A promoter highly active in activated T cells

Abstract

The present invention provides a promoter that is highly active in activated T cells, which comprises a CMV enhancer, an IFNγ promoter, and a human T-cell leukemia virus long terminal repeat sequence linked in this order from the 5' to the 3' end. The promoter exhibits stronger activity in activated immune cells than existing promoters, but has low or no activity in other non-immune cells.

Description

[Technical Field]

[0001] The present invention relates to promoters that are highly active in activated T cells. [Background technology]

[0002] A promoter is a DNA sequence that is usually located upstream of the 5' end of a structural gene and that RNA polymerase recognizes, binds to, and initiates transcription. The promoter is one of the important factors that affect the expression efficiency of an introduced gene, and selecting a highly efficient promoter is the key to achieving highly efficient expression of a foreign gene.

[0003] According to the transcription mode of promoters, they are divided into three types: constitutive promoters, tissue or organ specific promoters and inducible promoters.

[0004] A constitutive promoter is one that, under the regulation of a constitutive promoter, does not show any significant differences in gene expression in different tissues, organs, or developmental stages. Commonly used constitutive promoters in mammals include the virus-derived mouse or human cytomegalovirus (CMV) promoter (abbreviated as mCMV and hCMV, respectively) and the simian vacuolar virus SV40 promoter; the natural human genome-derived EF1α promoter, ubiquitin promoter (abbreviated as Ubi), β-actin promoter, PGK-1 promoter, Rosa26 promoter, HSP70 promoter, GAPDH promoter, eIF4A1 promoter, Egr1 promoter, FerH promoter, SM22α promoter, and endothelin-1 promoter.

[0005] Maintaining efficient and stable expression of exogenous genes is crucial for tumor immunotherapy. However, while some viral constitutive promoters (e.g., the CMV promoter) exhibit high transient expression activity, their expression is easily turned off due to epigenetic modifications. On the other hand, some natural constitutive or tumor-specific human promoters exhibit stable expression, but their expression activity is relatively weak, making it difficult to meet the needs of immunotherapy. Therefore, researchers have designed and constructed a series of artificial chimeric promoters containing cis-elements, such as the widely used chimeric promoter CAG (human CMV enhancer-chicken β-actin promoter-rabbit β-globin intron). These artificial chimeric promoters contain a promoter core sequence that primarily stabilizes expression, as well as upstream enhancers or downstream introns that can enhance expression efficiency.

[0006] An enhancer is a DNA sequence that increases the transcription frequency of its associated gene, thereby increasing the transcription of downstream genes through a promoter. Effective enhancers can be located at the 5' end or 3' end of a gene, or in an intron of a gene. The effect of an enhancer is very pronounced, and can increase the frequency of gene transcription by 10-200 times, or even 1,000 times. Summary of the Invention

[0007] The present invention constructs a promoter that combines a CMV enhancer, an IFNγ promoter, and the long terminal repeat (LTR) sequence of HTLV (human T-cell leukemia virus), and the promoter exhibits stronger activity than existing promoters in activated immune cells, but exhibits low or no activity in other non-immune cells.

[0008] The present invention also provides a promoter, which comprises a CMV enhancer, an IFNγ promoter, and a human T-cell leukemia virus long terminal repeat sequence linked in this order from the 5' end to the 3' end.

[0009] In one or more embodiments, the CMV enhancer is selected from a CMV enhancer having the nucleotide sequence set forth in SEQ ID NO:8 or a CMV enhancer derived from human CMV that has at least 97% sequence identity to the nucleotide sequence set forth in SEQ ID NO:8.

[0010] In one or more embodiments, the IFNγ promoter is selected from an IFNγ promoter having the nucleotide sequence set forth in SEQ ID NO:4, or an IFNγ promoter derived from a human having at least 97% sequence identity to the nucleotide sequence set forth in SEQ ID NO:4.

[0011] In one or more embodiments, the human T-cell leukemia virus long terminal repeat sequence is selected from a long terminal repeat sequence having the nucleotide sequence set forth in SEQ ID NO:3, or a long terminal repeat sequence derived from a human T-cell leukemia virus having at least 97% sequence identity to the nucleotide sequence set forth in SEQ ID NO:3.

[0012] In some embodiments, the present invention further provides a nucleic acid molecule whose base sequence is complementary to the base sequence of the promoter described above.

[0013] The present invention further provides a nucleic acid construct comprising a promoter according to the present invention and a gene of interest operably linked to the promoter.

[0014] In one or more embodiments, the nucleic acid construct is an expression cassette.

[0015] In one or more embodiments, the gene of interest encodes an autocrine antibody, preferably an immune checkpoint antibody, such as PD-1, CTLA4, PD-L1, LAG-3, TIM-3, TIGIT, and VISTA antibodies, more preferably a nanobody derived from alpaca.

[0016] In one or more embodiments, the gene of interest encodes a cytokine.

[0017] The present invention further provides a vector containing a promoter or a nucleic acid construct described in the present invention.

[0018] In one or more embodiments, the vector is an expression vector or a cloning vector.

[0019] Additionally provided are host cells containing the promoters, nucleic acid constructs or vectors described herein.

[0020] In one or more embodiments, the host cell is an immune cell, preferably a T cell, the genome of which incorporates a nucleic acid construct described in any of the embodiments herein; preferably, the immune cell further expresses a CAR or contains a CAR expression vector.

[0021] Further provided are nucleic acid constructs or methods for enhancing expression of a gene of interest in activated immune cells or for enhancing expression in activated immune cells. or the application of the promoters described in the present invention in the preparation of vectors. [Brief explanation of the drawings]

[0022] [Figure 1] Figure 1: pS338B-EGFP plasmid map. [Figure 2] Figure 2: pS-IFPT-EGFP plasmid map. [Figure 3] Figure 3: pS-IL3en-EGFP plasmid map. [Figure 4] Figure 4: pS-uIFP-EGFP plasmid map. [Figure 5] Figure 5: pS-uIFPT-EGFP plasmid map. [Figure 6]Figure 6: pS-CIFT-EGFP plasmid map. [Figure 7] Figure 7: pS-ILFP-EGFP plasmid map. [Figure 8] Figure 8: pS-ILPT-EGFP plasmid map. [Figure 9] Figure 9: pS-uILP-EGFP plasmid map. [Figure 10] Figure 10: pS-uILT-EGFP plasmid map. [Figure 11] Figure 11: pS-CILT-EGFP plasmid map. [Figure 12] Figure 12: pS-ILFP-EGFP plasmid map. [Figure 13] Figure 13: pS-IFen-EGFP plasmid map. [Figure 14] Figure 14: pS-uIFen-EGFP plasmid map. [Figure 15] Figure 15: pS-CIFen-EGFP plasmid map. [Figure 16] Figure 16: pS-LIFen-EGFP plasmid map. [Figure 17] Figure 17: pS338B-Fluc plasmid map. [Figure 18] Figure 18: pS-IFPT-Fluc plasmid map. [Figure 19] Figure 19: pS-CIFT-Fluc plasmid map. [Figure 20] Figure 20: pS-ILFP-Fluc plasmid map. [Figure 21] Figure 21: pS-ILPT-Fluc plasmid map. [Figure 22] Figure 22: pS-CILT-Fluc plasmid map. [Figure 23] Figure 23: pS338B-αPD1 plasmid map. [Figure 24] Figure 24: pS-CIFT-αPD1 plasmid map. [Figure 25]Figure 25: Comparison of the effects of the IFN-γ gene promoter and the IL2 gene promoter on the promoter activity of the chimeric genes. [Figure 26] Figure 26: Comparison of the effects of TLTR and IFN-γ intronic enhancers on chimeric gene promoter activity. [Figure 27] Figure 27: Effect of different activation modes on two plasmid eGFP expression. [Figure 28] Figure 28: Detection results of the dual luciferase reporter system. [Figure 29] Figure 29: Expression activity of cytokine gene chimeric promoters in HEK293T cells. [Figure 30] FIG. 30: Expression activity of cytokine gene chimeric promoters in CHO cells. [Figure 31] FIG. 31: Expression activity of cytokine gene chimeric promoters in DC cells. [Figure 32] FIG. 32: Expression activity of cytokine gene chimeric promoters in Jurkat cells. [Figure 33] FIG. 33: Expression activity of cytokine gene chimeric promoters in Raji cells. [Figure 34] Figure 34: Expression activity of cytokine gene chimeric promoters in Hep G2 cells. [Figure 35] Figure 35: Expression activity of cytokine gene chimeric promoters in SKOV3 cells. [Figure 36] Figure 36: Cytokine gene chimeric promoters enhance PD1 antibody secretion by CAR-T cells. DETAILED DESCRIPTION OF THE INVENTION

[0023] It should be understood that within the scope of the present invention, the above technical features of the present invention and the technical features specifically described below (such as examples) can be combined with each other to form preferred technologies.

[0024] The present invention improves promoter activity, thereby increasing the strength of gene expression promotion and achieving highly efficient expression of foreign genes in activated immune cells.

[0025] In the present invention, immune cells refer to cells involved in or related to immune responses, including lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, and mast cells. Preferred immune cells of the present invention are peripheral blood mononuclear cells (PBMCs), including lymphocytes and monocytes. Lymphocytes include T lymphocytes, B lymphocytes, K lymphocytes, and NK lymphocytes. Preferably, cells suitable for the modified promoter of the present invention are immune cells that themselves highly express interferon gamma.

[0026] In the present invention, "activation" refers to the general process known in the art of using a corresponding activator to stimulate immune cells into which a target plasmid or vector has been introduced, thereby achieving proliferation to increase immune cell number and activation to enhance immune cell activity. Typically, the activator is an activator known in the art, such as an anti-CD28 antibody and, optionally, a corresponding immunogen. For example, in some embodiments, when a chimeric antigen receptor for a tumor antigen is introduced, the activator may also include the tumor antigen or an active fragment thereof. In the present invention, the timing of activation, the concentration at the activation timing, and the duration of activation are not particularly limited. In some embodiments, the present invention employs activation using an anti-CD28 antibody; in some embodiments, the present invention employs activation using a combination of an anti-CD28 antibody and a tumor antigen.

[0027] In the present invention, the term "expression cassette" refers to the complete elements necessary to express a gene, including an operably linked promoter and gene coding sequence.

