Template DNA manufacturing method

A cell-free cloning system for producing template DNA using a cassette double-stranded DNA and strand-displacing DNA polymerase addresses inefficiencies in existing methods, enabling rapid and cost-effective high-throughput production of template DNA for sgRNA.

JP7748093B2Active Publication Date: 2025-10-02HIROSHIMA UNIVERSITY
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
JP2021183664
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-11-10
Publication Date
2025-10-02
Estimated Expiration
2041-11-10

AI Technical Summary

Technical Problem

Current methods for producing template DNA for sgRNA are time-consuming, require handling of cells, are not suitable for high-throughput production, and may lack accuracy in base sequence, making them inefficient and costly.

Method used

A method involving a cell-free cloning system to produce template DNA by preparing a cassette double-stranded DNA with an RNA polymerase promoter and sgRNA scaffold sequence, ligating an oligonucleotide containing a target sequence, and amplifying it using strand-displacing DNA polymerase to obtain template DNA suitable for in vitro transcription.

Benefits of technology

Enables rapid production of large quantities of template DNA with desired target recognition sequences, suitable for high-throughput production and improved accuracy, reducing costs and time compared to existing methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007748093000007
    Figure 0007748093000007
  • Figure 0007748093000008
    Figure 0007748093000008
  • Figure 0007748093000009
    Figure 0007748093000009
Patent Text Reader

Abstract

To enable a template DNA for obtaining sgRNA by in vitro transcription to be prepared in large quantities, at low cost, readily, and quickly.SOLUTION: This method for producing a template DNA comprises: a step (a) for preparing a cassette double-stranded DNA; a step (b) for preparing an oligonucleotide containing a target sequence; a step (c) for ligating the same by a DNA ligase to thereby obtain a cyclic nucleotide containing the target sequence; a step (d) for, using the nucleotide as a template, amplifying by a strand displacement DNA polymerase to thereby obtain a double-stranded DNA containing the target sequence that is a concatemer having the same sequences and having a repeated sequence consisting of a support sequence, an RNA polymerase promoter sequence, the target sequence and an sgRNA scaffold sequence; and a step (e) for cleaving the double-stranded DNA between the same sequences to thereby obtain a template DNA having sequences consisting of the support sequence, the RNA polymerase promoter sequence, the target sequence and the sgRNA scaffold sequence.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a method for producing template DNA, and in particular to a method for producing template DNA for obtaining sgRNA by in vitro transcription. [Background technology]

[0002] The CRISPR / Cas9 system enables genetic manipulation of various species, and has had an impact not only on basic research but also on applied research, including medicine. In particular, in recent years, it has been used not only for genome editing but also for applications such as the detection of SARS-CoV-2 (COVID-19).

[0003] To use the CRISPR / Cas9 system, it is necessary to use sgRNA (single-guide RNA), which combines crRNA (synthetic CRISPR RNA) and tracrRNA (trans-activating crRNA). When creating this sgRNA by in vitro transcription using RNA polymerase, it is necessary to prepare template DNA for each target sequence.

[0004] Currently, the template DNA is prepared by cloning into a plasmid vector or by PCR.

[0005] Non-Patent Document 1 discloses a method for preparing template DNA for obtaining gRNA (guide RNA) by cloning into a plasmid vector. In the preparation method described in Non-Patent Document 1, two DNA oligonucleotides corresponding to the target sequence are first chemically synthesized and then annealed to produce a double-stranded DNA oligonucleotide. The double-stranded DNA oligonucleotide is then ligated into a vector, followed by transformation and selection of positive clones by direct sequencing, thereby preparing template DNA.

[0006] Non-Patent Document 2 discloses a method for preparing template DNA for sgRNA by PCR. In the preparation method in Non-Patent Document 2, three types of oligo DNAs, DNA containing the target sequence, the crRNA / tracrRNA sequence, and a portion of the crRNA / tracrRNA sequence, are chemically synthesized in advance, and these oligo DNAs are extended by PCR to prepare template DNA.

[0007] Alternatively, template DNA may be synthesized using Integrated DNA Technologies' gBlocks (registered trademark) artificial gene synthesis contract service or the like (Non-Patent Document 3). [Prior art documents] [Non-patent literature]

[0008] [Non-Patent Document 1] "Genome Editing | 2020," Funakoshi Co., Ltd., Funakoshi News, May 15, 2020 (No. 703), pp. 1-40 (right column of p. 16) [Non-patent document 2] "Guide RNA Synthesis Kit CUGA (registered trademark) 7 gRNA Synthesis Kit Supplementary Volume "Reference Materials"", Nippon Gene Publishing Co., Ltd., Product Manual, Revised Edition R302, pp. 1-11 (pp. 3, 4) [Non-patent document 3] Satoshi Tsukamoto, "No cloning required! Creating knockout mice using gBlocks (registered trademark)-based CRISPR / Cas9," Medical and Biological Laboratories Publishing, IDT Technical Report, vol. 1, pp. 1-6 (Figure 1 on p. 3) Summary of the Invention [Problem to be solved by the invention]

[0009] However, the method of preparing template DNA by cloning into a plasmid vector described in Non-Patent Document 1 requires time for transformation and selection of positive clones by direct sequencing, so it takes several days to prepare template DNA. Furthermore, since it requires handling of cells, it is not suitable for high-throughput gRNA production.

[0010] Furthermore, in the preparation of template DNA by PCR described in Non-Patent Document 2, it is necessary to chemically synthesize DNA containing the target sequence, which has a T7 promoter sequence, a target sequence, and a portion of the crRNA / tracrRNA sequence, and it takes several days to prepare the template DNA. Furthermore, in the method of preparing template DNA by PCR, the base sequence of the synthesized template DNA may lack accuracy, and the sgRNA prepared from this template DNA may not perform the desired function.

[0011] Furthermore, obtaining template DNA using the gBlocks (registered trademark) artificial gene synthesis contract service, as described in Non-Patent Document 3, takes several weeks and is more expensive than the above-mentioned methods.

[0012] As described above, these preparation methods require several days to several weeks to prepare the template DNA, and some of them have the problem of lacking accuracy in the base sequence of the synthesized template DNA. Furthermore, these methods require many steps, which increases the cost of template DNA synthesis. Furthermore, none of these methods is suitable for high-throughput sgRNA production.

[0013] The present invention has been made in consideration of the above-mentioned problems, and aims to provide a method for producing template DNA that enables large amounts of template DNA for obtaining sgRNA to be prepared inexpensively, simply, and quickly, simply by providing oligonucleotides having a target sequence contained in the target DNA. [Means for solving the problem]

[0014] In order to achieve the above-mentioned object, the present inventors conducted extensive research and discovered that template DNA for obtaining sgRNA can be produced by preparing a cassette double-stranded DNA containing an RNA polymerase promoter sequence and an sgRNA scaffold sequence, which are common parts in sgRNA transcription, and then ligating and amplifying the cassette double-stranded DNA and an oligonucleotide containing a target sequence using a cell-free cloning system, thereby completing the present invention.

[0015] Specifically, the method for producing template DNA according to the present invention is a method for producing template DNA for obtaining sgRNA by in vitro transcription using a cell-free cloning system, and includes the steps of: (a) preparing a cassette double-stranded DNA consisting of a fragment including an sgRNA scaffold sequence, a support sequence, and a promoter sequence for RNA polymerase, the fragment having overhanging sequences at both ends and a phosphate group at the 5' end of at least one strand of the fragment; (b) preparing a target sequence-containing oligonucleotide having a phosphorylated 5' end and including a cassette double-stranded DNA binding sequence having a sequence complementary to the overhanging sequence of the cassette double-stranded DNA and a target sequence of a desired sgRNA; and (c) binding the cassette double-stranded DNA and the target sequence-containing oligonucleotide. (d) using a strand-displacing DNA polymerase to amplify the target sequence-containing cyclic nucleotide as a template to obtain a target sequence-containing double-stranded DNA that is an identical sequence concatemer having a repeat sequence consisting of the support sequence, a promoter sequence for the RNA polymerase, the target sequence, and the sgRNA scaffold sequence; and (e) cutting the target sequence-containing double-stranded DNA obtained in step (d) between the identical sequences to obtain the template DNA having a sequence consisting of the support sequence, the promoter sequence for the RNA polymerase, the target sequence, and the sgRNA scaffold sequence.

