Novel juniper pollen proteins

Abstract

The present disclosure relates to a juniper pollen protein selected from (a)-(c) below.　(a) A protein comprising an amino acid sequence represented by SEQ ID NO: 2. (b) A protein comprising an amino acid sequence represented by SEQ ID NO: 2 with one or more amino acids substituted, deleted, or added, and having a juniper pollen allergen activity. (c) A protein having at least 90% amino acid identity with the amino acid sequence represented by SEQ ID NO: 2, and having a juniper pollen allergen activity.

Description

[Technical Field]

[0001] The present disclosure relates to a novel protein derived from juniper pollen and uses of said protein. [Background technology]

[0002] Hay fever is an allergic disease caused by inhaling pollen dispersed in the air, and presents with symptoms such as allergic conjunctivitis (e.g., itchy and painful eyes), rhinitis, skin inflammation, asthma, etc. Plants of the Cupressaceae family are the main cause of hay fever worldwide, and in Japan, hay fever caused by Japanese cedars (Cryptomeria japonica) and Japanese cypress (Chamaecyparis obtusa) is well known (Non-Patent Document 1).

[0003] Meanwhile, in the United States, Juniperus ashei, a member of the Cupressaceae family, is the main cause of hay fever, and measures such as banning planting of the tree have been implemented (Non-Patent Document 2). It has also been reported that in areas of Japan where juniper (Juniperus rigida), a member of the Juniper genus, is widely distributed, 26.5% of allergy patients are sensitized to the juniper. Therefore, it has been suggested that hay fever caused by Juniperus ashei is an allergen that should be given as much attention as cedar and cypress (Non-Patent Document 3).

[0004] Antihistamines, steroidal anti-inflammatory drugs, anti-leukotriene drugs, degranulation inhibitors, Th2 cytokine inhibitors, etc. are used to treat these allergic diseases, but all of these are merely symptomatic treatments. However, in recent years, a number of allergen immunotherapies, including subcutaneous allergen immunotherapy (SCIT) and sublingual allergen immunotherapy (SLIT), have been developed and approved by the Ministry of Health, Labour and Welfare. Allergen immunotherapy is a treatment that controls the immune response to allergens by administering small amounts of allergens into the body. At present, it is considered the only method that can cure allergic diseases, and the number of treatment options for hay fever is increasing.

[0005] Research and understanding of the causative allergens is essential for the development of allergen immunotherapy. In the United States, highly antigenic allergens called Jun a 1, Jun a 2, and Jun a 3 have been reported in Juniperus ashei pollen (Non-Patent Documents 4, 5, 6), and have already been cloned. However, SCIT and SLIT drugs using Juniperus ashei allergens have not yet been put to practical use. To achieve highly effective allergen immunotherapy for juniper pollinosis, the use of additional novel allergen proteins is necessary.

[0006] Cross-reactivity has also been reported with antigens contained in Cupressaceae pollen. However, it has been reported that SCIT and SLIT against cedar pollen are often ineffective for cypress pollinosis (Non-Patent Documents 7 and 8). Therefore, it is considered essential to use allergens specific to pollen that cause allergies in allergen immunotherapy. Therefore, there is a high medical need for novel Juniperus allergen immunotherapy using allergens specific to Juniperus. [Prior art documents] [Patent documents]

[0007] [Non-Patent Document 1] Gabriella Di Felice, et al., Int Arch Allergy Immunol., 126: 280-289, 2001 [Non-patent document 2] Midoro-Horiuti T, et al., J Allergy Clin Immunol., 104:608-612, 1999 [Non-patent document 3] Tetsuo Oka, Allergy vol. 43, No. 2-2, 301, 1994 [Non-patent document 4] Midoro-Horiuti T, et al., J Allergy Clin Immunol., 104:613-617, 1999 [Non-patent document 5] Yokoyama, et al., Biochem Biophys Res Commun., 275.1:195-202, 2000 [Non-patent document 6] Midoro-Horiuti, et al., J. Immunol., 164, 2188-2192, 2000 [Non-Patent Document 7] Atsushi Yuda, Journal of Japanese Nose Research, Vol. 54, No. 4, 503-508, 2015 [Non-patent document 8] Atsushi Yuda, Journal of the Japanese Society of Otolaryngology, Vol. 120, No. 6, 833-840, 2017 Summary of the Invention [Problem to be solved by the invention]

[0008] The present disclosure relates to providing a novel juniper pollen protein, and diagnostic agents, preventive agents, therapeutic agents, etc. for allergic diseases caused by juniper pollen using the same. [Means for solving the problem]

[0009] The present disclosure relates to the discovery of a new protein from juniper pollen crude antigen that exhibits high reactivity with lymphocytes and serum IgE from patients with cypress pollinosis, and its usefulness as a diagnostic, preventive, or therapeutic agent for allergic diseases caused by juniper pollen.

[0010] That is, one aspect of the present disclosure is as follows. [1] A juniper pollen protein selected from the following (a) to (c): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 (b) a protein consisting of an amino acid sequence in which one or several amino acids are substituted, deleted, or added in the amino acid sequence shown in SEQ ID NO: 2 and having juniper pollen allergen activity; (c) a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and having juniper pollen allergen activity [2] A polynucleotide encoding a juniper pollen protein selected from the following (a) to (c): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 (b) a protein consisting of an amino acid sequence in which one or several amino acids are substituted, deleted, or added in the amino acid sequence shown in SEQ ID NO: 2 and having juniper pollen allergen activity; (c) a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and having juniper pollen allergen activity [3] A polynucleotide selected from the following (d) to (f): (d) a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 1 (e) a polynucleotide that hybridizes under stringent conditions with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 1 and encodes a protein having juniper pollen allergen activity; (f) a polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 1 and encoding a protein having juniper pollen allergen activity; [4] A recombinant vector comprising the polynucleotide described in [3]. [5] A transformant containing the recombinant vector described in [4]. [6] A method for producing the juniper pollen protein, comprising culturing the transformant according to [5] and collecting the juniper pollen protein from the resulting culture. [7] A preventive or therapeutic agent for allergic diseases caused by juniper pollen, comprising the juniper pollen protein according to [1] as an active ingredient. [8] A preventive or therapeutic agent for allergic diseases caused by cedar pollen and / or cypress pollen, comprising the juniper pollen protein according to [1] as an active ingredient. [9] A diagnostic agent for allergic diseases caused by juniper pollen, comprising the juniper pollen protein described in [1] as an active ingredient.

