Methods and compositions for preparing nucleic acid libraries

Abstract

To provide a system, method and composition regarding preparation of a nucleic acid library.SOLUTION: Some embodiments include preparation of a nucleic acid library by ligation of single-stranded nucleic acid. In one embodiment of the method, single-stranded nucleic acid is prepared by reducing the possibility of self concatenation of a reactive species. For example, in order to ligate a 3' adapter to a 3' terminal of the single-stranded nucleic acid, the 3' adapter can have a protective group inhibiting self-concatenation. Similarly, a 5' terminal of the single-stranded nucleic acid is dephosphorylated, and self-concatenation can be inhibited.SELECTED DRAWING: None

Description

[Technical Field]

[0001] Related Applications This application claims priority to U.S. Provisional Application No. 62 / 473,595, filed March 20, 2017, entitled "METHODS AND COMPOSITIONS FOR PREPARING NUCLEIC ACID LIBRARIES," the disclosure of which is incorporated herein by reference in its entirety.

[0002] Sequence Listing

[0002] This application contains an electronic sequence listing. The sequence listing is provided as a file named ILLINC362WOSEQLIST, created on March 15, 2018, and is approximately 4kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

[0003] FIELD OF THE INVENTION The systems, methods and compositions provided herein relate to the preparation of nucleic acid libraries. Some embodiments include the preparation of nucleic acid libraries by ligation of single-stranded nucleic acids. [Background technology]

[0004] Background of the Invention Several next-generation sequencing technologies are available for rapid and economical determination of entire genome sequences. Prior to sequencing, a library of template nucleic acids is typically prepared from a double-stranded target genomic DNA sample. Sample preparation usually involves a DNA fragmentation step, in which larger DNA strands are cleaved into smaller DNA fragments more suitable for next-generation sequencing. Adapters are often added to the ends of the DNA fragments, which can be achieved by DNA end repair followed by adapter ligation or, more recently, by using the transposome system. The use of transposomes, a complex of a transposase and a transposon sequence, allows for simultaneous genome fragmentation and adapter ligation of the fragments, thereby simplifying library preparation. Library preparation methods are typically labor-intensive and require several hands-on steps at different stages. Summary of the Invention [Means for solving the problem]

[0005] Summary of the Invention Some embodiments include a method of preparing a nucleic acid library, the method comprising: (a) obtaining a plurality of nucleic acids, wherein the plurality of nucleic acids are single-stranded nucleic acids; (b) dephosphorylating 5' ends of the single-stranded nucleic acids; (c) ligating a first adaptor to a 3' end of the single-stranded nucleic acid in the presence of a ligase, wherein the 3' end of the first adaptor comprises a protecting group; (d) phosphorylating the 5' end of the ligated single-stranded nucleic acid; and (e) ligating a second adaptor to the 5' end of the phosphorylated ligated single-stranded nucleic acid in the presence of the ligase, thereby obtaining a library of nucleic acids.

[0006] In some embodiments, the 5' end of the second adaptor is not phosphorylated.

[0007] In some embodiments, the second adaptor is attached to a substrate. In some embodiments, the substrate comprises a bead or a flow cell.

[0008] Some embodiments also include removing unligated single-stranded first adaptors prior to step (e).

[0009] Some embodiments also include hybridizing a non-ligated single-stranded first adaptor to the capture probe. In some embodiments, the capture probe comprises a sequence complementary to at least a portion of the first adaptor. In some embodiments, the 3' end of the capture probe comprises a protecting group. In some embodiments, the 5' end of the capture probe comprises a protecting group.

[0010] Some embodiments also include digesting the unligated single-stranded first adaptor. In some embodiments, digesting the unligated single-stranded first adaptor comprises contacting the unligated single-stranded first adaptor with a 5' phosphate-dependent exonuclease. In some embodiments, digesting the unligated single-stranded first adaptor comprises contacting the unligated single-stranded first adaptor with a 5' phosphate-dependent exonuclease and a 5' deadenylase.

[0011] In some embodiments, phosphorylating the 5' end of the ligation single-stranded nucleic acid comprises contacting the ligation single-stranded nucleic acid with a kinase.

[0012] Some embodiments include a method of preparing a nucleic acid library, the method comprising: (a) obtaining a plurality of nucleic acids, wherein the plurality of nucleic acids are double-stranded nucleic acids; (b) contacting the double-stranded nucleic acids with a 5' exonuclease to obtain a plurality of modified double-stranded nucleic acids having single-stranded 3' overhangs; (c) ligating a first adaptor to the 3' ends of the modified double-stranded nucleic acids in the presence of a ligase, wherein the 3' ends of the first adaptor comprise a protecting group; (d) dehybridizing the modified double-stranded nucleic acids ligated to the first adaptor to obtain a plurality of single-stranded nucleic acids; and (e) ligating a second adaptor to the 5' ends of the single-stranded nucleic acids in the presence of the ligase, thereby obtaining a library of nucleic acids.

[0013] In some embodiments, the 5' end of the second adaptor is not phosphorylated.

[0014] Some embodiments include a method of preparing a nucleic acid library, the method comprising: (a) obtaining a plurality of nucleic acids, wherein the plurality of nucleic acids are single-stranded nucleic acids; (b) dephosphorylating 5' ends of the single-stranded nucleic acids; (c) ligating a first adaptor to the 3' ends of the single-stranded nucleic acids in the presence of a ligase, wherein the 3' ends of the first adaptor comprise a protecting group; (d) hybridizing the ligated first adaptor to a capture probe; and (e) extending the capture probe and ligating a second adaptor to the 3' end of the extended capture probe in the presence of the ligase, wherein the 3' end of the second adaptor comprises a protecting group, thereby obtaining a library of nucleic acids.

[0015] Some embodiments also include removing the hybridized ligation first adaptor from the extended capture probe.

[0016] In some embodiments, the capture probe is attached to a substrate. In some embodiments, the substrate comprises a bead or a flow cell. In some embodiments, the capture probe comprises a capture probe index. In some embodiments, the capture probe comprises a cleavable linker. Some embodiments also include cleaving the cleavable linker.

[0017] Some embodiments include a method of preparing a nucleic acid library, the method comprising: (a) obtaining a plurality of nucleic acids, wherein the plurality of nucleic acids are single-stranded nucleic acids; (b) dephosphorylating 5' ends of the single-stranded nucleic acids; (c) ligating a linker to the 3' ends of the single-stranded nucleic acids, wherein the linker comprises a first adaptor and a second adaptor, and the 3' end of the linker comprises a protecting group; (d) phosphorylating the 5' ends of the ligated single-stranded nucleic acids; and (e) deprotecting the 3' ends of the phosphorylated nucleic acids and circularizing the deprotected nucleic acids by ligation, thereby obtaining a library of circular nucleic acids.

[0018] In some embodiments, the linker comprises a cleavable site between the first adaptor and the second adaptor.

[0019] Some embodiments also include linearizing the circular nucleic acid by cleavage at the cleavable linker. In some embodiments, the cleavable site comprises a uracil residue. Some embodiments also include contacting the circular nucleic acid with a uracil-specific cleavage reagent. In some embodiments, the uracil-specific cleavage reagent comprises an enzyme selected from uracil DNA glycosylase (UDG) and DNA glycosylase-lyase endonuclease VIII.

[0020] Some embodiments also include amplifying the circular nucleic acid by a method comprising hybridizing at least a primer to the first adaptor or the second adaptor. In some embodiments, the amplification is selected from PCR and rolling circle amplification (RCA). In some embodiments, the amplification comprises contacting the circular nucleic acid with a polymerase that forms a linear product upon contact with uracil residues in the template.

[0021] In some embodiments, dephosphorylating the 5' end of the single-stranded nucleic acid comprises contacting the single-stranded nucleic acid with a phosphatase.

[0022] In some embodiments, steps (b) through (e) are carried out in a single reaction volume.

[0023] In some embodiments, steps (b) through (e) are carried out in a single reaction vessel.

[0024] In some embodiments, the first adaptor and / or the second adaptor comprises a sequencing primer binding site.

[0025] In some embodiments, the first adaptor comprises a P7 sequence, a P5 sequence, or a complement or reverse complement thereof. In some embodiments, the second adaptor comprises a P7 sequence, a P5 sequence, or a complement or reverse complement thereof.

[0026] In some embodiments, the first adaptor and / or the second adaptor comprise an adaptor index. In some embodiments, the first adaptor index is different from the second adaptor index. In some embodiments, the adaptor index indicates a source of multiple nucleic acids.

[0027] In some embodiments, the protecting group comprises a 3' spacer C3 or a dideoxynucleotide.

[0028] In some embodiments, the ligase comprises a single-stranded nucleic acid ligase.

[0029] In some embodiments, the ligation of the first adaptor and / or the ligation of the second adaptor is performed in the presence of a volume exclusion agent. In some embodiments, the volume exclusion agent is selected from the group consisting of polyethylene glycol (PEG), dextran, hetastarch, ficoll, and polyvinylpyrrolidone. In some embodiments, the first ligation step and / or the second ligation step is performed in a reaction volume containing at least about 37% (wt / vol) PEG. In some embodiments, the first ligation step and / or the second ligation step is performed in a reaction volume containing at least about 60% (wt / vol) PEG.

[0030] In some embodiments, the plurality of nucleic acids comprises RNA, hi some embodiments, the plurality of nucleic acids comprises cDNA or genomic DNA.

[0031] In some embodiments, the average nucleic acid size of the plurality of nucleic acids is less than about 200 nucleotides.

[0032] In some embodiments, the plurality of nucleic acids is obtained from a low quality nucleic acid source, hi some embodiments, the plurality of nucleic acids is obtained from a fixed sample.

[0033] Some embodiments also include amplifying the library of nucleic acids.

[0034] Some embodiments also include obtaining sequence data from a library of nucleic acids.

[0035] Some embodiments include a nucleic acid library prepared by the method of any one of the preceding embodiments.

[0036] Some embodiments include a kit comprising a component selected from the group consisting of a first adaptor (wherein the 3' end of the first adaptor comprises a protecting group, and the first adaptor comprises a P7 sequence, a P5 sequence, or a complement or reverse complement thereof); a ligase; and a volume exclusion agent, a kinase, a phosphatase, a 5' phosphate-dependent exonuclease, a 5' deadenylase, a polymerase that forms a linear product upon contact with a uracil residue in a template, a uracil-specific excision reagent, and a second adaptor (wherein the second adaptor comprises a P7 sequence, a P5 sequence, or a complement or reverse complement thereof). In some embodiments, a linker comprises the first and second adaptors.

[0037] Some embodiments include a reaction vessel comprising a reaction volume comprising: a plurality of nucleic acids; a first adaptor (wherein a 3' end of said first adaptor comprises a protecting group); a ligase; and a volume exclusion agent.

[0038] In some embodiments, the plurality of nucleic acids is a single-stranded nucleic acid.

[0039] In some embodiments, the first adaptor is ligated to the 3' ends of the plurality of single-stranded nucleic acids, thereby forming a plurality of modified single-stranded nucleic acids.

[0040] In some embodiments, the non-ligated first adaptor is hybridized to a capture probe, hi some embodiments, the capture probe comprises a sequence complementary to at least a portion of the first adaptor.