[0028] The term "coding sequence" refers to that portion of a nucleic acid sequence that directly determines its protein product. The boundaries of the coding sequence are usually determined by the ribosome binding site (in prokaryotes) immediately upstream of the 5' open reading frame of the mRNA and the transcription termination sequence immediately downstream of the 3' open reading frame of the mRNA. A coding sequence may include, but is not limited to, DNA, cDNA, and recombinant nucleic acid sequences.

[0029] The term "operably linked" or "operably linked" refers to the functional spatial arrangement of two or more nucleotide regions or nucleic acid sequences. For example, in a nucleic acid construct, a promoter is placed at a specific location in the nucleic acid sequence of a gene of interest such that transcription of the nucleic acid sequence is directed by the promoter region; for example, the promoter is located upstream of the nucleic acid sequence of the gene, and the promoter region is "operably linked" to the nucleic acid sequence of the gene. "Operable linkage" can be achieved by genetic recombination.

[0030] The enhancer of the present invention is a CMV enhancer. The present invention may be practiced with any CMV enhancer known in the art, including the mCMV enhancer derived from murine cytomegalovirus and the hCMV enhancer derived from human cytomegalovirus, preferably the human CMV enhancer. An exemplary CMV enhancer may have the nucleotide sequence set forth in SEQ ID NO:8.

[0031] The IFNγ promoter of the present invention generally has its core region sequence or a sequence containing the core region sequence. A fragment of the IFNγ promoter containing the nucleotide sequence shown in SEQ ID NO:4 is employed. For the selection of the IFNγ promoter core region sequence, see John C. Chrivia et al., "A model of human cytokine regulation based on transfection of gamma interferon gene fragments directly into isolated peripheral blood T lymphocytes," The Journal of Experimental Medicine, August 1990, Vol. 172, pp. 661-664. An exemplary IFNγ promoter is a fragment of the IFNγ promoter having the nucleotide sequence shown in SEQ ID NO:4. In a preferred embodiment, the promoter of the present invention employs the nucleotide sequence shown in SEQ ID NO:4.

[0032] A human T-cell leukemia virus long terminal repeat suitable for the present invention may have the nucleotide sequence shown in SEQ ID NO:3.

[0033] The present invention further encompasses nucleotide sequences modified by substitution, deletion, or addition of one or more bases from the nucleotide sequences set forth in SEQ ID NOs:3, 4, and 8, wherein the sequences modified by substitution, deletion, or addition retain the biological function of SEQ ID NOs:3, 4, and 8, respectively. For example, substitutions, deletions, and / or additions of up to 20 bases, e.g., up to 15 bases, up to 10 bases, up to 8 bases, up to 5 bases, etc., can be made separately or simultaneously at the 5' and / or 3' ends of the nucleotide sequences and / or within the sequences. In some embodiments, the present invention encompasses sequences having at least 95%, at least 97%, or at least 99% sequence identity to the nucleotide sequences set forth in SEQ ID NOs:3, 4, and 8, respectively, which also retain the biological function of SEQ ID NOs:3, 4, and 8, respectively, and preferably, these sequences are derived from human T-cell leukemia virus, human cytomegalovirus, and human cytomegalovirus, respectively. Sequence homology can be determined using algorithms well known in the art, such as the BLAST and BLAST 2.0 algorithms.

[0034] In one embodiment, the promoter sequence of the present invention comprises, or consists of, SEQ ID NO:8, SEQ ID NO:4 and SEQ ID NO:3 linked in order.

[0035] The present invention includes nucleotide sequences that have modifications, such as substitutions, deletions, or additions of one or more bases, compared to this promoter sequence (i.e., a promoter sequence containing or consisting of SEQ ID NO:8, SEQ ID NO:4, and SEQ ID NO:3), and the sequences modified by the substitutions, deletions, or additions retain the biological function of the promoter to efficiently express in activated immune cells. In some embodiments, the present invention includes sequences that have at least 95%, at least 97%, or at least 99% sequence homology to this promoter sequence and that retain the biological function of the promoter to efficiently express in activated immune cells. The substitutions, deletions, or additions may be modified by modifying the sequence of SEQ ID NO:8, SEQ ID NO:4, and SEQ ID NO:3. It should be understood that the amino acid sequence may occur in any one, any two, or all three of SEQ ID NO:8, SEQ ID NO:4, and SEQ ID NO:3.

[0036] Nucleic acid molecules whose base sequences are complementary to the base sequences of the promoters described in any of the embodiments herein are also included within the scope of the present application.

[0037] The present invention includes nucleic acid constructs that contain a promoter sequence described herein or its complement (including a promoter sequence having said mutation or at least 95% sequence homology thereto).

[0038] In one embodiment, the nucleic acid construct is an expression cassette containing an enhanced promoter sequence as described herein and a coding sequence for a protein of interest. Expression cassettes typically contain a transcription termination sequence (i.e., a transcription terminator) that is recognized by a host cell and terminates the sequence to be transcribed. The transcription termination sequence is operably linked to the 3' end of the coding sequence as described herein. Any terminator that is functional in the host cell of choice may be used in the present invention, including, but not limited to, the SV40 polyA transcription termination sequence.

[0039] In one embodiment, the nucleic acid construct is a vector. Vectors typically include, but are not limited to, plasmids, phagemids, phage derivatives, animal viruses, and cosmids. The vector may be an expression vector, including transient expression vectors, viral expression vectors, and transposon vectors. Preferably, the vector is a eukaryotic expression vector. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. The vector may also be a cloning vector for providing the promoter or expression cassette of the present invention.

[0040] Suitable vectors usually contain at least one origin of replication functional in the host cell, convenient restriction endonuclease restriction sites and one or more selectable markers.

[0041] Selectable restriction sites include, but are not limited to, AscI, XbaI, PvuI, HindIII, EcoRI, and SalI. Typically, a restriction site is located between the promoter sequence and the transcription termination sequence described in the present invention, allowing the vector to be cleaved at that position and the coding sequence of the target protein to be inserted, so that the coding sequence of the target protein is operably linked to the enhanced promoter sequence and the transcription termination sequence described in the present invention.

[0042] To identify and select expressing cells from a population of cells infected with the viral vector, the selectable marker comprises either a selectable marker gene or a reporter gene, or both. Useful selectable marker genes include antibiotic resistance genes such as kanamycin or neo. Suitable reporter genes may include genes encoding luciferase, β-galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein.

[0043] In one embodiment, the vector is a vector for integrating an expression cassette of a gene of interest into the genome of a host cell, and is preferably a transposon vector. In one embodiment, the transposon vector is a vector such as piggybac, sleeping The present invention relates to a eukaryotic expression vector containing a transposable element selected from the group consisting of beauty, frog prince, Tn5, and Ty. Such a transposon-based vector contains the 5' inverted terminal repeat (5' ITR) and 3' inverted terminal repeat (3' ITR) of the corresponding transposon. The transposase may be derived from the piggybac, sleeping beauty, frog prince, Tn5, or Ty transposition system. When using a transposase derived from a different transposition system, the sequences of the 5' and 3' ITRs in the above vector must be changed accordingly to sequences compatible with the transposition system, as can be easily determined by those skilled in the art. Typically, the expression cassette of the present invention is located between the 5' and 3' ITRs.

[0044] In some embodiments, the transposase is a transposase derived from the piggybac transposition system. The 5' inverted terminal repeat and the 3' inverted terminal repeat are, respectively, the 5' inverted terminal repeat and the 3' inverted terminal repeat of the piggybac transposon. In one embodiment, the transposon 5' inverted terminal repeat is set forth in SEQ ID NO:1 of CN201510638974.7 (the contents of which are incorporated herein by reference). In one embodiment, the transposon 3' inverted terminal repeat is set forth in SEQ ID NO:4 of CN201510638974.7. In one embodiment, the piggybac transposase is a transposase comprising a c-myc nuclear localization signal coding sequence. In one embodiment, the coding sequence of the piggybac transposase is set forth in SEQ ID NO:5 of CN201510638974.7.

[0045] The promoter for the transposase coding sequence may be any promoter known in the art for controlling the expression of a transposase coding sequence. In one embodiment, the expression of the transposase coding sequence is controlled by a CMV promoter. The sequence of the CMV promoter is set forth in CN 201510638974.7 SEQ ID NO:6.

[0046] In one embodiment, the vector of the present invention is based on the pNB328 vector disclosed in CN201510638974.7, but replaces the EF1α promoter originally contained in the vector with the promoter sequence described herein.

[0047] In one embodiment, the vectors of the present invention are empty vectors, i.e., vectors that do not contain a coding sequence for a protein of interest. Typically, these empty vectors contain, in order, one or more promoter sequences described herein, one or more restriction endonuclease restriction sites, and a transcription termination sequence, so that the coding sequence for the protein of interest can be ligated between the promoter sequence and the transcription termination sequence using a restriction enzyme. In one embodiment, the vectors of the present invention are vectors in which the coding sequence for the protein of interest is inserted between the promoter sequence and the transcription termination sequence described herein, and are preferably transposon-based vectors. These vectors contain, in order, the promoter sequence described herein, the coding sequence for the protein of interest, and a transcription termination sequence between the 5' ITR and 3' ITR, and preferably also contain a coding sequence for a transposase and its promoter sequence at the 3' end of the 3' LTR.

[0048] The present invention also includes the complementary sequence of each nucleotide sequence described herein. The polynucleotide sequences described herein may be in the form of DNA or RNA.

[0049] The nucleotide sequences described herein can typically be obtained by PCR amplification. Specifically, primers can be designed according to the nucleotide sequences disclosed herein, and relevant sequences can be obtained by amplification using a commercially available cDNA library or a cDNA library prepared by a method known to those skilled in the art as a template. For long sequences, two or more rounds of PCR amplification are often performed, with the amplified fragments then joined in the correct order. In some embodiments, specific nucleotide sequences of the present invention can be synthesized, where appropriate, by artificial synthesis.

[0050] In the present invention, the protein of interest includes, but is not limited to, various proteins, enzymes, antibodies, and other proteins with required functions (e.g., cytokines) known in the art. Preferably, the protein of interest is a protein known in the art to be expressed in T cells, such as various antibodies with anti-tumor effects, including single-chain antibodies or chimeric antigen receptors (CARs), and cytokines.