[0016] According to the template DNA production method of the present invention, a cassette double-stranded DNA containing a base sequence common to that used in sgRNA transcription is prepared, and then an oligonucleotide containing a target sequence prepared from the target DNA targeted by the sgRNA is ligated to the cassette double-stranded DNA to prepare a target sequence-containing cyclic nucleotide. The target sequence-containing cyclic nucleotide is then amplified using the target sequence-containing cyclic nucleotide as a template to produce a template DNA for in vitro transcription of an sgRNA. Therefore, in vitro transcription of this template DNA can rapidly produce large quantities of sgRNAs containing the desired target recognition sequence. Furthermore, the template DNA production method of the present invention can produce a wide variety of template DNAs in a short period of time, making it more versatile than template DNA production methods using PCR. Furthermore, the template DNA production method of the present invention can be performed in a cell-free system, making it suitable for high-throughput template DNA production.

[0017] In the method for producing template DNA according to the present invention, the cassette double-stranded DNA in step a may have the overhanging sequence at the 5'-end of each strand, and the target sequence-containing oligonucleotide in step b may be a target sequence-containing double-stranded oligonucleotide, and only the 5'-end of the oligonucleotide strand that binds to the phosphorylated strand of the cassette double-stranded DNA may be phosphorylated.

[0018] In the method for producing a template DNA according to the present invention, the cassette double-stranded DNA in step a may have the protruding sequences at both ends of one strand of the fragment, and the target sequence-containing oligonucleotide in step b may be a single-stranded oligonucleotide that includes, at both ends of the target sequence, a first cassette double-stranded DNA binding sequence complementary to one of the protruding sequences in the cassette double-stranded DNA and a second cassette double-stranded DNA binding sequence complementary to the other protruding sequence.

[0019] In the method for producing template DNA according to the present invention, the sgRNA scaffold sequence may have a restriction enzyme DraI site or a restriction enzyme BtgZI site and a PAM sequence at its end.

[0020] In the method for producing template DNA according to the present invention, the strand displacement DNA polymerase is preferably a strand displacement DNA polymerase having exonuclease activity.

[0021] By using a strand-displacing DNA polymerase with exonuclease activity in step c, double-stranded DNA containing the target sequence can be obtained by rolling circle amplification using a circular nucleotide containing the target sequence as a template, thereby easily obtaining double-stranded DNA containing the target sequence that becomes a concatemer of the same sequence.

[0022] In the method for producing template DNA according to the present invention, the target sequence-containing double-stranded DNA in step d is preferably obtained by rolling circle amplification using two or more primers that bind to the ends of the RNA polymerase promoter sequence and the sgRNA scaffold sequence of the cassette double-stranded DNA, respectively. Furthermore, the primers are preferably primers that are resistant to the exonuclease activity of the strand-displacing DNA polymerase.

[0023] In this way, the target sequence-containing double-stranded DNA in step d can be obtained by hyperbranched rolling circle amplification using the target sequence-containing circular nucleotide as a template, thereby rapidly obtaining double-stranded DNA containing the target sequence as concatemers of the same sequence.

[0024] In the method for producing template DNA according to the present invention, the cleavage of the target sequence-containing double-stranded DNA in step e may be performed by cleavage with a restriction enzyme or a CRISPR / Cas system corresponding to the restriction enzyme DraI site or the restriction enzyme BtgZI site.

[0025] In the method for producing template DNA according to the present invention, the cassette double-stranded DNA in step a is preferably prepared by a method comprising: (a1) preparing a base sequence-containing double-stranded DNA comprising a support sequence and a base sequence, wherein the base sequence consists of the sgRNA scaffold sequence, the RNA polymerase promoter sequence, and a variable region sequence disposed between the sgRNA scaffold sequence and the RNA polymerase promoter sequence and having restriction enzyme sites at both ends, and (a2) cleaving the restriction enzyme sites in the variable region with a restriction enzyme to obtain the cassette double-stranded DNA. Furthermore, the base sequence-containing double-stranded DNA in step a1 is preferably prepared by rolling circle amplification using a base sequence-containing cyclic nucleotide comprising the support sequence and the base sequence as a template, with two or more primers that bind to at least one of the support sequence and the base sequence.

[0026] In this way, the cassette double-stranded DNA in step a can be obtained rapidly and in large quantities.

[0027] In the method for producing template DNA according to the present invention, the restriction enzyme sites in the variable region preferably have two types of restriction enzyme sites selected from the group consisting of Type-IIS, Type-IIC, and Type-IIG, which recognize discontinuous or non-palindromic sequences. Furthermore, the cassette double-stranded DNA in step a2 is preferably obtained by simultaneously cleaving the base sequence-containing double-stranded DNA obtained in step a1 with a first type of restriction enzyme corresponding to the restriction enzyme sites and dephosphorylating it, inactivating each enzyme, and then cleaving it with a second type of restriction enzyme corresponding to the restriction enzyme sites.

[0028] In this way, it is not necessary to carry out the restriction enzyme cleavage and dephosphorylation of the double-stranded DNA in step a1 as separate steps, and the desired cassette double-stranded DNA can be easily obtained.

[0029] In the kit for carrying out the method for producing template DNA according to the present invention, the kit preferably comprises the cassette double-stranded DNA, the DNA binding enzyme, the strand-displacement DNA polymerase, a strand-displacement DNA synthesis reaction buffer, an amplification primer, and four types of deoxyribonucleotides.

[0030] Such a kit contains all the tools necessary to produce template DNA for in vitro transcription of sgRNA. Additionally, because the kit contains a cassette double-stranded DNA, the desired template DNA can be produced simply by performing steps b to e of the template DNA production method of the present invention. Therefore, sgRNAs having target recognition sequences can be rapidly and abundantly provided. Furthermore, the kit can produce the desired template DNA simply by linking the cassette double-stranded DNA to a target sequence-containing oligonucleotide to prepare a target sequence-containing cyclic nucleotide, which is then amplified using this as a template. Therefore, the kit can provide a wide variety of template DNAs, making it a highly versatile kit for producing template DNA. [Effects of the Invention]

[0031] According to the template DNA production method of the present invention, a cassette double-stranded DNA containing a base sequence common to that used in sgRNA transcription is prepared in advance, and then an oligonucleotide containing a target sequence prepared from the target DNA targeted by the sgRNA is ligated to the cassette double-stranded DNA to prepare a target sequence-containing cyclic nucleotide. The target sequence-containing cyclic nucleotide is then amplified using the template DNA as a template to produce a template DNA for in vitro transcription of an sgRNA. Therefore, in vitro transcription of this template DNA can rapidly produce large quantities of sgRNAs containing the desired target recognition sequence. Furthermore, the template DNA production method of the present invention is more versatile than template DNA production methods using PCR because it can produce a wide variety of template DNAs in a short time using pre-prepared cassette double-stranded DNA. Furthermore, the template DNA production method of the present invention can be performed in a cell-free system, making it suitable for high-throughput template DNA production. [Brief explanation of the drawings]

[0032] [Figure 1] FIG. 1 is a schematic diagram illustrating production steps a to e in a method for producing template DNA according to one embodiment of the present invention. [Figure 2] FIG. 1 is a schematic diagram illustrating a preferred method for preparing a cassette double-stranded DNA used in a method for producing template DNA according to one embodiment of the present invention. [Figure 3] 1 is a schematic diagram illustrating production steps a and b in a method for producing template DNA according to a modified embodiment of the present invention, where (a) is a diagram illustrating step a, and (b) is a diagram illustrating step b. [Figure 4] FIG. 1 shows a DNA map obtained when a base oligonucleotide and a support oligonucleotide are ligated and circularized in the method for producing template DNA according to Example 1. [Figure 5] 1 is a photograph showing the results of electrophoresis of the cassette double-stranded DNA prepared in Example 1. [Figure 6] FIG. 10 is a diagram showing a DNA map obtained when a base oligonucleotide and a support oligonucleotide are ligated and circularized in the method for producing template DNA according to Example 2. DETAILED DESCRIPTION OF THE INVENTION

[0033] DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The following description of preferred embodiments is merely exemplary in nature and is not intended to limit the present invention, its application, or its uses.

[0034] An overview of a method for producing template DNA (1) according to one embodiment of the present invention is shown in Figure 1. As shown in Figure 1, the method for producing template DNA (1) according to this embodiment includes steps a to e, which are described in detail below, and is a method for producing template DNA (1) for obtaining sgRNA by in vitro transcription using a cell-free cloning system. In particular, the method for producing template DNA (1) according to this embodiment is characterized by the use of a double-stranded target sequence-containing oligonucleotide (7A).