[0041] In some embodiments, the plurality of nucleic acids are double-stranded nucleic acids having 3' overhangs. In some embodiments, the first adaptor is ligated to the 3' ends of the plurality of double-stranded nucleic acids having 3' overhangs, thereby forming a plurality of modified double-stranded nucleic acids.

[0042] Some embodiments also include a second adaptor, in some embodiments, the 5' end of the second adaptor is not phosphorylated.

[0043] Some embodiments also include a dephosphorylating agent. In some embodiments, the dephosphorylating agent includes a phosphatase. In some embodiments, the phosphatase is inactivated.

[0044] In some embodiments, the volume exclusion agent is selected from the group consisting of polyethylene glycol (PEG), dextran, hetastarch, ficoll, and polyvinylpyrrolidone. In some embodiments, the reaction volume comprises at least about 37% (wt / vol) PEG. In some embodiments, the reaction volume comprises at least about 60% (wt / vol) PEG.

[0045] In some embodiments, the first adaptor and / or the second adaptor comprises a sequencing primer binding site.

[0046] In some embodiments, the first adaptor and / or the second adaptor comprise an adaptor index. In some embodiments, the first adaptor index is different from the second adaptor index. In some embodiments, the adaptor index indicates a source of multiple single-stranded nucleic acids.

[0047] In some embodiments, the protecting group comprises a 3' spacer C3 or a dideoxynucleotide. In some embodiments, the protecting group comprises a 3' spacer C3.

[0048] In some embodiments, the ligase comprises a single-stranded nucleic acid ligase.

[0049] In some embodiments, the plurality of nucleic acids comprises RNA, hi some embodiments, the plurality of nucleic acids comprises cDNA or genomic DNA.

[0050] In some embodiments, the plurality of single-stranded nucleic acids is obtained from a low quality nucleic acid source, hi some embodiments, the plurality of nucleic acids is obtained from a fixed sample.

[0051] Some embodiments include a flow cell comprising the reaction vessel of any one of the preceding embodiments.

[0052] Some embodiments include a system including the reaction vessel of any one of the preceding embodiments and a detector for obtaining sequencing data. The present invention provides, for example, the following items. (Item 1) 1. A method for preparing a nucleic acid library, comprising: (a) obtaining a plurality of nucleic acids, wherein said plurality of nucleic acids are single-stranded nucleic acids; (b) dephosphorylating the 5' end of the single-stranded nucleic acid; (c) ligating a first adaptor to the 3' end of the single-stranded nucleic acid in the presence of a ligase, wherein the 3' end of the first adaptor comprises a protecting group; (d) phosphorylating the 5' end of the ligated single-stranded nucleic acid; and (e) ligating a second adaptor to the 5' end of the phosphorylated ligated single-stranded nucleic acid in the presence of the ligase, thereby obtaining a library of nucleic acids. A method comprising: (Item 2) Item 10. The method of item 1, wherein the 5' end of the second adaptor is not phosphorylated. (Item 3) 3. The method of claim 1 or 2, wherein the second adapter is attached to a substrate. (Item 4) 4. The method of claim 3, wherein the substrate comprises a bead or a flow cell. (Item 5) The method according to item 1, further comprising removing unligated single-stranded first adaptors prior to step (e). (Item 6) 6. The method of claim 5, comprising hybridizing the unligated single-stranded first adaptor to a capture probe. (Item 7) 7. The method of claim 6, wherein the capture probe comprises a sequence complementary to at least a portion of the first adaptor. (Item 8) The method according to item 6 or 7, wherein the 3' end of the capture probe comprises a protecting group. (Item 9) 9. The method according to any one of items 6 to 8, wherein the 5' end of the capture probe comprises a protecting group. (Item 10) 6. The method of claim 5, further comprising digesting the unligated single-stranded first adaptor. (Item 11) 11. The method of claim 10, wherein digesting the unligated single-stranded first adaptor comprises contacting the unligated single-stranded first adaptor with a 5′ phosphate-dependent exonuclease. (Item 12) 12. The method of claim 10 or 11, wherein digesting the unligated single-stranded first adaptor comprises contacting the unligated single-stranded first adaptor with a 5' phosphate-dependent exonuclease and a 5' deadenylase. (Item 13) 13. The method of any one of items 1 to 12, wherein phosphorylating the 5' end of the ligation single-stranded nucleic acid comprises contacting the ligation single-stranded nucleic acid with a kinase. (Item 14) 1. A method for preparing a nucleic acid library, comprising: (a) obtaining a plurality of nucleic acids, wherein said plurality of nucleic acids are double-stranded nucleic acids; (b) contacting the double-stranded nucleic acid with a 5' exonuclease to obtain a plurality of modified double-stranded nucleic acids having single-stranded 3' overhangs; (c) ligating a first adaptor to the 3' end of the modified double-stranded nucleic acid in the presence of a ligase, wherein the 3' end of the first adaptor comprises a protecting group; (d) dehybridizing the modified double-stranded nucleic acid ligated to the first adaptor to obtain a plurality of single-stranded nucleic acids; and (e) ligating a second adaptor to the 5' end of the single-stranded nucleic acid in the presence of the ligase, thereby obtaining a library of nucleic acids. (Item 15) Item 15. The method of item 14, wherein the 5' end of the second adaptor is not phosphorylated. (Item 16) 1. A method for preparing a nucleic acid library, comprising: (a) obtaining a plurality of nucleic acids, wherein said plurality of nucleic acids are single-stranded nucleic acids; (b) dephosphorylating the 5' end of the single-stranded nucleic acid; (c) ligating a first adaptor to the 3' end of the single-stranded nucleic acid in the presence of a ligase, wherein the 3' end of the first adaptor comprises a protecting group; (d) hybridizing the ligated first adaptor with a capture probe; (e) extending the capture probe and ligating a second adaptor to the 3' end of the extended capture probe in the presence of the ligase, wherein the 3' end of the second adaptor comprises a protecting group, thereby obtaining a library of nucleic acids. A method comprising: (Item 17) 17. The method of claim 16, further comprising removing the hybridized ligation first adaptor from the extended capture probe. (Item 18) 18. The method of claim 16 or 17, wherein the capture probe is attached to a substrate. (Item 19) 19. The method of claim 18, wherein the substrate comprises a bead or a flow cell. (Item 20) 20. The method of any one of items 16 to 19, wherein the capture probe comprises a capture probe index. (Item 21) 21. The method of any one of items 16 to 20, wherein the capture probe comprises a cleavable linker. (Item 22) 22. The method of claim 21, comprising cleaving the cleavable linker. (Item 23) 1. A method for preparing a nucleic acid library, comprising: (a) obtaining a plurality of nucleic acids, wherein said plurality of nucleic acids are single-stranded nucleic acids; (b) dephosphorylating the 5' end of the single-stranded nucleic acid; (c) ligating a linker to the 3' end of the single-stranded nucleic acid, wherein the linker comprises a first adaptor and a second adaptor, and the 3' end of the linker comprises a protecting group; (d) phosphorylating the 5' end of the ligated single-stranded nucleic acid; (e) deprotecting the 3' ends of the phosphorylated nucleic acids and circularizing the deprotected nucleic acids by ligation, thereby obtaining a library of circular nucleic acids. A method comprising: (Item 24) 24. The method of claim 23, wherein the linker comprises a cleavable site between the first adaptor and the second adaptor. (Item 25) 25. The method of claim 24, further comprising linearizing the circular nucleic acid by cleavage at the cleavable linker. (Item 26) 26. The method of claim 24 or 25, wherein the cleavable site comprises a uracil residue. (Item 27) 27. The method of claim 26, comprising contacting the circular nucleic acid with a uracil-specific excision reagent. (Item 28) 28. The method of claim 27, wherein the uracil-specific cleavage reagent comprises an enzyme selected from uracil DNA glycosylase (UDG) and DNA glycosylase-lyase endonuclease VIII. (Item 29) 29. The method of any one of items 23 to 28, further comprising amplifying the circular nucleic acid by a method comprising hybridizing at least a primer to the first adaptor or the second adaptor. (Item 30) 30. The method of claim 29, wherein the amplifying is selected from PCR and rolling circle amplification (RCA). (Item 31) 30. The method of claim 29, wherein the amplifying comprises contacting the circular nucleic acid with a polymerase that forms linear products by contacting uracil residues in the template. (Item 32) 32. The method according to any one of Items 23 to 31, wherein dephosphorylating the 5' end of the single-stranded nucleic acid comprises contacting the single-stranded nucleic acid with a phosphatase. (Item 33) 33. The method according to any one of items 1 to 32, wherein steps (b) to (e) are carried out in a single reaction volume. (Item 34) 34. The method according to any one of items 1 to 33, wherein steps (b) to (e) are carried out in a single reaction vessel. (Item 35) 35. The method of any one of items 1 to 34, wherein the first adaptor and / or the second adaptor comprises a sequencing primer binding site. (Item 36) 36. The method of claim 35, wherein the first adaptor comprises a P7 sequence, a P5 sequence, or a complement or reverse complement thereof. (Item 37) 36. The method of claim 35, wherein the second adaptor comprises a P7 sequence, a P5 sequence, or a complement or reverse complement thereof. (Item 38) 38. The method of any one of items 1 to 37, wherein the first adaptor and / or second adaptor comprises an adaptor index. (Item 39) Item 39. The method of item 38, wherein the first adapter index is different from the second adapter index. (Item 40) 40. The method of claim 38 or 39, wherein the adapter index indicates the source of the plurality of nucleic acids. (Item 41) 41. The method of any one of items 1 to 40, wherein the protecting group comprises a 3' spacer C3 or a dideoxynucleotide. (Item 42) 42. The method of any one of items 1 to 41, wherein the ligase comprises a single-stranded nucleic acid ligase. (Item 43) 43. The method according to any one of items 1 to 42, wherein ligation of the first adaptor and / or ligation of the second adaptor is carried out in the presence of a volume-exclusion agent. (Item 44) 44. The method of claim 43, wherein the volume-excluding agent is selected from the group consisting of polyethylene glycol (PEG), dextran, hetastarch, ficoll, and polyvinylpyrrolidone. (Item 45) 44. The method of claim 43, wherein the first ligation step and / or the second ligation step is carried out in a reaction volume containing at least about 37% (wt / vol) PEG. (Item 46) 44. The method of claim 43, wherein the first ligation step and / or the second ligation step is carried out in a reaction volume containing at least about 60% (wt / vol) PEG. (Item 47) 47. The method of any one of items 1 to 46, wherein the plurality of nucleic acids comprises RNA. (Item 48) 47. The method of any one of items 1 to 46, wherein the plurality of nucleic acids comprises cDNA or genomic DNA. (Item 49) 49. The method of any one of items 1 to 48, wherein the average nucleic acid size of the plurality of nucleic acids is less than about 200 nucleotides. (Item 50) 50. The method of any one of items 1 to 49, wherein the plurality of nucleic acids is obtained from a low-quality nucleic acid source. (Item 51) 51. The method of claim 50, wherein the plurality of nucleic acids is obtained from a fixed sample. (Item 52) 52. The method of any one of items 1 to 51, further comprising amplifying said library of nucleic acids. (Item 53) 53. The method of any one of items 1 to 52, further comprising obtaining sequence data from said library of nucleic acids. (Item 54) A nucleic acid library prepared by the method according to any one of items 1 to 53. (Item 55) a first adaptor, wherein the 3' end of the first adaptor comprises a protecting group, and the first adaptor comprises a P7 sequence, a P5 sequence, or a complement or reverse complement thereof; ligase; and a component selected from the group consisting of a volume exclusion agent, a kinase, a phosphatase, a 5' phosphate-dependent exonuclease, a 5' deadenylase, a polymerase that forms a linear product upon contact with a uracil residue in the template, a uracil-specific excision reagent, and a second adaptor, the second adaptor comprising a P7 sequence, a P5 sequence, or its complement or reverse complement. Includes a kit. (Item 56) 56. The kit of item 55, wherein the linker comprises the first and second adaptors. (Item 57) Multiple nucleic acids; a first adaptor, wherein the 3' end of said first adaptor comprises a protecting group; 1st adapter; ligase; and Volume exclusion agent a reaction vessel comprising a reaction volume comprising: (Item 58) 58. The reaction vessel according to item 57, wherein the plurality of nucleic acids are single-stranded nucleic acids. (Item 59) 59. The reaction vessel of claim 58, wherein the first adaptor is ligated to the 3' ends of the plurality of single-stranded nucleic acids, thereby forming a plurality of modified single-stranded nucleic acids. (Item 60) 60. The reaction vessel of item 59, wherein the non-ligated first adaptor is hybridized to the capture probe. (Item 61) Item 61. The reaction vessel of Item 60, wherein the capture probe comprises a sequence complementary to at least a portion of the first adaptor. (Item 62) 58. The reaction vessel of item 57, wherein the plurality of nucleic acids are double-stranded nucleic acids having 3' overhangs. (Item 63) 63. The reaction vessel of claim 62, wherein the first adaptor is ligated to the 3' ends of the plurality of double-stranded nucleic acids having 3' overhangs, thereby forming a plurality of modified double-stranded nucleic acids. (Item 64) 64. The reaction vessel according to any one of items 57 to 63, further comprising a second adaptor. (Item 65) Item 66. The reaction vessel according to Item 64, wherein the 5' end of the second adaptor is not phosphorylated. 66. The reaction vessel according to any one of items 57 to 65, comprising a dephosphorylation agent. (Item 67) 67. The reaction vessel of item 66, wherein the dephosphorylating agent comprises a phosphatase. (Item 68) 68. The reaction vessel of item 67, wherein the phosphatase is inactivated. (Item 69) 69. The reaction vessel according to any one of items 57 to 68, wherein the volume-excluding agent is selected from the group consisting of polyethylene glycol (PEG), dextran, hetastarch, ficoll and polyvinylpyrrolidone. (Item 70) 70. The reaction vessel of item 69, wherein the reaction volume comprises at least about 37% (wt / vol) PEG. (Item 71) 70. The reaction vessel of item 69, wherein the reaction volume comprises at least about 60% (wt / vol) PEG. (Item 72) 72. The reaction vessel of any one of items 64 to 71, wherein the first adaptor and / or the second adaptor comprises a sequencing primer binding site. (Item 73) 73. The reaction vessel of any one of items 64 to 72, wherein the first adaptor and / or the second adaptor comprises an adaptor index. (Item 74) Item 74. The reaction vessel of item 73, wherein the first adapter index is different from the second adapter index. (Item 75) 74. The reaction vessel of item 73, wherein the adapter index indicates the source of the plurality of single-stranded nucleic acids. (Item 76) 76. The reaction vessel according to any one of items 57 to 75, wherein the protecting group comprises a 3' spacer C3 or a dideoxynucleotide. (Item 77) 77. The reaction vessel according to any one of items 57 to 76, wherein the protecting group comprises a 3' spacer C3. (Item 78) 78. The reaction vessel according to any one of Items 57 to 77, wherein the ligase comprises a single-stranded nucleic acid ligase. (Item 79) 79. The reaction vessel according to any one of items 57 to 78, wherein the plurality of nucleic acids comprises RNA. (Item 80) 79. The reaction vessel according to any one of items 57 to 78, wherein the plurality of nucleic acids comprises cDNA or genomic DNA. (Item 81) 81. The reaction vessel according to any one of items 57 to 80, wherein the plurality of single-stranded nucleic acids are obtained from a low-quality nucleic acid source. (Item 82) 82. The reaction vessel of item 81, wherein the plurality of nucleic acids is obtained from a fixed sample. (Item 83) A flow cell comprising the reaction vessel according to any one of Items 57 to 82. (Item 84) 83. A system comprising the reaction vessel according to any one of items 57 to 82 and a detector for obtaining sequencing data. [Brief explanation of the drawings]