[0051] Cytokines stimulate immune cells (monocytes, macrophages, T cells, B cells, NK cells, etc.) Cytokines are a class of small protein molecules with a wide range of biological activities that are synthesized and secreted by immune cells (e.g., immune cells) and some non-immune cells (e.g., endothelial cells, epidermal cells, fibroblasts). Cytokines generally regulate immune responses by binding to corresponding receptors and modulating cell growth, differentiation, and efficacy. Cytokines can have various functions, such as regulating innate and adaptive immunity, hematopoiesis, cell proliferation, APSC pluripotent cells, and repair of damaged tissues. Cytokines are divided into interleukins, interferons, tumor necrosis factor superfamily, colony-stimulating factors, chemokines, and growth factors.

[0052] In some embodiments, the promoter sequences of the present invention are particularly suitable for driving gene expression of various antibodies, preferably single-chain antibodies, in T cells. Preferably, the antibody is an autocrine antibody. Preferably, the antibody is an immune checkpoint antibody, such as a PD-1 antibody, a CTLA4 antibody, a PD-L1 antibody, a LAG-3 antibody, a TIM-3 antibody, a TIGIT antibody, or a VISTA antibody. In some embodiments, the antibody includes, for example, a bispecific antibody formed by an immune checkpoint antibody and a TGF-β. Preferably, the antibody is a nanobody derived from an alpaca. In some embodiments, the antibody is a PD-1 antibody, and its amino acid sequence may be the amino acid sequence encoded by the sequence set forth in SEQ ID NO:15. The vectors of the present invention can be introduced into target cells using conventional transfection methods; these introduction methods include, but are not limited to, viral transduction, microinjection, particle bombardment, biolistic transformation, electroporation, etc. In some embodiments, the vectors described herein are transfected into cells of interest by electroporation. In some embodiments, the vectors of the present application may simultaneously express two or more proteins of interest, for example, simultaneously expressing an antibody and a cytokine described in any of the embodiments herein. Thus, in these embodiments, transfecting such vectors into cells of interest results in cells that simultaneously express the antibody and cytokine. Alternatively, when a vector expresses only one protein of interest, the cell of interest may be co-transfected with vectors expressing two or more different proteins of interest, thereby expressing two or more proteins of interest (e.g., any two or three of an antibody, cytokine, and CAR).

[0053] The cells of interest may be any of a variety of T cells known in the art, including, but not limited to, peripheral blood T lymphocytes, cytotoxic killer T cells (CTLs), helper T cells, suppressor / regulatory T cells, γδ T cells, cytokine-induced killer cells (CIKs), tumor-infiltrating lymphocytes (TILs), and other mixed population T cells. In some embodiments, the T cells may be derived from PBMCs of a patient with a B-cell malignancy. In some embodiments, the T cells are primary T cells.

[0054] In one embodiment, the present invention provides applications for the promoter sequences described herein in promoting the expression of exogenous genes (e.g., coding sequences for single-chain antibodies) in activated immune cells.

[0055] In certain embodiments, the present invention further provides immune cells, particularly T cells, containing the promoter sequence or nucleic acid construct or vector described herein (including a nucleic acid construct or vector for expressing an antibody of interest and / or a cytokine of interest). Preferably, the genome of the immune cells (particularly T cells) has incorporated therein an expression cassette that drives the expression of a foreign gene of interest (including an antibody of interest and / or cytokine) using the promoter sequence described herein as a promoter. More preferably, the genome of the immune cells (particularly T cells) of the present invention has incorporated therein an expression cassette that contains the promoter sequence described herein and a coding sequence for an immune checkpoint antibody or a bispecific antibody thereof operably linked to the promoter sequence. Some embodiments In some embodiments, the genome of the immune cell (particularly a T cell) incorporates an expression cassette comprising a promoter described herein and a coding sequence for a cytokine (particularly a chemokine) operably linked to the promoter. In some embodiments, the genome of the immune cell (particularly a T cell) incorporates an expression cassette comprising a promoter described herein and a coding sequence for a cytokine (particularly a chemokine) operably linked to the promoter, and an expression cassette comprising a promoter described herein and a coding sequence for an immune checkpoint antibody or a bispecific antibody thereof operably linked to the promoter.

[0056] In some embodiments, the immune cells are CAR T cells, i.e., T cells that express a CAR or contain a CAR coding sequence or a vector that expresses a CAR. Thus, in some embodiments, the CAR T cells provided herein can simultaneously express a CAR and an antibody of interest, or simultaneously express a CAR and a cytokine of interest, or simultaneously express a CAR, an antibody of interest, and a cytokine of interest.

[0057] The CAR may be any CAR known in the art. As used herein, the chimeric antigen receptor (CAR) of interest may be directed against one or more of the following antigens: Her2, CD19, CD20, CEA, GD2 (also known as B4GALNT1, β1,4-acetyl-galactosaminosyltransferase 1), FR (flavin reductase), PSMA (prostate-specific membrane antigen), PMEL (frontal black proteosome protein), CA9 (carbonic anhydrase anhydrase IX), CD171 / L1-CAM, IL-13Rα2, M ART-1 (also known as mucin-A), ERBB2, NY-ESO-1 (also known as CTAG1B, cancer / testis antigen 1B), MAGE (melanoma-associated antigen E1) family proteins, BAGE (B melanoma antigen family) family proteins, GAGE ​​(growth hormone-releasing factor) family proteins, AFP (alpha-fetoprotein), MUC1 (mucin 1, cell surface associated), CD22, CD23, CD30, CD33, CD44v7 / 8, CD70, VEGFR1, VEG FR2, IL-11Rα, EGP-2, EGP-40, FBP, GD3 (also known as ST8SIA1, ST8α-N-acetylceramide α-2,8-sialyltransferase 1), PSCA (prostate stem cell antigen), FSA (also known as KIAA1109), PSA (also known as KLK3, kallikrein-related peptidase 3), HMGA2, fetal acetylcholine receptor, LeY (also known as FUT3), EpCAM, MSLN (mesothelin), IGFR1, EGFR, EGFR vIII, ERBB3, ERBB4, CA125 (also known as MUC16, mucin16, cell surface associated), CA15-3, CA19-9, CA72-4, CA242, CA50, CYFRA21-1, SCC (also known as SERPINB3), AFU (also known as FUCA1), EBV-VCA, POA (also known as VDR, vitamin D (1,25-dihydrovitamin D3) receptor), β2-MG (beta-2-microglobulin), and PROGRP (GRP gastrin-releasing peptide).Unless otherwise specified, it should be understood that the various antigens described herein are antigens known in the art and their sequences are known in the art.

[0058] A vector expressing a CAR and a vector containing another gene of interest (including, but not limited to, an antibody and / or cytokine of interest described in any of the embodiments herein) operably linked to a promoter of the present invention are transfected simultaneously or sequentially into T cells to prepare CAR T cells of the gene of interest whose expression is controlled by the promoter of the present invention.

[0059] Pharmaceutical compositions comprising the immune cells of the invention and a pharmaceutically acceptable carrier are also provided.

[0060] In some embodiments, the present invention further provides a method for expressing a protein of interest in a cell of interest. The present invention provides a method for enhancing expression of a gene of interest in activated immune cells, the method comprising transfecting a nucleic acid molecule containing a coding sequence for the protein of interest operably linked to a promoter described in any of the embodiments herein into a cell of interest and incubating the cell under conditions allowing expression of the protein of interest. Also provided is a method for enhancing expression of a gene of interest in activated immune cells, the method comprising transfecting a vector containing the gene of interest operably linked to a promoter described in any of the embodiments herein into the activated immune cells and incubating the activated immune cells under conditions compatible with expression of the gene of interest. The cell of interest and the protein of interest are described in any one of the embodiments herein. Cell incubation conditions are well known in the art and can be selected according to different cell types. In some embodiments, the method comprises constructing a vector containing the promoter and a coding sequence for the protein of interest operably linked to the promoter, transfecting the vector into the cell of interest by known means (e.g., electroporation or lipofection), and incubating the cell under conditions compatible with expression of the gene and production of the protein.

[0061] In some embodiments, the present disclosure provides a cellular immunotherapy method comprising providing an immune cell described in any of the embodiments herein and administering a therapeutically effective amount of the immune cell to an individual in need thereof. The individual may be, for example, a mammal, particularly a human, with a disease known in the art that can be treated with a protein expressed by the immune cell, such as an antibody and / or cytokine and / or CAR. The immune cell may be prepared and provided by a method described in any of the embodiments herein. In some embodiments, the immune cell is autologous, i.e., derived from the individual to be treated, and the cell is treated in vitro by a method described in any of the embodiments herein to express the desired antibody, cytokine, and / or CAR, prior to reinfusion into the individual.

[0062] In the present invention, it has been found that when a vector containing a coding sequence of a protein of interest and a promoter of the present invention operably linked thereto is introduced into immune cells, the expression level of the protein of interest can be increased by several to several dozen times compared to the control. Therefore, when the immune cells of the present invention are used as a pharmaceutical, when the drug of the present invention encounters an activating agent (such as a tumor antigen) in vivo, the immune cells of the present invention are activated and express large amounts of the foreign genes they possess, such as various therapeutic molecules such as therapeutic antibodies or chimeric antigen receptors, thereby playing a therapeutic role; when the disease is treated so that the activating agent is reduced or eliminated, the immune cells return to normal.

[0063] Hereinafter, the embodiments of the present invention will be described in detail using examples. Those skilled in the art will understand that the following embodiments are used only to illustrate the present invention and should not be considered to limit the scope of the present invention. If specific techniques or conditions are not shown in the examples, they shall be carried out according to the techniques or conditions described in the literature of the field (for example, see "Molecular Cloning Laboratory Manual" by J. Sambrook et al., translated by Huang Peitang et al., 3rd Edition, Scientific Press) or according to the product specifications. Reagents or equipment not labeled with a manufacturer are all common commercially available products. [Example]

[0064] Example 1: Construction of human cytokine gene promoter expression vector Plasmid pS338B-EGFP (Fig. 1) containing a chimeric cytokine gene promoter consisting of SV40 enhancer DTS (SEQ ID NO: 1), EF1α promoter (SEQ ID NO: 2) and TLTR (SEQ ID NO: 3) was cloned into the vector. It was used as a control plasmid and a modified prototype.