[10] A diagnostic kit for allergic diseases caused by juniper pollen, which contains the juniper pollen protein described in [1] as an active ingredient.

[11] A method for detecting an allergic disease caused by juniper pollen, which comprises reacting a sample with the juniper pollen protein according to [1].

[12] A diagnostic agent for allergic diseases caused by cedar pollen and / or cypress pollen, comprising the juniper pollen protein according to [1] as an active ingredient.

[13] An antibody against juniper pollen protein as described in [1].

[14] An antibody against a juniper pollen protein according to paragraph 13, which is a monoclonal antibody.

[15] Use of the juniper pollen protein according to [1] for producing an agent for preventing or treating an allergic disease caused by juniper pollen.

[16] Use of the juniper pollen protein according to [1] for producing a diagnostic agent for an allergic disease caused by juniper pollen.

[17] The juniper pollen protein according to [1] for preventing or treating allergic diseases caused by juniper pollen.

[18] The juniper pollen protein according to [1], for diagnosing an allergic disease caused by juniper pollen.

[19] A method for preventing or treating an allergic disease caused by juniper pollen, which comprises administering the juniper pollen protein according to [1] to a patient.

[20] A method for diagnosing an allergic disease caused by juniper pollen, comprising administering the juniper pollen protein according to [1] to a patient. Furthermore, one aspect of the present disclosure includes the following.

[21] A kit for detecting juniper pollen proteins, which comprises the antibody according to

[13] or

[14] as an active ingredient.

[22] A method for detecting juniper pollen proteins, comprising reacting the antibody according to

[13] or

[14] with the juniper pollen proteins to detect the juniper pollen proteins. [Effects of the Invention]

[0011] The juniper pollen protein of the present disclosure can be used as a diagnostic agent, preventive agent, therapeutic agent, etc. for allergic diseases caused by juniper pollen. [Brief explanation of the drawings]

[0012] [Figure 1] FIG. 1 shows the results of SDS-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of crude extracts and purified proteins from juniper pollen. [Figure 2] FIG. 1 shows the results of measuring the proliferation response of peripheral blood mononuclear cells from two subjects with tree allergy symptoms (hay fever symptoms) in spring and one healthy subject in response to the addition of purified juniper protein. [Figure 3] This figure shows the results of flow cytometry. Basophils in the peripheral blood of nine subjects with spring tree allergy symptoms were activated by purified recombinant protein, and CD203c expression was increased. In contrast, CD203c expression remained unchanged in basophils in the peripheral blood of two healthy subjects. DETAILED DESCRIPTION OF THE INVENTION

[0013] Juniper pollen protein The juniper pollen protein of the present disclosure is a protein selected from the following (a) to (c): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 (b) a protein consisting of an amino acid sequence in which one or several amino acids are substituted, deleted, or added in the amino acid sequence shown in SEQ ID NO: 2 and having juniper pollen allergen activity; (c) a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and having juniper pollen allergen activity

[0014] The juniper pollen protein of the present disclosure includes proteins (above (b)) consisting of the amino acid sequence shown in SEQ ID NO: 2 in which one or more amino acids have been substituted, deleted, or added, so long as they have juniper pollen allergen activity. Examples of juniper pollen proteins consisting of such amino acid sequences include isoforms of the juniper pollen protein having the amino acid sequence shown in SEQ ID NO: 2. Here, "one or several amino acids" to be deleted, substituted or added means, for example, 1 to 10 amino acids, more preferably 1 to 5 amino acids. The above addition or deletion also includes addition or deletion of one to several amino acids at both ends. A specific example of an isoform is one in which four residues are deleted from the C-terminus.

[0015] Here, "juniper pollen allergen activity" refers not only to the activity of binding to IgE on mast cells and inducing an immediate allergic reaction in atopic humans (De Weck, A.L. et al., Int. Arch. Allergy Immunol., 146:177-189, 2008), but also to the activity of simply binding to IgE in serum. The IgE-binding activity can be measured by the method described in WO 2012 / 105541, etc.

[0016] Furthermore, the juniper pollen proteins of the present disclosure include proteins ((c) above) consisting of proteins that have 90% or more identity with the amino acid sequence shown in SEQ ID NO: 2 when the corresponding sequences in the amino acid sequence shown in SEQ ID NO: 2 are properly aligned, as long as they have juniper pollen allergen activity. Here, the identity with the amino acid sequence shown in SEQ ID NO: 2 is preferably 95% or more, more preferably 98% or more. The identity of the amino acid sequence can be calculated, for example, using BLAST (Basic Local Alignment Search Tool at the National Center for Biological Information) with optional parameters set to the default values.

[0017] The juniper pollen proteins of the present disclosure may also be fused with sequences that aid in purification, such as multiple histidine residues, or proteins to ensure stability during recombinant production.

[0018] The juniper pollen proteins of the present disclosure can be obtained by artificial processes. For example, the juniper pollen proteins of the present disclosure can be obtained as recombinant proteins. For example, the juniper pollen proteins of the present disclosure can be obtained by artificial extraction, isolation, and purification from pollen.

[0019] Known plants belonging to the Juniper genus include mountain cedar (Juniperus ashei), Chinese juniper (Juniperus chinensis), common juniper (Juniperus communis), and Japanese juniper (Juniperus conferta), but are not limited to these.