[0053] [Figure 1] 1 is a schematic diagram of a method for preparing a library of single-stranded nucleic acids according to one embodiment. The library may be prepared by dehybridizing double-stranded nucleic acids to form single-stranded nucleic acids, dephosphorylating the 5' ends of the single-stranded nucleic acids, ligating a P7' adapter containing a 3' protecting group to the 3' end of the single-stranded nucleic acids, rephosphorylating the 5' end of the ligated single-stranded nucleic acids, and ligating a P5 adapter containing an unphosphorylated 5' end to the 5' end of the ligated single-stranded nucleic acids.

[0054] [Figure 2] 2 is a schematic diagram of a method for preparing a library of single-stranded nucleic acids according to one embodiment. Double-stranded nucleic acids can be partially digested with a 5' exonuclease to form double-stranded nucleic acids with 3' overhangs, dehybridized to form single-stranded nucleic acids, a P7' adaptor containing a 3' protecting group can be ligated to the 3' end of the double-stranded nucleic acids with 3' overhangs, the ligated double-stranded nucleic acids with 3' overhangs can be dehybridized to form single-stranded nucleic acids, and a P5 adaptor containing a non-phosphorylated 5' end can be ligated to the 5' end of the ligated single-stranded nucleic acids.

[0055] [Figure 3]3 shows a schematic diagram of a method for preparing a library of single-stranded nucleic acids using beads, according to one embodiment. The library can be prepared by dephosphorylating the 5' ends of the single-stranded nucleic acids, ligating a P5' adapter containing a 3' protecting group to the 3' end of the single-stranded nucleic acids, hybridizing the first ligation product to a P5 capture probe attached to a bead, extending the capture probe, removing the hybridized first ligation product from the extended capture probe, and ligating a P7' adapter containing a 3' protecting group to the 3' end of the extended capture probe.

[0056] [Figure 4A] 4A is a schematic diagram of a method for preparing a library of circular single-stranded nucleic acids according to one embodiment. The library can be prepared by dehybridizing double-stranded nucleic acids to form single-stranded nucleic acids, dephosphorylating the 5'-ends of the single-stranded nucleic acids, ligating a linker comprising a P7' adaptor, a cleavable site ("U"), and a P5 adaptor having a 3'-protecting group ("R") to the 3'-end of the single-stranded nucleic acids, rephosphorylating the 5'-ends of the ligated single-stranded nucleic acids, deprotecting the 3'-ends of the ligated single-stranded nucleic acids, and circularizing the deprotected nucleic acids to form library members comprising circular single-stranded nucleic acids.

[0057] [Figure 4B] FIG. 4B is a schematic diagram showing that the circular nucleic acid of FIG. 4B can be linearized by cleaving the cleavable site (“U”) or amplified by PCR or by rolling circle amplification (RCA).

[0058] [Figure 5]Figure 5 is a schematic diagram of a method for preparing a library of single-stranded nucleic acids, including the embodiment shown in Figure 1. As shown in Figure 5, a capture probe having a P7 sequence hybridizes to a P7' adaptor ligated to a target nucleic acid and to excess unligated P7' adaptors. Hybridization of the capture probe to the unligated P7' adaptors inhibits ligation of the unligated P7' adaptors to other nucleic acids.

[0059] [Figure 6] 6 is a schematic diagram of a method for preparing a library of single-stranded nucleic acids according to one embodiment. The library may be prepared by dehybridizing double-stranded nucleic acids to form single-stranded nucleic acids, dephosphorylating the 5' ends of the single-stranded nucleic acids, ligating P7' adapters containing 3' protecting groups to the 3' ends of the single-stranded nucleic acids, removing excess unligated single-stranded P7' adapters by digestion with a 5' phosphate-dependent exonuclease and a 5' deadenylase, rephosphorylating the 5' ends of the ligated single-stranded nucleic acids, and ligating P5 adapters containing unphosphorylated 5' ends to the 5' ends of the ligated single-stranded nucleic acids.

[0060] [Figure 7] Figure 7 shows the results of an experiment to dephosphorylate the 5' end of a 60-mer single-stranded nucleic acid (3'OH-60-Phos5') and confirm that the product (3'OH-60-OH5') cannot form concatemers. The top panel is a schematic showing the dephosphorylation. The table outlines the conditions for the reaction performed and run on the gel shown in the bottom panel.

[0061] [Figure 8]Figure 8 shows the results of an experiment in which a 64-mer P7' adapter containing a 3' protecting group (3'C3-P7-phos5') was ligated to the 3' end of a dephosphorylated 60-mer single-stranded nucleic acid (3'OH-60-OH5'). The top panel is a schematic showing the ligation. The table outlines the conditions for the reaction performed and run on the gel shown in the bottom panel.

[0062] [Figure 9] Figure 9 shows the results of an experiment to rephosphorylate the 5' end of a 124-mer dephosphorylated single-stranded nucleic acid containing a ligated 64-mer adapter (3'C3-P7-60-OH) with a 3' protecting group. The top panel is a schematic showing the kinase reaction. The table outlines the conditions for the reaction performed and run on the gel shown in the bottom panel.

[0063] [Figure 10] Figure 10 shows the results of an experiment in which a 60-mer P5 adapter with an unphosphorylated 5' end (5'-P5-OH) was ligated to the 5' end of a 124-mer single-stranded nucleic acid (3'C3-60-B2-Phos). The 124-mer single-stranded nucleic acid contains a ligated 64-mer adapter with a 3' protecting group (3'C3-P7-phos5'). The top panel is a schematic showing the ligation. The table outlines the conditions for the reaction performed and run on the gel shown in the bottom panel.

[0064] [Figure 11] Figure 11 shows the results of an experiment in which a 64-mer P7' adapter containing a 3' protecting group (3'C3-P7-phos5') was ligated to the 3' end of single-stranded dephosphorylated cell-free DNA (cfDNA). The table outlines the conditions for the reaction performed and run on the gel shown in the bottom panel.

[0065] [Figure 12]Figure 12 shows the results of an experiment in which dephosphorylated cfDNA (cfDNA [Apex]) was treated with a kinase (PNK) and a 64-mer P7' adapter containing a 3' protecting group (3'C3-P7-phos5') was ligated to the 3' end of the rephosphorylated cfDNA. The table outlines the conditions for the reaction performed and run on the gel shown in the bottom panel.

[0066] [Figure 13] Figure 13 shows the results of an experiment in which a 64-mer P7' adapter containing a 3' protecting group (3'C3-P7-phos5') was ligated to the 3' end of dephosphorylated cfDNA, the resulting first ligation product (3'C3-P7-cfDNA-phos5') was treated with a kinase (PNK), and a 60-mer P5 adapter (5'-P5-OH) with an unphosphorylated 5' end was ligated to the 5' end of the first ligation product to form a second ligation product (P7'-cfDNA-P5). The table outlines the conditions for the reaction performed and run on the gel shown in the bottom panel.

