Method for assisting in the diagnosis of nontuberculous mycobacterial disease and kit for assisting in the diagnosis of nontuberculous mycobacterial disease

Abstract

To provide a method for assisting in diagnosis of NTM disease that does not require detection of NTM disease-causing bacteria in sputum.SOLUTION: A method for assisting in diagnosis of non-tuberculous mycobacterial disease comprises the following steps (1) to (3): (1) bringing a sample containing lymphocytes from a subject into contact with Mycobacterium avium protein; (2) measuring a cytokine level in the sample after contact; and (3) selecting a subject with an increased cytokine level as compared to cytokine levels in healthy subject samples having brought into contact with Mycobacterium avium protein.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a method for assisting in the diagnosis of nontuberculous mycobacterial disease and a kit for assisting in the diagnosis of nontuberculous mycobacterial disease. [Background technology]

[0002] Non-tuberculous mycobacterial (NTM) disease (hereinafter referred to as "NTM disease") is a disease caused by infection with mycobacteria other than Mycobacterium tuberculosis complex and Mycobacterium leprae, and the primary organ of infection is the lungs. Pulmonary NTM disease has been increasing significantly in developed countries, including Japan, and is difficult to treat, making it one of the most intractable diseases of modern times. In Japan, the number of affected individuals exceeded 14 per 100,000 people in 2014, and the disease affects more than 8,000 people annually.

[0003] Diagnosis of pulmonary NTM disease, in accordance with the guidelines of the Japanese Society of Tuberculosis and Nontuberculous Mycobacterial Diseases, requires a time-consuming microbiological test called the double sputum positive test. However, there are cases in which sputum is not present as a symptom. Following the analysis of IgA antibody dynamics in patients infected with mycobacterial infection (Non-Patent Document 1), attention has focused on humoral immunity. For the diagnosis of pulmonary NTM disease, the Capillary MAC antibody ELISA method, which measures serum IgA antibodies against the GPL (glycopeptidolipid) core antigen, has been developed (Non-Patent Documents 2 and 3). However, it is difficult to predict treatment completion or relapse based solely on antibody levels (Non-Patent Document 4), and it is difficult to say that an objective determination of the disease stage of pulmonary NTM disease has been achieved at this time.

[0004] It is known that pulmonary NTM disease forms granulomas, although not as large as those seen in tuberculosis. Furthermore, it has been shown that the incidence of disseminated NTM disease is higher in HIV-infected groups (Non-Patent Document 5), suggesting that cellular immunity (CD4+ T cells) plays an important role in the defense against NTM disease.

[0005] The present inventors have reported that peripheral blood mononuclear cells from NTM patients and healthy individuals were stimulated with mitogen, purified tuberculin (PPD: Purified Protein Derivative), and the tuberculosis antigen ESAT-6 / CFP-10, and then measured using a flow cytometer the cytokines IL-2, IL-10, IL-13, IL-17, TNF-α, and IFN-γ. The results showed that when stimulated with PPD, the expression levels of TNF-α and IL-2 were higher in the patient group than in the healthy individual group (Non-Patent Document 6). [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Niki M, Suzukawa M, Akashi S, Nagai H, Ohta K, Inoue M, Niki M, Kaneko Y, Morimoto K, Kurashima A, Kitada S, Matsumoto S, Suzuki K, Hoshino Y. J Immunol Res. (2015) 2015, 527395. [Non-patent document 2] Kitada S, Yoshimura K, Miki K, Miki M, Hashimoto H, Matsui H, Kuroyama M, Ageshio F, Kagawa H, Mori M, Maekura R, Kobayashi K. Int J Tuberc Lung Dis. (2015) 19(1), 97-103. [Non-patent document 3] Kitada S, Maekura R, Toyoshima N, Naka T, Fujiwara N, Kobayashi M, Yano I, Ito M, Kobayashi K. Clin Diagn Lab Immunol. (2005) 12(1), 44-51. [Non-patent document 4] Kitada S, Maekura R, Yoshimura K, Miki K, Miki M, Oshitani Y, Nishida K, Sawa N, Mori M, Kobayashi K. J Clin Microbiol. (2017) 55(3), 884-892. [Non-patent document 5] Ristola MA, von Reyn CF, Arbeit RD, Soini H, Lumio J, Ranki A, Buehler S, Waddell R, Tosteson AN, Falkinham 3rd JO, Sox CH. J Infect. (1999) 39(1), 61-67. [Non-patent document 6] Yoshiro Yamashita, Kensuke Minami, Kazuyuki Yasuda, Takeyuki Tanaka, Masahiro Takagi, and Koya Ariyoshi. Journal of the Japanese Respiratory Society (2019), Vol. 8, Special Issue, p. 158. Summary of the Invention [Problem to be solved by the invention]

[0007] An objective of the present invention is to provide a method for assisting in the diagnosis of NTM disease that does not require detection of NTM disease-causing bacteria in sputum, and an NTM disease diagnostic assistance kit for carrying out said method. [Means for solving the problem]