[0020] Polynucleotides encoding juniper pollen proteins The polynucleotides disclosed herein encode the juniper pollen protein, and preferably include (d) a polynucleotide consisting of the base sequence shown in SEQ ID NO: 1, (e) a polynucleotide that hybridizes under stringent conditions with a polynucleotide consisting of a base sequence complementary to the base sequence shown in SEQ ID NO: 1 and encodes a protein having juniper pollen allergen activity, and (f) a polynucleotide consisting of a base sequence having 90% or more identity to the base sequence shown in SEQ ID NO: 1 and encodes a protein having juniper pollen allergen activity. The polynucleotides of (e) and (f) include variants of the polynucleotide of (d), including naturally occurring allelic variants and non-naturally occurring variants that can be produced using mutagenesis techniques well known in the art.

[0021] The polynucleotides of the present disclosure encompass not only double-stranded DNA but also various single-stranded DNAs and RNAs, such as the sense and antisense strands that constitute them. Antisense strands can be used as probes, etc. DNA includes isolated cDNA obtained, for example, by cloning, chemical synthesis, or a combination thereof. DNA also includes genomic DNA. Furthermore, in addition to the base sequence encoding the polypeptide of the present disclosure, the polynucleotides of the present disclosure may also contain base sequences such as untranslated region (UTR) sequences and vector sequences (including expression vector sequences).

[0022] Examples of stringent conditions include those described in Molecular Cloning: A Laboratory Manual (Fourth Edition, J. Sambrook et al., 2012), such as those in which a solution containing 6xSSC (1xSSC composition: 0.15 M sodium chloride, 0.015 M sodium citrate, pH 7.0), 0.5% SDS, 5x Denhardt's, and 100 mg / mL herring sperm DNA is incubated with a probe at 65°C for 8 to 16 hours for hybridization.

[0023] The identity with the base sequence shown in SEQ ID NO: 1 is 90% or more, preferably 95% or more, and more preferably 98% or more. The identity of the base sequence can be calculated, for example, using BLAST with the option parameters set to the default values.

[0024] Examples of the above-mentioned polynucleotide variants include those in which g at position 86 of the base sequence shown in SEQ ID NO: 1 is changed to t, g at position 154 to c, g at position 242 to c, a at position 265 to g, c at position 278 to a, a at position 289 to g, c at position 341 to t, c at position 424 to t, g at position 454 to a, a at position 461 to g, c at position 466 to t, c at position 484 to a, and c at position 490 Examples include mutations in which the a at the 1st position is changed to c, the 625th g to a, the 645th c to t, the 727th t to c, the 763rd a to g, the 799th a to t, the 907th g to a, the 988th c to t, the 1154th c to t, the 1156th g to a, the 1253rd g to a, and the 1439th a to t, and the mutations have at least one of these mutations.

[0025] Obtaining polynucleotides encoding juniper pollen proteins Polynucleotides encoding juniper pollen proteins of the present disclosure can be cloned from juniper pollen, and cloning methods include known methods such as the shotgun method and PCR method.

[0026] For example, a probe that specifically hybridizes with a portion of the base sequence of the polynucleotide disclosed herein may be prepared and used to screen a genomic DNA library or a cDNA library. Such a probe may have any sequence and length, as long as it specifically hybridizes with at least a portion of the polynucleotide disclosed herein or its complementary strand. Another method involves artificially synthesizing polynucleotides. (Kosuri S et al., Nature Methods 11, 499-507, 2014)

[0027] The polynucleotides of the present disclosure can also be obtained by obtaining a sequence that hybridizes to a polynucleotide comprising a part or all of the polynucleotides of the present disclosure using an appropriate method, such as a PCR method using a polynucleotide comprising a part of the polynucleotides of the present disclosure as a primer, or a method using a polynucleotide comprising a part of the polynucleotides of the present disclosure as a probe.

[0028] For example, in a method using an amplification means such as PCR, primers are prepared from the 5' and 3' sequences (or their complementary sequences) of the polynucleotide of the present disclosure, and these primers are used to carry out an amplification reaction such as PCR using genomic DNA (or cDNA) as a template, thereby amplifying the DNA region sandwiched between the two primers, thereby making it possible to obtain large quantities of DNA fragments containing the polynucleotide.

[0029] The polynucleotides provided by the present disclosure can also be prepared by modifying a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 1, for example, by planned or random mutagenesis. Here, when introducing mutations intentionally, the mutations can be planned by taking into consideration, for example, characteristic sequences in the polynucleotide sequence. Methods for randomly introducing mutations include, for example, PCR and mutagen treatment. Methods for intentionally introducing mutations include site-directed mutagenesis, and more specifically, this can be carried out using, for example, the Site-Directed Mutagenesis System Mutan-Super Express Km Kit (Takara Bio). Recombinant PCR (PCR protocols, Academic Press, New York, 1990) can also be used.

[0030] Production of juniper pollen protein The juniper pollen protein of the present disclosure can be obtained by separating and purifying juniper pollen. The separation and purification method is not particularly limited, and for example, juniper pollen extract may be separated and purified using conventionally known techniques such as gel filtration, ion exchange chromatography, and affinity chromatography.

[0031] Pollen sources include, but are not limited to, mountain cedar (Juniperus ashei), Chinese cedar (Juniperus chinensis), common juniper (Juniperus communis), Japanese juniper (Juniperus conferta), etc. Mountain cedar (Juniperus ashei) is preferred. In addition, a recombinant vector prepared by incorporating the polynucleotide of the present disclosure into an appropriate vector can be introduced into a host cell to express juniper pollen proteins intracellularly or extracellularly, and then the proteins can be harvested.