[0065] 1. Construction of a vector expressing an EGFP reporter gene driven by the human IFN-γ gene promoter Construction of vector pS-IFPT-EGFP We commissioned Kin Weizhi to synthesize the human IFN-γ gene promoter sequence (uIFP, SEQ ID NO:4). The vector pUC57-uIFP was double-digested with PvuI and HindIII to obtain the 253-bp uIFP fragment. The control vector pS338B-EGFP, which contains a chimeric cytokine gene promoter consisting of an SV40 enhancer, the EF1α promoter, and TLTR, was double-digested with HindIII and PvuI. The uIFP fragment was then ligated into the pS338B-EGFP vector to obtain the vector pS-IFPT-EGFP, which contains the SV40 enhancer, the IFN-γ promoter, and the TLTR chimeric cytokine gene promoter (Figure 2).

[0066] Construction of vector pS-IL3en-EGFP We commissioned Kin Weizhi to synthesize the human IL-3 gene enhancer sequence (IL3en, SEQ ID NO: 5). The vector pUC57-IL3en was double-digested with PvuI and NheI to recover a 266-bp fragment containing the IL3 gene enhancer. The pS338B-EGFP vector, which contains the EF1α promoter and TLTR sequence, was double-digested with XbaI and PvuI, and the recovered fragment IL3en was ligated into the pS338B-EGFP vector. The correctly ligated clone was the vector containing the IL3 gene enhancer, EF1α promoter, and TLTR chimeric cytokine gene promoter: pS-IL3en-EGFP (Figure 3).

[0067] Construction of vector pS-uIFP-EGFP The synthesis of the 5'-phosphorylated primer was commissioned to Kim Wei-chi Co., Ltd. IFNp-f:5'-TCTGCGATCGAAAAGTGCCTTCAAAGAATCC-3'(SEQ ID NO:16) IFNp-r:5'-GTTAAAACAATACTGCAGCTGCACCTCCTCTGGCTGC-3' (SEQ ID NO:17)

[0068] Using the synthetic primers described above and the vector pS-IFPT-EGFP as a template, a 256-bp sequence containing the IFN-γ promoter (SEQ ID NO: 6) was amplified by PCR. This fragment and the vector pS-IFPT-EGFP were both double-digested with Xba I and EcoR I, ligated, and transformed into Top10. The resulting monoclonal clones were double-digested with EcoR I and Sal I. After identification, they were sent to Kin Weizhi Co., Ltd. for sequencing. The correct clones were identified as the vector containing the IFN-γ gene promoter: pS-uIFP-EGFP (Figure 4).

[0069] Construction of vector pS-uIFPT-EGFP Primers were designed to amplify the IFN-γ gene promoter and DTS-EF1α sequences from the pS-IFPT-EGFP vector, and the 5'-phosphorylated primers were synthesized by Kin Weizhi Co., Ltd.: IFNp-f2:5'- TCTAGAAGGATCTGCGATCGAAAAGTGCCTT -3'(SEQ ID NO:18) TLR-r:5'- ATGGTGGCGAATTCGTAGGCGCCGGTCAC-3' (SEQ ID NO:19)

[0070] Using the above synthetic primers and the vector pS-IFPT-EGFP as a template, a 555-bp sequence consisting of the IFN-γ promoter and TLTR (SEQ ID NO: 7) was obtained by PCR amplification. Both this fragment and the vector pS-IFPT-EGFP were double-digested with XbaI and EcoR I, ligated, and transformed into Top10. The resulting monoclonal clones were double-digested with EcoR I and Sal I. After identification, they were sent to Kin Weizhi Co., Ltd. for sequencing. The correct clones were identified as vectors containing the IFN-γ gene promoter and TLTR chimeric cytokine gene promoter: pS-uIFPT-EGFP (Figure 5).

[0071] Construction of vector pS-CIFT-EGFP Primers for amplifying the CMV gene enhancer from the pC23-MCS vector were designed, and the 5'-phosphorylated primers were synthesized by Kin Weizhi Co., Ltd.: CMVen-f:5'- CACCTCTAGAGACATTGATTATTGACT-3' (SEQ ID NO:20) CMVen-r:5'- GACTCGATCGCATGGTAATAGCGATG-3' (SEQ ID NO:21)

[0072] Using the synthetic primers described above and the vector pC23-MCS containing the human CMV gene enhancer as a template, a 380-bp CMV gene enhancer sequence (SEQ ID NO: 8) was PCR amplified. This fragment and the vector pS-IFPT-EGFP were both double-digested with XbaI and PvuI, ligated, and transformed into Top10. The resulting monoclonal clones were double-digested with EcoR I and Sal I. After identification, they were sent to Kin Weizhi Co., Ltd. for sequencing. The correct clones were then cloned into the vector pS-IFPT-EGFP, which contains the CMV gene enhancer, IFN-γ gene promoter, and TLTR chimeric cytokine gene promoter (Figure 6).

[0073] Construction of vector pS-ILFP-EGFP Both the vector pS-IFPT-EGFP containing the chimeric cytokine gene promoter consisting of the IFN-γ gene promoter and TLTR and the vector pS-IL3en-EGFP containing the IL3 gene enhancer were double-digested with Pvu I and EcoR I to obtain the corresponding fragments and vector. After transforming Top10, the resulting monoclonal clone was double-digested with EcoR I and Sal I to identify it as a correct clone, and a vector containing the chimeric cytokine gene promoter consisting of the IL3 gene enhancer, IFN-γ gene promoter, and TLTR: pS-ILFP-EGFP (Figure 7).

[0074] 2. Construction of a vector expressing an EGFP reporter gene under the control of the human IL-2 gene promoter Construction of vector pS-ILPT-EGFP We commissioned Kin Weizhi to synthesize the human IL-2 gene promoter sequence (IL2P, SEQ ID NO: 9). The vector pUC57-IL2P was double-digested with PvuI and HindI to recover the 300-bp fragment IL2P. The pS338B-EGFP vector, which contains the EF1α promoter and TLTR sequence, was double-digested with HindIII and PvuI, and the recovered fragment IL2P was ligated into the pS338B-EGFP vector. The correctly ligated clone was the vector containing the SV40 enhancer, IL2 gene promoter, and TLTR chimeric cytokine gene promoter: pS-ILPT-EGFP (Figure 8).

[0075] Construction of vector pS-uILP-EGFP Primers for amplifying the IL-2 gene promoter from the pS-ILPT-EGFP vector were designed, and the 5'-phosphorylated primers were synthesized by Kin Weizhi Co., Ltd.: IL2p-f:5'-TCTAGAATCTGCGATCGCCCCACCCCC-3'(SEQ ID NO:22) IL2p-r:5'-GAATTCCTCGAAGCTTCTTGAACAA-3'(SEQ ID NO:23)

[0076] Using the above synthetic primers and the vector pS-ILPT-EGFP as a template, a 308-bp IL-2 promoter sequence (SEQ ID NO: 10) was obtained by PCR amplification. This fragment and the vector pS-ILPT-EGFP were both double-digested with Xba I and EcoR I, ligated, and transformed into Top10. The resulting monoclonal clones were double-digested with EcoR I and Sal I. After identification, they were sent to Kin Weizhi Co., Ltd. for sequencing. The correct clones were identified as the vector containing the IL-2 gene promoter: pS-uILP-EGFP (Figure 9).

[0077] Construction of vector pS-uILT-EGFP Primers were designed to amplify the IL-2 gene promoter and DTS-EF1α sequences from the pS-ILPT-EGFP vector, and the 5'-phosphorylated primers were synthesized by Kin Weizhi Co., Ltd.: IL2p-f:5'-TCTAGAATCTGCGATCGCCCCACCCCC -3'(SEQ ID NO:24) TLR-r:5-CACCATGGTGGCGAATTCGTAGGCGCCGGTC -3'(SEQ ID NO:25)

[0078] Using the synthetic primers described above and the vector pS-ILPT-EGFP as a template, a 598-bp fragment of the IL-2 promoter and DTS-EF1α sequence (SEQ ID NO: 11) was amplified by PCR. This fragment and the vector pS-ILPT-EGFP were double-digested with XbaI and EcoR I, ligated, and transformed into Top10. The resulting monoclonal clones were double-digested with EcoR I and Sal I. After identification, they were sent to Kin Weizhi Co., Ltd. for sequencing. The correct clones were identified as vectors containing the IL2 gene promoter and the TLTR chimeric cytokine gene promoter: pS-uILT-EGFP (Figure 9).

[0079] Construction of vector pS-CILT-EGFP Both the vector pS-CIFT-EGFP containing the CMV enhancer sequence and the vector pS-ILPT-EGFP containing the IL2 gene promoter and TLTR sequence were double-digested with Pvu I and Xba I to obtain the corresponding fragments and vector, which were then ligated and transformed into Top10. The resulting monoclonal clone was then double-digested with EcoR I and Sal I to identify it as the correct clone, yielding pS-CILT-EGFP (Figure 11).

[0080] Construction of vector pS-LILP-EGFP Both the vector pS-ILPT-EGFP containing the IL3 gene enhancer sequence and the vector pS-IL3en-EGFP containing the IL2 gene promoter and TLTR sequence were double-digested with Pvu I and EcoR I to obtain two corresponding fragments, which were then ligated and transformed into Top10. The resulting monoclonal clone was then double-digested with EcoR I and Sal I to identify it as a correct clone, and a vector containing a chimeric cytokine gene promoter consisting of the IL3 gene enhancer, IL2 gene promoter, and TLTR: pS-ILFP-EGFP (Figure 12).

[0081] 3. Construction of a vector expressing an EGFP reporter gene driven by the human IFN-γ gene promoter and its intron enhancer Construction of vector pS-IFen-EGFP The synthesis of the vector pUC57-uIFen containing the enhancer sequence in the intron of the human IFN-γ gene (uIFen, SEQ ID NO: 12) was commissioned to Kin Weizhi Company.

