SNP (Single Nucleotide Polymorphism) molecular marker related to saline-alkaline resistance of leymus chinensis in germination period, amplification primer and application of SNP molecular marker

By developing SNP molecular markers in Leymus chinensis and combining them with PCR amplification and enzyme digestion techniques, the problem of salt and alkali tolerance screening during the germination period of Leymus chinensis was solved, enabling early identification of salt and alkali tolerance and improving breeding efficiency. This method is applicable to the breeding and population improvement of Leymus chinensis varieties.

CN120843732AActive Publication Date: 2025-10-28INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI

Patent Information

Application Number
CN202511358325.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-23
Publication Date
2025-10-28
Estimated Expiration
2045-09-23

AI Technical Summary

Technical Problem

The lack of effective molecular markers in existing technologies for screening salt and alkali tolerance during the germination period of Leymus chinensis results in long breeding cycles and low efficiency. It is impossible to screen for salt and alkali tolerance during the germination period, and evaluation must be carried out after flowering and fruiting.

Method used

A SNP molecular marker located at base 184482188 on chromosome 3Xm of Leymus chinensis was developed. Specific primers were designed and combined with PCR amplification and restriction endonuclease digestion to distinguish between C and T genotypes, providing a rapid and accurate method for genotype identification.

Benefits of technology

This technology enables the screening of salt-tolerant germplasm resources during the vegetative growth stage of Leymus chinensis, significantly shortening the breeding cycle, improving breeding efficiency, and providing reliable genetic markers for variety selection and population improvement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120843732A_ABST
    Figure CN120843732A_ABST
Patent Text Reader

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to saline-alkaline resistance in a germination period of leymus chinensis, an amplification primer and application of the SNP molecular marker. The SNP molecular marker is located at the 184482188th basic group of a leymus chinensis 3Xm chromosome, and the polymorphism is C or T; the sequence of the C genotype is as shown in SEQ ID NO.3, and the sequence of the T genotype is as shown in SEQ ID NO.4. According to the invention, the SNP locus significantly related to saline-alkaline tolerance in the germination period is identified in Leymus chinensis for the first time, the association relationship between the genotype and saline-alkaline tolerance phenotype is defined, and a reliable genetic marker is provided for Leymus chinensis saline-alkaline tolerance molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant molecular marker technology, and in particular to a SNP molecular marker, amplification primer, and application of Leymus chinensis germination period salt and alkali tolerance. Background Technology

[0002] Leymus chinensis (Trin.) Tzvel., also known as alkali grass, is a perennial rhizomatous plant belonging to the genus Leymus in the Poaceae family. It is an important dominant species in meadow steppes and typical steppes in eastern Eurasian steppe regions, widely distributed in Heilongjiang, Jilin, Liaoning, Inner Mongolia, Hebei, and Shanxi provinces of my country. Leymus chinensis is characterized by high nutritional value, palatability, strong root penetration and expansion capabilities, and the ability to bind and stabilize soil, conserve water and soil. It also possesses excellent traits such as cold resistance, salt and alkali tolerance, and drought resistance, making it a forage grass with significant economic and ecological value. It is commonly used for saline-alkali land improvement, desertification control, and degraded grassland restoration. Developing new salt-tolerant varieties of Leymus chinensis can not only effectively utilize saline-alkali land for forage production and alleviate pressure on arable land, but also improve saline-alkali land and restore grassland ecosystems.

[0003] In current Leymus chinensis breeding practices, important agronomic traits are mostly selected indirectly for genotypes through phenotypic selection, resulting in long breeding cycles and low efficiency, thus hindering the progress of Leymus chinensis breeding. Marker-assisted selection, especially using molecular markers associated with target traits, can transform traditional phenotypic selection into direct genotype selection, thereby greatly improving breeding efficiency and accelerating genetic improvement. Identifying molecular markers closely linked to important agronomic traits is fundamental to marker-assisted selection. Therefore, developing molecular markers related to Leymus chinensis' salt tolerance and conducting marker-assisted selection breeding research is of great significance.

[0004] Seed germination, as the starting point of plant growth, is particularly sensitive to salt and alkali stress. Salt and alkali environments inhibit normal seed respiration, reduce seed viability, and lead to delayed germination or even death. Therefore, screening salt-tolerant Leymus chinensis germplasm resources during germination is crucial for breeding new salt-tolerant Leymus chinensis varieties. In breeding practice, germination rate is often used as an indicator to evaluate the salt and alkali tolerance of Leymus chinensis during germination, but molecular markers linked to germination rate under salt and alkali conditions still need to be discovered. Currently, there are no usable molecular markers for assisting in the screening of salt and alkali tolerance during the germination period of Leymus chinensis; the evaluation can only be conducted after the material has flowered and set fruit. Leymus chinensis has a long growth period and a low fruit set rate; therefore, when selecting salt-tolerant Leymus chinensis materials for breeding as parents, the selection must be limited by the growth period and must wait until flowering and fruiting before screening can proceed. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention proposes a SNP molecular marker, amplification primers, and their applications related to salt and alkali tolerance during the germination period of Leymus chinensis. By developing a molecular marker related to salt and alkali tolerance during the germination period, this invention enables the screening of salt- and alkali-tolerant germplasm resources during the vegetative growth stage of Leymus chinensis, significantly accelerating the breeding process.