[0008] In order to solve the above problems, the present invention includes the following inventions. [1] A method for assisting in the diagnosis of nontuberculous mycobacterial disease, comprising the following steps (1) to (3): (1) contacting a sample containing lymphocytes from a subject with a protein of Mycobacterium avium; (2) measuring the amount of cytokines in the sample after contact; and (3) A step of selecting subjects whose cytokine levels are increased compared to the cytokine levels in samples from healthy individuals contacted with Mycobacterium avium proteins. [2] The method described in [1] above, wherein the Mycobacterium avium protein comprises at least one protein selected from the group consisting of a protein having an amino acid sequence identical or substantially identical to the amino acid sequence shown in SEQ ID NO: 1, a protein having an amino acid sequence identical or substantially identical to the amino acid sequence shown in SEQ ID NO: 2, a protein having an amino acid sequence identical or substantially identical to the amino acid sequence shown in SEQ ID NO: 3, a protein having an amino acid sequence identical or substantially identical to the amino acid sequence shown in SEQ ID NO: 4, and fragments thereof. [3] The method according to [1] or [2] above, wherein the cytokine is a Th1 cytokine and / or a non-Th1 cytokine. [4] The method according to [3] above, wherein the Th1 cytokine is at least one selected from the group consisting of interferon-γ, tumor necrosis factor-α, and interleukin-2. [5] The method according to [3] above, wherein the non-Th1 cytokine is at least one selected from the group consisting of interleukin-10, interleukin-13, and interleukin-17. [6] The method according to [1] or [2] above, wherein the cytokine is interleukin-10 and / or interleukin-17. [7] A diagnostic aid kit for nontuberculous mycobacterial infection, comprising at least one protein selected from the group consisting of a protein having an amino acid sequence identical or substantially identical to the amino acid sequence shown in SEQ ID NO: 1, a protein having an amino acid sequence identical or substantially identical to the amino acid sequence shown in SEQ ID NO: 2, a protein having an amino acid sequence identical or substantially identical to the amino acid sequence shown in SEQ ID NO: 3, a protein having an amino acid sequence identical or substantially identical to the amino acid sequence shown in SEQ ID NO: 4, and fragments thereof. [8] The kit according to [7] above, further comprising a reagent for measuring the amount of cytokines. [9] The kit according to [8] above, wherein the cytokine is a Th1 cytokine and / or a non-Th1 cytokine.

[10] The kit according to [9] above, wherein the Th1 cytokine is at least one selected from the group consisting of interferon-γ, tumor necrosis factor-α, and interleukin-2.

[11] The kit according to [9] above, wherein the non-Th1 cytokine is at least one selected from the group consisting of interleukin-10, interleukin-13, and interleukin-17.

[12] The kit according to any one of [8] to

[11] above, wherein the reagent comprises an antibody that specifically binds to the cytokine.

[13] The kit according to [7], further comprising an anti-interleukin-10 antibody and / or an anti-interleukin-17 antibody. [Effects of the Invention]

[0009] The present invention can provide a method for assisting in the diagnosis of NTM disease that does not require detection of NTM disease-causing bacteria in sputum, and can also provide an NTM disease diagnostic assistance kit for carrying out the NTM disease diagnostic assistance method of the present invention. [Brief explanation of the drawings]

[0010] [Figure 1] Figure 1 shows the results of two-dimensional electrophoresis of soluble proteins from Mycobacterium avium strain 104. (A) and (B) show the results of silver staining of the gel after two-dimensional electrophoresis. (A) shows an overstained gel to detect low-abundance proteins, while (B) shows a stained gel to match the abundant proteins. (C) and (D) show the results of Western blotting of proteins transferred to a PVDF membrane after two-dimensional electrophoresis. (C) shows the primary antibody reaction with serum from an NTM patient (M4), and (D) shows the primary antibody reaction with serum from a healthy individual (H16). [Figure 2] Figure 2 shows the results of identifying four Mycobacterium avium proteins that react with NTM patient sera, producing their recombinant proteins, subjecting them to SDS-PAGE, and staining with Coomassie Brilliant Blue. [Figure 3] Figure 3 shows the results of treating peripheral blood mononuclear cells (PBMCs) from subjects (undiagnosed, on treatment, and post-treatment) with each of the recombinant proteins shown in Figure 2 with findings consistent with NTM disease, staining with anti-interferon-γ (IFN-γ) antibody, and measuring the amount of intracellular IFN-γ in CD4-positive T cells by flow cytometry. [Figure 4] Figure 4 shows the results of treating peripheral blood mononuclear cells (PBMCs) from subjects (undiagnosed, on treatment, and post-treatment) with each of the recombinant proteins shown in Figure 2 with findings consistent with NTM disease, staining with anti-tumor necrosis factor α (TNF-α) antibody, and measuring the amount of intracellular TNF-α in CD4-positive T cells by flow cytometry. [Figure 5] Figure 5 shows the results of treating peripheral blood mononuclear cells (PBMCs) from subjects (undiagnosed, on treatment, and post-treatment) with each of the recombinant proteins shown in Figure 2 with findings consistent with NTM disease, staining with interleukin-2 (IL-2) antibody, and measuring the amount of intracellular IL-2 in CD4-positive T cells by flow cytometry. [Figure 6] Figure 6 shows the results of treating peripheral blood mononuclear cells (PBMCs) from subjects (undiagnosed, on treatment, and post-treatment) with each of the recombinant proteins shown in Figure 2 with findings consistent with NTM disease, staining with interleukin-10 (IL-10) antibody, and measuring the amount of intracellular IL-10 in CD4-positive T cells by flow cytometry. [Figure 7] Figure 7 shows the results of treating peripheral blood mononuclear cells (PBMCs) from subjects (undiagnosed, on treatment, and post-treatment) with each of the recombinant proteins shown in Figure 2 with findings consistent with NTM disease, staining with interleukin-13 (IL-13) antibody, and measuring the amount of intracellular IL-13 in CD4-positive T cells by flow cytometry. [Figure 8]Figure 8 shows the results of treating peripheral blood mononuclear cells (PBMCs) from subjects (undiagnosed, on treatment, and post-treatment) with each of the recombinant proteins shown in Figure 2 with findings consistent with NTM disease, staining with interleukin-17 (IL-17) antibody, and measuring the amount of intracellular IL-17 in CD4-positive T cells by flow cytometry. DETAILED DESCRIPTION OF THE INVENTION

[0011] [Method for assisting in the diagnosis of nontuberculous mycobacterial infection] The present invention provides a method for assisting in the diagnosis of nontuberculous mycobacterial disease (NTM disease) (hereinafter referred to as the "method of the present invention"). The method of the present invention may include the following steps (1) to (3): (1) contacting a sample containing lymphocytes from a subject with a protein of Mycobacterium avium; (2) measuring the amount of cytokines in the sample after contact; and (3) A step of selecting subjects whose cytokine levels are increased compared to the cytokine levels in samples from healthy individuals contacted with Mycobacterium avium proteins.