[0082] Primers were designed to amplify the human IFN-γ gene promoter and enhancer from the pUC57-uIFP and pUC57-uIFen vectors, and the 5'-phosphorylated primers were synthesized by Kin Weizhi Co., Ltd.: IFNP-f:5'-TCTGCGATCGAAAAGTGCCTTCAAAGAATCC-3'(SEQ ID NO:26) IFNP-r:5'-GTTAAAACAATACTGCAGCTGCACCTCCTCTGGCTGC-3'(SEQ ID NO:27) IFNen-f:5'-GCAGCTGCAGTATTGTTTTAACCTTCTGCTC-3'(SEQ ID NO:28) IFNen-r:5'-TGGCGAATTCTAAGGACCTTTTTGAC-3'(SEQ ID NO:29)

[0083] Using the above synthetic primers and the vectors pUC57-uIFP and pUC57-uIFNen as templates, a 519-bp long human IFN-γ gene promoter and enhancer (SEQ ID NO: 13) was obtained by overlap PCR amplification. This fragment and the vector pS-IFPT-EGFP containing the SV40 enhancer were both double-digested with PvuI and EcoRI, ligated, and transformed into Top10. The resulting monoclonal clones were double-digested with EcoRI and SalI. After identification, they were sent to Kin Weizhi Co., Ltd. for sequencing. The correct clones were identified as the chimeric cytokine gene promoter vector containing the SV40 enhancer, IFN-γ gene promoter, and IFN-γ enhancer: pS-IFen-EGFP (Figure 13).

[0084] Construction of vector pS-uIFen-EGFP Primers were designed to amplify the human IFN-γ gene promoter and enhancer from the pS-IFen-EGFP vector, and the 5'-phosphorylated primers were synthesized by Kin Weizhi Co., Ltd.: IFNP-f:5'- TCTGCGATCGAAAAGTGCCTTCAAAGAATCC-3'(SEQ ID NO:30) IFNen-r:5'- TGGCGAATTCTAAGGACCTTTTTGAC-3'(SEQ ID NO:31)

[0085] Using the above synthetic primers and the vector pS-IFen-EGFP as a template, a 529-bp human IFN-γ gene promoter and its enhancer (SEQ ID NO: 14) was PCR amplified. This fragment and the vector pS-IFPT-EGFP were both double-digested with Xba I and EcoR I, ligated, and transformed into Top10. The resulting monoclonal clones were double-digested with EcoR I and Sal I. After identification, they were sent to Kin Weizhi Company for sequencing. The correct clones were identified as the chimeric cytokine gene promoter vector containing the IFN-γ gene promoter and IFN-γ enhancer: pS-uIFen-EGFP (Figure 14).

[0086] Construction of vector pS-CIFen-EGFP and vector pS-IFPT-EGFP Both vector pS-CIFT-EGFP, which contains the CMV enhancer and IFN-γ gene promoter, and vector pS-IFen-EGFP, which contains an enhancer in the intron of the human IFN-γ gene, were double-digested with Pvu I and Xba I to obtain the corresponding fragments and vector. These were then ligated and transformed into Top10. The resulting monoclonal clones were then double-digested with EcoR I and Sal I to identify the correct clones, and a vector containing a chimeric cytokine gene promoter consisting of the CMV enhancer, IFN-γ gene promoter, and IFN-γ enhancer: pS-CIFen-EGFP (Figure 15).

[0087] Construction of vector pS-LIFen-EGFP Both vector pS-CIFen-EGFP, which contains the IFN-γ gene promoter and an enhancer in the intron of the human IFN-γ gene, and vector pS-IL3en-EGFP, which contains the IL3 gene enhancer, were double-digested with Pvu I and EcoR I to obtain the corresponding fragments and vector, which were then ligated and transformed into Top10. The resulting monoclonal clones were then double-digested with EcoR I and Sal I to identify them as correct clones, and a vector containing a chimeric cytokine gene promoter consisting of the IL3 gene enhancer, IFN-γ gene promoter, and IFN-γ enhancer: pS-LIFen-EGFP (Figure 16).

[0088] 4. Construction of a Vector Expressing the Fluc Reporter Gene Construction of vector pS338B-Fluc Both the control vector pS338B-EGFP, which contains a chimeric cytokine gene promoter consisting of the SV40 enhancer, EF1α promoter, and TLTR, and the vector pS-AD-F-Fluc, which contains a luciferase reporter gene, were transfected with EcoRI. The corresponding fragments and vectors were double-digested with I and XbaI, ligated, transformed into Top10, and the resulting monoclonals were then digested with EcoRI and SalI. The clone was double-digested with .I. and identified as a correct clone, pS338B-Fluc (FIG. 17).

[0089] Construction of vector pS-IFPT-Fluc Both the vector pS-IFPT-EGFP, which contains a chimeric cytokine gene promoter consisting of an SV40 enhancer, an IFN-γ promoter, and TLTR, and the vector pS-AD-F-Fluc, which contains a luciferase reporter gene, were double-digested with EcoR I and Xba I to obtain the corresponding fragments and vector, which were then ligated and transformed into Top10. The resulting monoclonal clone was then double-digested with EcoR I and Sal I, identified, and the correct clone, pS-IFPT-Fluc (Figure 18), was obtained.

[0090] Construction of vector pS-CIFT-Fluc Both the vector pS-CIFT-EGFP, which contains a chimeric cytokine gene promoter consisting of a CMV enhancer, IFN-γ promoter, and TLTR, and the vector pS-AD-F-Fluc, which contains a luciferase reporter gene, were double-digested with EcoR I and Xba I to obtain the corresponding fragments and vector, which were then ligated and transformed into Top10. The resulting monoclonal clone was then double-digested with EcoR I and Sal I, identified, and the correct clone, pS-CIFT-Fluc (Figure 19), was obtained.

[0091] Construction of vector pS-ILFP-Fluc pS-ILFP-EGFP, which contains a chimeric cytokine gene promoter consisting of the IL3 gene enhancer, IFN-γ gene promoter, and TLTR, and ... Both the vector pS-AD-F-Fluc containing the enzyme reporter gene were double-digested with EcoRI and XbaI to obtain the corresponding fragments and vector, which were then ligated and transformed into Top10. The resulting monoclonal clone was then double-digested with EcoRI and SalI to identify it as the correct clone, pS-ILFP-Fluc (Figure 20).

[0092] Construction of vector pS-ILPT-Fluc Both the vector pS-ILPT-EGFP, which contains a chimeric cytokine gene promoter consisting of the IL3 gene enhancer, IL2 gene promoter, and TLTR, and the vector pS-AD-F-Fluc, which contains a luciferase reporter gene, were double-digested with EcoR I and Xba I to obtain the corresponding fragments and vector, which were then ligated and transformed into Top10. The resulting monoclonal clone was then double-digested with EcoR I and Sal I, identified, and the correct clone, pS-ILPT-Fluc (Figure 21), was obtained.

[0093] Construction of vector pS-CILT-Fluc Both the vector pS-CILT-EGFP, which contains a chimeric cytokine gene promoter consisting of a CMV enhancer, an IL2 gene promoter, and TLTR, and the vector pS-AD-F-Fluc, which contains a luciferase reporter gene, were double-digested with EcoR I and Xba I to obtain the corresponding fragments and vector, which were then ligated and transformed into Top10. The resulting monoclonal clone was then double-digested with EcoR I and Sal I, identified, and the correct clone, pS-CILT-Fluc (Figure 22), was obtained.

[0094] 5. Construction of gene vector expressing anti-PD1 antibody The sequence (SEQ ID NO: 15) expressing human anti-PD1 antibody (nivolumab) was obtained from US 10160806, and the synthesis of the sequence was commissioned to Kin Weizhi Company.

[0095] Construction of vector pS338B-αPD1 The vector was double-digested with EcoR I and Sal I to recover the synthetic anti-PD1 antibody sequence αPD1. The control vector pS338B-EGFP, which contains a chimeric cytokine gene promoter composed of DTS, EF1α promoter, and TLTR, was then double-digested with EcoR I and Sal I, and the recovered fragment anti-PD1 antibody sequence αPD1 was ligated into the pS338B-EGFP vector to obtain pS338B-αPD1 (Figure 23), a vector capable of expressing anti-PD1 antibody and containing a chimeric cytokine gene promoter composed of DTS, EF1α promoter, and TLTR.

[0096] Construction of vector pS-CIFT-αPD1 The vector was double-digested with EcoR I and Sal I to recover the synthetic anti-PD1 antibody sequence αPD1. The vector pS-CIFT-EGFP, which contains a chimeric cytokine gene promoter consisting of a CMV enhancer, an IFN-γ promoter, and TLTR, was then double-digested with EcoR I and Sal I, and the recovered fragment anti-PD1 antibody sequence αPD1 was ligated into the pS-CIFT-EGFP vector to obtain pS-CIFT-αPD1 (Figure 24), a vector capable of expressing anti-PD1 antibody and containing a chimeric cytokine gene promoter consisting of a CMV enhancer, an IFN-γ promoter, and TLTR.

[0097] Example 2: Detection of expression of engineered cytokine gene promoters in T cells 1. pS338B-EGFP was used as a control plasmid, and promoter expression was measured by EGFP expression intensity. 5×10 6 Resuscitate and resuspend freshly isolated peripheral blood mononuclear cells (PBMCs) in Lon In a 4D-Nucleofector, 4 μg of mesothelin CAR plasmid pNB338B-MSLN was transfected. CAR (for its construction, see CN201711459160.2 or 201711462801.X, except that the vector backbone was replaced from pNB328 to pNB338B; for the sequence and structure of vector pNB338B, see "pNB338B-E" in CN201711476630.6) and 4 μg of the plasmid of the cytokine gene promoter-driven EGFP protein reporter gene expression vector (e.g., pS-uILP-EGFP) obtained in Example 1 were electroporated into PBMCs and incubated at 37°C in a 5% CO2 incubator. After 4 hours, the cells were transferred to culture plates coated with 5 μg / ml anti-CD28 antibody or 5 μg / ml human mesothelin antigen and 5 μg / ml anti-CD28 antibody (purchased from Novoprotein), and supplemented with AIM-V (Gibco), 2% fetal bovine serum (Gibco), and 500 μg of CAR-derived cytokines. After 5 days, the cells were transferred to non-antigen-coated culture plates and cultured in a medium containing AIM-V (Gibco), 2% fetal bovine serum (Gibco), and 200 IU / ml IL-2 (purchased from Novoprotein). On the 7th day of culture, the cells were analyzed by flow cytometry.