[0067] [Figure 14] 14 shows a gel showing the ligation products of Example 2 and the amplification products from ligation products Extract B1 and Extract B2. In the "reference" lane, Extract B1 is marked by two black boxes and Extract B2 is marked by one white box.

[0068] [Figure 15] Figure 15 shows electropherograms of the amplified ligation products, Extract B1 and Extract B2. Peaks represent 126 bp primer dimer (P7'-P5), 292 bp (P7'-cfDNA-P5), and 480 bp (P7'-cfDNA-P5) species.

[0069] [Figure 16] FIG. 16 shows a gel showing the results of extracting amplification products using SPRI beads at various ratios.

[0070] [Figure 17] Figure 17 shows the results of an experiment in which a 63-mer P7' adapter containing a 3' protecting group (3'C3-P7'-Phos5') was ligated to the 3' end of single-stranded dephosphorylated cfDNA. The table outlines the conditions for the reaction performed and run on the gel shown in the bottom panel.

[0071] [Figure 18] Figure 18 shows the results of an experiment in which a 60-mer P5 adapter (5'-P5-OH) with an unphosphorylated 5' end was ligated to the 5' end of the first ligation product (3'C3-P7'-cfDNA-phos5') in the presence of a 63-mer P7 capture probe (3'C3-P7-C35') containing 5' and 3' protecting groups. The top panel is a schematic showing the ligation. The table outlines the conditions for the reaction performed and run on the gel shown in the bottom panel.

[0072] [Figure 19] Figure 19 shows electropherogram analysis of the amplified ligation products, Extract B1 and Extract B2. Peaks represent 126 bp primer dimer (P7'-P5), 292 bp (P7'-cfDNA-P5), and 480 bp (P7'-cfDNA-P5) species.

[0073] [Figure 20] Figure 20 shows a gel of the ligation products before amplification, after amplification, and after extraction with SPRI beads.

[0074] [Figure 21] Figure 21 shows the results of an experiment in which a 39-mer oligo 1 with a dephosphorylated 5' end (5'OH-oligo1-OH3') was ligated to a 37-mer oligo 2 with a phosphorylated 3' protecting group (5'phos-oligo2-phos3') in the presence of various concentrations of polyethylene glycol (PEG). The table outlines the conditions for the reaction performed and run on the gel shown in the bottom panel.

[0075] [Figure 22] Figure 22 shows the results of an experiment in which a 39 bp oligo 1 with a dephosphorylated 5' end (5'OH-oligo 1-OH3') was ligated to a 37 bp oligo 2 with a phosphorylated 3' protecting group (5'phos-oligo 2-phos3') using various oligo 1:oligo 2 ratios. The table outlines the conditions for the reactions performed and run on the gel shown in the bottom panel.

[0076] [Figure 23] Figure 23 shows the results of an experiment in which a 39 bp oligo 1 with a dephosphorylated 5' end (5'OH-oligo1-OH3') was ligated to a 37 bp oligo 2 with a phosphorylated 3' protecting group (5'phos-oligo2-phos3') using various amounts of ligase (CIRCLIGASE). The table outlines the conditions for the reaction performed and run on the gel shown in the bottom panel.

[0077] [Figure 24] Figure 24 shows the results of an experiment in which a 37-mer oligo 2 with a phosphorylated 3'-protecting group (5'phos-oligo 2-phos 3') was ligated to a 39-mer oligo 1 with a dephosphorylated 5'-end (5'OH-oligo 1-OH 3') conjugated to beads. The ligation product was assayed by cleavage from the beads using uracil-DNA glycosylase (UDG), which cuts at the uracil site in oligo 1. The table outlines the conditions for the reaction performed and run on the gel shown in the bottom panel.

[0078] [Figure 25] Figure 25 shows the results of an experiment in which a 37-mer oligo 2 with a phosphorylated 3' protecting group (5'phos-oligo2-phos3') was ligated to a 39-mer oligo 1 with a dephosphorylated 5' end (5'OH-oligo1-OH3') conjugated to beads in a final reaction volume with 45% PEG. The table outlines the conditions for the reaction performed and run on the gel shown in the bottom panel.

[0079] [Figure 26] Figure 26 shows a schematic diagram of a method for preparing a library of single-stranded nucleic acids using beads, according to one embodiment. The library can be prepared by dephosphorylating the 5' ends of the single-stranded nucleic acids, ligating a P5' adapter containing a 3' protecting group to the 3' end of the single-stranded nucleic acids, hybridizing the first ligation product to a P5 capture probe attached to a flow cell, extending the capture probe, removing the hybridized first ligation product from the extended capture probe, hybridizing a complementary primer, ligating a P7' adapter containing a 3' protecting group to the 3' end of the extended capture probe, and dehybridizing the complementary primer. DETAILED DESCRIPTION OF THE INVENTION

[0080] Detailed Description Embodiments of the systems, methods, and compositions provided herein relate to preparing a nucleic acid library. Some embodiments include ligating single-stranded nucleic acids to adaptors to prepare a library of nucleic acids from a small amount of source nucleic acid. Some embodiments include ligating double-stranded nucleic acids with 3' overhangs to adaptors to prepare a library of nucleic acids from a small amount of source nucleic acid. Some embodiments include ligating single-stranded nucleic acids to linkers comprising adaptors to prepare a library of circular nucleic acids from a small amount of source nucleic acid.

[0081] In one embodiment, single-stranded nucleic acids are prepared by reducing the likelihood of self-concatamerization of reactive species. For example, to ligate a 3' adapter to the 3' end of a single-stranded nucleic acid, the 3' adapter can have a protecting group that inhibits self-concatamerization. Similarly, the 5' end of the single-stranded nucleic acid can be dephosphorylated to inhibit self-concatamerization. The ligation product from this reaction will include a ligated single-stranded nucleic acid having a 3' protecting group. In some embodiments, ligation of a 3' adapter to the 3' end of a single-stranded nucleic acid has been found to be highly efficient and was performed in the presence of a volume-exclusion agent. The 5' end of a ligated single-stranded nucleic acid having a 3' protecting group can be dephosphorylated so that a 5' adapter can be ligated to its 5' end. To ligate a 5' adapter to the 5' end of a rephosphorylated ligated single-stranded nucleic acid having a 3' protecting group, the 5' adapter can have a dephosphorylated 5' end to inhibit self-concatamerization. The ligation product from this reaction will contain a single-stranded nucleic acid with a 5' adapter and a 3' adapter. The adapter may include a sequencing primer site, an amplification primer site, and an index. As used herein, "index" may include a sequence of nucleotides that can be used as a molecular identifier and / or barcode to tag a nucleic acid and / or identify the source of the nucleic acid. In some embodiments, the index may be used to identify a single nucleic acid or a subpopulation of nucleic acids. In some embodiments, a single-stranded nucleic acid library may be prepared in a single reaction vessel, in a single volume. Additionally, the embodiments provided herein may reduce the likelihood of primer-dimer products forming in subsequent amplification reactions.

[0082] An exemplary method according to one embodiment is outlined in Figure 1. As shown, the 5' end of a target single-stranded nucleic acid is dephosphorylated to prevent concatemer formation in the subsequent ligation step. A single-stranded ligase is used to ligate a first adaptor to the 3' end of the dephosphorylated target. The 3' end of the first adaptor may be blocked to prevent concatemer formation with the first adaptor. A kinase is used to rephosphorylate the 5' end of the ligation target, and a single-stranded ligase is used to ligate a second adaptor to the 5' end of the dephosphorylated target, thereby forming a library of nucleic acids. The 5' end of the second adaptor may be unphosphorylated to prevent concatemer formation with the second adaptor.

[0083] Another exemplary method according to one embodiment is outlined in Figure 2, in which an adaptor is ligated to a double-stranded nucleic acid having a 3' overhang. In some embodiments, a first adaptor may be ligated to the 3' end of the double-stranded nucleic acid having a 3' overhang. The 3' end of the first adaptor may be protected to prevent concatemer formation by the first adaptor. The double-stranded nucleic acid ligated to the first adaptor may be dehybridized to obtain multiple single-stranded nucleic acids. A second adaptor may be ligated to the 5' end of the single-stranded nucleic acid.

[0084] Another exemplary method according to one embodiment is outlined in FIG. 3 and involves preparing a library of nucleic acids using adapters attached to beads. In some such embodiments, a single-stranded ligase is used to ligate a first adapter to the 3' end of a dephosphorylated target. The ligated first adapter may be hybridized to a capture probe attached to a bead. The capture probe may be extended, and a second adapter may be ligated to the extended capture probe. Unligated single-stranded adapters may be removed by washing from the beads. Some embodiments for preparing a library of nucleic acids, including the use of adapters attached to beads, are useful for adding indexes to a nucleic acid library. For example, a first adapter comprising a first index may be attached to a bead, and a second adapter comprising a second index and a capture probe may be ligated to the first adapter. The target nucleic acid hybridized to the capture probe may be extended to incorporate the first and second indexes.

[0085] Another exemplary method according to one embodiment is outlined in Figure 4A, in which a linker comprising a first and second adaptor may be used to prepare a library of single-stranded circular nucleic acids. In some such embodiments, the linker may include a cleavable site between the first and second adaptors, such that cleavage of the cleavable site of the circular nucleic acid may result in a linear nucleic acid having the first adaptor at one end and the second adaptor at the other end of the linear nucleic acid.

[0086] In some embodiments, a primer site in the adapter sequence may be used to amplify a library of nucleic acids. In some embodiments, the efficiency of subsequent amplification steps may be reduced by the formation of primer-dimers. To increase the efficiency of subsequent amplification steps, unligated single-stranded adapters may be removed from the ligation product. An example, outlined in FIG. 5 and further described herein, involves removing unligated single-stranded first adapters by hybridization with a capture probe. Another example, outlined in FIG. 6 and further described herein, involves removing unligated single-stranded first adapters by digestion using a 5' phosphate-dependent exonuclease and a 5' deadenylase. Preparation of single-stranded libraries

[0087] Some embodiments of the systems, methods, and compositions provided herein include methods for ligating adaptors to target nucleic acids. Some embodiments provided herein for preparing nucleic acid libraries can advantageously be performed in a single reaction volume.

[0088] The adapter comprises a nucleic acid, such as a single-stranded nucleic acid. The adapter may comprise a short nucleic acid having a length less than, greater than, or equal to about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, or a range between any two of the aforementioned sizes. The adapter may comprise a sequencing primer binding site, an amplification primer binding site, and / or an index. For example, the adapter may comprise a P5 sequence, a P7 sequence, or their complements. The index may be useful for identifying the source of a nucleic acid molecule. Examples of the use and preparation of indexes useful in the embodiments provided herein can be found in International Publication Nos. 2012 / 061832 and 2014 / 142850; and U.S. Patent Nos. 9,074,251 and 8,829,171 (each of which is incorporated herein by reference in its entirety). In some embodiments, adapters may be modified to prevent concatemer formation, for example, by the addition of protecting groups at one or both ends that prevent extension of the adapter. A protecting group is any chemical moiety that prevents reaction of the compound to which it is attached during subsequent steps in the workflow, such as activation of the adapter by ligase, reaction with phosphate, and self-reaction. Examples of 3' protecting groups include a 3' spacer C3, a dideoxynucleotide, and attachment to a substrate. Further examples of 3' protecting groups include alkyls optionally substituted with one or more hydroxyl groups, thiols, azides, or alkynes. In some aspects, protecting groups may provide functionality useful for subsequent manipulations, such as enrichment, purification, further functionalization, etc. Examples of 5' protecting groups include a dephosphorylated 5' nucleotide and attachment to a substrate (e.g., when the protecting group is a substrate optionally attached via a linker).