[0012] Although there are no particular limitations on the subjects to which the methods of the present invention are applied, patients clinically suspected of having NTM disease are preferred. The NTM disease may be pulmonary NTM disease or pulmonary MAC (Mycobacterium avium complex) disease.

[0013] In step (1), a sample containing lymphocytes from a subject is contacted with Mycobacterium avium proteins. The sample is not particularly limited as long as it contains lymphocytes, and examples include blood, body fluids, and tissues. The lymphocyte-containing sample may be a sample containing lymphocytes isolated from peripheral blood collected from a subject, or may be peripheral blood mononuclear cells (PBMCs). PBMCs can be prepared by known techniques, such as density gradient centrifugation.

[0014] The Mycobacterium avium protein may be the entire protein extracted from Mycobacterium avium, a specific fraction of the protein extracted from Mycobacterium avium, a specific Mycobacterium avium protein, or a combination of multiple specific proteins. The method for extracting protein from Mycobacterium avium is not particularly limited, and known methods for extracting proteins from bacteria can be used. Specifically, for example, Mycobacterium avium can be cultured, harvested by centrifugation or other methods, disrupted, and the disrupted solution centrifuged to recover the protein. The protein extracted from Mycobacterium avium may be a soluble protein. A specific Mycobacterium avium fraction may be prepared by chromatography, ultrafiltration, or other methods. The specific protein of Mycobacterium avium may be an extracted protein separated and recovered by electrophoresis, chromatography, etc., or may be a recombinant protein produced using known gene recombination techniques.

[0015] The Mycobacterium avium protein used in the method of the present invention preferably comprises at least one protein selected from the group consisting of a protein consisting of an amino acid sequence identical or substantially identical to the amino acid sequence set forth in SEQ ID NO: 1, a protein consisting of an amino acid sequence identical or substantially identical to the amino acid sequence set forth in SEQ ID NO: 2, a protein consisting of an amino acid sequence identical or substantially identical to the amino acid sequence set forth in SEQ ID NO: 3, a protein consisting of an amino acid sequence identical or substantially identical to the amino acid sequence set forth in SEQ ID NO: 4, and fragments thereof. These proteins have been confirmed to contain a region that reacts with the sera of NTM disease patients (see Example 1). As the above-mentioned fragment, a fragment containing a region that reacts with the sera of NTM disease patients can be used.

[0016] The Mycobacterium avium proteins used in the methods of the present invention may include proteins based on one, two, three, or all four of the amino acid sequences selected from SEQ ID NOs: 1 to 4. Preferably, any combination includes a protein or fragment thereof having an amino acid sequence identical or substantially identical to the amino acid sequence set forth in SEQ ID NO: 4.

[0017] The protein consisting of the amino acid sequence shown in SEQ ID NO: 1 is registered in the UniProt database for Mycobacterium avium strain 104 (Proteome ID UP000001574) under the following conditions: Protein name: Glucose-methanol-choline, Gene name: MAV_4925, Length: 598. The GenBank accession number is ABK66486.1. The mass is approximately 66 kDa. The nucleotide sequence of the gene encoding this protein is, for example, the sequence shown in SEQ ID NO: 5.

[0018] The protein consisting of the amino acid sequence shown in SEQ ID NO: 2 is registered in the UniProt database for Mycobacterium avium strain 104 (Proteome ID UP000001574) under the following conditions: Protein name: Diaminopimelate decarboxylase, Gene name: MAV_1160, Length: 444. The GenBank accession number is ABK66486.1. The mass is approximately 50 kDa. The nucleotide sequence of the gene encoding this protein is, for example, the sequence shown in SEQ ID NO: 6.

[0019] The protein consisting of the amino acid sequence shown in SEQ ID NO: 3 is registered in the UniProt database for Mycobacterium avium strain 104 (Proteome ID UP000001574) under the following conditions: Protein name: Acetyl-CoA acetyltransferase, Gene name: MAV_1276, Length: 382. The GenBank accession number is ABK68410.1. The mass is approximately 40 kDa. The nucleotide sequence of the gene encoding this protein is, for example, the sequence shown in SEQ ID NO: 7.

[0020] The protein consisting of the amino acid sequence shown in SEQ ID NO: 4 is registered in the UniProt database for Mycobacterium avium strain 104 (Proteome ID UP000001574) under the following conditions: Protein name: Bac_luciferase domain-containing protein, Gene name: MAV_0986, Length: 345. The GenBank accession number is ABK65320.1. The mass is approximately 38 kDa. The nucleotide sequence of the gene encoding this protein is, for example, the sequence shown in SEQ ID NO: 8.

[0021] Examples of proteins consisting of an amino acid sequence substantially identical to the amino acid sequence shown in SEQ ID NO: 1 include proteins consisting of an amino acid sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence shown in SEQ ID NO: 1, proteins that react with serum from NTM disease patients, and proteins to which an affinity tag has been added. The same applies to proteins consisting of an amino acid sequence substantially identical to the amino acid sequence shown in SEQ ID NO: 2, 3, or 4.