[0006] This invention provides a SNP molecular marker related to salt and alkali tolerance during the germination period of Leymus chinensis. The SNP molecular marker is located at base 184482188 on chromosome 3Xm of Leymus chinensis and has a polymorphism of C or T. The C genotype sequence is shown in SEQ ID NO.3 and the T genotype sequence is shown in SEQ ID NO.4.

[0007] In some embodiments, the C-type mutant sheepgrass has a significantly higher relative germination rate in saline-alkali environments than the T-type mutant.

[0008] The present invention also provides a detection primer for the SNP molecular marker described above, as shown in SEQ ID NO. 1~2.

[0009] The present invention also provides a detection kit comprising the aforementioned detection primers.

[0010] The present invention also provides the application of any one of the SNP molecular marker, the detection primer, and the detection kit in distinguishing the salt and alkali tolerance of Leymus chinensis during its germination period.

[0011] The present invention also provides the application of any one of the SNP molecular markers, the detection primers, and the detection kits in the preparation of reagents for distinguishing the salt and alkali tolerance of Leymus chinensis during its germination period.

[0012] The present invention also provides the application of any one of the SNP molecular markers, the detection primers, and the detection kits in the identification of salt-tolerant Leymus chinensis individuals, population selection, or maintenance of salt-tolerant Leymus chinensis strains during the germination period.

[0013] This invention also provides a method for breeding sheepgrass varieties, comprising the following steps: (1) Extract genomic DNA from individual Leymus chinensis specimens during the germination period; (2) The genomic DNA was amplified by PCR using the detection primers described above; (3) The amplification products were digested with restriction endonuclease and detected by electrophoresis to determine the genotype of the SNP molecular marker; (4) Select individuals of the C genotype of Leymus chinensis as backup parents for breeding salt-tolerant Leymus chinensis varieties during the germination period.

[0014] In some embodiments, the restriction endonuclease is HindIII, and the distinction between C genotype and T genotype is achieved by HindIII recognizing and cleaving PCR amplification products.

[0015] The present invention also provides a method for screening salt and alkali tolerance during the germination period of Leymus chinensis, including using the SNP molecular markers to identify the genotype of Leymus chinensis germplasm resources in order to predict and screen Leymus chinensis individuals or populations with strong salt and alkali tolerance.

[0016] In summary, compared with the prior art, the present invention achieves the following technical effects: 1. This invention is the first to identify a SNP locus in Leymus chinensis that is significantly associated with salt and alkali tolerance during germination, and clarifies the association between its genotype and salt and alkali tolerance phenotype, providing a reliable genetic marker for molecular breeding of Leymus chinensis with salt and alkali tolerance.

[0017] 2. This invention designs specific primers based on this SNP site and establishes a rapid and accurate method for genotype identification. Through PCR amplification combined with restriction endonuclease HindIII digestion, C homozygous and C / T heterozygous genotypes can be directly distinguished. The operation is simple, and the results are stable and reliable.

[0018] 3. By utilizing the molecular markers provided by this invention, molecular marker-assisted selection for salt and alkali tolerance during the germination period can be achieved in the early stages of Leymus chinensis breeding, avoiding reliance solely on phenotypic identification, significantly shortening the breeding cycle and improving breeding efficiency.

[0019] 4. The molecular markers, detection primers, and detection kits of the present invention can be widely used in the identification of Leymus chinensis germplasm resources, the breeding of salt-tolerant varieties, the improvement of populations, and the maintenance of superior lines, and have strong promotion and application value. Attached Figure Description

[0020] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0021] Figure 1 This is the SNP index and related statistical results of an embodiment of the present invention.

[0022] Figure 2 The electrophoresis results of genotyping of 200 Leymus chinensis germplasm resources using molecular markers are shown in this embodiment of the invention.

[0023] Figure 3 This is a statistical analysis of the relative germination rates of two genotypes of Leymus chinensis in salt-alkali soil, as described in this embodiment of the invention. Detailed Implementation

[0024] To enable those skilled in the art to better understand the present invention, the technical solutions in the embodiments of the present invention are clearly and completely described. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, all materials and reagents used are commercially available.