[0089] Target nucleic acids include single-stranded and double-stranded nucleic acids. Methods for dehybridizing double-stranded nucleic acids to form single-stranded nucleic acids are well known in the art, including thermal or chemical methods. Examples of target nucleic acids include DNA, such as genomic DNA or cDNA; RNA, such as mRNA, sRNA, or rRNA; or hybrids of DNA and RNA. Nucleic acids can contain phosphodiester bonds and other types of backbones, including, for example, phosphoramide, phosphorothioate, phosphorodithioate, O-methylphosphoramidite, and peptide nucleic acid backbones and bonds. Nucleic acids can contain any combination of deoxyribonucleotides and ribonucleotides, as well as any combination of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, isoguanine, and base analogs, such as nitropyrrole (including 3-nitropyrrole) and nitroindole (including 5-nitroindole). In some embodiments, nucleic acids may contain at least one non-specific base. Non-specific bases can base pair with more than one different type of base, and may be useful, for example, when included in oligonucleotide primers or inserts used for random hybridization in complex nucleic acid samples, such as genomic DNA samples. Examples of non-specific bases include inosine, which can base pair with adenine, thymine, or cytosine. Other examples include hypoxanthine, 5-nitroindole, acylated 5-nitroindole, 4-nitropyrazole, 4-nitroimidazole, and 3-nitropyrrole. Non-specific bases that can base pair with at least two, three, four, or more types of bases may be used.

[0090] The target nucleic acid may comprise a sample in which the average size of double-stranded nucleic acids in the sample is less than, greater than, or equal to about 2 kb, 1 kb, 500 bp, 400 bp, 200 bp, 100 bp, or 50 bp, or in a range between any two of the aforementioned sizes. In some embodiments, the average size of single-stranded nucleic acids in the sample is less than, greater than, or equal to about 2000 nucleotides, 1000 nucleotides, 500 nucleotides, 400 nucleotides, 200 nucleotides, 100 nucleotides, or 50 nucleotides, or in a range between any two of the aforementioned sizes. The sample may comprise an amount of target nucleic acid that is less than, greater than, or equal to about 50 μg, 10 μg, 5 μg, 1 μg, 500 ng, 400 ng, 200 ng, 100 ng, 50 ng, or 10 ng, or in a range between any two of the aforementioned amounts. The target nucleic acid may be obtained from a low-quality nucleic acid source, such as a degraded sample, such as a fixed sample or an ancient sample. Examples of fixed samples include those fixed with compounds such as formalin, glutaraldehyde, alcohol, osmic acid, and paraformaldehyde. Fixed samples may include formalin-fixed paraffin-embedded (FFPE) samples. Ancient samples may include those that are approximately 5, 10, 20, 50, 100, 500, or more than 1000 years old, or between any two of the aforementioned years.

[0091] Methods for dephosphorylating a nucleic acid, e.g., a 5' nucleotide of a nucleic acid, include contacting the nucleic acid with a phosphatase. Exemplary phosphatases include calf intestinal phosphatase, shrimp alkaline phosphatase, Antarctic phosphatase, and APEX alkaline phosphatase (Epicentre, Madison, WI).

[0092] A method for ligating single-stranded nucleic acids includes contacting the single-stranded nucleic acid with a ligase. Examples of single-stranded ligases include T4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, Methanobacterium RNA ligase, and TS2126 RNA ligase (CIRCLIGASE; Epicentre, Madison, WI). A method for ligating two nucleic acids together can be by reducing the reaction volume in the presence of a volume-excluding agent. As used herein, "volume-excluding agent" can include an agent that reduces the effective volume in which a reaction, such as a ligation reaction, can occur. Examples of volume-excluding agents include polymers, such as inert polymers, such as polyethylene glycol (PEG), ficoll, dextran, hetastarch, and polyvinylpyrrolidone. Examples of PEGs useful in the embodiments provided herein include PEG600, PEG800, PEG1000, PEG6000, and PEG8000. The reaction volume may contain a concentration, e.g., (weight / volume), of volume-excluding agent that is less than, greater than, or equal to about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or a range between any two of the foregoing percentages.

[0093] A method for phosphorylating a nucleic acid, e.g., the 5' nucleotide of a nucleic acid, includes contacting the nucleic acid with a kinase. Exemplary kinases include T4 polynucleotide kinase.

[0094] Some embodiments provided herein can be carried out in a single reaction volume. In some embodiments, the method for preparing nucleic acids can be carried out within a short period of time, for example, less than about 12 hours, less than about 6 hours, or less than about 3 hours.

[0095] In one embodiment, shown in Figure 1, target double-stranded DNA fragments are dephosphorylated and denatured to form target single-stranded DNA. A ligase, such as CIRCLIGASE™ (Lucigen Corporation, Middleton, WI), is used to ligate a first 64-bp adapter containing a phosphorylated 5' end, a P7' sequence, and a protected 3' end to the 3' end of the target single-stranded DNA to form ligated DNA. A kinase, such as T4 polynucleotide kinase, is used to phosphorylate the 5' end of the ligated DNA. A second 60-bp adapter containing a P5 sequence is ligated to the 5' end of the phosphorylated ligated DNA to form a member of the DNA library (5'-P5-ssDNA insert-P7-3'). Exemplary primer sequences may include the P5 primer sequence (SEQ ID NO: 1: aatgatacggcgaccaccga); the P5' primer sequence (SEQ ID NO: 2: tcggtggtcgccgtatcatt); the P7 primer sequence (SEQ ID NO: 3: caagcagaagacggcatacga); and the P7' primer sequence (SEQ ID NO: 4: tcgtatgccgtcttctgcttg).

[0096] In some embodiments, a method for preparing a library of nucleic acids may include dephosphorylating the 5' end of a target single-stranded nucleic acid to prevent the formation of concatemers in a subsequent ligation step; ligating a first adaptor to the 3' end of the dephosphorylated target using a single-stranded ligase (wherein the 3' end of the first adaptor is protected); rephosphorylating the 5' end of the ligation target; and ligating a second adaptor to the 5' end of the dephosphorylated target using a single-stranded ligase (wherein the 5' end of the second adaptor is not phosphorylated), thereby obtaining a library of nucleic acids. In some embodiments, the second adaptor is attached to a substrate. In some embodiments, the substrate comprises beads.

[0097] Some embodiments include removing the unligated single-stranded first adaptor before ligating the second adaptor to the 5' end of the dephosphorylated target. In some embodiments, the unligated single-stranded first adaptor may be hybridized to a capture probe. In some embodiments, the capture probe comprises a sequence complementary to at least a portion of the first adaptor. In some such embodiments, hybridization to the capture probe inhibits ligation of the unligated first adaptor to the single-stranded second adaptor. In some embodiments, the 3' end of the capture probe comprises a protecting group. In some embodiments, the 5' end of the capture probe comprises a protecting group. In some embodiments, the unligated single-stranded first adaptor may be removed by digestion. In some embodiments, digesting the unligated single-stranded first adaptor comprises contacting the unligated single-stranded first adaptor with a 5' phosphate-dependent exonuclease, and optionally with a 5' deadenylase.

[0098] Another embodiment is shown in Figure 2, in which a 5' exonuclease is used to partially digest a double-stranded target nucleic acid to form a double-stranded nucleic acid with a single-stranded 3' overhang. A ligase, such as CIRCLIGASE™, is used to ligate a first 64-bp adapter containing a phosphorylated 5' end, a P7' sequence, and a protected 3' end to the 3' end of the target double-stranded DNA to form a ligated DNA. The ligated DNA is dehybridized to form a single-stranded nucleic acid. A second 60-bp adapter containing a P5 sequence is ligated to the 5' end of the phosphorylated ligated DNA to form a member of the DNA library (5'-P5-ssDNA insert-P7-3').

[0099] In some embodiments, a method for preparing a library of nucleic acids may include contacting a target double-stranded nucleic acid with a 5' exonuclease to obtain a plurality of modified double-stranded nucleic acids having single-stranded 3' overhangs; ligating a first adaptor to the 3' end of the modified double-stranded nucleic acid in the presence of a ligase and a volume-exclusion agent, wherein the 3' end of the first adaptor comprises a protecting group; dehybridizing the modified double-stranded nucleic acid ligated to the first adaptor to obtain a plurality of single-stranded nucleic acids; and ligating a second adaptor to the 5' end of the single-stranded nucleic acid in the presence of a ligase, thereby obtaining a library of nucleic acids.

[0100] In one embodiment, shown in Figure 3, alkaline phosphatase is used to dephosphorylate target single-stranded DNA. A ligase, e.g., CIRCLIGASE™, is used to ligate a first adapter containing a phosphorylated 5' end, a P5' sequence, and a protected 3' end to the 3' end of the target single-stranded DNA to form ligated DNA. The ligated DNA is hybridized via the first adapter to a capture probe containing a P5 sequence and attached to a bead. The capture probe is extended to form extended DNA, and the ligated DNA is removed from the extended DNA. A ligase, e.g., CIRCLIGASE™, is used to ligate a second adapter containing a phosphorylated 5' end, a P7' sequence, and a protected 3' end to the 3' end of the extended DNA to form a DNA library member (P5-insert'-P7') attached to a bead.

[0101] In some embodiments, a method for preparing a library of nucleic acids may include dephosphorylating the 5' end of a target single-stranded nucleic acid; ligating a first adaptor to the 3' end of the single-stranded nucleic acid in the presence of a ligase and a volume exclusion agent, where the 3' end of the first adaptor comprises a protecting group; hybridizing the ligated first adaptor to a capture probe; extending the capture probe, and ligating a second adaptor to the 3' end of the extended capture probe in the presence of a ligase, where the 3' end of the second adaptor comprises a protecting group, thereby obtaining a library of nucleic acids. Some embodiments also include removing the hybridized ligated first adaptor from the extended capture probe. In some embodiments, the capture probe is attached to a substrate. In some embodiments, the substrate bearing the capture probe is a flow cell, bead, glass, controlled pore glass, plastic, silicon, fused silica, silicon dioxide, silicon nitride, silicon derivatives, gallium arsenide, indium phosphide, aluminum, ceramic, polyimide, quartz, resin, or polymer or copolymer (e.g., polystyrene). The substrate can be composed of multiple layers of materials or a mixture of materials. The substrate can be rigid or semi-rigid. The substrate can be plate-like, round, or textured. In some embodiments, the substrate can be a rigid material, such as glass and / or silica derivatives, with one or more polymeric materials coated thereon. In some embodiments, the substrate comprises a bead. In some embodiments, the capture probe comprises a capture probe index. In some embodiments, the capture probe index indicates the source of the capture probe. In some embodiments, the capture probe comprises a cleavable linker. Some embodiments also include cleaving the cleavable linker. In some embodiments, the capture probe is attached to a substrate, such as a flow cell (see Figure 26), and then extension is performed on the substrate. If the substrate is a flow cell, the resulting library can be sequenced directly.In some embodiments, the method further comprises hybridizing a complementary primer to the extended capture probe, ligating a P7' adapter containing a 3' protecting group to the 3' end of the extended capture probe, and dehybridizing the complementary primer, for example as shown in Figure 26.