[0032] The vector into which the polynucleotide of the present disclosure is inserted is not particularly limited as long as it is replicable in the above-mentioned host, and can be appropriately determined depending on the type of host into which it is introduced, the method of introduction, etc. Examples include plasmid DNA, phage DNA, and viral vectors. Widely available and readily available vector DNAs are used for constructing expression vectors. Examples include pUC19 (Takara Bio), pTV118N (Takara Bio), pMAMneo (Clontech), pGEX (GE Healthcare), pET160 (Invitrogen), pDEST (Invitrogen), pIEx (Merck Millipore), and pBacPAK (Clontech). Examples of viral vectors include baculovirus vectors, retrovirus vectors, lentivirus vectors such as human immunodeficiency virus (HIV), adenovirus vectors, adeno-associated virus vectors (AAV vectors), and DNA and RNA viruses such as herpesvirus, vaccinia virus, poxvirus, poliovirus, Simbis virus, Sendai virus, and Simian virus-40 (SV-40).

[0033] The host is not particularly limited as long as it is a living cell that can be transformed, and examples thereof include bacteria such as Escherichia coli and Bacillus subtilis, fungi such as yeast and filamentous fungi, cultured insect cells such as Sf9 cells, insects such as silkworms, animal cells, plants, and plant-derived cells.

[0034] Transformation of a host using the recombinant vector can be carried out using the protoplast method, competent cell method, electroporation, or the like. The resulting transformant can be cultured under appropriate conditions using a medium containing assimilable carbon sources, nitrogen sources, metal salts, vitamins, and the like. Proteins can be collected and purified from the culture solution thus obtained by standard methods to obtain the juniper pollen protein of the present disclosure (Sambrook et al., Molecular Cloning: A Laboratory Manual, Fourth Edition, Cold Spring Harbor Laboratory Press, 2012). For example, when Escherichia coli is used as the host, methods described in the pET System Manual, 10th edition (Novagen) can be used.

[0035] Preventive or therapeutic agent for allergic diseases caused by juniper pollen The juniper pollen protein of the present disclosure can be used as a preventive or therapeutic agent for allergic diseases caused by juniper pollen, and can be administered to a human (patient) in need thereof to prevent or treat allergic diseases caused by juniper pollen.

[0036] Here, allergic diseases caused by juniper pollen include any allergic diseases caused by specific antigens of juniper pollen, specifically, for example, atopic bronchial asthma, allergic rhinitis, allergic conjunctivitis, atopic dermatitis, etc. Such a preventive or therapeutic agent for allergic diseases caused by juniper pollen can be used, for example, as a hyposensitization therapy agent for allergic diseases caused by juniper pollen.

[0037] As a result of amino acid homology analysis using GENETYX Ver. 12, the juniper pollen protein of the present disclosure is a protein with an amino acid sequence different from that of Cry j 1, Cry j 2, Cry j 3, Cha o 1, and Cha o 2, which have been reported as major pollen allergens associated with the onset of cedar pollinosis and cypress pollinosis, and is therefore a different allergen from the previously known Cry j 1, Cry j 2, Cry j 3, Cha o 1, and Cha o 2. Therefore, by combining the juniper pollen protein of the present disclosure with the above-mentioned known proteins, more useful hyposensitization therapy becomes possible. Furthermore, because the juniper pollen protein of the present disclosure is different from known proteins, it becomes possible to newly detect allergic diseases caused by juniper pollen that cannot be detected by known proteins.

[0038] The juniper pollen protein of the present disclosure showed a positive reaction in all subjects with spring tree allergy symptoms in a basophil activation test (BAT), which measures the phenomenon induced in basophil cells by IgE binding (Example 2). This is significantly higher than the IgE binding of known pollen proteins Jun a 1 (71.4%, Non-Patent Document 2) and Jun a 3 (42.9%, Non-Patent Document 6). Regarding Jun a 2, its homolog Cha o 2 has been reported to have an IgE binding positivity rate of 82.5% (Allergology International, 70

[2021] :281-290). Therefore, a preventive or therapeutic agent for allergic diseases caused by juniper pollen using the juniper pollen protein of the present disclosure is applicable to a wider range of patients and can be said to be a useful means of resolving current issues.

[0039] Furthermore, in order to improve the efficacy of allergen immunotherapy, it is useful to identify proteins that may be allergens for individual patients and sensitize them using these. Traditionally, allergen identification was based on the detection of specific IgE against a total extract containing allergenic and non-allergenic components extracted from the allergen source. However, in recent years, molecular or component-resolved diagnostics (CRD) have been used, which detect IgE antibodies against individual molecules (allergen components) to which the patient is sensitized, i.e., analyze and diagnose allergens at the causative protein level.

[0040] CRD allows for more detailed testing of cross-reactivity, risk molecules, and prognostically significant sensitization based on individual IgE profiles and allergen patterns (Curr Allergy Asthma Rep (2013) 13:110-117), making it possible to provide optimal allergen immunotherapy for each individual patient. Therefore, the provision of the novel allergenic protein disclosed herein is of great significance in that it can realize effective allergen immunotherapy for a greater number of allergy patients. In this case, the allergenic protein does not replace existing allergenic proteins, but is used in conjunction with existing allergenic proteins, contributing to expanding the range of allergen options for sensitizing individual patients. Therefore, the novel allergenic protein disclosed herein does not need to be concerned with its effectiveness compared to conventional allergenic proteins. As long as it has allergenic activity that is clearly different from that of conventional allergenic proteins, it can contribute to the diagnosis of allergic diseases such as CRD and the treatment thereof, and its industrial utility value can be said to be high.

[0041] When the preventive or therapeutic agent for allergic diseases caused by juniper pollen of the present disclosure is used as a hyposensitization therapeutic agent, it is preferable to prepare the juniper pollen protein of the present disclosure as is, or dried into powder, or as a compounded agent to which commonly used adjuvants and various additives, such as stabilizers, excipients, solubilizers, emulsifiers, buffers, soothing agents, preservatives, colorants, etc. are added in a conventional manner as needed. For example, purified juniper pollen protein in powder form can be dissolved in physiological saline containing phenol and used as a stock solution of antigen for hyposensitization therapy.