[0098] Figure 25 shows the results of flow cytometry analysis of the activity of the IFN-γ promoter and IL-2 promoter under the same enhancer using FlowJoX analysis. The results indicated that the expression intensity of the IFN-γ promoter was stronger than that of the IL-2 promoter, and that the enhancer before the promoter sequence could enhance promoter expression. Based on this, the TLTR sequence after the promoter was replaced with an enhancer sequence in the IFN-γ intron, and the effects of the two different sequences after the promoter sequence on the original promoter were compared. Figure 26 shows a flow cytometry analysis graph of the change in promoter activity when the TLTR sequence after the promoter sequence was changed under the same promoter sequence. The results showed that changing the TLTR sequence after the promoter had a certain effect on promoter activity. Figure 27 compares the effects of different T cell activation modes on promoter activity when pS338B-EGFP and pS-CIFT-EGFP use the same promoter sequence. It shows that the expression activity of the chimeric cytokine gene promoter pS-CIFT-EGFP, which contains the CMV gene enhancer, IFN-γ gene promoter, and TLTR, is more susceptible to cell activation than the control plasmid pS338B-EGFP.

[0099] 2. pS338B-Fluc was used as a control plasmid to further detect promoter expression by a dual luciferase reporter system.

[0100] 2.1 Electroporation of T cells: 5 x 10 6Freshly isolated peripheral blood mononuclear cells (PBMCs) were resuscitated and resuspended in a Lonza 4D-Nucleofector. 4 μg of the plasmid pS-AD-F-Rluc (a vector expressing the Renilla luciferase gene) and 4 μg of the cytokine gene promoter reporter gene vectors obtained in Example 1 (e.g., vectors expressing the firefly luciferase gene, pS-IFPT-Fluc, pS-CIFT-Fluc, pS-ILFP-Fluc, pS-ILPT-Fluc, pS-CILT-Fluc, etc.) were electroporated into the PBMCs and incubated at 37°C in a 5% CO2 incubator. After 4 hours, the PBMCs were transferred to a culture plate coated with 5 μg / ml anti-CD3 antibody and 5 μg / ml anti-CD28 antibody (purchased from Novoprotein) and supplemented with AIM-V (Gibco), 2% fetal bovine serum (Gibco), and 500 IU / ml The cells were cultured in a medium containing IL-2 (purchased from Novoprotein); after 48 hours, the cellular dual luciferase activity was detected using a Promega Dual Luciferase Reporter System Detection Kit to detect the activity of each promoter.

[0101] 2.2 Detection with the dual luciferase reporter system (according to the kit instructions): a) 5 × 10 cells per group were cultured in 75 μL of AIM-V medium. 4 b) Cells were resuspended in 100 μL of Dual-Glo® Luciferase Reagent and seeded into a 96-well plate; b) An equal volume of 75 μL Dual-Glo® Stop&Glo® Luciferase Reagent was added to a), mixed evenly, placed on a shaker, and waited for at least 10 minutes (less than 2 hours) to completely lyse the cells and detect the luminescence intensity of firefly fluorescein; c) 75 μL Dual-Glo® Stop&Glo® Reagent was added, mixed evenly, placed on a shaker, and waited for at least 10 minutes (less than 2 hours) to completely lyse the cells and measure the luminescence intensity of Renilla fluorescein; d) The fluorescence intensity value detected by firefly fluorescein was divided by the fluorescence intensity value detected by Renilla fluorescein to obtain a signal normalization value reflecting the activity of each promoter.

[0102] The group with the highest fluorescence intensity detected by flow cytometry was selected to construct a dual-luciferase reporter system plasmid and transfected with T cells. The results are shown in Figure 28. The fluorescence intensity value detected with firefly fluorescein in the pS-CIFT-Fluc group divided by the fluorescence intensity value detected with renilla fluorescein was significantly different from that of the control group, the pS338B-EGFP plasmid. This ratio was much higher than the fluorescence intensity ratios of other groups with various combinations of cytokine gene promoters and enhancers. Therefore, the promoter consisting of the combination of the CMV enhancer, IFN-γ gene promoter, and TLTR showed the highest activity.

[0103] Example 3: Detection of expression of constructed cytokine gene promoters in HEK-293T cells 1. HEK-293T cell transfection (ViaFect transfection kit): pS338B-EGFP was used as a control plasmid. A. Cell plating: Digest HEK-293T cells in good condition with trypsin and count 3 x 10 cells. 5 The cells were resuspended in 3 mL of medium, plated in a 6-well plate, and cultured for 24 h, with the medium composition being DMEM medium + 10% serum; B. Medium replacement: After culturing HEK-293T cells in a 6-well plate for 24 hours, the original cell culture medium was completely discarded, 1 mL of PBS buffer was added to wash the cells, the washing solution was completely discarded, 2 mL of new medium was added, and the 6-well plate was returned to the incubator at 37°C; C. Plasmid formulation (per well): 1 ug of the EGFP-expressing vector (pS-CIFT-EGFP / pS-IFPT-EGFP / pSCILT-EGFP / pSCILT-EGFP / pS338B-EGFP) constructed in Example 1 + 1 ug of RFP expression plasmid + 6 uL transfection solution (plasmid:transfection reagent=1:3) was dissolved in 200 uL of opt medium, vortexed for 10 seconds, and incubated at room temperature for 5 to 20 minutes to form complexes; D. Addition of transfection mixture: The mixture prepared in C was quickly added dropwise to the 6-well plate containing HEK-293T cells. The 6-well plate was then shaken several times and returned to a 37°C, 5% CO2 incubator for 24-48 hours. When the fluorescence intensity was appropriate, DAPI staining was performed.

[0104] 2. DAPI staining A. Fixation: The transfected cells with appropriate fluorescence expression intensity were washed twice with 1 mL of PBS buffer, and after completely discarding the washing solution, 1 mL of 4% paraformaldehyde fixative was added to the cells and allowed to stand at room temperature for 30 minutes; B. Permeabilization: The fixed cells were washed three times with 1 mL of PBS buffer for 5 minutes each. After discarding the wash solution, the cells were permeabilized with 1 mL of PBS buffer containing 0.3% Triton X-100. The solution was added to the cells and allowed to stand at room temperature for 30 minutes. C. DAPI staining: Wash the permeabilized cells with 1 mL of PBS buffer three times for 5 minutes each time. After completely discarding the washing solution, add 1 mL of formulated DAPI dye to the cells, shake gently several times, and leave at room temperature for 4 minutes. Observe under a fluorescence microscope. If the cell nuclei are completely stained, proceed to step D. If the staining is not complete, leave until the cell nuclei are completely stained. D. Observation under a fluorescence microscope: The DAPI staining solution was completely discarded, and 1 mL of PBS buffer was added to wash the cells. After shaking several times, the cells were left at room temperature for 5 minutes. This was repeated three times, and then photographed under a fluorescence microscope.

[0105] As shown in Figure 29, the expression activity of the interferon-γ gene promoter and interleukin-2 gene promoter in HEK293T cells was inferior to that of the control plasmid pS338B-EGFP.

[0106] Example 4: Detection of expression of constructed cytokine gene promoters in CHO cells 1. CHO cell transfection (ViaFect transfection kit): pS338B-EGFP was used as a control plasmid A. Cell plating: Digest CHO cells in good condition with trypsin and count 3 x 10 5 The cells were resuspended in 3 mL of medium, plated in a 6-well plate, and cultured for 24 h. The medium composition was 45% DMEM medium + 45% RPMI-1640 medium + 10% serum + 1% L-glutamine + 1% hypoxanthine-thymidine; B. Medium replacement: After culturing CHO cells in a 6-well plate for 24 hours, the original cell culture medium was completely discarded, 1 mL of PBS buffer was added to wash the cells, the washing solution was completely discarded, 2 mL of fresh medium was added, and the 6-well plate was returned to the incubator at 37°C. C. Plasmid formulation (per well): 1 ug of the EGFP-expressing vector (pS-CIFT-EGFP / pS-IFPT-EGFP / pSCILT-EGFP / pSCILT-EGFP / pS338B-EGFP) constructed in Example 1 + 1 ug of RFP expression plasmid + 6 uL transfection solution (plasmid:transfection reagent=1:3) was dissolved in 200 uL of opt medium, vortexed for 10 seconds, and incubated at room temperature for 5 to 20 minutes to form complexes; D. Addition of transfection mixture: The mixture prepared in C was quickly added dropwise to the 6-well plate containing CHO cells. The 6-well plate was then shaken several times, and returned to a 37°C, 5% CO2 incubator for 24-48 hours. When the fluorescence intensity was appropriate, DAPI staining was performed.

[0107] 2. DAPI staining A. Fixation: The transfected cells with appropriate fluorescence expression intensity were washed twice with 1 mL of PBS buffer, and after completely discarding the washing solution, 1 mL of 4% paraformaldehyde fixative was added to the cells and allowed to stand at room temperature for 30 minutes; B. Permeabilization: The fixed cells were washed three times with 1 mL of PBS buffer for 5 minutes each time. After discarding the washing solution, 1 mL of PBS buffer containing 0.3% Triton X-100 was added to the cells and allowed to stand at room temperature for 30 minutes. C. DAPI staining: Wash the permeabilized cells with 1 mL of PBS buffer three times for 5 minutes each time. After completely discarding the washing solution, add 1 mL of formulated DAPI dye to the cells, shake gently several times, and leave at room temperature for 4 minutes. Observe under a fluorescence microscope. If the cell nuclei are completely stained, proceed to step D. If the staining is not complete, leave until the cell nuclei are completely stained. D. Observation under a fluorescent microscope: Discard the DAPI staining solution completely, add 1 mL of PBS buffer, wash the cells, shake several times, and leave at room temperature for 5 minutes. Repeat this three times. I took a photo under a microscope.

[0108] As shown in Figure 30, the expression activity of the interferon-γ gene promoter and interleukin-2 gene promoter in CHO cells was inferior to that of the control plasmid pS338B-EGFP.

[0109] Example 5: Detection of expression of engineered cytokine gene promoters in dendritic cells (DCs) 1. DC cell transfection (ViaFect transfection kit): pS338B-EGFP was used as a control plasmid. A. Cell plating: Collect well-cultured DC cells, count them, and plate 3 x 10 5 The cells were resuspended in 3 mL medium, plated in a 6-well plate, and cultured for 24 h, with the medium composition being AIM-V; B. Medium replacement: After culturing DC cells in a 6-well plate for 24 hours, the original cell culture medium was completely discarded, 1 mL of PBS buffer was added to wash the cells, the washing solution was completely discarded, 2 mL of new medium was added, and the 6-well plate was returned to the incubator at 37°C; C. Plasmid formulation (per well): 1 μg of the EGFP-expressing vector (pS-CIFT-EGFP / pS-IFPT-EGFP / pSCILT-EGFP / pSCILT-EGFP / pS338B-EGFP) constructed in Example 1 + 1 μg of RFP expression plasmid + 6 μL of transfection solution (plasmid:transfection reagent=1:3) was dissolved in 200 μL of opt medium, vortexed for 10 seconds, and incubated at room temperature for 5-20 minutes to form complexes; D. Addition of the transfection mixture: The mixture prepared in C was quickly added dropwise to the 6-well plate containing DC cells. The 6-well plate was then shaken several times, and returned to a 37°C, 5% CO2 incubator for 24-48 hours of culture. When the fluorescence intensity was appropriate, DAPI staining was performed.