[0035] As shown in the middle left panel of Figure 1 (including an enlarged view), step a is a step of preparing a cassette double-stranded DNA (2A) consisting of a fragment containing an sgRNA scaffold sequence (3), a support sequence (5), and an RNA polymerase promoter sequence (4), with overhanging sequences (6A, 6B) at both ends and a phosphate group at the 5' end of at least one strand of the fragment. In particular, in this embodiment, the cassette double-stranded DNA (2A) is characterized by having overhanging sequences (6A, 6B) at the 5' end of each strand. In this embodiment, the method for preparing the cassette double-stranded DNA (2A) in step a is not particularly limited. A suitable method for preparing the cassette double-stranded DNA (2A) will be described later.

[0036] As used herein, the sgRNA scaffold sequence (3) refers to a sequence that serves as a scaffold for the sgRNA. In this embodiment, the sgRNA scaffold sequence (3) preferably has a restriction enzyme DraI site or a restriction enzyme BtgZI site and a PAM sequence at its end. This allows the target sequence-containing double-stranded DNA (12) to be easily cleaved between identical sequences using the restriction enzyme DraI or BtgZI in step e, which will be described later. Furthermore, the presence of a PAM sequence also enables cleavage using the CRISPR / Cas9 system.

[0037] The RNA polymerase promoter sequence (4) is a sequence required for transcription reaction of template DNA (1). In this embodiment, the RNA polymerase promoter sequence (4) can be selected depending on the RNA polymerase used in the transcription reaction of template DNA (1). For example, when T7 RNA polymerase is used, a T7 promoter sequence can be preferably used, but is not limited to this.

[0038] As used herein, the term "support sequence (5)" refers to a sequence that is not required for the function of the sgRNA. In this embodiment, the length and type of bases in the support sequence (5) can be appropriately selected as long as they do not inhibit the function of the sgRNA obtained by transcribing the template DNA (1) containing the support sequence.

[0039] 1 illustrates the case where the protruding sequence (6A) has the sequence "ATCC" and the protruding sequence (6B) has the sequence "GTTT," but is not limited to these sequences. In this embodiment, the protruding sequences (6A, 6B) can be appropriately selected as long as they can complementarily bind to the cassette double-stranded DNA binding sequences (9A, 9B) described below.

[0040] In this embodiment, the cassette double-stranded DNA (2A) preferably contains a phosphate group at the 5'-end of at least one strand of the fragment. Therefore, a cassette double-stranded DNA (2A) having a phosphate group at the 5'-end of each strand can be used, or a cassette double-stranded DNA (not shown) having a phosphate group at the 5'-end of only one strand can also be used.

[0041] As shown in the upper left panel of Figure 1, step b is a step of preparing a target sequence-containing oligonucleotide (7A) having a phosphorylated 5' end, the oligonucleotide containing a cassette double-stranded DNA binding sequence (9A, 9B) complementary to the overhanging sequences (6A, 6B) of the cassette double-stranded DNA (2A) and a target sequence (8) of the desired sgRNA. In particular, in this embodiment, the target sequence-containing oligonucleotide (7A) in step b is double-stranded, and only the 5' end of one strand is phosphorylated (only the 5' end of the antisense oligonucleotide (Antisense-ON) is phosphorylated). Here, in Figure 1, both 5' ends of the cassette double-stranded DNA (2A) are phosphorylated. However, if only one strand is phosphorylated, the target sequence-containing oligonucleotide is phosphorylated only at the 5' end of the oligonucleotide strand that will bind to the phosphorylated strand of the cassette double-stranded DNA (2A) later, so that the one strand will become completely circular without a nick. In this embodiment, the method for preparing the target sequence-containing oligonucleotide (7A) in step b is not particularly limited.

[0042] A preferred method for preparing a target sequence-containing oligonucleotide (7A) in this embodiment will be described with reference to the upper left panel of Figure 1. First, a sense oligonucleotide (Sense-ON) is prepared, which has a cassette double-stranded DNA binding sequence (9A) on its 5' end that is complementary to the overhanging sequence (6A) of one strand of the cassette double-stranded DNA (2A) and a target sequence (8) of the desired sgRNA on its 3' end. Also, an antisense oligonucleotide (Antisense-ON) is prepared, which has a cassette double-stranded DNA binding sequence (9B) on its 5' end that is complementary to the overhanging sequence (6B) of the other strand of the cassette double-stranded DNA (2A), a target sequence (8) of the desired sgRNA on its 3' end, and is phosphorylated at the 5' end. The sense oligonucleotide and antisense oligonucleotide are preferably synthetic oligonucleotides precisely synthesized base by base according to the desired sequence using standard methods. Subsequently, the sense oligonucleotide and the antisense oligonucleotide are annealed to form a double-stranded oligonucleotide, whereby a target sequence-containing oligonucleotide (7A) can be suitably prepared.

[0043] In this embodiment, the cassette double-stranded DNA binding sequences (9A, 9B) can be selected according to the overhanging sequences (6A, 6B) of the cassette double-stranded DNA (2A). For example, as shown in the upper part of Figure 1, the sequence "TAGG" can be used as the cassette double-stranded DNA binding sequence (9A) and the sequence "CAAA" can be used as the cassette double-stranded DNA binding sequence (9B), but this is not limitative.

[0044] As shown in the lower left panel of Figure 1, step c is a step in which the cassette double-stranded DNA (2A) and the target sequence-containing oligonucleotide (7A) are ligated using a DNA ligase to obtain a target sequence-containing cyclic nucleotide (10). More specifically, the overhanging sequences (6A, 6B) of the cassette double-stranded DNA (2A) first complementarily bind to the cassette double-stranded DNA-binding sequences (9A, 9B) of the target sequence-containing oligonucleotide (7A). In this state, the ends of the cassette double-stranded DNA (2A) and the target sequence-containing oligonucleotide (7A) are ligated using a DNA ligase to obtain a target sequence-containing cyclic nucleotide (10). The target sequence-containing cyclic nucleotide (10) thus obtained has a nick in the outer loop of the strand of the target sequence-containing oligonucleotide (7A) whose 5' end was not phosphorylated, as in the example of Figure 1. In this case, if the oligonucleotide is prone to forming a secondary structure, the nick may be a gap of one or more bases.

[0045] In this embodiment, the target sequence-containing cyclic nucleotide (10) refers to a cyclic nucleotide formed by linking the cassette double-stranded DNA (2A) and the target sequence-containing oligonucleotide (7A).

[0046] In the example of Figure 1, the target sequence-containing cyclic nucleotide (10) has one nick in the outer ring, but the number of nicks in the target sequence-containing cyclic nucleotide (10) is not particularly limited.

[0047] In this embodiment, the DNA ligase used in step c is preferably, for example, E. coli DNA ligase (manufactured by New England Biolabs). However, the type of DNA ligase is not particularly limited, and any DNA ligase known to those skilled in the art can be appropriately selected. Furthermore, the conditions for the ligation reaction using the DNA ligase can also be appropriately set.

[0048] As shown in the upper and middle right panels of Figure 1, step d is a step in which target sequence-containing cyclic nucleotides (10) are used as templates to amplify with a strand-displacing DNA polymerase (11) to obtain target sequence-containing double-stranded DNA (12) that is an identical concatemer having a repeat sequence consisting of a support sequence (5), an RNA polymerase promoter sequence (4), a target sequence (8), and an sgRNA scaffold sequence (3). More specifically, using the outer cyclic nucleotide containing a nick of the target sequence-containing cyclic nucleotides (10) as a template, amplification is initiated from the nick by the strand-displacing DNA polymerase (11) to obtain target sequence-containing double-stranded DNA (12).

[0049] In this embodiment, the strand displacement DNA polymerase (11) preferably has exonuclease activity. Use of such a strand displacement DNA polymerase (11) is advantageous because it allows for the production of a target sequence-containing double-stranded DNA (12) by rolling circle amplification using a target sequence-containing cyclic nucleotide (10) as a template. For example, φ29 DNA polymerase can be suitably used as such a strand displacement DNA polymerase (11).