[0042] The preventive or therapeutic agent for allergic diseases caused by juniper pollen of the present disclosure can be administered by local or systemic administration via a conventional route, for example, oral or parenteral (transdermal, transmucosal, intradermal, subcutaneous, intramuscular, intraperitoneal, etc.) Dosage forms applicable to these administration methods include, for example, troches, sublingual tablets, injections, eye drops, intranasal sprays, poultices, creams, lotions, etc.

[0043] The disclosed method for diagnosing an allergic disease caused by juniper pollen can be carried out by a local or systemic administration method via a conventional route of administration, for example, oral or parenteral (transdermal, transmucosal, intradermal, subcutaneous, intramuscular, intraperitoneal, etc.) Dosage forms applicable to these administration methods include, for example, troches, sublingual tablets, injections, eye drops, intranasal sprays, poultices, creams, lotions, etc.

[0044] The dosage and frequency of administration of the preventive or therapeutic agent for allergic diseases caused by juniper pollen of the present disclosure vary depending on the route of administration, symptoms, etc., but are appropriately selected, for example, to be in the range of approximately 0.1 to 1000 μg per dose for an adult, and are administered once to several times per week.

[0045] Juniper pollen is also known as an allergen for hay fever caused by mountain cedar pollen, and is a plant of the cupressaceae family that causes hay fever in regions such as France, Italy, and Australia. The present disclosure is expected to be effective in treating hay fever caused not only by juniper pollen, cedar pollen, and cypress pollen, but also by mountain cedar pollen.

[0046] It is known that the positive rate of juniper antibodies is high among Japanese cedar pollinosis patients, and particularly high among Japanese cypress pollinosis patients. The present disclosure can be used to treat Japanese cedar pollinosis and Japanese cypress pollinosis, and is expected to be effective.

[0047] Diagnosis of allergic diseases caused by juniper pollen The juniper pollen protein of the present disclosure serves as a diagnostic agent for allergic diseases caused by juniper pollen, and can be used to diagnose allergic diseases caused by juniper pollen. Such diagnostic agents for allergic diseases caused by juniper pollen are used, for example, as skin reaction diagnoses for allergic diseases caused by juniper pollen, i.e., as intradermal or prick test reagents. In addition, by preparing reagents for specific IgE antibody tests, diagnosis using patient serum or plasma is possible. (Nasal Allergy Treatment Guidelines - Perennial Rhinitis and Hay Fever - 2013 Edition, Life Science Co., Ltd.)

[0048] When used as a skin reaction diagnostic reagent, the juniper pollen protein of the present disclosure obtained by the above-mentioned method is, for example, dried to a powder, which is then dissolved in physiological saline containing phenol or glycerin and diluted for use. Reagents for testing specific IgE antibodies include methods in which IgE antibodies in a patient sample are bound to the juniper pollen protein of the present disclosure in an aqueous phase or on a solid phase, and then detected based on the principles of fluoroenzyme immunoassay, chemiluminescence enzyme immunoassay, enzyme immunoassay, etc., but are not limited to these.

[0049] Thus, the present disclosure provides a method for detecting a skin reaction, which comprises reacting a juniper pollen protein with a sample. The present disclosure also provides a kit for detecting a skin reaction, which comprises the juniper pollen protein. Here, "reacting" includes both contacting the juniper pollen protein of the present disclosure with a patient sample and allowing IgE antibodies in the sample to bind to the juniper pollen protein of the present disclosure.

[0050] When the juniper pollen protein of the present disclosure is used as a kit, the protein can be combined with other solvents or solutes to form a composition. For example, distilled water, pH buffer reagents, surfactants, etc. can be combined. The juniper pollen protein can also be used after being labeled with an enzyme or biotin. Examples of labeling enzymes that can be used include horseradish peroxidase (HRP), alkaline phosphatase, malate dehydratase, α-glucosidase, β-galactosidase, and gold colloid. When the present disclosure is used in a kit, in addition to the protein of the present disclosure, the kit may contain the above-mentioned solvent, solute, enzyme-labeled reagent, substrate solution, reaction stop solution, washing solution, instructions for use, and the like.

[0051] Antibodies against juniper pollen proteins The antibody against the juniper pollen protein of the present disclosure is an antibody that can specifically bind to the juniper pollen protein of the present disclosure. The antibody refers to immunoglobulins (IgA, IgD, IgE, IgG, IgM, and antigen-binding fragments thereof (Fab fragment, F(ab')2 fragment, Fc fragment, scFv, etc.)), including, but not limited to, polyclonal antibodies, monoclonal antibodies, single-chain antibodies, anti-idiotype antibodies, and humanized antibodies. The above-mentioned antibody can be produced using various known methods, and the production method is not particularly limited.

[0052] For example, a method for obtaining a monoclonal antibody of the present disclosure involves first immunizing a non-human mammal with juniper pollen protein or a partial peptide thereof, and then collecting antibody-producing cells (e.g., B cells) from the immunized animal. These antibody-producing cells are then fused with myeloma cells to produce hybridomas (fused cell lines). The antibodies produced by these hybridomas are then collected to obtain the desired monoclonal antibody.

[0053] The amino acid sequence that serves as the basis for synthesizing the antigen peptide is a partial sequence of the full-length amino acid sequence of juniper pollen protein, and a sequence of approximately 10 to 50 consecutive amino acids is selected from that amino acid sequence. The partial peptide can be synthesized by methods known to those skilled in the art, such as the Fmoc method or the tBoc method.