[0022] Proteins and fragments thereof having the same or substantially the same amino acid sequences as those shown in SEQ ID NOS: 1 to 4 may be recombinant proteins. Recombinant proteins can be produced using DNA having a nucleotide sequence encoding the amino acid sequences of these proteins, employing known gene recombination techniques and recombinant protein production techniques. Recombinant proteins may contain an affinity tag. The affinity tag is not particularly limited, and known affinity tags such as His tag, HA tag, FLAG tag, and Myc tag can be used. The affinity tag may be linked directly to the above protein, or may be linked via a spacer peptide or linker.

[0023] The method for contacting a sample with a Mycobacterium avium protein is not particularly limited, and examples include immersing the sample in a solution of the Mycobacterium avium protein. When PBMCs are used as the sample, examples include adding the Mycobacterium avium protein to a commercially available medium suitable for PBMC culture and culturing the PBMCs. The time for contacting the sample with the Mycobacterium avium protein is not particularly limited, and when PBMCs are cultured in a 37°C, 5% CO2 incubator after contacting the Mycobacterium avium protein, the time may be, for example, 12 hours or more, 13 hours or more, 14 hours or more, or 24 hours or less, 22 hours or less, 20 hours or less, 18 hours or less, or 16 hours or less.

[0024] In step (2), the amount of cytokines in the sample after contact with Mycobacterium avium proteins is measured. The cytokines to be measured are not particularly limited and may be Th1 cytokines, non-Th1 cytokines, or both Th1 and non-Th1 cytokines. Th1 cytokines are cytokines produced by Th1 cells, a subset of helper T cells (CD4-positive T cells), and examples include interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α), and interleukin-2 (IL-2). Non-Th1 cytokines are cytokines other than those produced by Th1 cells, such as interleukin-10 (IL-10), interleukin-13 (IL-13), interleukin-17 (IL-17), interleukin-6 (IL-6), interleukin-9 (IL-9), interleukin-21 (IL-21), interleukin-27 (IL-27), transforming growth factor-β (TGF-β), and granulocyte macrophage colony-stimulating factor (GM-CSF).

[0025] The method for measuring the amount of cytokines is not particularly limited, and any known method can be appropriately selected, such as enzyme-linked immunosorbent assay (ELISA), chemiluminescent enzyme immunoassay (CLEIA), chemiluminescent immunoassay (CLIA), flow cytometry, and enzyme-linked immunospot (ELISPOT).

[0026] In step (1), if blood or PBMCs collected from blood are cultured in a medium containing Mycobacterium avium proteins, cytokines may be measured in the culture supernatant, PBMCs may be collected and intracellular cytokines may be measured, or the culture supernatant and total intracellular cytokines may be measured. For these measurements, ELISA, CLEIA, CLIA, etc. can be suitably used. Flow cytometry and ELISPOT can be used to measure intracellular cytokines in PBMCs. For flow cytometry, for example, as described in the Examples below, PBMCs cultured in a medium containing Mycobacterium avium proteins can be collected, cell surface fixed, cell membrane permeabilized, stained with fluorescently labeled antibodies against the target cytokine, and subjected to flow cytometry. To measure only CD4+ T cells in PBMCs, the PBMCs can be simultaneously stained with antibodies against cell surface markers (e.g., CD3 and CD4) to identify CD4+ T cells, and the fluorescence of both the cell surface markers and the target cytokine can be evaluated. When using ELISPOT, PBMCs are assayed on a plate coated with a target cytokine capture antibody. After the assay, a detection antibody and a chromogenic substrate are added, and the cytokine can be measured by counting the number of colored positive spots.

[0027] In step (3), a subject is selected whose cytokine levels are elevated compared to those in a healthy subject sample contacted with Mycobacterium avium proteins. In the method of the present invention, healthy subjects typically refer to individuals with no history of NTM disease and no suspicion of NTM disease. The healthy subject sample is a sample containing lymphocytes from the subject after contact with Mycobacterium avium proteins. The healthy subject sample is preferably one that has been contacted with Mycobacterium avium proteins under the same conditions as the subject sample. Furthermore, the cytokine levels in the healthy subject sample are preferably measured using the same method as the subject sample. The cytokine levels in the healthy subject sample may be measured simultaneously with the subject sample in steps (1) and (2), or may be accumulated data of values ​​previously measured under the same conditions as the subject sample.

[0028] When measuring Th1 cytokines as cytokines, if the amount of Th1 cytokines in a subject's sample is increased compared to the amount of the corresponding cytokine in a healthy subject's sample, the subject can be determined to be highly likely to have nontuberculous mycobacterial disease. The degree of increase in cytokine amount is not particularly limited, and for example, subjects with an increase in cytokine amount of at least two-fold, three-fold, four-fold, or five-fold compared to the amount in a healthy subject's sample may be selected. Preferred Th1 cytokines are IFN-γ, TNF-α, and IL-2. Multiple Th1 cytokines may be measured, and subjects with an increase in all of them may be selected.

[0029] When non-Th1 cytokines are measured as cytokines, if the amount of non-Th1 cytokines in a subject's sample is increased compared to the amount of the corresponding cytokine in a healthy subject's sample, the subject can be determined to be highly likely to have nontuberculous mycobacterial disease. The degree of increase in cytokine amount is not particularly limited, and, for example, subjects with an increase in cytokine amount of at least two-fold, at least three-fold, at least four-fold, or at least five-fold compared to the amount in a healthy subject's sample may be selected. Preferred non-Th1 cytokines are IL-10, IL-13, and IL-17, with IL-10 and IL-17 being more preferred. Multiple non-Th1 cytokines may be measured to select subjects with an increase in all of them.