[0050] In this embodiment, the target sequence-containing double-stranded DNA (12) in step d is preferably obtained by rolling circle amplification using two or more primers that bind to the ends of the RNA polymerase promoter sequence (4) and the sgRNA scaffold sequence (3) of the cassette double-stranded DNA (2A). This is advantageous because multiple target sequence-containing double-stranded DNAs (12) can be simultaneously synthesized starting from multiple primer recognition sequences (not shown) in the target sequence-containing cyclic nucleotide (10). Furthermore, random primers such as 6R5S primers can be used. Furthermore, such primers are preferably resistant to the exonuclease activity of the strand-displacing DNA polymerase (11). If the primers are not resistant to the exonuclease activity of the strand-displacing DNA polymerase (11), simultaneous synthesis starting from multiple primer recognition sequences cannot be achieved.

[0051] As shown in the lower right panel of Figure 1, step e is a step of cleaving the target sequence-containing double-stranded DNA (12) between identical sequences to obtain template DNA (1) having a sequence consisting of support sequence (5), RNA polymerase promoter sequence (4), target sequence (8), and sgRNA scaffold sequence (3). As described above, for example, if the sgRNA scaffold sequence (3) has a restriction enzyme DraI site or BtgZI site at its end, step e can be performed using the restriction enzyme DraI or BtgZI.

[0052] The template DNA (1) obtained in this embodiment can be suitably used as template DNA (1) for obtaining sgRNA by in vitro transcription. Furthermore, template DNA (1) can be suitably used as template DNA (1) for obtaining sgRNA for use in a CRISPR / Cas system by in vitro transcription, and is most suitably used as sgRNA for use in a CRISPR / Cas9 system, although the type of CRISPR / Cas system is not particularly limited.

[0053] In this embodiment, cleavage between identical sequences in the target sequence-containing double-stranded DNA (12) in step e can be performed using, for example, a restriction enzyme or a CRISPR / Cas system. In this case, as described above, a PAM sequence is provided at the end of the sgRNA scaffold sequence (3). Cleavage by the CRISPR / Cas system is particularly preferred because it has a more specific cleavage site than cleavage using a restriction enzyme and can prevent cleavage at sites other than the desired site. Furthermore, in this embodiment, the conditions for the cleavage reaction between the identical sequences can be set appropriately.

[0054] In this embodiment, the template DNA (1) has a sequence consisting of at least an RNA polymerase promoter sequence (4), a target sequence (8), and an sgRNA scaffold sequence (3). As described above, the template DNA (1) may further include a support sequence (5) in addition to the above sequences, as long as the RNA obtained by transcribing the template DNA can function as an sgRNA.

[0055] In the method for producing template DNA (1) according to this embodiment, the above steps a to e can be performed in a cell-free system. Therefore, the production method of this embodiment does not require handling cells, significantly reducing the labor required for producing template DNA (1). Furthermore, because the production method of this embodiment can be performed in a cell-free system, it is suitable for high throughput. Therefore, it is possible to rapidly provide a large amount of template DNA (1) for obtaining the desired sgRNA by in vitro transcription.

[0056] A suitable method for preparing the cassette double-stranded DNA (2A) used in step a of the method for producing template DNA (1) according to this embodiment is shown in Fig. 2. As shown in Fig. 2, the suitable method for preparing the cassette double-stranded DNA (2A) includes, for example, steps a1 and a2, which will be described in detail below.

[0057] As shown in the upper right panel of Figure 2, step a1 is a step of preparing a base sequence-containing double-stranded DNA (19A) comprising a support sequence (5) and a base sequence (17), wherein the base sequence (17) consists of an sgRNA scaffold sequence (3), an RNA polymerase promoter sequence (4), and a variable region sequence (18) that is positioned between the sgRNA scaffold sequence (3) and the RNA polymerase promoter sequence (4) and has restriction enzyme sites at both ends.

[0058] Referring to Figure 2, a preferred method for preparing the base sequence-containing double-stranded DNA (19A) in step a1 of this embodiment is described. First, as shown in the upper left panel of Figure 2, base oligonucleotides (13A, 13B) and support oligonucleotides (14A, 14B) are prepared, each having an sgRNA scaffold sequence (3), an RNA polymerase promoter sequence (4), and a variable region sequence (18). Furthermore, splint oligonucleotides (15A, 15B, 15C, 15D) are prepared, each having a sequence complementary to the end sequence of each oligonucleotide (13A, 13B, 14A, 14B) and capable of annealing across the end of the oligonucleotide. Next, as shown in the middle left panel of Figure 2, the base oligonucleotides (13A, 13B), support oligonucleotides (14A, 14B), and splint oligonucleotides (15A, 15B, 15C, 15D) are annealed and then ligated using a DNA-binding enzyme to prepare a single-stranded cyclic base sequence-containing nucleotide (16). This method is known as circular assembling into ordered sequence (CAIOS). The splint oligonucleotides (15A, 15B, 15C, 15D) are not shown in the single-stranded cyclic base sequence-containing nucleotide (16) shown in the middle left panel of Figure 2. Next, as shown in the lower left panel of Figure 2, the resulting single-stranded base sequence-containing cyclic nucleotide (16) is used as a template, and starting from the site where the splint oligonucleotide binds, a base sequence-containing double-stranded DNA (19A) can be suitably prepared by rolling circle amplification using two or more primers that bind to at least one of the support sequence (5) and the base sequence (17) and a strand-displacing DNA polymerase (11). Furthermore, random primers such as 6R5S primers can be used. This method is known as MPRCA (Multiply-primed RCA).

[0059] In this embodiment, the two or more primers that bind to at least one of the support sequence (5) and the base sequence (17) can be appropriately selected from primers known to those skilled in the art. Furthermore, the strand-displacing DNA polymerase (11) used in rolling circle amplification preferably has exonuclease activity. For example, φ29 DNA polymerase can be suitably used as such a strand-displacing DNA polymerase (11).

[0060] As shown on the right side of Figure 2, step a2 is a step of cleaving the restriction enzyme site in the variable region with a restriction enzyme to obtain a cassette double-stranded DNA (2A). Note that the example in Figure 2 illustrates a case where the restriction enzyme site in the variable region is a BcoDI site. More specifically, by acting the restriction enzyme BcoDI on the base sequence-containing double-stranded DNA (19A) to simultaneously cleave both ends of the variable region sequence (18) at two locations, a cassette double-stranded DNA (2A) can be obtained that has overhanging sequences (6A, 6B) on the 5' side of each strand and a phosphate group at the 5' end of each strand (see the enlarged view in the lower part of Figure 2).

[0061] In this embodiment, the restriction enzyme site in the variable region and the type of restriction enzyme in step a2 are not limited to BcoDI, and can be appropriately selected from those known to those skilled in the art.

[0062] Furthermore, in this embodiment, the restriction enzyme sites in the variable region can have two types of restriction enzyme sites selected from the group consisting of Type-IIS, Type-IIC, and Type-IIG, which recognize discontinuous or non-palindromic sequences. In this way, after cleaving the base sequence-containing double-stranded DNA (19A) with any of the Type-IIS, Type-IIC, or Type-IIG restriction enzymes, a phosphate group can be left at the cleavage site. Furthermore, by simultaneously cleaving and dephosphorylating the base sequence-containing double-stranded DNA (19A) with a first type of restriction enzyme corresponding to the restriction enzyme site, inactivating each enzyme, and then cleaving with a second type of restriction enzyme corresponding to the restriction enzyme site, a cassette double-stranded DNA (not shown) having a phosphate group only at the 5'-end of one strand can be obtained.

[0063] A method for producing template DNA (1) according to a modified embodiment of the present invention will be described with reference to Figure 3. In particular, the method for producing template DNA (1) according to this modified embodiment is characterized in that a single-stranded target sequence-containing oligonucleotide (7B) is used.

[0064] The production method according to a modified embodiment differs from the production method according to the above-described embodiment in the following two respects. First, in step a, a cassette double-stranded DNA (2B) having overhanging sequences (6A, 6C) at both ends of one strand of the fragment is used. Second, in step b, a single-stranded target sequence-containing oligonucleotide (7B) is used, which has, at both ends of the target sequence (8), a first cassette double-stranded DNA-binding sequence (23) complementary to the overhanging sequence (6A) of the cassette double-stranded DNA (2B) and a second cassette double-stranded DNA-binding sequence (24) complementary to the overhanging sequence (6C) of the cassette double-stranded DNA (2B). The other steps are the same as in the production method for template DNA (1) according to the above-described embodiment of the present invention.