[0054] The type of non-human mammal to be immunized is not particularly limited, and examples include mice, rats, guinea pigs, rabbits, dogs, goats, etc., with mice being preferred. The total amount of antigen administered per animal is 10 to 150 μg. When immunizing with an antigen, it is common to mix the antigen solution with an adjuvant, and examples of adjuvants include Freund's complete adjuvant (FCA), Freund's incomplete adjuvant (FIA), and aluminum hydroxide adjuvant. Immunization is typically carried out by intravenous, subcutaneous, intraperitoneal, intramuscular, or subcutaneous injection into the footpad. The interval between immunizations is not particularly limited, and immunizations are typically performed 1 to 10 times at intervals of several days to several weeks, preferably 2 to 3 weeks. Antibody-producing cells are prepared from spleen cells or regional lymph nodes of an immunized non-human mammal.

[0055] Cell fusion is a procedure performed to fuse the above-mentioned antibody-producing cells with myeloma cells to produce cells (hybridomas) that proliferate semipermanently while producing antibodies. Those skilled in the art can fuse antibody-producing cells with myeloma cells using known cell fusion methods. Next, hybridomas producing the desired antibodies are selected from the cells after cell fusion. 10 to 14 days after cell fusion, the selected cells form colonies in HAT medium. Culture supernatants are collected from each well of the colony-positive culture plates, and antibody titers against juniper pollen proteins are confirmed by ELISA or other methods.

[0056] Finally, the cells in the selected wells are cloned to separate them into single cells. For cloning, the cell suspension is diluted appropriately with RPMI 1640 medium containing 10-20% FCS, and the cells are seeded into a 96-well culture plate so that one cell is placed in each well. After seeding, the culture supernatant from colony-positive wells is collected. The cells in the selected wells are then expanded to a certain extent to establish hybridoma lines. Cloning can be performed several times as needed.

[0057] Monoclonal antibodies specific to juniper pollen proteins are purified and collected from the established hybridoma strains by various methods, including culturing the hybridomas in a medium with a reduced serum concentration, culturing the hybridomas in a commercially available serum-free medium, and injecting the hybridomas into the abdominal cavity of an animal, collecting ascites, and then preparing the antibodies from the ascites.

[0058] The epitope (antigenic determinant) of the antibody against the juniper pollen protein of the present disclosure is not limited as long as it is at least a part of the juniper pollen protein that is the antigen. Furthermore, the antibody against juniper pollen protein is not limited to the monoclonal antibody against juniper pollen protein produced by the above hybridoma, but is included in the antibodies of the present disclosure as long as it binds to an epitope recognized by the monoclonal antibody produced by these hybridomas. The "epitope" referred to here refers to the epitope recognized by the monoclonal antibody produced by the above hybridoma.

[0059] The monoclonal antibodies of the present disclosure can also be recombinant antibodies or antigen-binding fragments prepared and expressed by recombinant means. For example, the antibodies of the present disclosure can be chimeric, humanized, or fully human. The recombinant antibodies of the present disclosure can be produced by recombinant expression of heavy and light chains.

[0060] To express a recombinant antibody, for example, a recombinant expression vector carrying nucleic acids encoding the antibody heavy and light chains is introduced into host cells, and the host cells containing the introduced vector are cultured. The antibody of interest is then recovered from the host cell culture. Standard recombinant methods in the art (Sambrook et al., Molecular Cloning: A Laboratory Manual, Fourth Edition, Cold Spring Harbor Laboratory Press, 2012) can be used to obtain antibody heavy and light chain genes, incorporate these nucleic acids into an expression vector, and introduce the vector into host cells.

[0061] Furthermore, the polyclonal antibodies of the present disclosure can be obtained by immunizing a non-human mammal with juniper pollen protein or a partial peptide thereof, collecting blood samples after three to four immunizations, and measuring the antibody titer by ELISA or the like. After confirming that the antibody titer has risen sufficiently, whole blood is collected and the antibodies are separated and purified by a commonly used method or the like.

[0062] The antibodies can be used to identify organisms or tissues or cells thereof that express the juniper pollen proteins of the present disclosure. For example, they can be used to measure the presence or absence of juniper pollen proteins in the atmosphere, indoor spaces, or human mucous membranes. The measurement can be performed by known immunological methods, such as ELISA.

[0063] Juniper pollen proteins are allergens in cypress pollinosis, so juniper pollen proteins can be detected by reacting the antibody of the present disclosure with a sample and measuring the amount of juniper pollen proteins in the sample. Therefore, the present disclosure provides a method for detecting juniper pollen proteins, comprising reacting the antibody or fragment thereof of the present disclosure with the juniper pollen proteins to detect the juniper pollen proteins. In addition, in the present disclosure, antibodies or fragments thereof against juniper pollen proteins can be used as reagents or kits for detecting juniper pollen proteins. The kits in the present disclosure can be used in the same manner as when juniper pollen proteins are used as kits.

[0064] The present disclosure will be specifically described below using examples, but the present disclosure is not limited to these examples. [Example]

[0065] Example 1 Purification of juniper proteins Five grams of juniper pollen (Juniperus ashei) was added to 200 mL of extraction buffer (25 mM Tris buffer, pH 8.0), disrupted using an ultrasonic generator (UD-201, TOMY), and centrifuged at 10,000 x g for 10 minutes to collect the supernatant. This supernatant was applied to a Vivapure Q Maxi H (Sartorius) column equilibrated with 25 mM Tris buffer, pH 8.0, and the non-adsorbed fraction was collected. This was then applied to a Vivapure S Maxi H (Sartorius) column equilibrated with 20 mM acetate buffer, pH 5.2, for adsorption. After washing with 20 mM acetate buffer, pH 5.2, containing 0.35 M NaCl, the fraction was eluted with 20 mM acetate buffer, pH 5.2, containing 0.5 M NaCl. The results of SDS-PAGE of the purified juniper protein are shown in Figure 1.