[0102] In one embodiment, shown in FIG. 4A, target double-stranded DNA fragments are dephosphorylated and denatured to form target single-stranded DNA. An adapter is provided, comprising a phosphorylated 5' end, a P7' sequence, a cleavable site ("U"), a P5 sequence, and a protected 3' end ("R") from 5' to 3'. The adapter is ligated to the 3' end of the target single-stranded DNA using a ligase to form a ligated DNA. The 5' end of the ligated DNA is phosphorylated using a kinase. The protected 3' end of the ligated DNA is deprotected, and the ligated DNA is circularized by ligation with the ligase to form a library member containing circular single-stranded DNA. In some embodiments, the circular nucleic acid can be used to generate single-stranded nucleic acids by any one of a variety of techniques. Some exemplary embodiments are shown in FIG. 4B, where the circular nucleic acid can be linearized by cleaving the cleavable site, which may include a uracil residue. Alternatively, the circular nucleic acid can be used to generate single-stranded nucleic acids by amplification, e.g., PCR, using a primer site within the adapter. Additionally, circular nucleic acids can be amplified by rolling circle amplification (RCA).

[0103] In some embodiments, a method for preparing a library of nucleic acids may include dephosphorylating the 5' end of a target single-stranded nucleic acid; ligating a linker to the 3' end of the single-stranded nucleic acid (wherein the linker comprises a first adaptor and a second adaptor, and the 3' end of the linker comprises a protecting group); phosphorylating the 5' end of the ligated single-stranded nucleic acid; deprotecting the 3' end of the phosphorylated nucleic acid, and circularizing the deprotected nucleic acid by ligation, thereby obtaining a library of circular nucleic acids.

[0104] In some embodiments, the linker comprises a cleavable site between the first adaptor and the second adaptor. In some such embodiments, cleavage of the circular nucleic acid at the cleavable site can result in a linear nucleic acid having the first adaptor at one end and the second adaptor at the other end of the linear nucleic acid. In some embodiments, the cleavable site includes a restriction site, a site containing at least one uracil residue, and a site containing an atypical base, such as 8-oxoguanine and a dithiol group. Some embodiments include linearizing the circular nucleic acid by cleavage at the cleavable site. Examples of cleavage of the cleavable site include contacting the site with a uracil-specific excision reagent, such as an enzyme selected from uracil DNA glycosylase (UDG) and DNA glycosylase-lyase endonuclease VIII, or a mixture thereof, or contacting the site with a restriction endonuclease.

[0105] Some embodiments also include amplifying the circular nucleic acid by hybridizing primers to the first and second adaptors. Examples of amplification methods include PCR, rolling circle amplification (RCA), and cluster amplification. In some such embodiments, RCA amplification can be performed in solution, or the circular single-stranded nucleic acid can be captured and amplified on a surface, such as the surface of a flow cell. In some embodiments, amplification includes contacting the circular nucleic acid with a polymerase that forms a linear product by contacting the uracil residue in the template. Exemplary polymerases include Pyrococcus-like proofreading polymerases, such as PHUSION DNA polymerase.

[0106] Some embodiments include a method for preparing a single-stranded nucleic acid library, the method comprising: (a) obtaining a plurality of single-stranded nucleic acids; (b) contacting the single-stranded nucleic acids with APEX alkaline phosphatase, thereby dephosphorylating the 5' ends of the single-stranded nucleic acids; (c) ligating a first adaptor to the 3' end of the single-stranded nucleic acid in a reaction volume comprising TS2126 RNA ligase (Lucigen Corporation, Middleton, WI) and at least 45% (w / v) polyethylene glycol (PEG), wherein the 3' end of the first adaptor comprises a 3' spacer C3 protecting group; (d) contacting the ligated single-stranded nucleic acid with T4 polynucleotide kinase, thereby phosphorylating the 5' end of the ligated single-stranded nucleic acid; and (e) ligating a second adaptor to the 5' end of the phosphorylated ligated single-stranded nucleic acid in the presence of ligase and PEG, wherein the 5' end of the second adaptor is not phosphorylated, thereby obtaining a library of nucleic acids.

[0107] Some embodiments include a method for preparing a single-stranded nucleic acid library, comprising: (a) obtaining a plurality of double-stranded nucleic acids; (b) contacting the double-stranded nucleic acids with a 5' exonuclease to obtain a plurality of modified double-stranded nucleic acids having single-stranded 3' overhangs; and (c) detecting TS2126. (d) ligating a first adaptor to the 3' end of the modified double-stranded nucleic acid in a reaction volume comprising an RNA ligase and at least 45% (w / v) polyethylene glycol (PEG), wherein the 3' end of the first adaptor comprises a 3' spacer C3 protecting group; (d) dehybridizing the modified double-stranded nucleic acid ligated to the first adaptor to obtain a plurality of single-stranded nucleic acids; and (e) ligating a second adaptor to the 5' end of the single-stranded nucleic acid in the presence of a ligase and PEG, wherein the 5' end of the second adaptor is not phosphorylated, thereby obtaining a library of nucleic acids.

[0108] Some embodiments include a method for preparing a single-stranded nucleic acid library, comprising: (a) obtaining a plurality of single-stranded nucleic acids; (b) contacting the single-stranded nucleic acids with APEX alkaline phosphatase, thereby dephosphorylating the 5' ends of the single-stranded nucleic acids; and (c) contacting the single-stranded nucleic acids with TS2126. (d) contacting the ligated single-stranded nucleic acid with T4 polynucleotide kinase, thereby phosphorylating the 5' end of the ligated single-stranded nucleic acid; (e) removing unligated single-stranded first adaptors from the ligated single-stranded nucleic acid by hybridizing the single-stranded first adaptors with a capture probe, wherein the capture probe comprises a 3' end comprising a 3' spacer C3 protecting group, an unphosphorylated 5' end, and a sequence complementary to at least a portion of the first adaptor; and (f) ligating a second adaptor to the 5' end of the phosphorylated ligated single-stranded nucleic acid in the presence of ligase and PEG, wherein the 5' end of the second adaptor is not phosphorylated, thereby obtaining a library of nucleic acids.

[0109] Some embodiments provide a method for preparing a bead-attached nucleic acid library, comprising: (a) obtaining a plurality of single-stranded nucleic acids; (b) contacting the single-stranded nucleic acids with APEX alkaline phosphatase, thereby dephosphorylating the 5' ends of the single-stranded nucleic acids; (c) ligating a first adaptor to the 3' end of the single-stranded nucleic acids in a reaction volume comprising TS2126 RNA ligase and at least 45% (w / v) polyethylene glycol (PEG), wherein the 3' end of the first adaptor comprises a 3' spacer C3 protecting group; (d) hybridizing the ligated first adaptor to a capture probe, wherein the capture probe is attached to a bead; (e) extending the capture probe; and (f) ligating a second adaptor to the 3' end of the extended capture probe in the presence of ligase and PEG, wherein the 5' end of the second adaptor is not phosphorylated, thereby obtaining a library of nucleic acids.

[0110] Some embodiments provide a method for preparing an indexed nucleic acid library, comprising: (a) obtaining a plurality of first single-stranded nucleic acids comprising a first index (wherein the 5' ends of the first single-stranded nucleic acids are attached to a plurality of beads) and a plurality of second single-stranded nucleic acids comprising a second index and a capture probe (wherein the 3' ends of the second single-stranded nucleic acids comprise a 3' spacer C3 protecting group); (b) ligating the 3' ends of the first single-stranded nucleic acids to the 5' ends of the second single-stranded nucleic acids in a reaction volume comprising TS2126 RNA ligase and at least 45% (w / v) polyethylene glycol (PEG); (c) hybridizing target nucleic acids to the capture probes; and (d) extending the target nucleic acids, thereby obtaining a library of indexed nucleic acids. Removal of unligated single-stranded adapters

[0111] Some embodiments of the systems, methods, and compositions provided herein include removing single-stranded, unligated adaptors from ligated adaptors, e.g., adaptors ligated to single-stranded nucleic acids. In some embodiments, removing single-stranded, unligated adaptors from ligated adaptors can increase the efficiency of amplifying a prepared nucleic acid library (e.g., by reducing the likelihood or amount of primer-dimer formation in a subsequent amplification step).

[0112] Some embodiments include a system or method for removing single-stranded unligated adapters, which may include hybridizing the single-stranded unligated adapters to a capture probe. One embodiment is shown in FIG. 5, in which target double-stranded DNA fragments are dephosphorylated and denatured to form target single-stranded DNA. A ligase is used to ligate a first 64-bp adapter containing a phosphorylated 5' end, a P7' sequence, and a protected 3' end to the 3' end of the target single-stranded DNA to form ligated DNA. A kinase, such as T4 polynucleotide kinase, is used to phosphorylate the 5' end of the ligated DNA. The unligated first adapter is removed from the ligated DNA by hybridization to a capture probe containing a P7 sequence. A second 60-bp adapter containing a P5 sequence is ligated to the 5' end of the phosphorylated ligated DNA to form a member of the DNA library (5'-P5-ssDNA insert-P7-3'). In some such embodiments, hybridization to the capture probe can inhibit ligation of the unligated first adaptor to the single-stranded second adaptor. In some embodiments, the capture probe can comprise the complement of at least a portion of the single-stranded unligated adaptor. In some embodiments, the capture probe can comprise 3' and / or 5' protecting groups to prevent concatemer formation. In some embodiments, the capture probe can be attached to a substrate, such as a bead.

[0113] Some embodiments for removing single-stranded unligated adapters may include digesting the single-stranded unligated adapters. Some such embodiments may include contacting the single-stranded unligated adapters with a nuclease, such as a 5' phosphate-dependent exonuclease, such as TERMINATOR (Epicentre, Madison, WI). One embodiment is shown in Figure 6, in which the target double-stranded DNA fragments are dephosphorylated and denatured to form target single-stranded DNA. A ligase is used to ligate a first 64-bp adapter containing a phosphorylated 5' end, a P7' sequence, and a protected 3' end to the 3' end of the target single-stranded DNA to form ligated DNA. The unligated first adapter is removed by digestion with a 5' phosphate-dependent exonuclease and a 5' deadenylase. The 5' end of the ligated DNA is phosphorylated using a kinase, such as T4 polynucleotide kinase. A second 60 bp adaptor containing the P5 sequence is ligated 5' to the phosphorylated ligated DNA to form a member of the DNA library (5'-P5-ssDNA insert-P7-3').