[0026] Acquisition of SNP molecular markers related to salt and alkali tolerance during Leymus chinensis germination period Germination rates of 200 Leymus chinensis germplasm resources from the National Mid-term Germplasm Resource Bank for Cold-Region Crops and Soybeans under saline-alkali conditions were evaluated using petri dish germination experiments. A mixed saline-alkali solution (NaCl, Na2SO4, NaHCO3, and Na2CO3, molar ratio 1:9:9:1, total concentration 60 mM) was used to simulate the composition of soda-alkali soil and subject the Leymus chinensis seeds to saline-alkali stress during germination. Each material had three control groups (distilled water) and three saline-alkali treatment groups, with 30 seeds in each group. Germination was carried out in a light incubator (photoperiod 14h / 10h, temperature 25℃ / 16℃). Germination rates were calculated for each group on day 20. The relative saline-alkali germination rate of each Leymus chinensis resource was obtained by dividing the average germination rate of the saline-alkali group by the average germination rate of the control group.

[0027] The relative germination rates of 200 Leymus chinensis germplasm resources were ranked, and DNA was extracted from the 20 materials with the highest and lowest relative germination rates. The specific methods are as follows: Weigh 0.1g of fresh leaves, cut them into small pieces, put them into a mortar, grind them with liquid nitrogen, and then add 500μL of 2×CTAB solution; The 2×CTAB solution is formulated as follows: 2% CTAB, 0.1% PVP40, 20mM EDTA (pH 8.0), 100mM Tris-HCl (pH 8.0), 1.4M NaCl, and 1% β-mercaptoethanol.

[0028] The DNA samples with the highest relative germination rates were mixed in equal amounts, and the DNA samples with the lowest relative germination rates were mixed in equal amounts. Then, 30-fold genome resequencing was performed on each sample.

[0029] First, the sequencing data was filtered using FASTP software with the default filtering parameters selected. After filtering, the cleaned data was aligned to the *Leymus chinensis* reference genome (Li et al., PNAS, 2023, PMID:37874858) using BWA software (v0.7.17-r1188). Next, variant information was obtained using bcftools software, and SNP sites were filtered. Finally, the SNP index and related statistical results were calculated using MutMap software.

[0030] The results are as follows Figure 1 As shown, there is a distinct peak in the SNP index on chromosome 3Xm, indicating that this locus may be related to salt and alkali tolerance during the germination period of Leymus chinensis.

[0031] Analysis of the sequencing data from the two pools revealed that at locus 184482188 on chromosome 3Xm, the salt-tolerant pool was predominantly C, while the salt-sensitive pool was C / T heterozygous. A pair of primers was designed based on the sequences near this locus, and the primer sequences are as follows: Forward primer: SEQ ID NO.1; Reverse primer: SEQ ID NO.2.

[0032] The above primers were used to amplify 200 Leymus chinensis germplasm resources by PCR. The PCR reaction system was as follows: DNA template: 0.5 μL; forward primer: 0.2 μL; reverse primer: 0.2 μL; 2×Rapid Taq Master Mix (Novozymes, catalog number P222-01): 5 μL; ddH2O: 4.1 μL.

[0033] The PCR reaction procedure is as follows: Pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 54°C for 15 seconds, extension at 72°C for 15 seconds, run for 35 cycles; final extension at 72°C for 5 minutes. PCR amplification products can be stored at 4°C.

[0034] The amplification product sequence of homozygous Leymus chinensis is as follows: CTTCAGAGGTTGGATGATGGGAGTCAAGCT C AATGCATCCCTCAGCTTTTCATAAGCCTGCACACAATTCTTATCAAAGGAATATGGTACGTCTTTCTACAAAAGGTCAGTCAACGGTTTTGAGAGCTTGG (SEQ ID NO. 3).

[0035] The amplification product sequence of heterozygous Leymus chinensis is as follows: CTTCAGAGGTTGGATGATGGGAGTCAAGCT T AATGCATCCCTCAGCTTTTCATAAGCCTGCACACAATTCTTATCAAAGGAATATGGTACGTCTTTCTACAAAAGGTCAGTCAACGGTTTTGAGAGCTTGG (SEQ ID NO. 4).

[0036] Add 0.2 μL of restriction endonuclease HindIII (NEB, catalog number R0104S) to the PCR amplification product, mix well, and digest at 37°C for 8-16 hours. Perform agarose gel electrophoresis on the reaction product.

[0037] The amplification product of homozygous Leymus chinensis could not be digested by HindIII restriction enzyme, and the band size remained at 131 bp. Half of the amplification product of heterozygous Leymus chinensis could be digested by HindIII into 26 bp and 105 bp bands. Since the 26 bp band is not easily distinguishable on agarose gel, the reaction product of heterozygous Leymus chinensis appeared as two bands of 131 bp and 105 bp on agarose gel. Figure 2 ).

