How to test for rheumatoid arthritis
By integrating microRNA enrichment analysis with genome-wide association studies and cell type-specific expression profiles, the method identifies biomarkers for rheumatoid arthritis, improving diagnostic accuracy and therapeutic assessment.
Patent Information
- Application Number
- JP2024031786
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2018-09-13
- Filing Date
- 2024-03-04
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2039-09-02
AI Technical Summary
Existing methods for screening microRNAs as biomarkers for rheumatoid arthritis are limited by their focus on small sample sizes and fail to utilize the vast amount of disease genomic information from large-scale studies, necessitating the development of technologies that can integrate microRNA-target gene networks with cell type specificity for more extensive in vivo screening.
The integration of microRNA enrichment analysis with genome-wide association study results, incorporating cell type-specific microRNA expression profiles, identifies candidate biomarkers such as miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762, which are differentially expressed in rheumatoid arthritis patients, enabling their detection in body fluids for diagnosis and therapeutic assessment.
This approach allows for accurate diagnosis of rheumatoid arthritis, evaluates therapeutic efficacy, and screens for active ingredients in preventive or therapeutic agents by detecting these biomarkers in body fluids, enhancing diagnostic accuracy and therapeutic management.
Smart Images

Figure 0007748744000003 
Figure 0007748744000004 
Figure 0007748744000005
Abstract
Description
[Technical Field]
[0001] The present invention relates to a method for testing for rheumatoid arthritis, a test agent for rheumatoid arthritis, a test kit for rheumatoid arthritis, etc. [Background technology]
[0002] Rheumatoid arthritis (RA [MIM 180300]) is an autoimmune systemic inflammatory disease affecting approximately 1% of the world's population. RA is characterized by joint destruction due to synovial inflammation and subsequent cartilage and bone destruction. It is an autoimmune disease of unknown cause, resulting in a decline in patients' quality of life and socioeconomic losses.
[0003] MicroRNAs are small biological molecules consisting of 20-25 bases, and are considered promising biomarkers for predicting the onset of diseases. They have attracted particular attention in the field of autoimmune diseases, including rheumatoid arthritis, and an invention related to microRNAs that contribute to the diagnosis of rheumatoid arthritis has been reported (Patent Document 1).
[0004] Screening for microRNAs that contribute to diagnosis has traditionally been performed by experimentally measuring the in vivo expression levels of microRNAs in patient and control groups using microarray technology and other methods, focusing on relatively small numbers of samples (several to several dozens). However, these methods only screened a few hundred pre-designed microRNAs. It has been reported that thousands of microRNAs exist in living organisms, necessitating the development and application of technologies for more extensive in vivo microRNA screening. Furthermore, large-scale disease genomic analyses, such as genome-wide association studies, have been implemented, and disease genomic information for samples of tens to hundreds of thousands of people has been made public. Therefore, there was a need to develop in vivo microRNA screening technologies that utilize disease genomic information from these large-scale samples. [Prior art documents] [Patent documents]
[0005] [Patent Document 1] International Publication No. 2004 / 034685 [Non-patent literature]
[0006] [Non-Patent Document 1] Okada, Y., Muramatsu, T., Suita, N., Kanai, M., Kawakami, E., Iotchkova, V., Soranzo, N. and Inazawa, J. (2016) Significant impact of miRNA-target gene networks on genetics of human complex traits. Sci. Rep., 10.1038 / srep22223. [Non-patent document 2] Okada,Y., Wu,D., Trynka,G., Raj,T., Terao,C., Ikari,K., Kochi,Y., Ohmura,K., Suzuki,A., Yoshida,S., et al. (2014) Genetics of rheumatoid arthritis contributes to biology and drug discovery. Nature, 506, 376-381. Summary of the Invention [Problem to be solved by the invention]
[0007] An objective of the present invention is to provide a novel biomarker for rheumatoid arthritis and a method for using the same. [Means for solving the problem]
[0008] We previously developed microRNA enrichment analysis in GWAS (MIGWAS), an information analysis technology that integrates the results of large-scale disease genome analyses with microRNA-target gene networks on a computer (Non-Patent Document 1). In this study, we newly integrated microRNA expression profile information measured by each cell type into an information analysis pipeline, enabling the screening of biomarker microRNAs that take cell type specificity into account. By applying this pipeline to the results of a large-scale genome-wide association study of rheumatoid arthritis (Non-Patent Document 2), we successfully identified candidate biomarker microRNAs that contribute to the diagnosis of rheumatoid arthritis. Furthermore, we examined these candidate microRNAs using expression information from microRNA fractions extracted from peripheral blood mononuclear cells collected from an independent group of 30 rheumatoid arthritis patients and 33 control subjects. We successfully identified four microRNAs (miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762) that were differentially expressed between the patient and control groups. Based on this finding, further research was carried out, and as a result, the present invention was completed.