[0114] Some embodiments of removing single-stranded, unligated adapters may include the use of beads. Advantageously, the use of beads may include washing the components of the reaction from the beads and the components attached to the beads. In some embodiments, a first adapter may be ligated to the 3' end of the dephosphorylated single-stranded nucleic acid. The first adapter may include a 3' protecting group and may include a target sequence. The target sequence may be hybridized to a capture probe attached to a substrate. In some embodiments, the substrate may include beads. The capture probe may include a sequencing primer site, an index, and an amplification primer site. The single-stranded, unligated adapter may be washed from the substrate and the hybridized, ligated, single-stranded nucleic acid. The capture probe may be extended. In some embodiments, the hybridized, ligated, single-stranded nucleic acid may be removed from the extended capture probe. A second adapter may be ligated to the 5' end of the extended capture probe. In some embodiments, the second adapter includes a protecting group at its 3' end. The second adapter may include a sequencing primer site, an index, and an amplification primer site. Preparation of indexed libraries

[0115] Some embodiments of the systems, methods, and compositions provided herein include a method for preparing an indexed nucleic acid library. The adapter and / or capture probe may include an index. Examples of the use and preparation of indexes useful in the embodiments provided herein can be found in International Publication Nos. 2012 / 061832 and 2014 / 142850; and U.S. Patent Nos. 9,074,251 and 8,829,171 (each of which is incorporated herein by reference in its entirety). In some embodiments, the index may be incorporated into the target nucleic acid by ligation. In some embodiments, the index may be incorporated into the nucleic acid by extension of the capture probe, adapter, or target nucleic acid. Thus, the methods provided herein can easily prepare an indexed library.

[0116] In some embodiments, a population of capture probes can be prepared. In some embodiments, the capture probes can be prepared by ligating a first adaptor to a second adaptor. Each adaptor can include an index. The first adaptor can be attached to a substrate, such as a bead. The second adaptor can include a hybridization probe. The hybridization probe can hybridize to a target single-stranded nucleic acid. The target single-stranded nucleic acid can be hybridized to the hybridization probe and extended, thereby incorporating a sequence complementary to one or more of the adaptor's indexes.

[0117] Some embodiments may include obtaining a plurality of first adaptors comprising a first index (wherein the 5' end of the first adaptor comprises a 5' protecting group) and a plurality of second adaptors comprising a second index and a capture probe (wherein the 3' end of the second adaptor comprises a 3' protecting group). Some embodiments also include ligating the 3' end of the first single-stranded nucleic acid to the 5' end of the second single-stranded nucleic acid in the presence of a ligase. Some embodiments also include hybridizing the target nucleic acid to the capture probe. Some embodiments also include extending the target nucleic acid, thereby obtaining a library of indexed nucleic acids. Some embodiments also include amplifying the extended target nucleic acid. In some embodiments, the 5' protecting group comprises a dephosphorylated nucleotide or attachment to a substrate. In some embodiments, the substrate comprises a plurality of beads. Kits, reaction vessels, flow cells

[0118] Embodiments of the systems and methods provided herein include kits, reaction vessels, and flow cells containing any one or more components useful for preparing a nucleic acid library by ligating an adaptor to nucleic acids, such as single-stranded and / or double-stranded nucleic acids. Exemplary components include a first adaptor (wherein the 3' end of the first adaptor comprises a protecting group), a ligase, a volume exclusion agent, a dephosphorylation agent, a second adaptor (wherein the 5' end of the second adaptor comprises a protecting group), a sequencing primer, an amplification primer, an index-containing nucleic acid, and a 5' exonuclease. In some embodiments, the kit may include reagents for any of the methods provided herein. In some embodiments, the kit may include a reaction vessel. In some embodiments, the kit may include a flow cell containing the reaction vessel.

[0119] Some embodiments include a reaction vessel containing a reaction volume in which the methods provided herein can be performed. In some such embodiments, the reaction vessel can contain components of any stage or step of the methods provided herein. In some embodiments, the reaction vessel can contain multiple nucleic acids, such as single-stranded nucleic acids and / or double-stranded nucleic acids; a first adaptor (wherein the 3' end of the first adaptor comprises a protecting group); a ligase; and a volume exclusion agent. In some embodiments, the reaction vessel can also contain a second adaptor. In some embodiments, the reaction vessel can also contain a dephosphorylation agent.

[0120] In some embodiments, the reaction vessel may include a reaction volume. In some embodiments, the reaction volume may include a plurality of nucleic acids, such as single-stranded nucleic acids and / or double-stranded nucleic acids; a first adaptor (wherein the 3' end of the first adaptor comprises a protecting group); a second adaptor; a dephosphorylation agent; a ligase; and a volume exclusion agent. In some embodiments, the reaction volume may include a plurality of first single-stranded nucleic acids comprising a first index (wherein the 5' end of the first single-stranded nucleic acid comprises a 5' protecting group); a plurality of second single-stranded nucleic acids comprising a second index and a capture probe (wherein the 3' end of the second single-stranded nucleic acid comprises a 3' protecting group); and a ligase.

[0121] In some embodiments, a first adaptor is ligated to the 3'-end of a plurality of single-stranded nucleic acids, thereby forming a plurality of modified single-stranded nucleic acids. In some embodiments, a non-ligated first adaptor is hybridized to a capture probe. In some embodiments, the capture probe comprises a sequence complementary to at least a portion of the first adaptor.

[0122] In some embodiments, the 5' end of the second adaptor is not phosphorylated. In some embodiments, the second adaptor is ligated to the 5' ends of the multiple modified single-stranded nucleic acids. In some embodiments, the dephosphorylation agent comprises a phosphatase. In some embodiments, the phosphatase is inactivated. Examples of phosphatases include calf intestinal phosphatase, shrimp alkaline phosphatase, Antarctic phosphatase, and APEX alkaline phosphatase.

[0123] In some embodiments, the first adaptor and / or the second adaptor can comprise a sequencing primer binding site. Examples of sequencing binding sites include the P7 sequence, its complement or its reverse complement; and the P5 sequence, its complement or its reverse complement.

[0124] In some embodiments, the first adaptor and / or the second adaptor can comprise an adaptor index. In some embodiments, the first adaptor index is different from the second adaptor index. In some embodiments, the adaptor index indicates a source of multiple single-stranded nucleic acids.

[0125] Some embodiments provided herein include a reaction vessel including a reaction volume containing: a plurality of first single-stranded nucleic acids comprising first indices (wherein the 5' ends of the first single-stranded nucleic acids comprise a 5' protecting group); a plurality of second single-stranded nucleic acids comprising second indices and capture probes (wherein the 3' ends of the second single-stranded nucleic acids comprise a 3' protecting group); and a ligase.

[0126] In some embodiments, the protecting group comprises a 3' spacer C3, a dideoxynucleotide, or a phosphate group. In some embodiments, the protecting group can comprise attachment to a substrate. Examples of substrates include beads.

[0127] In some embodiments, the volume exclusion agent is selected from the group consisting of polyethylene glycol (PEG), dextran, hetastarch, ficoll, and polyvinylpyrrolidone. Examples of PEG useful in the embodiments provided herein include PEG600, PEG800, PEG1000, PEG6000, and PEG8000. The reaction volume may contain a concentration, e.g., (weight / volume), of the volume exclusion agent that is less than, greater than, or equal to about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or a range between any two of the foregoing percentages.

[0128] In some embodiments, the ligase comprises a single-stranded nucleic acid ligase. Examples of single-stranded nucleic acid ligases include T4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, Methanobacterium RNA ligase, and TS2126 RNA ligase (CIRCLIGASE).

[0129] Some embodiments provided herein include a flow cell including a reaction vessel provided herein. Some embodiments include a system including a reaction vessel provided herein and a detector for obtaining sequencing data.

[0130] Flow cell can comprise a chamber with a surface through which one or more fluid reagents can flow.Generally, flow cell will have an inlet opening and an outlet opening for facilitating fluid flow.Examples of flow cell and related fluid system and detection platform that can be easily used in the method of the present disclosure are described in, for example, Bentley et al., Nature 456:53-59 (2008), WO 04 / 018497; U.S. Patent No. 7,057,026; WO 91 / 06678; WO 071123744; U.S. Patent No. 7,329,492; U.S. Patent No. 7,211,414; U.S. Patent No. 7,315,019; U.S. Patent No. 7,405,281 and U.S. Patent Application Publication No. 2008 / 0108082 (each of which is incorporated herein by reference in its entirety). [Example]

[0131] Example 1 - Ligation of an adapter to a single-stranded target nucleic acid A four-step single-stranded DNA (ssDNA) library preparation method was performed using single-stranded DNA as the target nucleic acid. Figure 1 provides an overview of the four steps, including 5' dephosphorylation of the target nucleic acid; ligation of a 3' adapter to the 3' end of the target nucleic acid (where the 3' end of the 3' adapter is protected to prevent self-concatamerization); rephosphorylation of the 5' dephosphorylated ligation target nucleic acid; and ligation of a 5' adapter to the 5' end of the ligation target nucleic acid (where the 5' end of the 5' adapter is protected to prevent self-concatamerization).

[0132] To examine the dephosphorylation step, the 5' end of a 60-mer single-stranded nucleic acid (3'OH-60-Phos5') was dephosphorylated using the alkaline phosphatase APEX Phosphatase (Epicentre, Madison, WI) in a reaction volume containing 25% polyethylene glycol (PEG). The extent of 5' dephosphorylation was assayed using the single-stranded ligase CIRCLIGASE™ Ligase (Lucigen Corporation, Middleton, WI) to confirm that the dephosphorylated product did not form concatemers. As shown in Figure 7, the dephosphorylation efficiency of alkaline phosphatase was approximately 100%.

[0133] To investigate the first ligation step, a 64-mer P7' adapter containing a 3'-protecting group (3'C3-P7-phos5') was ligated to the 3' end of a dephosphorylated 60-mer single-stranded nucleic acid (3'OH-60-OH5') using CIRCLIGASE in a reaction volume containing 25% PEG. The 3' end of the P7' adapter was protected to prevent self-concatamerization. As shown in Figure 8, the yield of this ligation step (lane 2) was determined to be 97.5%.

[0134] To investigate the kinase step, T4 polynucleotide kinase (PNK) was used to re-dephosphorylate the 5' end of a 124-mer dephosphorylated single-stranded nucleic acid containing a ligated 64-mer adapter (3'C3-P7-60-OH) with a 3' protecting group. As shown in Figure 9, the rephosphorylation was determined to have a yield of approximately 99%.

[0135] To investigate the second ligation step, a 60-mer P5 adapter with an unphosphorylated 5' end (5'P5-OH) was ligated to the 5' end of a 124-mer single-stranded nucleic acid (3'C3-60-B2-Phos) using CIRCLIGASE in a reaction volume containing 1.6% PEG. The 124-mer single-stranded nucleic acid contained a ligated 64-mer adapter with a 3' protecting group (3'C3-P7-phos5'). As shown in Figure 10, the yield of this ligation step (lane 2) was determined to be >85%. Therefore, the overall yield of the four-step ssDNA library preparation approach was >80%. Example 2 - Ligation of adapters to cell-free target nucleic acids

[0136] The scheme outlined in Figure 1 was performed using cell-free DNA (cfDNA). The double-stranded target nucleic acid was dephosphorylated and dehybridized using APEX alkaline phosphatase to form single-stranded target nucleic acid. To examine the first ligation step, a 64-mer P7' adapter containing a 3' protecting group (3'C3-P7-phos5') was ligated to the 3' end of single-stranded dephosphorylated cell-free DNA (cfDNA) using CIRCLIGASE for 3 hours in a reaction volume containing 22.5% PEG. As shown in Figure 11, the yield of this ligation step (lane 2) was determined to be greater than 95%.

[0137] To investigate the kinase step, dephosphorylated cfDNA (cfDNA [Apex]) was treated with T4 polynucleotide kinase (PNK), and a 64-mer P7' adapter containing a 3' protecting group (3'C3-P7-phos5') was ligated to the 3' end of the rephosphorylated cfDNA. The reaction was carried out for 1 hour in a volume containing 11.25% PEG (Figure 12).