[0065] An outline of steps a and b of a method for producing template DNA (1) according to a modified embodiment of the present invention is shown in Figure 3. Figure 3a shows step a, and Figure 3b shows step b.

[0066] In this modification, step a is essentially the same as step a in the above-described embodiment. In particular, in this modification, as shown in FIG. 3A, step a is a step of preparing a cassette double-stranded DNA (2B) consisting of a fragment containing an sgRNA scaffold sequence (3) and an RNA polymerase promoter sequence (4), with overhanging sequences (6A, 6C) at both ends of one strand of the fragment and a phosphate group at the 5' end of at least one strand of the fragment. In this modification, the method for preparing the cassette double-stranded DNA (2B) in step a is not particularly limited.

[0067] Referring to Figure 3a, a preferred method for preparing the cassette double-stranded DNA (2B) in step a of this modified example will be described in more detail. As shown in Figure 3a, first, a base sequence-containing double-stranded DNA (19B) is prepared. This base sequence-containing double-stranded DNA (19B) is a double-stranded DNA having a base sequence (17) consisting of an RNA polymerase promoter sequence (4), a variable region sequence (18), and an sgRNA scaffold sequence (3), and a support sequence (5) not shown. In the example of Figure 3, the variable region sequence (18) of the base sequence-containing double-stranded DNA consists of a BcoDI site (20), an MwoI site (21), and a variable sequence (22) located between the BcoDI site (20) and the MwoI site (21). First, the base sequence-containing double-stranded DNA (19B) is cleaved with the restriction enzyme MwoI to create a protruding sequence (6C) at the 3' end of the sgRNA scaffold sequence (3) and a phosphate group at the 5' end of the other strand. The resulting fragment is then cleaved with the restriction enzyme BcoDI to create a protruding sequence (6A) on the 5' side of the RNA polymerase promoter sequence (4) and a phosphate group at the 5' end of the protruding sequence. This allows for the preparation of a cassette double-stranded DNA (2B) that has protruding sequences (6A, 6C) at both ends of one strand and phosphate groups at the 5' ends of both strands.

[0068] In the example of Figure 3a, a BcoDI site (20) and an MwoI site (21) are described as restriction enzyme sites. However, as long as protruding sequences (6A, 6C) can be formed at both ends of one strand, the restriction enzyme sites are not limited to these, and any restriction enzyme site known to those skilled in the art can be appropriately selected.

[0069] In this modification, step b is essentially the same as step b in the above-described embodiment. In particular, in this modification, as shown in FIG. 3B, step b is a step of preparing a single-stranded target sequence-containing oligonucleotide (7B) having a phosphorylated 5' end and a first cassette double-stranded DNA-binding sequence (23) complementary to the overhanging sequence (6A) of the cassette double-stranded DNA (2B) and a second cassette double-stranded DNA-binding sequence (24) complementary to the overhanging sequence (6C) of the cassette double-stranded DNA (2B) at both ends of the target sequence (8). In this modification, the method for preparing the single-stranded target sequence-containing oligonucleotide (7B) in step b is not particularly limited, but it is preferably a synthetic oligonucleotide precisely synthesized base by base according to the desired sequence by a conventional method.

[0070] Although not shown, in this modified example, step c is a step in which the cassette double-stranded DNA (2B) and the single-stranded target sequence-containing oligonucleotide (7B) are ligated with a DNA-binding enzyme to obtain a target sequence-containing cyclic nucleotide. More specifically, the overhanging sequences (6A, 6C) of the cassette double-stranded DNA (2B) first complementarily bind to the first cassette double-stranded DNA-binding sequence (23) and the second cassette double-stranded DNA-binding sequence (24) of the single-stranded target sequence-containing oligonucleotide (7B). In this state, the cassette double-stranded DNA (2B) and the single-stranded target sequence-containing oligonucleotide (7B) are ligated with a DNA-binding enzyme to obtain a target sequence-containing cyclic nucleotide.

[0071] In this modification, step c is the same as step c of the production method according to the above embodiment, except that the cassette double-stranded DNA (2B) and the single-stranded target sequence-containing oligonucleotide (7B) used have different structures and are linked together in different ways. Therefore, the number of nicks, the type of DNA-binding enzyme, and the conditions for the ligation reaction using the DNA-binding enzyme are not particularly limited, and can be the same as step c of the production method according to the above embodiment, for example.

[0072] Although not shown, in this modification, steps d and e are the same as steps d and e in the production method according to the above-described embodiment. In this manner, template DNA (1) can be prepared.

[0073] A kit according to one embodiment of the present invention, although not shown, is a kit for carrying out the method for producing template DNA according to the above-described embodiment or a modified example of the embodiment, and is characterized by including a cassette double-stranded DNA (2A or 2B), a DNA binding enzyme, a strand-displacement DNA polymerase (11), a buffer solution for strand-displacement DNA synthesis reaction, an amplification primer, and four types of deoxyribonucleotides.

[0074] In this embodiment and its modifications, the cassette double-stranded DNA (2A, 2B) can be either the cassette double-stranded DNA (2A) or the cassette double-stranded DNA (2B). The DNA binding enzyme and strand-displacing DNA polymerase (11) are not particularly limited, but the above-mentioned ones can be preferably used.

[0075] In this embodiment and its modifications, the buffer solution for strand displacement-type DNA synthesis reaction, the amplification primers, and the four types of deoxyribonucleotides are not particularly limited, and can be appropriately selected from those well known to those skilled in the art. [Example]

[0076] Examples are provided below to explain in detail the method for producing template DNA according to the present invention.

[0077] Example 1: Preparation of template DNA In Example 1, template DNA for obtaining sgRNA by in vitro transcription was prepared as follows using a cassette double-stranded DNA having an overhanging sequence on the 5' side of each strand and a phosphate group at the 5' end of each strand, and a double-stranded oligonucleotide containing a target sequence.

[0078] <Preparation of cassette double-stranded DNA> First, a cassette double-stranded DNA having a protruding sequence on the 5' side of each strand and a phosphate group at the 5' end of each strand was prepared as follows: The preparation was carried out by the CAIOS method described in detail in the embodiment.

[0079] (Oligonucleotide preparation) The oligonucleotides used in Example 1 are shown in Table 1, and the splint oligonucleotides are shown in Table 2. Figure 4 shows the DNA map obtained when the oligonucleotides (bv2.1_1, bv4_2, sv2.1_1, sv2_2) were ligated and circularized. In these oligonucleotides, the T7 promoter sequence refers to the "TAATACGACTCACTATAGG" sequence in oligonucleotide bv2.1_1, and the sgRNA scaffold sequence refers to the "GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT" sequence in oligonucleotides bv2.1_1 and bv4_2. The BcoDI site refers to the "GAGAC" and "GTCTC" sequences in oligonucleotide bv2.1_1.

[0080] [Table 1]

[0081] [Table 2]

[0082] (Preparation of buffer solution) The 10x phosphorylation buffer was prepared by mixing 2 mL of 1M Tris acetate (pH 7.9), 1 mL of 1M magnesium acetate, 1 mL of 1 mg bovine serum albumin, and 6 mL of distilled water. The 10x annealing buffer was prepared by mixing 2 mL of 1M Tris acetate (pH 7.8), 1 mL of 1M magnesium acetate, 2.5 mL of 4M potassium glutamate, 0.2 mL of 50 mM NAD, 1 mL of 1M ammonium sulfate, and 3.3 mL of distilled water. The 10x RCA buffer was prepared by mixing 2 mL of 1M Tris acetate (pH 7.5), 0.625 mL of 4M potassium glutamate, 2 mL of 1M magnesium acetate, 4 mL of 1M ammonium sulfate, and 1.375 mL of distilled water.

[0083] (Oligonucleotide phosphorylation) For subsequent ligation of the oligonucleotides, the 5'-ends of the oligonucleotides represented by SEQ ID NOS: 1-4 were phosphorylated as follows. First, 4 μL of a solution was prepared by mixing the oligonucleotides represented by SEQ ID NOS: 1-4 (bv2.1_1, bv4_2, sv2.1_1, and sv2_2) in a single container so that the concentration of each oligonucleotide was 10 pmol / μL. To this solution, 5 μL of 10x phosphorylation buffer, 5 μL of 10 mM ATP, 0.5 μL of 100 mM dithiothreitol, 2 μL of T4 polynucleotide kinase (New England Biolabs), and 33.5 μL of distilled water were added to bring the total volume to 50 μL. This mixture was incubated at 37°C for 30 minutes to phosphorylate the oligonucleotides, followed by 20 minutes at 65°C to inactivate the enzyme, and then cooled to 12°C. The concentration of each oligonucleotide in the resulting phosphate-containing oligonucleotide mixture was 0.8 pmol / μL.

