted, substituted, inserted, or added in the base sequence shown by the SEQ ID NO of each primer, and which have the respective primer functions (primers that hybridize under stringent conditions (preferably highly stringent conditions) to cDNA reverse-transcribed from mRNA derived from the Gp Y45F10D.4 gene). Here, "stringent conditions" refers, for example, to hybridization conditions of "5x SSPE, 5x Denhardt's solution, 0.5% SDS, 50% formamide, 200 μg / mL salmon sperm DNA, overnight at 42°C," and washing conditions of "0.5x SSC, 0.1% SDS, 42°C." "Highly stringent conditions" refers to, for example, hybridization conditions of "5x SSPE, 5x Denhardt's solution, 0.5% SDS, 50% formamide, 200 μg / mL salmon sperm DNA, overnight at 42°C" and washing conditions of "0.2x SSC, 0.1% SDS, 65°C."

[0016] The present invention also relates to a kit for detecting viable Gp by RT-PCR, which includes the primer set of the present invention. The kit may further include, for example, reverse transcriptase and DNA polymerase used in RT-PCR; nucleic acid synthesis substrates (dNTPs), buffer solutions, salts, containers, etc. used in RT-PCR; reagents necessary for detecting RT-PCR amplification products (e.g., agarose gel, ethidium bromide, staining reagents (intercalators) capable of detecting nucleic acids, etc.); and instructions for use.

[0017] Furthermore, the present invention relates to a method for detecting viable Gp (hereinafter referred to as "the method"), which comprises a step of performing an RT-PCR amplification reaction of the target nucleic acid region of Gp using the primer set or kit of the present invention described above.

[0018] In this method, RNA is first extracted and purified from an isolate containing cysts and / or eggs isolated from, for example, a field soil sample containing or suspected of containing Gp (e.g., a field soil sample with a history of potato cultivation), or from the cysts and / or eggs isolated from the field soil sample. Examples of RNA extraction methods include those using commercially available RNA extraction reagents. The primer set of the present invention is designed to sandwich an approximately 500-bp intron between the forward and reverse primers in the sequence of the Gp Y45F10D.4 gene to prevent amplification from genomic DNA that is also detected in extinct Gp. Because the primer set's long base sequence prevents amplification from genomic DNA containing the intron by PCR, the step of degrading genomic DNA during RNA extraction can be omitted.

[0019] Next, when using one-step RT-PCR, the purified RNA is used as a template in PCR using the primer set of the present invention. The PCR reaction solution is prepared so that, for example, per 10 μL of reaction solution, each primer included in the primer set of the present invention is present at a final concentration of 300 to 400 nM (preferably 400 nM), 1 to 2 μL (preferably 1 μL) of template RNA, and the respective volumes of DNA polymerase, reverse transcriptase, and dNTPs according to the manufacturer's instructions. Thermal cycling conditions for PCR include, for example, reverse transcription reaction: 42°C for 5 minutes, initial denaturation: 95°C for 10 seconds, PCR reaction: denaturation: 95°C for 5 seconds, and annealing and extension at 62 to 64°C (preferably 63°C) for 33 to 35 seconds (preferably 35 seconds), for 30 to 40 cycles (preferably 40 cycles).

[0020] After the PCR reaction, the reaction mixture is subjected to agarose gel electrophoresis and stained with ethidium bromide or the like to confirm the presence or absence of an amplification product of the expected size (367 bp amplification product). The presence or absence of an amplification product can be used to detect the presence of surviving Gp.

[0021] When quantitative RT-PCR (RT-qPCR) such as reverse transcription (RT-) real-time PCR is used in this method, for example, PCR is performed using, in addition to the reagents used in RT-PCR, a staining reagent capable of detecting nucleic acids (intercalator; a method using an intercalator is referred to as the "intercalator method"), or a fluorescent dye probe that complementarily binds within the amplified region (for example, a fluorescent dye probe that has a base sequence that can specifically anneal to a sequence present between the regions to which the primers used anneal, and is labeled with a reporter at the 5' end and a quencher at the 3' end), and the amplified product can be quantified using the fluorescent signal from the staining reagent or fluorescent dye probe that can detect nucleic acids as an indicator.

[0022] In particular, in this method, it is preferable to perform reverse transcription real-time PCR (RT-qPCR) using the intercalator method as the RT-PCR, which can reduce running costs compared to when using fluorescent dye probes.

[0023] When using the two-step RT-PCR method, a reverse transcription reaction is performed using purified RNA as a template to produce cDNA, followed by a PCR reaction in a separate tube. Specifically, cDNA is produced using a reverse transcriptase and primers such as random hexamers from an isolate containing cysts and / or eggs isolated from a field soil sample, or RNA from cysts and / or eggs isolated from a field soil sample, as a template. Then, PCR is performed using the primer set of the present invention and the cDNA as a template. [Example]

[0024] The present invention will be described in more detail below using examples, but the technical scope of the present invention is not limited to these examples.

[0025] Example 1: Method for detecting live potato cyst nematodes (Gp) and primer set used in the method In this example, we employed an RNA-based live nematode detection method. To keep running costs low, we aimed for a probe-free intercalator method. Furthermore, we examined various gene regions to select sequences that ensured high species specificity. To prevent amplification of the target gene from genomic DNA, we designed primers to sandwich an approximately 500-bp intron between the forward and reverse primers. This eliminated the need for a genomic DNA digestion step during RNA extraction, further improving efficiency and reducing costs.

[0026] 1. Primer Design As a result of the investigation, Gp-specific primers designed on the sequence of the Gp Y45F10D.4 gene were selected (Table 1 and Figure 1; product size: 367 bp).