[0030] To improve accuracy, both Th1 cytokines and non-Th1 cytokines may be measured, and if the levels of both cytokines are increased compared to the corresponding cytokine levels in samples from healthy individuals, the subject may be determined to be highly likely to have developed nontuberculous mycobacterial disease. Preferably, the Th1 cytokine measured is at least one selected from IFN-γ, TNF-α, and IL-2, and the non-Th1 cytokine measured is at least one selected from IL-10 and IL-17.

[0031] [Diagnostic aid kit for nontuberculous mycobacterial infections] The present invention provides a kit for carrying out the above-described method of the present invention (hereinafter referred to as the "kit of the present invention"). The kit of the present invention may contain at least one protein selected from the group consisting of a protein consisting of the same or substantially the same amino acid sequence as the amino acid sequence set forth in SEQ ID NO: 1, a protein consisting of the same or substantially the same amino acid sequence as the amino acid sequence set forth in SEQ ID NO: 2, a protein consisting of the same or substantially the same amino acid sequence as the amino acid sequence set forth in SEQ ID NO: 3, a protein consisting of the same or substantially the same amino acid sequence as the amino acid sequence set forth in SEQ ID NO: 4, and fragments thereof. Preferably, the kit contains proteins based on two, three, or four of the amino acid sequences set forth in SEQ ID NOs: 1 to 4.

[0032] These proteins may be recombinant proteins. The recombinant proteins may contain an affinity tag. The affinity tag is not particularly limited, and known affinity tags such as His tag, HA tag, FLAG tag, and Myc tag can be used. The affinity tag may be linked directly to the above protein or via a spacer peptide or linker.

[0033] The kit of the present invention may contain, in addition to the above-mentioned protein, a reagent for measuring the amount of the cytokine to be measured. The cytokine to be measured may be a Th1 cytokine or a non-Th1 cytokine. Preferably, both Th1 cytokines and non-Th1 cytokines are used. Preferred Th1 cytokines are IFN-γ, TNF-α, and IL-2, and preferred non-Th1 cytokines are IL-10, IL-13, and IL-17. The reagent for measuring the amount of the cytokine to be measured may be an antibody that specifically binds to the cytokine to be measured.

[0034] The kit of the present invention preferably comprises, in addition to the above-mentioned protein, one or more antibodies selected from anti-IFN-γ antibody, anti-TNF-α antibody, anti-IL-2 antibody, anti-IL-10 antibody, anti-IL-13 antibody, and anti-IL-17 antibody. More preferably, the kit comprises, in addition to the above-mentioned protein, at least one antibody selected from anti-IFN-γ antibody, anti-TNF-α antibody, anti-IL-2 antibody, and anti-IL-10 antibody, and at least one antibody selected from anti-IL-10 antibody, anti-IL-13 antibody, and anti-IL-17 antibody.

[0035] The kit of the present invention may contain, in addition to the above-mentioned protein, either one or both of an anti-IL-10 antibody and an anti-IL-17 antibody. The kit of the present invention may further include various tubes for preparing the reagent, buffer solutions for preparing the reagent, instructions for use, etc. [Example]

[0036] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples.

[0037] Example 1: Identification of Mycobacterium avium proteins that react with serum from NTM patients 1-1 Detection of Mycobacterium avium proteins reacting with serum from patients with NTM disease <Isoelectric focusing> Mycobacterium avium strain 104 was cultured in Middlebrook 7H9 broth (Difco) supplemented with 0.2% glycerol, ADC, and 0.05% Tween 80. The cells were grown to an OD600 of 1 and harvested by centrifugation. The cells were disrupted using a bead-disruptor and soluble proteins were collected by centrifugation. The resulting Mycobacterium avium proteins were separated by isoelectric focusing as previously described (Enany S et al., Molecules, 2021). Isoelectric focusing was performed using 7 cm pH gradient gel strips (Immobiline DryStrip Non-Linear, GE Healthcare) adjusted to pH 3-10 with Ettan IPGphor 3 (Amersham Biosciences). The gel strips were rehydrated according to the manufacturer's instructions. The protein extract was further diluted with Destreak rehydration buffer and run at 9400 V / h with a maximum voltage output of 5000 V. After electrophoresis, the gel strip was immersed in 5 mL of equilibration solution (6 M urea, 50 mM Tris-HCl; pH 8.8, 30% glycerol, 2% SDS, 0.004% bromophenol blue) supplemented with 50 mg dithiothreitol for 15 min at room temperature, followed by immersion in 5 mL of the same equilibration solution supplemented with 125 mg iodoacetamide for protein reduction and alkylation.

[0038] <Two-dimensional SDS-PAGE> After isoelectric focusing, the SDS-treated gel strip was subjected to two-dimensional SDS-PAGE as previously described (O'Farrell, J Biol Chem, 1975). The gel strip equilibrated as described above was sealed on top of an SDS-PAGE gel (12.5% ​​polyacrylamide gel) using 0.5% agarose. The buffer used was Tris-glycine-SDS solution (25 mM Tris, 198 mM glycine, 0.1% SDS). The gel was run at 20 mA / gel until the dye reached the bottom of the gel. Two replicates of two-dimensional electrophoresis were performed for each sample.

[0039] <Silver staining> After two-dimensional electrophoresis, the gel was silver-stained using 2D-Silver Stain Reagent II (Cosmo Bio) according to the manufacturer's instructions. The distribution of proteins on the gel was digitized and recorded using a high-resolution scanner. Images were captured as TIFF files at 800 dpi and compared using Progenesis SameSpots software (Totallab).