[0084] (annealing) After the phosphorylation treatment, the following procedure was performed to anneal the phosphate-containing oligonucleotide mixture with the splint oligonucleotides listed in Table 2. Prior to the treatment, 1 μL of splint oligonucleotide mixture was prepared by mixing each splint oligonucleotide (splint v2.1_1 to v4_2, splint v4_2 to sv2.1_1, splint sv2_1 to sv2_2, and splint sv2_2 to tv2_1) in a single container at a concentration of 5 pmol / μL. First, 1 μL of 10x annealing buffer and 1.8 μL of distilled water were added to a 0.2 mL tube and mixed. Next, 6.3 μL of the 0.8 pmol / μL phosphate-containing oligonucleotide mixture was added to the tube, followed by 1 μL of the 5 pmol / μL splint oligonucleotide mixture for a total volume of 10 μL. The mixture was heated to 95°C for 1 minute, then rapidly cooled to 4°C and maintained for 10 minutes, and then maintained at 12°C for an extended period to complete the annealing process between the oligonucleotide and the splint oligonucleotide.

[0085] (ligation reaction) Next, the following treatment was carried out to ligate and circularize the oligonucleotides annealed to the splint oligonucleotides. After annealing, 1 μL of 10× annealing buffer and 1 μL of E. coli DNA ligase (New England Biolabs) were added to the tube, followed by 8 μL of distilled water to make a total volume of 10 μL. This mixture was then mixed with the above solution to make a total volume of 20 μL. The resulting mixture was incubated at 37°C for 30 minutes to complete the ligation reaction, then incubated at 65°C for 20 minutes to inactivate the enzyme, and then cooled to 12°C to obtain a ligation reaction solution containing a base sequence-containing cyclic nucleotide.

[0086] (Amplification reaction) To perform the MPRCA (Multiply-primed RCA) amplification reaction, 2 μL of 100 μM 6R5S primer, 2 μL of 10× RCA buffer, 2 μL of 10 mM dNTPs, 1 μL of 100 mM DTT, 0.1 μL of pyrophosphatase (New England Biolabs), 1 μL of φ29 DNA polymerase (Kanto Chemical Co., Ltd.), and 9.9 μL of distilled water were added to a new 0.2 mL tube and stirred. Then, 2 μL of the ligation reaction mixture was added to the tube to bring the total volume to 20 μL. This mixture was incubated at 30°C for 16 hours, then inactivated by heating at 65°C for 10 minutes. The mixture was then cooled to 12°C to complete the amplification reaction. As a result of this reaction, a base sequence-containing double-stranded DNA was obtained as an amplification product, which was a concatemer of the same sequence consisting of the support sequence and the base sequence. Subsequently, 180 μL of distilled water was added to the amplified product to dilute it to an appropriate concentration, thereby obtaining a diluted product.

[0087] (Preparation of cleavage reaction solution for size confirmation by cleavage of amplification products) The following procedure was performed to confirm the size of the oligonucleotide by cleavage at the BamHI site. 5 μL of 10× CutSmart buffer (New England Biolabs), 1 μL of the restriction enzyme BamHI, and 20 μL of distilled water were added to a new 0.2 mL tube and stirred. Next, 25 μL of the diluted product was added to the tube. This mixture was incubated at 37°C for 30 minutes and then cooled to 12°C to complete the cleavage reaction at the BamHI site. The resulting cleavage reaction solution for size confirmation was used to confirm the size of the product by standard agarose gel electrophoresis, as described below. The results are described below.

[0088] (restriction enzyme cleavage) To a tube containing 50 μL of the diluted product, 10 μL of 10x CutSmart buffer (New England Biolabs), 2 μL of the restriction enzyme BcoDI, and 38 μL of distilled water were added to bring the total volume to 100 μL. This mixture was incubated at 37°C for 1 hour to complete the BcoDI cleavage reaction, and then cooled to 12°C. The size confirmation cleavage reaction mixture and the BcoDI cleavage reaction mixture obtained in this step were analyzed by standard agarose gel electrophoresis. The results are shown in Figure 5. As shown in Figure 5, the size confirmation cleavage reaction mixture (lane 1) revealed the presence of a 280 bp product (see Figure 4) consisting of four oligonucleotides (bv2.1_1, bv4_2, sv2.1_1, and sv2_2). In contrast, the BcoDI cleavage reaction mixture (lane 2) revealed a product approximately 30 bases shorter than the 280 bp product. Therefore, the variable region sequence was cleaved from the base sequence-containing double-stranded DNA, confirming the generation of cassette double-stranded DNA. Finally, the BcoDI cleavage reaction solution was purified using the Wizard® SV Gel and PCR Clean-Up System to obtain a 0.1 pmol / μL cassette double-stranded DNA solution. The concentration of this cassette double-stranded DNA was determined using the Qubit® assay. As described above, this cassette double-stranded DNA contains overhanging sequences on the 5' side of each strand and a phosphate group at the 5' end of each strand, and is also used in the subsequent preparation of template DNA.

[0089] <Preparation of cassette double-stranded DNA containing a phosphate group only at the 5' end of one strand> Although not used in the subsequent preparation of template DNA, a cassette double-stranded DNA having overhanging sequences on the 5' side of each strand and containing a phosphate group at only the 5' end of one strand was prepared as follows.

[0090] (Preparation of oligonucleotides ~ Size confirmation by cleavage of amplified products) The same base oligonucleotides, support oligonucleotides, and splint oligonucleotides as above were used, and the procedures from preparation of the oligonucleotides to confirmation of size by cleavage of the amplified product were carried out in the same manner as above.

[0091] (First cleavage by restriction enzyme and dephosphorylation) To the tube containing the remaining 88 μL of the diluted product, 10 μL of 10× CutSmart buffer (New England Biolabs), 2 μL of restriction enzyme Esp3I, and 2 μL of dephosphorylation enzyme CIAP (Takara Bio Inc.) were added. This mixture was reacted at 37°C for 1 hour to complete the cleavage reaction with the restriction enzyme Esp3I and the dephosphorylation reaction at the cleaved site. The enzyme was then inactivated by treatment at 65°C for 20 minutes and cooled to 12°C. The resulting solution was purified using the Wizard® SV Gel and PCR Clean-Up System to obtain a dephosphorylated solution.

[0092] (Second cleavage with restriction enzyme) To a tube containing 50 μL of the dephosphorylation solution, 10 μL of 10x CutSmart buffer (New England Biolabs), 2 μL of the restriction enzyme BsaI, and 38 μL of distilled water were added to a total volume of 100 μL. This mixture was incubated at 37°C for 1 hour to complete the cleavage reaction at the BsaI site. The mixture was then cooled to 12°C, and the resulting solution was purified using the Wizard® SV Gel and PCR Clean-Up System to obtain a 0.1 pmol / μL cassette double-stranded DNA solution. The concentration of this cassette double-stranded DNA was determined using a Qubit® assay. As described above, this cassette double-stranded DNA contains overhanging sequences on the 5' end of each strand and a phosphate group at the 5' end of only one strand.

[0093] <Preparation of target sequence-containing oligonucleotides> Next, a double-stranded oligonucleotide containing the target sequence was prepared as follows.

[0094] (Oligonucleotide preparation) The sense and antisense oligonucleotides used in Example 1 are shown in Table 3. In these sense and antisense oligonucleotides, the target sequences are "CATTACTGGATCTATCAAC" and "TTGATAGATCCAGTAATGA," which are complementary to each other. The cassette double-stranded DNA binding sequences are "TAGG" and "AAAC."

[0095] [Table 3]

[0096] (Phosphorylation of antisense oligonucleotides) Phosphorylation of the 5' end of antisense oligonucleotides (sgRNA for lambda_1 AS) was performed as follows. First, 6 μL of a 50 pmol / μL oligonucleotide solution (consisting of a cassette double-stranded DNA binding sequence and a target sequence), 5 μL of 10x phosphorylation buffer, 5 μL of 10 mM ATP, 0.5 μL of 100 mM dithiothreitol, 2 μL of T4 polynucleotide kinase (New England Biolabs), and 31.5 μL of distilled water were added to a new tube to bring the total volume to 50 μL. This mixture was incubated at 37°C for 30 minutes to phosphorylate the oligonucleotides, then incubated at 65°C for 20 minutes to inactivate the enzyme, and then cooled to 12°C to obtain a phosphate-containing antisense oligonucleotide solution. The concentration of the phosphate-containing antisense oligonucleotide in this solution was 6 pmol / μL.