[0066] Example 2 Confirmation of allergenic activity of purified juniper protein (i) Lymphocyte proliferative response to purified juniper protein Peripheral blood mononuclear cells were isolated from 30 mL of peripheral blood obtained from two subjects with spring tree allergy symptoms and one healthy individual, and cultured at 1 × 10 cells / mL in RPMI-1640 medium containing 10% inactivated autologous plasma. 6 180 μL of the prepared cell suspension and 20 μL of purified juniper protein solution (concentration 100 μg / mL) were seeded into a 96-well plate (2 × 10 5After culturing for 3 days at 37°C and 5% CO2, 3H-thymidine was added and the amount of thymidine taken up was measured as radioactivity up to 16 hours after the addition to evaluate cell proliferation. The stimulation index was calculated by dividing the amount of 3H-thymidine taken up with the addition of purified juniper protein by the amount taken up without the addition of juniper protein, and the results are shown in Figure 2.

[0067] Generally, in lymphocyte stimulation tests in clinical examinations, a stimulation index of 1.8 or higher is considered a positive criterion (Uchida Shigeyuki et al., Liver, Vol. 30, No. 4, pp. 439-443, 1989). Based on this criterion, two out of two subjects (100%) with allergic symptoms were determined to be positive. On the other hand, the healthy subjects were negative. These results indicate that people with tree allergy symptoms in spring are frequently sensitized to the protein of the present disclosure at the T cell level.

[0068] (ii) Basophil activation by purified juniper proteins It is known that CD203c expression is increased in basophils stimulated and activated by allergens (De Weck, AL. et al., Int. Arch. Allergy Immunol., 146:177-189, 2008). Based on this principle, we analyzed basophil activation in the blood of subjects with spring tree allergy symptoms and healthy controls using an Allergenicity Kit (Beckman Coulter).

[0069] Specifically, 20 μL of the purified juniper protein solution of the present disclosure was added to 100 μL of heparinized whole blood to a final concentration of 100 ng / mL, and 20 μL of PBS(-) was added to the negative control sample. Subsequently, 20 μL of an antibody cocktail containing CD3-PC7, CRTH2-FITC, and CD203c-PE was added to all samples and incubated at 37°C for 15 minutes. 100 μL of reaction stop solution and 2 mL of hemolysis fixative were added, and the mixture was incubated at room temperature for 10 minutes. After centrifugation (200 x g, 5 minutes), the supernatant was removed, and 3 mL of phosphate buffered saline (PBS) was added, followed by centrifugation again.

[0070] After removing the supernatant, the cells were suspended in PBS containing 0.1% formaldehyde and analyzed using a flow cytometer (FACSVerse, BD Biosciences). Basophils were selected from the blood cells based on CD3-PC7 negative and CRTH2-FITC positive markers, and the intensity of CD203c expression was analyzed. The data presented represent the percentage of CD203c-positive basophils (%) in samples stimulated with the protein solution of the present disclosure minus the percentage of CD203c-positive basophils (%) in each negative control sample. A value of 1.5 or higher, twice the maximum value of 0.75% in healthy individuals, was considered positive.

[0071] As a result, as shown in Figure 3, in two of two healthy subjects, no enhancement of CD203c expression was observed when purified juniper protein was added, whereas in nine of nine subjects (100%) who showed tree allergy symptoms in spring, enhancement of CD203c expression was observed, and the difference was significant (p<0.05, Welch's t test). Therefore, it was demonstrated that subjects who showed tree allergy symptoms in spring frequently had IgE that bound to the purified juniper protein of the present disclosure, and further that the protein of the present disclosure had allergenic activity.

[0072] Example 3 Determination of the partial internal amino acid sequence of purified juniper protein To clarify the partial amino acid sequence within the protein of the present disclosure, we analyzed the peptide mixture obtained by trypsin digestion of purified juniper protein. After SDS-PAGE of the purified juniper protein, the protein band to be analyzed was excised from the SDS gel. The excised gel fragment was subjected to trypsin hydrolysis to obtain a peptide mixture. The peptide mixture was analyzed by LC-MS / MS, and peptides represented by LPLLAR [partial amino acid sequence 1 (SEQ ID NO: 3)], WIVDETTGLR [partial amino acid sequence 2 (SEQ ID NO: 4)], ATVGETFAR [partial amino acid sequence 3 (SEQ ID NO: 5)], YFNPNTWVK [partial amino acid sequence 4 (SEQ ID NO: 6)], and IRNPDFIAR [partial amino acid sequence 5 (SEQ ID NO: 7)] were obtained.

[0073] Example 4 Nucleotide sequence determination of purified juniper proteins <Juniper total RNA extraction> 25 mL of Plant RNA Isolation Reagent (Invitrogen) was added to 2 g of frozen juniper pollen, mixed, and then allowed to stand at room temperature for 5 minutes. After centrifugation at 4°C (2600 x g, 5 minutes), the upper layer was decanted and filtered through a 100 μm mesh. To the collected filtrate, 1 / 5 volume of 5 M NaCl and 3 / 5 volumes of chloroform were added. After centrifugation at 4°C (2600 x g, 30 minutes), 20 mL of the upper layer was collected, to which 9 / 10 volumes of isopropyl alcohol was added and stirred. After allowing to stand at room temperature for 10 minutes, the mixture was centrifuged at 4°C (2600 x g, 30 minutes) to precipitate the RNA. The supernatant was removed, and the RNA pellet was washed with 10 mL of 75% ethanol. After further centrifugation at 4°C (2600 xg, 5 minutes), the supernatant was removed, and the total RNA was dried at room temperature and then dissolved in 200 µL of RNase-free water.

[0074] RNA was purified from the total RNA solution using an RNeasy Mini kit (Qiagen) as follows: 200 μL of 70% ethanol solution was added to the total RNA solution, then loaded onto an RNeasy Mini column and centrifuged (10,000 rpm for 15 seconds). The column was then washed with 350 μL of Buffer RW1 and then treated with DNase using an RNase-Free DNase set (Qiagen). After washing with 350 μL of Buffer RW1, the column was washed twice with 500 μL of Buffer RPE. After washing, 30 μL of RNase-free HO was added, and the resulting solution was collected as cleaned-up total RNA.