[0040] <Western blotting> After two-dimensional electrophoresis, a PVDF membrane was attached to the gel and transferred according to standard methods. The transferred membrane was blocked with a 5% BSA solution and then reacted with a primary antibody. The primary antibody was a serum from an NTM patient (M4) isolated at Toneyama National Hospital, and a control serum from a healthy individual (H16), each diluted 5,000 times. After washing, the membrane was reacted with a goat anti-human IgG-Fc antibody diluted 10,000 times as the secondary antibody. After washing, the membrane was reacted with ECLprime and the signal was detected.

[0041] <Result> The results are shown in Figure 1. Figure 1 (A) and (B) show the results of isoelectric focusing of soluble proteins from Mycobacterium avium strain 104 cells, followed by two-dimensional electrophoresis and silver staining of the extracted gel. (A) shows an overstained gel to detect low-abundance proteins, while (B) shows an overstained gel for high-abundance proteins. Silver staining revealed numerous spots. (C) and (D) show the results of Western blotting of proteins transferred to a PVDF membrane after two-dimensional electrophoresis. (C) shows a primary antibody reaction with NTM patient serum (M4), while (D) shows a primary antibody reaction with healthy donor serum (H16). Five spots that reacted with NTM patient serum (M4) but not with healthy donor serum (H16) were identified (see Figure 1 (C)) and used as samples for mass spectrometry.

[0042] 1-2 Identification of Mycobacterium avium proteins that react with sera from NTM patients <Mass spectrometry> The five spots identified in Example 1 were excised from the silver-stained gel and destained using a Silver Stain Kit for Mass Spectrometry (Pierce). Each excised spot was reduced with methylated carbamide in 10 mM dithiothreitol and 55 mM iodoacetamide and digested with trypsin. The resulting peptides were dissolved in 0.3% formic acid and injected into a nano-flow LC (Eksgent nanoLC 415 with ekspert cHiPLC, AB Sciex). Analysis was performed twice for each sample using two different sizes of ChromeXP C18 Chip columns (200 μm × 0.5 mm) and ChromeXP C18 Chip columns (75 μm × 150 mm) in trap and elute mode. Mobile phase A contained 0.1% formic acid, and mobile phase B contained acetonitrile-0.1% formic acid. Acetonitrile was used as the organic solvent for eluting hydrophobic peptides. The sample was eluted with mobile phase B from 2% to 32% for 20 min. Mass spectrometry was performed in data-dependent mode. The output data was analyzed using the UniProtKB database and the Mascot search engine (version 2.4, Matrix Science).

[0043] <Result> The mass spectrometry results of the trypsin-digested samples from each spot were matched with the UniProt database for Mycobacterium avium strain 104 (Proteome ID UP000001574), and the following four proteins were identified. Spot 1: glucose-methanol-choline oxidoreductase (GenBank: ABK64837.1, Gene name: MAV_4925) Spot 2: Diaminopimelic acid decarboxylase (GenBank: ABK66486.1, Gene name: MAV_1160) Spot 4: Acetyl-CoA acetyltransferase (GenBank: ABK68410.1, Gene name: MAV_1276) Spot 5: Unidentified protein (GenBank: ABK65320.1, Gene name: MAV_0986)

[0044] Hereinafter, the protein identified from spot 1 is referred to as "MAV_4925," the protein identified from spot 2 as "MAV_1160," the protein identified from spot 4 as "MAV_1276," and the protein identified from spot 5 as "MAV_0986." Of these, MAV_4925 is an antigen specific to Mycobacterium avium and Mycobacterium abscessus, and MAV_0986 is an antigen specific to NTM disease, particularly MAC disease. The amino acid sequences of "MAV_4925" are shown in SEQ ID NO: 1, "MAV_1160" in SEQ ID NO: 2, "MAV_1276" in SEQ ID NO: 3, and "MAV_0986" in SEQ ID NO: 4.

[0045] 1-2 Production of recombinant proteins <Expression in E. coli> Mycobacterium avium strain 104 was grown and genomic DNA was extracted according to standard methods. The resulting genomic DNA was used as a template for PCR amplification of the DNA encoding each protein using the following primer set. These primers add a restriction enzyme NdeI sequence to the 5' end of the amplified DNA and a restriction enzyme HindIII sequence to the 3' end. Furthermore, the start codon (methionine) of MAV_0986, MAV_1160, and MAV_4925 was changed to ATG.

[0046] MAV_4925-Fw: GGGCATATGCGGTGCGGCCCGCTGAACAC (SEQ ID NO: 9) MAV_4925-Rv: CCCAAGCTTCTTGTACAGGTCCGTGTGGTC (SEQ ID NO: 10) MAV_1160-Fw: GGGCATATGCTGGACATCCTGCCGTCGCTGG (SEQ ID NO: 11) MAV_1160-Rv: CCCAAGCTTCCCGCGGTCGCGGGCCAGCAGG (SEQ ID NO: 12) MAV_1276-Fw: GGGCATATGGCTGAAGCCGTCATCGTCGAG (SEQ ID NO: 13) MAV_1276-Rv: CCCAAGCTTCAACAGTTCCACGATGGTGG (SEQ ID NO: 14) MAV_0986-Fw: GGGCATATGAAAACCGTTGCGGTGCGGCCGG (SEQ ID NO: 15) MAV_0986-Rv: CCCAAGCTTGCTCAGCGCGGGAATGATCTCCCGC (SEQ ID NO: 16)

[0047] The amplified gene fragments were digested with restriction enzymes (NdeI and HindIII) and inserted into the pET-22b(+) vector at the corresponding restriction enzyme sites. Each expression plasmid was amplified in E. coli DH-5α and transformed into endotoxin-free protein expression E. coli (trade name: ClearColi BL21(DE3) electrocompetent cells, Lucigen). These transformants were cultured in LB medium containing 50 μg / mL carbenicillin, and each recombinant protein was purified using a nickel affinity column as previously described (Osada-Oka M et al., Microbiol Immunol, 2013). A sequence containing a 6x histidine tag (KLAAALEHHHHHH, SEQ ID NO: 17) was added to the C-terminus of each recombinant protein.