[0097] (annealing) After the phosphorylation treatment, the following annealing process was performed to double-strand the sense oligonucleotide and phosphate-containing antisense oligonucleotide. First, 10 μL of 6 pmol / μL phosphate-containing antisense oligonucleotide solution, 1.2 μL of 50 pmol / μL sense oligonucleotide, 2 μL of 10× annealing buffer, and 6.8 μL of distilled water were added to a 0.2 mL tube to make a total volume of 20 μL. This mixture was heated at 95°C for 1 minute, then slowly cooled to 25°C and maintained for an extended period to complete the annealing process. The concentration of the target sequence-containing oligonucleotide in the resulting target sequence-containing oligonucleotide solution was 3 pmol / μL. 20 μL of this target sequence-containing oligonucleotide solution was added to 180 μL of distilled water and mixed to prepare a 0.3 pmol / μL target sequence-containing oligonucleotide solution.

[0098] <Preparation of template DNA> Template DNA was prepared as follows using a cassette double-stranded DNA solution containing overhanging sequences on the 5' side of each strand and a phosphate group at the 5' end of each strand, and a double-stranded target sequence-containing oligonucleotide solution.

[0099] (ligation reaction) The following procedure was used to ligate the cassette double-stranded DNA and the target sequence-containing oligonucleotide. To a new tube, 2 μL of 0.1 pmol / μL cassette double-stranded DNA solution, 2 μL of 0.3 pmol / μL target sequence-containing oligonucleotide solution, 2 μL of 10× annealing buffer, 1 μL of E. coli DNA ligase (New England Biolabs), and 13 μL of distilled water were added to a total volume of 20 μL. This mixture was incubated at 16°C for 30 minutes to complete the ligation reaction between the cassette double-stranded DNA and the target sequence-containing oligonucleotide. The enzyme was then inactivated by incubation at 65°C for 20 minutes, and the mixture was then cooled to 25°C. 180 μL of distilled water was added to the resulting solution and mixed to obtain a target sequence-containing cyclic nucleotide solution.

[0100] (Amplification reaction) To perform the MPRCA amplification reaction, 2 μL of 100 μM 6R5S primer, 2 μL of 10x RCA buffer, 2 μL of 10 mM dNTPs, 1 μL of 100 mM DTT, 0.1 μL of pyrophosphatase (New England Biolabs), 1 μL of φ29 DNA polymerase (Kanto Chemical Co., Ltd.), and 9.9 μL of distilled water were added to a new 0.2 mL tube and stirred. Then, 2 μL of target sequence-containing cyclic nucleotide solution was added to the tube to bring the total volume to 20 μL. This mixture was reacted at 30 °C for 16 hours to obtain the target sequence-containing double-stranded DNA, which was an identical concatemer consisting of the support sequence, T7 promoter sequence, target sequence, and sgRNA scaffold sequence. After the reaction, the enzyme was inactivated by heating at 65 °C for 10 minutes, and the mixture was cooled to 12 °C to complete the amplification reaction. Subsequently, the amplified product was transferred to another tube containing 62.5 μL of distilled water and diluted to an appropriate concentration to obtain a diluted product.

[0101] (Preparation of cleavage reaction solution for size confirmation by cleavage of amplification products) The following procedure was performed to confirm the size of the target sequence-containing double-stranded DNA by cleavage at the BamHI site located in the buffer sequence. 2.5 μL of 10×K buffer (New England Biolabs), 0.5 μL of the restriction enzyme BamHI, and 9.5 μL of distilled water were added to a new 0.2 mL tube and mixed. Next, 12.5 μL of the diluted product was added to the tube to make a total volume of 25 μL. This mixture was incubated at 37°C for 30 minutes and then cooled to 12°C to complete the cleavage reaction at the BamHI site. The resulting cleavage reaction mixture for size confirmation was used to confirm the size of the product by standard agarose gel electrophoresis, as described below. The results are described below.

[0102] (restriction enzyme cleavage) The following procedure was performed to cleave the target sequence-containing double-stranded DNA at the DraI site contained at the end of the sgRNA scaffold sequence. 10 μL of 10xM buffer (Nippon Gene), 1 μL of the restriction enzyme DraI (Nippon Gene), and 39 μL of distilled water were added to a new 0.2 mL tube and stirred. Next, 50 μL of the diluted product was added to the tube to bring the total volume to 100 μL. This mixture was incubated at 37°C for 30 minutes to complete the cleavage reaction at the DraI site, and then cooled to 12°C. The cleavage reaction mixture for size confirmation and the BcoDI cleavage reaction mixture obtained in this step were analyzed by standard agarose gel electrophoresis (not shown). The results confirmed the presence of a product of the desired length consisting of the support sequence, T7 promoter sequence, target sequence, and sgRNA scaffold sequence. Therefore, cleavage of the target sequence-containing double-stranded DNA at the DraI restriction enzyme site at the end of the sgRNA scaffold sequence confirmed the generation of template DNA. Finally, the DraI cleavage reaction mixture was purified using the Monarch® PCR & DNA Cleanup Kit to obtain a 1 pmol / μL template DNA solution, the concentration of which was determined using the Qubit® assay.

[0103] It was found that the above procedure enabled the preparation of template DNA having a sequence consisting of a support sequence, a T7 promoter sequence, a target sequence, and an sgRNA scaffold sequence.

[0104] [Application Example 1: sgRNA Preparation] Using the template DNA obtained in Example 1 and the CUGA (registered trademark) sgRNA Synthesis Kit, sgRNA was prepared as follows.

[0105] (transcription reaction) To prepare sgRNA via transcription using the T7 promoter in the template DNA, the following procedure was performed. 4 μL of 5x transcription buffer, 2 μL of 100 mM DTT, 6 μL of NTP Mix, and 1 μL of CUGA7 enzyme solution were added to a 0.2 mL tube and stirred. Next, 2 μL of 1 pmol / μL template DNA solution was added to the tube for a total volume of 20 μL. This mixture was incubated at 37°C for 2 hours, then cooled to 12°C and maintained for an extended period. This completed the transcription reaction, yielding a crude sgRNA solution. Finally, the crude sgRNA solution was purified using the RNA purification system provided with the kit, completing the preparation of the sgRNA.

[0106] [Example 2: Preparation of template DNA] In Example 2, template DNA for obtaining sgRNA by in vitro transcription was prepared using a cassette double-stranded DNA fragment containing overhanging sequences at both ends of one strand and phosphate groups at the 5' ends of both strands, and a single-stranded oligonucleotide containing the target sequence.

[0107] <Preparation of cassette double-stranded DNA> Cassette double-stranded DNA was prepared in the same manner as in Example 1, except that the combination of oligonucleotides and splint oligonucleotides was changed from the method for preparing cassette double-stranded DNA having a phosphate group only at the 5' end of one strand of the fragment, the restriction enzyme used for the first cleavage was changed to MwoI and no dephosphorylation reaction was performed, and the restriction enzyme used for the second cleavage was changed to BcoDI. Note that the restriction enzyme BcoDI can cleave both the restriction enzyme BcoDI site and the restriction enzyme BsaI site.

[0108] The oligonucleotides used in Example 2 are shown in Table 4, and the splint oligonucleotides are shown in Table 5. Figure 6 shows the DNA map obtained by ligating and circularizing the oligonucleotides (bv4_1, bv4.1_2, sv2.1_1, sv2_2). In these oligonucleotides, the T7 promoter sequence refers to the "TAATACGACTCACTATAGG" sequence in oligonucleotide bv4_1, and the sgRNA scaffold sequence refers to the "TTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT" sequence in oligonucleotides bv4_1 and bv4.1_2. The BcoDI site refers to the "GAGAC" sequence in oligonucleotide bv4_1, and the MwoI site refers to the "GCTTTTAGAGC" sequence in oligonucleotide bv4_1.