[0075] <Preparation of Juniper cDNA> cDNA was synthesized from the resulting cleaned total RNA using the Superscript IV First-Strand Synthesis System for RT-PCR (Invitrogen). 2 μg of total RNA was dissolved in 11 μL of purified water, and 1 μL of 50 μM oligo(dT)20 and 1 μL of 10 mM dNTPs were added. The mixture was then incubated at 65°C for 5 minutes. After cooling the sample on ice, 4 μL of 5x SSIV Buffer, 1 μL of 100 mM DTT, 1 μL of Ribonuclease Inhibitor, and 1 μL of SuperScript IV Reverse Transcriptase were added and mixed. The reaction was then stopped by incubation at 50°C for 10 minutes and then at 80°C for 10 minutes. Next, 1 μL of RNase H was added to the sample and incubated at 37°C for 20 minutes to obtain juniper cDNA.

[0076] <Cloning> Using juniper cDNA as a template, PCR was performed using Primer 1 (ATGACGATGGCGGCGCTA: SEQ ID NO: 8) as the sense primer and Primer 2 (TCAAAGTTGATGCAACAATTGTTTGTTG: SEQ ID NO: 9) as the antisense primer using KOD Fx Neo (TOYOBO). PCR reaction mixture composition: 10 μL of 5x PrimeSTAR GXL Buffer, 4 μL of dNTP Mixture (2.5 mM each), 0.5 μL of cDNA, 1.5 μL of each 10 mM Primer, 1 μL of PrimeSTAR GXL DNA Polymerase, and up to 50 μL of sterile purified water. Cycle conditions: 35 cycles of 98°C for 10 seconds and 68°C for 2 minutes

[0077] The PCR product was purified using the Wizard SV Gel and PCR Clean-Up System (Promega) and then cloned into the pCR 2.1-TOPO TA Vector using the TOPO TA Cloning Kit for Sequencing (Thermo Fischer). The nucleotide sequence of the obtained vector was analyzed to obtain sequence information.

[0078] Furthermore, for analysis of the 3' sequence, a juniper cDNA with an anchor sequence added to the 3' end was prepared using the 5' / 3' RACE kit 2nd generation (Roche). Nested PCR was performed using two primers, Primer 3 (AGTGGATGTGTTTAGATGGG: SEQ ID NO: 10) and Primer 4 (AGCAGTGGTTTAAAGTCATAA: SEQ ID NO: 11), with KOD Fx neo. The PCR product was purified using the Wizard SV Gel and PCR Clean-Up System (Promega). The purified PCR product was then inserted into the pCR 2.1-TOPO TA Vector using the TOPO TA Cloning Kit for Sequencing (Thermo Fischer). The resulting vector was sequenced to obtain the 3'-terminal sequence.

[0079] The cDNA encoding the juniper protein of the present disclosure was encoded by the polynucleotide shown in SEQ ID NO: 1. The amino acid sequence (SEQ ID NO: 2) encoded by SEQ ID NO: 1 contains partial amino acid sequences 1 to 5, indicating that the protein of the present disclosure is a protein encoded by the polynucleotide of SEQ ID NO: 1. [Sequence List Free Text]

[0080] SEQ ID NOs: 1 to 7: synthetic peptides SEQ ID NOs: 8 to 11: Synthetic DNA

Claims

1. A juniper pollen protein selected from the following (a) to (c): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 (b) a protein consisting of an amino acid sequence in which one or several amino acids are substituted, deleted, or added in the amino acid sequence shown in SEQ ID NO: 2 and having juniper pollen allergen activity. (c) a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and having juniper pollen allergen activity.

2. A polynucleotide encoding a juniper pollen protein selected from the following (a) to (c): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 (b) a protein consisting of an amino acid sequence in which one or several amino acids are substituted, deleted, or added in the amino acid sequence shown in SEQ ID NO: 2 and having juniper pollen allergen activity. (c) a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and having juniper pollen allergen activity.

3. A polynucleotide of (d) or (e) below: (d) a polynucleotide consisting of the base sequence shown in SEQ ID NO: 1 (e) a polynucleotide that consists of a base sequence having 90% or more identity to the base sequence shown in SEQ ID NO: 1 and encodes a protein having juniper pollen allergen activity;

4. A recombinant vector comprising the polynucleotide of claim 3.

5. A transformant comprising the recombinant vector according to claim 4.

6. A method for producing juniper pollen proteins, which comprises culturing the transformant according to claim 5 and collecting juniper pollen proteins from the resulting culture.

7. A preventive or therapeutic agent for allergic diseases caused by juniper pollen, comprising the juniper pollen protein according to claim 1 as an active ingredient.

8. A preventive or therapeutic agent for allergic diseases caused by cedar pollen and / or cypress pollen, comprising the juniper pollen protein according to claim 1 as an active ingredient.

9. A diagnostic agent for allergic diseases caused by juniper pollen, comprising the juniper pollen protein according to claim 1 as an active ingredient.

10. A kit for diagnosing allergic diseases caused by juniper pollen, which comprises the juniper pollen protein of claim 1 as an active ingredient.

11. A diagnostic agent for allergic diseases caused by cedar pollen and / or cypress pollen, comprising the juniper pollen protein according to claim 1 as an active ingredient.

12. An antibody against the juniper pollen protein according to claim 1.

13. The antibody against juniper pollen protein according to claim 12, wherein the antibody is a monoclonal antibody.

14. Use of the juniper pollen protein according to claim 1 for producing an agent for preventing or treating allergic diseases caused by juniper pollen.

15. 10. Use of the juniper pollen protein according to claim 1 for the production of a diagnostic agent for allergic diseases caused by juniper pollen.

16. The juniper pollen protein according to claim 1 for preventing or treating allergic diseases caused by juniper pollen.

17. The juniper pollen protein according to claim 1, for diagnosing an allergic disease caused by juniper pollen.

Images