[0048] Each purified recombinant protein was subjected to SDS-PAGE and stained with Coomassie Brilliant Blue, and the results are shown in Figure 2. For each recombinant protein, a band appeared at the position of its respective mass, confirming that the desired recombinant protein had been produced.

[0049] Example 2: Analysis of cytokines expressed by PBMCs treated with each recombinant protein <Selection of subjects and group division> Subjects were those who had findings not inconsistent with NTM disease in imaging examinations such as chest CT, and who had one or more positive cultures of sputum and bronchoalveolar lavage fluid, or one or more positive non-tuberculous mycobacteria PCRs of sputum and bronchoalveolar lavage fluid, or one or more positive serum IgA antibodies against GPL core antigen. Among these, subjects with only one positive sputum culture who did not meet the guidelines of the Japanese Society for Tuberculosis and Nontuberculous Mycobacteriosis and had not received chemotherapy intervention were defined as the NTM disease diagnosis uncertain (Before-Treatment) group (n = 17), subjects who were under chemotherapy at the time of specimen collection were defined as the NTM disease on-treatment (On-Treatment) group (n = 16), and subjects who were after chemotherapy at the time of specimen collection were defined as the NTM disease after-treatment (After-Treatment) group (n = 18). Furthermore, subjects who had no previous history of NTM disease and had never had suspicion of NTM disease pointed out were defined as the healthy control (Control) group (n = 17).

[0050] <Extraction of PBMCs> After collecting 15 - 20 mL of whole blood from the subjects, PBMCs were extracted from the whole blood according to a previously reported method (Y Yamashita et al., Jpn. J. Infect. Dis. 2013). A density gradient separation method was used for the extraction of PBMCs. The whole blood was dispensed into 15 mL tubes, and after centrifugation, the buffy coat layer that appeared between the plasma layer and the blood cell layer was collected using a Pasteur pipette. The collected fraction was mixed with phosphate buffered saline (PBS) and allowed to stand on a lymphocyte separation solution (trade name: Lymphoprep, AXIS-Shield) prepared in a 15 mL tube in advance. After centrifugation, the white thin layer (PBMCs) was collected using a Pasteur pipette. The collected PBMCs were washed with PBS and then used for subsequent assays.

[0051] <PBMCs in vitro assay> After counting the number of collected PBMCs, 1×10 per well was added to a 96-well plate 6The assay was performed in RPMI 1640 (Wako Pure Chemical Industries, Ltd.) medium supplemented with 10% fetal bovine serum and penicillin-streptomycin. After seeding, each recombinant protein (MAV_0986, MAV_1160, MAV_1276, MAV_4925) prepared in Example 1 was added to each well to a final concentration of 2.1 μg / mL. Purified tuberculin (PPD) was used as a control. The PBMC assay was performed for 14–16 hours in a 5% CO2 incubator at 37°C under conditions supplemented with CD28 / 49d costimulator (0.5 μg / mL, BD), Golgi blockers brephedrin A (1 μg / mL), and monensin (0.5 μM) (all Sigma-Aldrich).

[0052] <Cell surface and intracellular staining> After the in vitro assay was completed, the medium was removed and PBMCs were stained for cell surface markers. CD3, CD4, and CD19 were used as controls. Live / dead cell marker staining was also performed simultaneously. A fluorescent antibody cocktail was added to PBMCs and incubated at 4°C for 30 minutes. Next, permeabilized fixed with FACS permeabilizing solution (BD) was added to PBMCs to simultaneously fix the cell surface and increase cell membrane permeability. Anti-cytokine fluorescent antibodies were then added and incubated at 4°C for 30 minutes to stain intracellular cytokines. An FcR blocking reagent (MBL) was used to prevent nonspecific reactions. The cytokines measured were IFN-γ, TNF-α, IL-2 (all Th1 cytokines), IL-10, IL-13, and IL-17 (all non-Th1 cytokines). The antibodies used are listed below. Anti-CD3-APC-Cy7 (HIT3a), anti-IFN-γ-PE-Cy7 (4S.B3), anti-IL-10-PE (JES3-9D7), anti-IL-17-Alexa Fluor 700 (BL168), anti-TNF-α-PerCP-Cy5.5 (MAb11) (Biolegend), anti-CD4-Pacific Blue (OKT4), anti-IL-2-APC (MQ1-17H12), anti-IL-13-FITC (PVM13-1) (eBioscience), anti-CD19-ECD (J3-119) (Beckman Coulter).

[0053] <Discrimination of stained cells by flow cytometry> After staining, PBMCs were loaded into a flow cytometer (Gallios, Beckman Coulter) and counted. Data were analyzed using dedicated software (Flow Jo, TreeStar). The color development of each anti-cytokine antibody in CD3+CD4+ cells (CD4+ T cells) was evaluated. Statistical analysis was performed using the values ​​obtained from Flow Jo analysis. GraphPad Prism (GraphPad Software) was used for statistical analysis. Comparisons between multiple groups were performed using the Kruskal-Wallis test.

[0054] <Result> Figure 3 shows the results of measuring the intracellular IFN-γ levels in CD4+ T cells. When treated with any of the four recombinant proteins, the IFN-γ levels in the treatment and post-treatment groups were significantly higher than those in the healthy control group. When treated with MAV_0986, MAV_1276, and MAV_4925, the IFN-γ levels in the treatment and post-treatment groups were significantly higher than those in the undiagnosed group. When treated with MAV_1160, the IFN-γ levels in the treatment group were significantly higher than those in the undiagnosed group. When treated with PPD, no significant differences were observed between any of the groups.