[0110] 2. DAPI staining A. Fixation: The transfected cells with appropriate fluorescence expression intensity were washed twice with 1 mL of PBS buffer, and after completely discarding the washing solution, 1 mL of 4% paraformaldehyde fixative was added to the cells and allowed to stand at room temperature for 30 minutes; B. Permeabilization: The fixed cells were washed three times with 1 mL of PBS buffer for 5 minutes each time. After discarding the washing solution, 1 mL of PBS buffer containing 0.3% Triton X-100 was added to the cells and allowed to stand at room temperature for 30 minutes. C. DAPI staining: Wash the permeabilized cells with 1 mL of PBS buffer three times for 5 minutes each time, discard the washing solution completely, add 1 mL of formulated DAPI dye to the cells, shake gently several times, and leave at room temperature for 4 minutes. Observe under a fluorescence microscope. If the cell nuclei are completely stained, proceed to step D. If the staining is not complete, leave until the cell nuclei are completely stained; D. Observation under a fluorescence microscope: The DAPI staining solution was completely discarded, and 1 mL of PBS buffer was added to wash the cells. After shaking several times, the cells were left at room temperature for 5 minutes. This was repeated three times, and then photographed under a fluorescence microscope.

[0111] As shown in Figure 31, the expression activity of the interferon-γ gene promoter and interleukin-2 gene promoter in DC cells was inferior to that of the control plasmid pS338B-EGFP.

[0112] Example 6: Detection of expression of constructed cytokine gene promoters in Jurkat cells, an acute T-cell leukemia cell line 1. Jurkat cell transfection (ViaFect transfection kit): pS338B-EGFP was used as a control plasmid. A. Cell plating: Well-cultured Jurkat cells were collected, counted, and plated at 6 x 10 5 The cells were resuspended in 3 mL of medium, plated in a 6-well plate, and cultured for 24 h, with the medium composition being RPMI-1640 medium + 10% serum; B. Medium replacement: After culturing Jurkat cells in a 6-well plate for 24 hours, the original cell culture medium was completely discarded, 1 mL of PBS buffer was added to wash the cells, the washing solution was completely discarded, 2 mL of new medium was added, and the 6-well plate was returned to the incubator at 37°C; C. Plasmid formulation (per well): 1 μg of the EGFP-expressing vector (pS-CIFT-EGFP / pS-IFPT-EGFP / pSCILT-EGFP / pSCILT-EGFP / pS338B-EGFP) constructed in Example 1 + 1 μg of RFP expression plasmid + 6 μL of transfection solution (plasmid:transfection reagent=1:3) was dissolved in 200 μL of opt medium, vortexed for 10 seconds, and incubated at room temperature for 5-20 minutes to form complexes; D. Addition of transfection mixture: The mixture prepared in C was quickly added dropwise to the 6-well plate containing Jurkat cells. The 6-well plate was then shaken several times, and returned to a 37°C, 5% CO2 incubator for 24-48 hours. When the fluorescence intensity was appropriate, DAPI staining was performed.

[0113] 2. DAPI staining A. Fixation: The transfected cells with appropriate fluorescence expression intensity were washed twice with 1 mL of PBS buffer, and after completely discarding the washing solution, 1 mL of 4% paraformaldehyde fixative was added to the cells and allowed to stand at room temperature for 30 minutes; B. Permeabilization: The fixed cells were washed three times with 1 mL of PBS buffer for 5 minutes each time. After discarding the washing solution, 1 mL of PBS buffer containing 0.3% Triton X-100 was added to the cells and allowed to stand at room temperature for 30 minutes. C. DAPI staining: Wash the permeabilized cells with 1 mL of PBS buffer three times for 5 minutes each time. After completely discarding the washing solution, add 1 mL of formulated DAPI dye to the cells, shake gently several times, and leave at room temperature for 4 minutes. Observe under a fluorescence microscope. If the cell nuclei are completely stained, proceed to step D. If the staining is not complete, leave until the cell nuclei are completely stained. D. Observation under a fluorescence microscope: The DAPI staining solution was completely discarded, and 1 mL of PBS buffer was added to wash the cells. After shaking several times, the cells were left at room temperature for 5 minutes. This was repeated three times, and then photographed under a fluorescence microscope.

[0114] As shown in Figure 32, the expression activity of the interferon-γ gene promoter and interleukin-2 gene promoter in Jurkat cells was inferior to that of the control plasmid pS338B-EGFP.

[0115] Example 7: Detection of expression of constructed cytokine gene promoters in Raji cells, a B-cell malignant lymphoma 1. Raji cell transfection (ViaFect transfection kit): pS338B-EGFP was used as a control plasmid. A. Cell plating: Well-cultured Raji cells were collected and counted, and 6 × 105 cells were resuspended in 3 mL of medium and plated in a 6-well plate, and cultured for 24 hours. The medium composition was RPMI-1640 medium + 10% serum; B. Medium replacement: After culturing Raji cells in a 6-well plate for 24 hours, the original cell culture medium was completely discarded, 1 mL of PBS buffer was added to wash the cells, the washing solution was completely discarded, 2 mL of new medium was added, and the 6-well plate was again incubate at 37°C. Switched back to beta; C. Plasmid formulation (per well): 1 μg of the EGFP-expressing vector (pS-CIFT-EGFP / pS-IFPT-EGFP / pSCILT-EGFP / pSCILT-EGFP / pS338B-EGFP) constructed in Example 1 + 1 μg of RFP-expressing plasmid + 6 μL of transfection solution (plasmid:transfection reagent = 1:3) was dissolved in 200 μL of opt medium, vortexed for 10 seconds, and incubated at room temperature for 5-20 minutes to form complexes; D. Addition of the transfection mixture: The mixture prepared in C was quickly added dropwise to the 6-well plate containing Raji cells. The 6-well plate was then shaken several times, and returned to a 37°C, 5% CO2 incubator for 24-48 hours of culture. When the fluorescence intensity was appropriate, DAPI staining was performed.

[0116] 2. DAPI staining A. Fixation: The transfected cells with appropriate fluorescence expression intensity were washed twice with 1 mL of PBS buffer, and after completely discarding the washing solution, 1 mL of 4% paraformaldehyde fixative was added to the cells and allowed to stand at room temperature for 30 minutes; B. Permeabilization: The fixed cells were washed three times with 1 mL of PBS buffer for 5 minutes each time. After discarding the washing solution, 1 mL of PBS buffer containing 0.3% Triton X-100 was added to the cells and allowed to stand at room temperature for 30 minutes. C. DAPI staining: Wash the permeabilized cells with 1 mL of PBS buffer three times for 5 minutes each time. After completely discarding the washing solution, add 1 mL of formulated DAPI dye to the cells, shake gently several times, and leave at room temperature for 4 minutes. Observe under a fluorescence microscope. If the cell nuclei are completely stained, proceed to step D. If the staining is not complete, leave until the cell nuclei are completely stained. D. Observation under a fluorescence microscope: The DAPI staining solution was completely discarded, and 1 mL of PBS buffer was added to wash the cells. After shaking several times, the cells were left at room temperature for 5 minutes. This was repeated three times, and then photographed under a fluorescence microscope.

[0117] As shown in Figure 33, the expression activity of the interferon-γ gene promoter and interleukin-2 gene promoter in Raji cells was inferior to that of the control plasmid pS338B-EGFP.

[0118] Example 8: Detection of expression of constructed cytokine gene promoters in Hep G2 cells, a liver cancer cell line 1. Hep G2 cell transfection (ViaFect transfection kit): pS338B-EGFP was used as a control plasmid. A. Cell plating: Well-cultured Hep G2 cells were collected, counted, and plated at 3 × 10 5 The cells were resuspended in 3 mL of medium, plated in a 6-well plate, and cultured for 24 h, with the medium composition being RPMI medium + 10% serum; B. Medium replacement: After culturing Hep G2 cells in a 6-well plate for 24 hours, the original cell culture medium was completely discarded, 1 mL of PBS buffer was added to wash the cells, the washing solution was completely discarded, 2 mL of new medium was added, and the 6-well plate was returned to the incubator at 37°C; C. Plasmid formulation (per well): 1 μg of the EGFP-expressing vector (pS-CIFT-EGFP / pS-IFPT-EGFP / pSCILT-EGFP / pSCILT-EGFP / pS338B-EGFP) constructed in Example 1 + 1 μg of RFP expression plasmid + 6 μL of transfection solution (plasmid:transfection reagent=1:3) was dissolved in 200 μL of opt medium, vortexed for 10 seconds, and incubated at room temperature for 5-20 minutes to form complexes; D. Addition of transfection mixture: 6 days after plating Hep G2 cells The mixture prepared in step C was quickly added dropwise to the well plate, the 6-well plate was shaken several times, and then returned to a 37°C, 5% CO2 incubator for 24-48 hours of culture. When the fluorescence intensity was appropriate, DAPI staining was performed.

[0119] 2. DAPI staining A. Fixation: The transfected cells with appropriate fluorescence expression intensity were washed twice with 1 mL of PBS buffer, and after completely discarding the washing solution, 1 mL of 4% paraformaldehyde fixative was added to the cells and allowed to stand at room temperature for 30 minutes; B. Permeabilization: The fixed cells were washed three times with 1 mL of PBS buffer for 5 minutes each time. After discarding the washing solution, 1 mL of PBS buffer containing 0.3% Triton X-100 was added to the cells and allowed to stand at room temperature for 30 minutes. C. DAPI staining: Wash the permeabilized cells with 1 mL of PBS buffer three times for 5 minutes each time, discard the washing solution completely, add 1 mL of formulated DAPI dye to the cells, shake gently several times, and leave at room temperature for 4 minutes. Observe under a fluorescence microscope. If the cell nuclei are completely stained, proceed to step D. If the staining is not complete, leave until the cell nuclei are completely stained; D. Observation under a fluorescence microscope: The DAPI staining solution was completely discarded, and 1 mL of PBS buffer was added to wash the cells. After shaking several times, the cells were left at room temperature for 5 minutes. This was repeated three times, and then photographed under a fluorescence microscope.