[0109] [Table 4]

[0110] [Table 5]

[0111] <Preparation of target sequence-containing oligonucleotides> A single-stranded oligonucleotide containing the target sequence was prepared as follows.

[0112] (Oligonucleotide preparation) The sense oligonucleotides used in Example 2 are shown in Table 6. In the sense oligonucleotides, the target sequence refers to the sequence "ACCGAGTCGGTGCTTTTAAA", the first cassette double-stranded DNA binding sequence refers to the sequence "TAGG", and the second cassette double-stranded DNA binding sequence refers to the sequence "GTTTTA".

[0113] [Table 6]

[0114] (phosphorylation of sense oligonucleotide) A single-stranded target sequence-containing oligonucleotide was prepared by phosphorylating the sense oligonucleotide (sgRNA_scaffold_for v4) in the same manner as in Example 1. The prepared target sequence-containing oligonucleotide solution was diluted with distilled water to obtain a 0.6 pmol / μL target sequence-containing oligonucleotide solution.

[0115] <Preparation of template DNA> Template DNA was prepared using a cassette double-stranded DNA solution containing overhanging sequences at both ends of one strand of the fragment and phosphate groups at the 5'-ends of both strands, and a single-stranded target sequence-containing oligonucleotide solution. The procedure was the same as in Example 1, except that the concentration of the target sequence-containing oligonucleotide solution used in the ligation reaction was 0.6 pmol / μL and the amount of the 0.6 pmol / μL target sequence-containing oligonucleotide solution used was half the volume, i.e., 1 μL.

[0116] The above procedure demonstrated that template DNA containing a support sequence, a T7 promoter sequence, a target sequence, and an sgRNA scaffold sequence could be prepared. Therefore, even when using a single-stranded target sequence-containing oligonucleotide, template DNA could be obtained using the same procedure as in Example 1.

[0117] [Application Example 2: Preparation of sgRNA] Using the template DNA obtained in Example 2, sgRNA was prepared in the same manner as in Application Example 1. As a result, it was found that sgRNA corresponding to the template DNA of Example 2 could be prepared. [Industrial Applicability]

[0118] The simple method for producing sgRNAs solves a bottleneck for genome editing contract companies and is expected to become widely used. [Explanation of symbols]

[0119] 1. Template DNA 2A, 2B cassette double-stranded DNA 3. sgRNA Scaffold Sequence 4. RNA polymerase promoter sequence 5 Support Arrays 6A, 6B, 6C protruding sequences 7A, 7B Target sequence-containing oligonucleotides 8. Target Sequence 9A, 9B Cassette double-stranded DNA binding sequence 10. Target sequence-containing cyclic nucleotides 11 DNA polymerase 12. Target sequence-containing double-stranded DNA 13A, 13B base oligonucleotides 14A, 14B support oligonucleotides 15A, 15B, 15C, 15D splint oligonucleotides 16-base sequence-containing circular nucleotide 17 base sequence 18 Variable region sequences Double-stranded DNA containing 19A and 19B base sequences 20 BcoDI sites 21 MwoI sites 22 Variable Arrays 23 Cassette 1 double-stranded DNA binding sequence 24 Second cassette double-stranded DNA binding sequence

Claims

1. A method for producing template DNA for obtaining sgRNA by in vitro transcription using a cell-free cloning system, (a) preparing a cassette double-stranded DNA comprising a fragment including an sgRNA scaffold sequence, a support sequence, and a promoter sequence for an RNA polymerase, the fragment having overhanging sequences at both ends and a phosphate group at the 5' end of at least one strand of the fragment; (b) preparing a target sequence-containing oligonucleotide having a cassette double-stranded DNA binding sequence having a sequence complementary to the overhanging sequence of the cassette double-stranded DNA and a target sequence of the desired sgRNA, and having a phosphorylated 5' end; (c) ligating the cassette double-stranded DNA and the target sequence-containing oligonucleotide with a DNA binding enzyme to obtain a target sequence-containing cyclic nucleotide; (d) amplifying the target sequence-containing cyclic nucleotide as a template with a strand-displacing DNA polymerase to obtain a target sequence-containing double-stranded DNA that is an identical sequence concatemer having a repeat sequence consisting of the support sequence, the promoter sequence of the RNA polymerase, the target sequence, and the sgRNA scaffold sequence; (e) cleaving the target sequence-containing double-stranded DNA obtained in step d between the identical sequences to obtain the template DNA having a sequence consisting of a support sequence, a promoter sequence for RNA polymerase, a target sequence, and an sgRNA scaffold sequence; The cassette double-stranded DNA in step a is (a1) preparing a base sequence-containing double-stranded DNA comprising a support sequence and a base sequence, wherein the base sequence is composed of the sgRNA scaffold sequence, a promoter sequence for the RNA polymerase, and a variable region sequence disposed between the sgRNA scaffold sequence and the promoter sequence for the RNA polymerase and having restriction enzyme sites at both ends; (a2) cleaving the restriction enzyme site in the variable region with a restriction enzyme to obtain the cassette double-stranded DNA.

2. the cassette double-stranded DNA in step a has the overhanging sequence at the 5' end of each strand, The method of claim 1, wherein the target sequence-containing oligonucleotide in step b is a target sequence-containing double-stranded oligonucleotide, and the target sequence-containing double-stranded oligonucleotide is phosphorylated only at the 5' end of the oligonucleotide strand that binds to the phosphorylated strand of the cassette double-stranded DNA.

3. the cassette double-stranded DNA in step a has the overhanging sequences at both ends of one strand of the fragment; The method of claim 1, wherein the target sequence-containing oligonucleotide in step b is a single-stranded oligonucleotide containing, at both ends of the target sequence, a first cassette double-stranded DNA binding sequence complementary to one of the overhanging sequences in the cassette double-stranded DNA, and a second cassette double-stranded DNA binding sequence complementary to the other.

4. The method of any one of claims 1 to 3, wherein the sgRNA scaffold sequence has a restriction enzyme DraI site or a restriction enzyme BtgZI site and a PAM sequence at its end.

5. The method according to any one of claims 1 to 4, wherein the strand-displacing DNA polymerase is a strand-displacing DNA polymerase having exonuclease activity.

6. The method of claim 5, wherein the target sequence-containing double-stranded DNA in step d is obtained by rolling circle amplification using two or more primers that bind to the ends of the RNA polymerase promoter sequence and the sgRNA scaffold sequence of the cassette double-stranded DNA, respectively.

7. The method according to claim 6, wherein the primer is resistant to the exonuclease activity of the strand-displacing DNA polymerase.

8. The method according to claim 4, wherein the cleavage of the target sequence-containing double-stranded DNA in step e is performed by cleavage with a restriction enzyme or a CRISPR / Cas system corresponding to the restriction enzyme DraI site or the restriction enzyme BtgZI site.

9. The method of claim 1, wherein the base sequence-containing double-stranded DNA in step a1 is prepared by rolling circle amplification using a base sequence-containing cyclic nucleotide having the support sequence and the base sequence as a template, and two or more primers that bind to at least one of the support sequence and the base sequence.

10. The method according to any one of claims 1 to 9, wherein the restriction enzyme site in the variable region has two types of restriction enzyme sites selected from the group consisting of Type-IIS, Type-IIC, and Type-IIG, which recognize non-contiguous sequences or non-palindromic sequences.

11. The method of claim 10, wherein the cassette double-stranded DNA in step a2 is obtained by simultaneously cleaving and dephosphorylating the base sequence-containing double-stranded DNA obtained in step a1 with a first type of restriction enzyme corresponding to the restriction enzyme site, inactivating each enzyme, and then cleaving with a second type of restriction enzyme corresponding to the restriction enzyme site.

12. A kit for carrying out the method according to any one of claims 1 to 11, comprising: The kit comprises the cassette double-stranded DNA, the DNA binding enzyme, the strand displacement DNA polymerase, a buffer solution for a strand displacement DNA synthesis reaction, an amplification primer, and four types of deoxyribonucleotides.

Citation Information

Patent Citations

  • Method for rapidly preparing sgRNA by PCR with multiple overlap primers

    CN109207559A

  • Molecular cloning using rolling circle amplification

    JP2002525049A

  • Cyclic double strand DNA and method for amplifying DNA therewith

    JP2010051182A

  • Isothermal amplification of nucleic acids using primers containing randomized sequences and specific primers, and their use

    JP2013518598A

  • Isothermal Amplification Using an Oligocation Composite Primer Array

    JP2016529915A