[0055] Figure 4 shows the results of measuring the intracellular TNF-α levels in CD4+ T cells. When treated with any of the four recombinant proteins, the TNF-α levels in the treatment and post-treatment groups were significantly higher than those in the healthy control group. When treated with MAV_1276 and MAV_4925, the TNF-α levels in the treatment and post-treatment groups were significantly higher than those in the undiagnosed group. When treated with MAV_0986 and MAV_1160, the TNF-α levels in the treatment group were significantly higher than those in the undiagnosed group. When treated with PPD, no significant differences were observed between any of the groups.

[0056] Figure 5 shows the results of measuring the intracellular IL-2 levels in CD4+ T cells. When treated with any of the four recombinant proteins, the IL-2 levels in the treatment and post-treatment groups were significantly higher than those in the healthy control group. Furthermore, when treated with any of the four recombinant proteins, the IL-2 levels in the treatment and post-treatment groups were significantly higher than those in the undiagnosed group. When treated with PPD, the IL-2 levels in the post-treatment group were significantly higher than those in the healthy control and undiagnosed groups, but the same trend as with treatment with recombinant proteins was not observed.

[0057] Figure 6 shows the results of measuring the intracellular IL-10 levels in CD4+ T cells. When treated with any of the four recombinant proteins, the IL-10 levels in the undiagnosed group were significantly higher than those in the healthy control group, the treatment group, and the post-treatment group. When treated with PPD, no significant differences were observed between any of the groups.

[0058] Figure 7 shows the results of measuring the intracellular IL-13 levels in CD4+ T cells. When treated with any of the four recombinant proteins, the IL-13 levels in the undiagnosed group were significantly higher than those in the healthy control group. When treated with MAV_1160, the IL-13 levels in the treatment group were significantly higher than those in the healthy control group. When treated with MAV_0986, MAV_1160, and MAV_4925, the IL-13 levels in the undiagnosed group were significantly higher than those in the treatment group. When treated with PPD, no significant differences were observed between any of the groups.

[0059] Figure 8 shows the results of measuring the intracellular IL-17 levels in CD4+ T cells. When treated with any of the four recombinant proteins, the IL-17 levels in the undiagnosed group were significantly higher than those in the healthy control group, the treatment group, and the post-treatment group. When treated with PPD, no significant differences were observed between any of the groups.

[0060] These results suggest that treatment with the four recombinant proteins resulted in significantly higher levels of Th1 cytokines (IFN-γ, TNF-α, and IL-2) in CD4+ T cells in the treatment and post-treatment groups than in the healthy control group, and tended to be higher in the undiagnosed group than in the healthy control group. Meanwhile, the levels of non-Th1 cytokines (IL-10, IL-13, and IL-17) in CD4+ T cells were significantly higher in the undiagnosed group than in the healthy control, treatment, and post-treatment groups. These findings suggest that these cytokine levels can be used as indicators to aid in the diagnosis of NTM disease.

[0061] The present invention is not limited to the above-described embodiments and examples, and various modifications are possible within the scope of the claims. The technical scope of the present invention also includes embodiments obtained by appropriately combining the technical means disclosed in different embodiments. Furthermore, all academic literature and patent documents described in this specification are incorporated herein by reference.

Claims

1. A method for assisting in the diagnosis of nontuberculous mycobacterial disease, comprising the following steps (1) to (3): (1) contacting a sample containing lymphocytes from a subject with a Mycobacterium avium protein; (2) measuring the amount of cytokines in the sample after contact; and (3) selecting a subject whose cytokine levels are increased compared to the cytokine levels in a sample from a healthy subject contacted with a Mycobacterium avium protein, the Mycobacterium avium protein is at least one protein selected from the group consisting of a protein consisting of the amino acid sequence shown in SEQ ID NO: 1, a protein consisting of the amino acid sequence shown in SEQ ID NO: 2, a protein consisting of the amino acid sequence shown in SEQ ID NO: 3, a protein consisting of the amino acid sequence shown in SEQ ID NO: 4, and a protein consisting of an amino acid sequence having at least 90% or more sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1 to 4; a protein having an amino acid sequence having at least 90% sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1 to 4, which reacts with serum from an NTM disease patient; a step in which the cytokine is a non-Th1 cytokine, and the non-Th1 cytokine is at least one selected from the group consisting of interleukin-10, interleukin-13, and interleukin-17.

2. 2. The method of claim 1, wherein the cytokine is interleukin-10 and / or interleukin-17.

3. The protein comprises at least one protein selected from the group consisting of a protein consisting of the amino acid sequence shown in SEQ ID NO: 1, a protein consisting of the amino acid sequence shown in SEQ ID NO: 2, a protein consisting of the amino acid sequence shown in SEQ ID NO: 3, a protein consisting of the amino acid sequence shown in SEQ ID NO: 4, and a protein consisting of an amino acid sequence having at least 90% or more sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1 to 4, a protein having an amino acid sequence having at least 90% sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1 to 4, which reacts with serum from an NTM disease patient; Further, a reagent for measuring the amount of cytokines is included, A diagnostic aid kit for nontuberculous mycobacterial disease, wherein the cytokine is a non-Th1 cytokine, and the non-Th1 cytokine is at least one selected from the group consisting of interleukin-10, interleukin-13 and interleukin-17.

4. The kit of claim 3 , wherein the reagent comprises an antibody that specifically binds to the cytokine.

5. The kit according to claim 3, further comprising an anti-interleukin-10 antibody and / or an anti-interleukin-17 antibody.

Images