[0120] As shown in Figure 34, the expression activity of the interferon-γ gene promoter and interleukin-2 gene promoter in Hep G2 cells was inferior to that of the control plasmid pS338B-EGFP.

[0121] Example 9: Detection of expression of constructed cytokine gene promoters in SKOV3 cells, an ovarian cancer cell line 1. SKOV3 cell transfection (ViaFect transfection kit): pS338B-EGFP was used as a control plasmid. A. Cell plating: Well-cultured SKOV3 cells were collected, counted, and plated at 3 x 10 5 The cells were resuspended in 3 mL of medium, plated in a 6-well plate, and cultured for 24 h, with the medium composition being DMEM medium + 10% serum; B. Medium replacement: After culturing SKOV3 cells in a 6-well plate for 24 hours, the original cell culture medium was completely discarded, 1 mL of PBS buffer was added to wash the cells, the washing solution was completely discarded, 2 mL of new medium was added, and the 6-well plate was returned to the incubator at 37°C; C. Plasmid formulation (per well): 1 μg of the EGFP-expressing vector (pS-CIFT-EGFP / pS-IFPT-EGFP / pSCILT-EGFP / pSCILT-EGFP / pS338B-EGFP) constructed in Example 1 + 1 μg of RFP expression plasmid + 6 μL of transfection solution (plasmid:transfection reagent=1:3) was dissolved in 200 μL of opt medium, vortexed for 10 seconds, and incubated at room temperature for 5-20 minutes to form complexes; D. Addition of the transfection mixture: The mixture prepared in C was quickly added dropwise to the 6-well plate containing SKOV3 cells. The 6-well plate was then shaken several times and returned to a 37°C, 5% CO2 incubator for 24-48 hours. When the fluorescence intensity was appropriate, DAPI staining was performed.

[0122] 2. DAPI staining A. Fixation: The transfected cells with appropriate fluorescence expression intensity were washed twice with 1 mL of PBS buffer, and after completely discarding the washing solution, 1 mL of 4% paraformaldehyde fixative was added to the cells and allowed to stand at room temperature for 30 minutes; B. Permeabilization: The fixed cells were washed three times with 1 mL of PBS buffer for 5 minutes each time. After discarding the washing solution, 1 mL of PBS buffer containing 0.3% Triton X-100 was added to the cells and allowed to stand at room temperature for 30 minutes. C. DAPI staining: Wash the permeabilized cells with 1 mL of PBS buffer three times for 5 minutes each time, discard the washing solution completely, add 1 mL of formulated DAPI dye to the cells, shake gently several times, and leave at room temperature for 4 minutes. Observe under a fluorescence microscope. If the cell nuclei are completely stained, proceed to step D. If the staining is not complete, leave until the cell nuclei are completely stained; D. Observation under a fluorescence microscope: The DAPI staining solution was completely discarded, and 1 mL of PBS buffer was added to wash the cells. After shaking several times, the cells were left at room temperature for 5 minutes. This was repeated three times, and then photographed under a fluorescence microscope.

[0123] As shown in Figure 35, the expression activity of the interferon-γ gene promoter and interleukin-2 gene promoter in SKOV3 cells was inferior to that of the control plasmid pS338B-EGFP.

[0124] Example 10: Application of chimeric interferon gamma gene promoter in autocrine anti-PD1 antibody CAR-T cells 5×10 6Freshly isolated peripheral blood mononuclear cells (PBMCs) were resuscitated and resuspended. 4 μg of mesothelin CAR plasmid pNB338B-MSLN CAR and 4 μg of the cytokine gene promoter-driven PD1 antibody expression vector (e.g., pS338B-αPD1) obtained in Example 1 were electroporated into the PBMCs using a Lonza 4D-Nucleofector and incubated at 37°C in a 5% CO2 incubator. After 4 hours, the PBMCs were transferred to culture plates coated with 5 μg / ml of anti-CD28 antibody or 5 μg / ml of human mesothelin antigen and 5 μg / ml of anti-CD28 antibody (purchased from Novoprotein) and supplemented with AIM-V (Gibco), 2% fetal bovine serum (Gibco), and 500 IU / ml of αPD1. After 5 days, the cells were transferred to non-antigen-coated culture plates and cultured in a medium containing AIM-V (Gibco), 2% fetal bovine serum (Gibco), and 200 IU / ml IL-2 (Novoprotein). 4 SKOV3 ovarian cancer cells were uniformly plated in a 96-well plate and cultured for 24 hours. After 24 hours, 5 × 10 cells were added to each well. 3 The cells were transfected with different plasmids and co-cultured with CAR-T cells cultured for 24 hours until day 10. The supernatant was collected and centrifuged to measure the content of PD1 antibodies secreted by CAR-T cells in the supernatant by enzyme-linked immunosorbent assay (ELISA).

[0125] ELISA assay steps: A. Antigen-coated plate: PD-1 antigen human PD-1 / PDCD1 protein (verified by HPLC) was prepared. When first used, the antigen was dissolved in commercially available PBS. The antigen was diluted to 1 μg / ml in the coating solution, and 100 μl / well was coated onto the ELISA plate overnight at 4°C. After overnight, the plate was washed five times with PBST, 200 μl / well, for 3 minutes each time, and then patted dry with absorbent paper. B. Blocking: 300ul of blocking solution was added to each well and incubated for 2 hours in a biochemical incubator at 37℃. Washed 5 times with PBST, 200ul / well, 3 minutes each time, and patted dry with absorbent paper; C. Sample Addition: Sample and standard zAb were added at 100 ul / well, and duplicate and control wells were set up and incubated in a biochemical incubator at 37°C for 1 hour. Samples and standards were diluted with diluent, and standards were set up in seven gradients, starting from 30 ng / ml and ending at 0 ng / ml. Samples were added at 100 ul / well, and duplicate and control wells were set up and incubated in a biochemical incubator at 37°C for 1 hour. The samples in this experiment were diluted 40-fold and 400-fold. Wash with PBST 5 times, 200ul / well, 3 minutes each time, and pat dry with absorbent paper; D. Addition of secondary antibody: IgGHRP, diluted 1:20,000 in blocking solution, 100ul / well, incubated for 1 hour at 37°C in a biochemical incubator. Wash 5 times with PBST, 200ul / well, 3 minutes each time, and pat dry with absorbent paper. E. Color development: Add 100ul / well of color developer TMB and allow to develop in the dark at room temperature for 6 minutes. F. Termination: Add 50ul / well of stop solution to terminate the reaction. Immediately load into meter for reading.

[0126] As shown in Figure 36, after co-transfection of the CAR plasmid with pS-CIFT-αPD1 or pS338B-αPD1 plasmid, T cells acquired the ability to autocrinely secrete PD1 antibodies, and the CMV enhancer-interferon gamma promoter-TLTR chimeric promoter was significantly superior to the DTS-EF1α-TLTR chimeric promoter in expressing PD1 antibodies secretion.

Claims

1. A promoter for promoting gene expression of an autocrine antibody in T cells activated by an anti-CD28 antibody and, if necessary, a corresponding immunogen, characterized in that the promoter comprises, linked in order from the 5' end to the 3' end, a CMV enhancer having the nucleotide sequence shown in SEQ ID NO: 8, an IFNγ promoter having the nucleotide sequence shown in SEQ ID NO: 4, and a long terminal repeat sequence derived from human T-cell leukemia virus having the nucleotide sequence shown in SEQ ID NO:

3.

2. A nucleic acid construct comprising the promoter according to claim 1 and a gene of interest operably linked to said promoter.

3. 3. The nucleic acid construct of claim 2, wherein the gene of interest encodes an autocrine antibody.

4. The nucleic acid construct of claim 3, wherein the autocrine antibody is an immune checkpoint antibody.

5. The nucleic acid construct according to claim 4, wherein the autocrine antibody is a PD-1 antibody, a CTLA4 antibody, a PD-L1 antibody, a LAG-3 antibody, a TIM-3 antibody, a TIGIT antibody, or a VISTA antibody.

6. The nucleic acid construct according to claim 4, wherein the autocrine antibody is a nanobody derived from an alpaca.

7. 3. The nucleic acid construct of claim 2, wherein the nucleic acid construct is an expression cassette.

8. A vector comprising the promoter according to claim 1.

9. A vector according to claim 8, comprising a nucleic acid construct according to any one of claims 2 to 7.

10. 9. The vector according to claim 8, wherein the vector is an expression vector or a cloning vector.

11. A T cell comprising the promoter of claim 1, the nucleic acid construct of claim 2, or the vector of claim 8.

12. The T cell of claim 11, wherein the T cell further expresses a CAR or contains a CAR expression vector.

13. The T cell comprises a promoter according to claim 1 and a coding sequence for a cytokine operably linked to the promoter, and / or a promoter according to claim 1 and a coding sequence for an immune checkpoint antibody or a bispecific antibody thereof operably linked to the promoter; or The T cell according to claim 11, characterized in that the genome of the T cell is integrated with an expression cassette comprising the promoter of claim 1 and a coding sequence of a cytokine operably linked to the promoter, and / or an expression cassette comprising the promoter of claim 1 and a coding sequence of an immune checkpoint antibody or a bispecific antibody thereof operably linked to the promoter.

14. The T cell of claim 13, wherein the T cell further expresses a CAR or contains a CAR expression vector.

15. Use of the promoter described in claim 1 in preparing a nucleic acid construct or vector for enhancing expression of a gene of interest in activated T cells.

16. 16. The use according to claim 15, wherein the gene of interest encodes an autocrine antibody.

17. The use according to claim 16, characterized in that the autocrine antibody is an immune checkpoint antibody.

18. The use according to claim 17, wherein the immune checkpoint antibody is a PD-1 antibody, a CTLA4 antibody, a PD-L1 antibody, a LAG-3 antibody, a TIM-3 antibody, a TIGIT antibody, or a VISTA antibody.

19. The use according to claim 17, characterized in that the autocrine antibody is a nanobody derived from alpaca.

Images