[0038] The relative germination rates of two genotypes of Leymus chinensis in saline-alkali environments were statistically analyzed, and the results showed that there were significant differences in the relative germination rates of the two genotypes. Figure 3 This indicates that the molecular marker can be used for screening salt and alkali tolerance during the germination period of Leymus chinensis.

[0039] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

[0040] sequence list SEQ ID NO.1 CTTCAGAGGTTGGATGATGGGAGTCAAGCT SEQ ID NO.2 CCAAGCTCTCAAAACCGTTGAC SEQ ID NO.3 CTTCAGAGGTTGGATGATGGGAGTCAAGCTCAATGCATCCCTCAGCTTTTCATAAGCCTGCACACAATTCTTATCAAAGGAATATGGTACGTCTTTCTACAAAAGGTCAGTCAACGGTTTTGAGAGCTTGG SEQ ID NO.4 CTTCAGAGGTTGGATGATGGGAGTCAAGCTTAATGCATCCCTCAGCTTTTCATAAGCCTGCACACAATTCTTATCAAAGGAATATGGTACGTCTTTCTACAAAAGGTCAGTCAACGGTTTTGAGAGCTTGG。

Claims

1. A SNP molecular marker related to salt and alkali tolerance during the germination period of Leymus chinensis, characterized in that, The SNP molecular marker is located at base 184482188 on chromosome 3Xm of Leymus chinensis, and the polymorphism is C or T; the C genotype sequence is shown in SEQ ID NO.3, and the T genotype sequence is shown in SEQ ID NO.

4.

2. The SNP molecular marker according to claim 1, characterized in that, The C-genotype of Leymus chinensis exhibits a significantly higher relative germination rate in saline-alkali environments than the T-genotype.

3. A detection primer for an SNP molecular marker as described in claim 1 or 2, characterized in that, The detection primers are shown in SEQ ID NO.1~2.

4. A test kit, characterized in that, It includes the detection primers as described in claim 3.

5. The application of any one of the SNP molecular markers of claim 1 or 2, the detection primers of claim 3, and the detection kit of claim 4 in distinguishing the salt and alkali tolerance of Leymus chinensis during its germination period.

6. The application of any one of the SNP molecular markers of claim 1 or 2, the detection primers of claim 3, and the detection kit of claim 4 in the preparation of a reagent for distinguishing the salt and alkali tolerance of Leymus chinensis during its germination period.

7. The application of any one of the SNP molecular markers of claim 1 or 2, the detection primers of claim 3, and the detection kit of claim 4 in the identification of salt-tolerant Leymus chinensis individuals, population selection, or maintenance of salt-tolerant Leymus chinensis strains during the germination period.

8. A method for breeding a variety of sheepgrass, characterized in that, The following steps are involved: (1) Extract genomic DNA from individual Leymus chinensis specimens during the germination period; (2) PCR amplification of the genomic DNA using the detection primers described in claim 3; (3) The amplification products were digested with restriction endonuclease and detected by electrophoresis to determine the genotype of the SNP molecular marker; (4) Select individuals of the C genotype of Leymus chinensis as backup parents for breeding salt-tolerant Leymus chinensis varieties during the germination period.

9. The breeding method according to claim 8, characterized in that, The restriction endonuclease is HindIII, which is used to distinguish between the C and T genotypes by recognizing and cleaving the PCR amplification products.

10. A method for screening salt and alkali tolerance during the germination period of Leymus chinensis, characterized in that, This includes using the SNP molecular markers described in claim 1 to identify the genotype of Leymus chinensis germplasm resources in order to predict and screen Leymus chinensis individuals or populations with strong salt and alkali tolerance.

Citation Information

Patent Citations

  • SNP primer applied to genetic typing of guinea grasses with different germplasm and application of primer

    CN104611435A

  • SNP (single nucleotide polymorphism) molecular markers related to salt tolerance and hypoxia tolerance of rice and application of SNP molecular markers

    CN109371160A

  • Saline-alkali tolerant major QTL site on brassica napus A04 chromosome, molecular marker and application

    CN117965782A

  • SNP molecular marker related to drought resistance character of leymus chinensis and application

    CN119120764A

  • KASP molecular marker related to salt tolerance of mung bean germination period, primer group, kit and application

    CN120624707A

Cited By

  • SNP molecular marker combination related to saline-alkaline tolerance of elymus dahuricus and application of SNP molecular marker combination

    CN121344248A

  • SNP molecular marker combination related to salt-alkali tolerance of elytrigia repens and application thereof

    CN121344248B

  • SNP (Single Nucleotide Polymorphism) molecular marker related to saline-alkaline resistance in germination period of leymus chinensis, amplification primer and application

    CN121896398A

  • Leymus mollis germination stage salt-tolerant related snp molecular marker, amplification primer and application

    CN121896398B