[0138] To investigate the second ligation step, a 64-mer P7' adapter containing a 3'-protecting group (3'C3-P7-phos5') was ligated to the 3' end of dephosphorylated cfDNA, and the resulting first ligation product (3'C3-P7-cfDNA-phos5') was treated with kinase (PNK). A 60-mer P5 adapter with an unphosphorylated 5' end (5'P5-OH) was ligated to the 5' end of the first ligation product to form the second ligation product (P7'-cfDNA-P5). The reaction was performed using CIRCLIGASE in a reaction volume containing 3.8% PEG. Figure 13 shows the ligation products (P7'-cfDNA-P5) and (P7'-P5). Example 3 - Analysis of ligation products

[0139] The ligation products of Example 2 were separated on a gel, the ligation product bands were extracted from the gel, the extracted ligation products were amplified, and the amplified products were separated using capillary electrophoresis (BioAnalyzer, Agilent).

[0140] The ligation products were separated on a gel, and bands B, extract B1 and extract B2, were excised from the gel. As shown in Figure 14, in lane "Reference," extract B1 is marked by two black boxes, and extract B2 is marked by one white box. The extracts were amplified for 24 cycles by PCR containing non-PCR (non-amplifiable) P7 primers at a ratio of 1:40 to 1:20 relative to the PCR P7 primers. The PCR products were extracted using solid-phase reversible immobilization (SPRI) beads at a 2:1 ratio relative to the sample. The results are shown in Figure 14.

[0141] The amplification products of extracts B1 and B2 were further analyzed by capillary electrophoresis (BioAnalyser, Agilent). As shown in Figure 15, extract B2 mainly contained 127 bp (P7'-P5) species, and extract B1 contained 292 bp (P7'-cfDNA-P5) and 480 bp (P7'-cfDNA-P5) species.

[0142] The amount of SPRI beads used to purify the gel extract was varied to determine the effective ratio for removing primer-dimers (Figure 16). A 1.2:1 SPRI beads:sample (v:v) was most effective at removing primer-dimers and did not result in loss of the majority of the cfDNA library. Example 4 - Capture of unligated P7' primer

[0143] Excess unligated P7' primer was removed using the scheme outlined in Figure 5. Briefly, after ligation of the P7' adapter primer to the 3' end of the target nucleic acid, a P7 primer complementary to the P7' adapter primer was added to the reaction volume. The P7 primer contained protecting groups at its 5' and 3' ends. After addition of the P7 primer, a P5 adapter was ligated to the 5' end of the rephosphorylated ligated target nucleic acid.

[0144] A 63-mer P7' primer (3'C3-P7'phos5') was ligated to the 3' end of cfDNA in a reaction volume containing 25% PEG. As shown in Figure 17, the yield of the ligation product was >95%. To examine ligation in the presence of a capture probe, a 60-mer P5 adapter with an unphosphorylated 5' end (5'P5-OH) was ligated to the 5' end of the first ligation product (3'C3-P7'cfDNA-phos5') in the presence of a 63-mer P7 capture probe (3'C3-P7-C35') containing a 5'-protecting group and a 3'-protecting group. The reaction was performed in a reaction volume containing 6.5% PEG. Figure 18 shows the ligation products (P7'-cfDNA-P5) and (P7'-P5).

[0145] Ligation products were further analyzed.As shown in Figure 19, ligation products were separated by size on gel, specific bands were extracted from gel, and extract B1 and extract B2 were amplified.Analysis of amplification products by capillary electrophoresis revealed that they contained 127bp (P7'-P5) species, 292bp (P7'-cfDNA-P5) species and 480bp (P7'-cfDNA-P5) species.Figure 20 shows the gel of ligation products before amplification, after amplification, and after extraction by SPRI beads.

[0146] Incorporation of non-PCR P7 to capture excess P7' significantly reduced primer-dimer formation, and removal using 1.2x SPRI significantly reduced primer-dimer formation without significant loss of cfDNA library content. Example 5 - Ligation of single-stranded nucleic acids conjugated to beads

[0147] The efficiency of ligation between two oligomers (Oligo 1 and Oligo 2) at various PEG concentrations was investigated. Because Oligo 1 contained a protected 3' end (OH) and Oligo 2 contained a protected 5' end (Phos), ligation resulted in a single ligated Oligo 1-Oligo 2 product. The reaction conditions included 10 pmol of each oligo + 2 μL of 10x buffer + 1 μL of 1 mM ATP, 1 μL of 50 mM MnCl2, 1 μL of CIRCLIGASE (100 U / μL), and 15 μL of 0, 25, 50, or 60% PEG in a final reaction volume of 20 μL containing 0, 19, 38, and 45% PEG, respectively. The results are shown in Figure 21. The reaction volume containing 45% PEG provided a 55.9% yield of ligated Oligo 1 and Oligo 2.

[0148] The efficiency of ligation between Oligo 1 and Oligo 2 at various Oligo 2 concentrations was investigated. Reaction conditions included 10 pmol Oligo 1 + 10x pmol Oligo 2 + 2 µL 10x buffer + 1 µL 1 mM ATP, 1 µL 50 mM MnCl2, 2 µL CIRCLIGASE (100 U / µL) + 15 µL 60% PEG, providing a final reaction volume of 20 µL containing 45% PEG. Results are shown in Figure 22. The reaction volume containing a 4x excess of Oligo 2 and + 2x CIRCLIGASE provided a 79.6% yield of ligated Oligo 1 and Oligo 2.

[0149] The efficiency of ligation between Oligo 1 and Oligo 2 at various CIRCLIGASE concentrations was investigated. Reaction conditions included 10 pmol of each oligo + 2 μL of 10x buffer + 1 μL of 1 mM ATP, 1 μL of 50 mM MnCl2, X μL of CIRCLIGASE (100 U / μL) + 15 μL of 60% PEG, providing a final reaction volume of 20 μL containing 45% PEG. Results are shown in Figure 23. The reaction volume containing an 8x concentration of CIRCLIGASE provided a 75.3% yield of ligated Oligo 1 and Oligo 2.

[0150] Oligo 1 was conjugated to beads via hydrazine-aldehyde coupling. The 39-mer Oligo 1 contains two uracil bases, which can be cleaved using uracil DNA glycosylase (UDG) to produce a shorter 27-mer oligo (Oligo 1*).

[0151] Various concentrations of Oligo 1 conjugated to beads were examined in ligation reactions. Ligation of Oligo 2 to conjugated Oligo 1 was analyzed by subsequent treatment with UDG. The ligation reaction conditions assumed that the amount of Oligo 1 used for bead attachment was equal to the amount of Oligo 1 on the beads. Four concentrations of total Oligo 1 input were tested: 0.5 nmol, 1 nmol, 2 nmol, and 4 nmol. Since 10% of the total bead solution was used, the amount of Oligo 1 in each reaction was assumed to be equal to 0.1 nmol, 0.2 nmol, 0.3 nmol, and 0.4 nmol. Reaction mixture: 10 μL of bead solution (2x concentrated), Oligo 2 (0.4 nmol), 2 μL of 10x buffer, 1 μL of 1 mM ATP, 1 μL of 50 mM MnCl2, 1 μL of CIRCLIGASE (100 U / μL) + 5 μL of 90% PEG, providing a final reaction volume of 20 μL containing 22.5% PEG. The reaction was incubated at 60°C for 3 hours and inactivated at 80°C for 10 minutes. The Oligo 1:Oligo 2 ratio in the reaction was: 0.05 nmol (1:8); 0.1 nmol (1:4); 0.2 nmol (1:2); 0.4 nmol (1:1). Uracil cleavage was performed with 10 μL of LMX1 in a final reaction volume of 10 μL and incubated at 37°C for 1 hour. The results are shown in Figure 24. The reaction volume containing a 1:1 Oligo 1:Oligo 2 ratio provided an 85.2% yield of ligated Oligo 1 and Oligo 2. The assay was repeated for a final reaction volume with 45% PEG. The results are shown in Figure 25. The reaction volume containing a 1:1 Oligo 1:Oligo 2 ratio provided an 84.5% yield of ligated Oligo 1 and Oligo 2.

[0152] As used herein, the term "comprising" is synonymous with "including," "containing," or "characterized by," and is inclusive or open-ended, not excluding additional, unrecited elements or method steps.

[0153] The above description discloses some of the methods and materials of the present invention. The invention is susceptible to modifications of the methods and materials, as well as to changes in the fabrication methods and devices. Such modifications will be apparent to those skilled in the art from a consideration of this disclosure or practice of the invention disclosed herein. Consequently, it is not intended that the present invention be limited to the particular embodiments disclosed herein, but rather to cover all modifications and alternatives within the true scope and spirit of the invention.

[0154] All references cited herein, including, but not limited to, published and unpublished applications, patents, and literature references, are incorporated by reference in their entirety and are hereby made a part of this specification. To the extent that the publications and patents or patent applications incorporated by reference conflict with the disclosure contained herein, the present specification is intended to supersede and / or take precedence over any such conflicting matter.

Claims

1. 1. A method for preparing a nucleic acid library, comprising: (a) obtaining a plurality of nucleic acids, wherein said plurality of nucleic acids are single-stranded nucleic acids; (b) dephosphorylating the 5' end of the single-stranded nucleic acid; (c) ligating a first adaptor to the 3′ end of the single-stranded nucleic acid in the presence of a ligase to obtain a template polynucleotide, wherein the 3′ end of the first adaptor comprises a protecting group; (d) hybridizing the first adaptor of the template polynucleotide with a capture probe, wherein the 5' end of the capture probe is attached to a substrate; (e) extending the capture probe with a polymerase to obtain an extended capture probe complementary to the template polynucleotide; (f) removing the template polynucleotide from the extended capture probe; and (g) ligating a second adaptor to the 3' end of the extended capture probe in the presence of the ligase, wherein the 3' end of the second adaptor comprises a protecting group, thereby obtaining a library of nucleic acids. A method comprising:

2. 10. The method of claim 1, wherein the capture probe comprises a cleavable linker, and the method further comprises cleaving the cleavable linker.

3. 3. The method of claim 1 or 2, wherein steps (b) to (e) are carried out in a single reaction volume.

4. The method of any one of claims 1 to 3, wherein the first adaptor and / or the second adaptor comprises a sequencing primer binding site.

5. The method of any one of claims 1 to 4, wherein the protecting group comprises a 3' spacer C3 or a dideoxynucleotide.

6. The method according to any one of claims 1 to 5, wherein the ligase is a single-stranded nucleic acid ligase having an activity of ligating single-stranded nucleic acids to each other.

7. 7. The method of any one of claims 1 to 6, wherein the ligation of the first adaptor and / or the ligation of the second adaptor is carried out in the presence of a volume-exclusion agent selected from the group consisting of polyethylene glycol (PEG), dextran, hetastarch, ficoll and polyvinylpyrrolidone.

8. 8. The method of claim 7, wherein step (c) and / or step (g) are carried out in a reaction volume containing at least 37% (wt / vol) PEG.

9. The method of any one of claims 1 to 8, wherein the plurality of nucleic acids comprises DNA.

10. 10. The method of any one of claims 1 to 9, wherein the average nucleic acid size of the plurality of nucleic acids is less than 200 nucleotides.

11. The method of any one of claims 1 to 10, further comprising amplifying said library of nucleic acids.

Images