[0027] [Table 1]

[0028] 2. Intercalator-based reverse transcription real-time PCR (RT-qPCR) using Gp and its related species Reverse transcription real-time PCR (RT-qPCR) using the intercalator method was performed on Gp and its related species using the designed primers shown in Table 1. Table 2 shows the nematode species from which the template nucleic acid used in RT-qPCR was derived, the number of cysts or eggs, and the type of template nucleic acid. (1) RNA extraction: RNA was extracted from each nematode sample using Takara's NucleoSpin RNA. (2) Preparation of PCR reaction solution: Takara's One Step TB Green® PrimeScript TMReverse transcription quantitative PCR was performed using the PLUS RT-PCR kit. The PCR reaction mixture consisted of 5 μl of 2x One Step TB Green RT-PCR Buffer, 0.6 μl of Takara Ex Taq HS Mix, 0.2 μl of PrimeScript PLUS RTase Mix, 0.4 μl of forward primer Y45_0803_F1 (10 μM), 0.4 μl of reverse primer Y45_0715_R4 (10 μM), 2.4 μl of RNase-free water, and 1 μl of template RNA (total volume: 10 μl). (3) PCR temperature conditions: The temperature conditions for PCR were as follows: reverse transcription reaction: 42°C for 5 min → initial denaturation: 95°C for 10 s → PCR reaction: denaturation at 95°C for 5 s → annealing / extension at 63°C for 35 s (40 cycles) → melting curve analysis: 95°C for 15 s → 60°C for 1 min → increase from 60°C to 95°C at 0.3°C / s. (4) RT-qPCR results using the intercalator method The results of RT-qPCR using the intercalator method are shown in Table 2.

[0029] [Table 2]

[0030] As shown in the "Detectability" section of Table 2, Gp RNA was specifically detected. This method also enabled detection under extremely low density conditions, where there were only 10 viable Gp eggs.

[0031] 3. Intercalator-based reverse transcription real-time PCR (RT-qPCR) using Gp cysts from soil treated with 1,3-dichloropropene Potato plants were inoculated with Gp cysts from soil treated with 1,3-dichloropropene (the active ingredient in the nematicide "DD," hereafter referred to as "1,3-D"), and RNA was extracted and analyzed using RT-qPCR. RT-qPCR was performed using the same method as for Gp and its related species described in Section 2 above. The results are shown in Table 3 below.

[0032] [Table 3]

[0033] As shown in Table 3, there was a good correlation between the survival status of Gp in the inoculation test and the nucleic acid amplification by RT-qPCR, and no nucleic acid amplification was observed in samples that were considered to have died.

[0034] When PCR was performed on DNA, nucleic acid amplification was confirmed in all samples. The PCR reaction mixture consisted of 5.0 μl of Dream Taq™ Hot Start Green Master Mix, 0.3 μl each of primers (ITS5 and PITSp4, both at 10 μM), 1 μl of template DNA, and 3.4 μl of RNase-free water (10 μl synthetic). The sequence information of ITS5 is available from White et al. (1990) Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In: Innis, MA, Gelfand, DH, Snisky, JJ and White, TJ, Eds., PCR Protocols: A Guide to Methods and Applications, Academic Press, San Diego, 315-322 (DOI:10.1016 / B978-0-12-372180-8.50042-1). The sequence information of PITSp4 is available from Bulman and Marshall (1997) Differentiation of Australasian potato cyst nematode (PCN) populations using the polymerase chain reaction (PCR), New Zealand Journal of Crop and Horticultural Science, Volume 25, Issue 2, pp. 123-129 (DOI: The primers were as described in the 10.1080 / 01140671.1997.9513998). These primers target the internal transcribed spacer (ITS) of rDNA. The PCR temperature conditions were as follows: initial denaturation: 94°C for 2 minutes, followed by PCR reaction: denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds (35 cycles). The PCR product was electrophoresed on an agarose gel to confirm the presence or absence of a band (265 bp).

[0035] 4. Summary From the above, RT-qPCR using the intercalator method with the Gp-specific primers designed in this example can specifically detect viable Gp more quickly (within a few days) than the cup detection method (which takes more than two months) without using expensive fluorescent dye probes. As a result, RT-qPCR using the Gp-specific primers designed in this example can specifically detect and evaluate viable Gp quickly and at low cost, which is expected to significantly improve the efficiency and speed of the current method of evaluating control efficacy, which currently requires more than two months.

Claims

1. A primer set for specifically detecting live potato white cyst nematodes (Globodera pallida), which includes the following primers (1) and (2), by RT-PCR amplification of a base sequence specific to the potato white cyst nematode (Globodera pallida). (1) a primer consisting of the nucleotide sequence set forth in SEQ ID NO: 1; and (2) A primer consisting of the base sequence set forth in SEQ ID NO:

2.

2. A kit for detecting live potato white cyst nematodes by RT-PCR, comprising the primer set according to claim 1.

3. A method for detecting live potato white cyst nematodes, comprising a step of carrying out an RT-PCR amplification reaction of a target nucleic acid region of the potato white cyst nematode using the primer set of claim 1 or the kit of claim 2.

4. The method according to claim 3, wherein the RT-PCR is reverse transcription real-time PCR (RT-qPCR) using an intercalator method.

Citation Information

Patent Citations

  • Lamp primer and detection method for detecting potato cyst nematode

    JP2021171012A

  • Simultaneous detection method of globodera rostochiensis and globodera pallida as well as primer set used for the method

    JP2022095271A