[0009] That is, the present invention includes the following aspects.
[0010] Item 1. A method for testing for rheumatoid arthritis, comprising: (1) detecting at least one biomarker selected from the group consisting of miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762 in a body fluid collected from a subject; 12. A testing method comprising:
[0011] Item 1A.(1) A step of detecting at least one biomarker selected from the group consisting of miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762 in a body fluid collected from a subject; , including, a measurement method.
[0012] Item 1B. A method for assisting in testing for rheumatoid arthritis, comprising: (1) detecting at least one biomarker selected from the group consisting of miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762 in a body fluid collected from a subject; 12. A testing method comprising:
[0013] Item 2. When the detected biomarkers include at least one biomarker (BM1) selected from the group consisting of miR-93-5p, miR-106b-5p, and miR-301b-3p, (2a) determining that the subject is suffering from rheumatoid arthritis when the amount or concentration of BM1 detected in the step (1) is equal to or lower than a cutoff value; Item 1. The testing method according to Item 1, comprising:
[0014] Item 3. If the detected biomarker includes miR-762 (BM2), (2b) determining that the subject is suffering from rheumatoid arthritis when the amount or concentration of the BM2 detected in the step (1) is equal to or greater than a cutoff value; Item 1. The testing method according to Item 1, comprising:
[0015] Item 4. When the detected biomarkers include at least one biomarker (BM1) selected from the group consisting of miR-93-5p, miR-106b-5p, and miR-301b-3p, and miR-762 (BM2), (2c) determining that the subject is suffering from rheumatoid arthritis when the amount or concentration of BM1 detected in the step (1) is equal to or less than a cutoff value and the amount or concentration of BM2 detected in the step (1) is equal to or more than a cutoff value; Item 1. The testing method according to Item 1, comprising:
[0016] Item 5. The testing method according to any one of Items 1 to 4, wherein the body fluid is at least one selected from the group consisting of whole blood, plasma, and serum.
[0017] Item 6. The testing method according to any one of Items 1 to 5, wherein the subject is a human.
[0018] Item 7. A diagnostic agent for rheumatoid arthritis, comprising a detection agent for at least one biomarker selected from the group consisting of miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762.
[0019] Item 7A. A detector for detecting at least one biomarker selected from the group consisting of miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762, for use as a diagnostic agent for rheumatoid arthritis.
[0020] Item 7B. Use of a detector for detecting at least one biomarker selected from the group consisting of miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762 for examining rheumatoid arthritis.
[0021] Item 7C. Use of a detector for at least one biomarker selected from the group consisting of miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762 for the manufacture of a diagnostic agent for rheumatoid arthritis.
[0022] Item 8. A test kit for rheumatoid arthritis, comprising a detection agent for at least one biomarker selected from the group consisting of miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762.
[0023] Item 9. A method for screening for an active ingredient of a preventive or therapeutic agent for rheumatoid arthritis, using as an indicator the amount or concentration of at least one biomarker selected from the group consisting of miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762 in a body fluid collected from an animal treated with a test substance.
[0024] Item 10. A method for evaluating the inducibility or aggravation of rheumatoid arthritis, using as an indicator the amount or concentration of at least one biomarker selected from the group consisting of miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762 in a body fluid collected from an animal treated with a test substance. [Effects of the Invention]
[0025] According to the present invention, a biomarker for rheumatoid arthritis can be provided. Use of the biomarker may enable testing for rheumatoid arthritis, screening for active ingredients of preventive or therapeutic agents for rheumatoid arthritis, evaluation of the inducibility or exacerbation of rheumatoid arthritis, etc. [Brief explanation of the drawings]
[0026] [Figure 1] 1 shows the screening results of Test Example 2. The plots represent each miRNA. The horizontal axis shows the logarithmic value of the expression level in the rheumatoid arthritis patient group divided by the expression level in the control group, and the vertical axis shows the false discovery rate when rejecting the null hypothesis that there is no difference in expression level, logarithmically transformed to base 10 and given a negative sign. [Figure 2] This figure shows the receiver operating characteristic (ROC) curve for early rheumatoid arthritis patients (30 patients) when diagnosing with hsa-miR-93-5p in Test Example 3. The vertical axis indicates sensitivity, and the horizontal axis indicates 1-specificity. The figure also shows the area under the curve (AUC) calculated based on the ROC curve. [Figure 3] This figure shows the receiver operating characteristic (ROC) curve for early rheumatoid arthritis patients (30 patients) when diagnosing with hsa-miR-106b-5p in Test Example 3. The vertical axis indicates sensitivity, and the horizontal axis indicates 1-specificity. The figure also shows the area under the curve (AUC) calculated based on the ROC curve. [Figure 4]This figure shows the receiver operating characteristic (ROC) curve for early rheumatoid arthritis patients (30 patients) when diagnosing with hsa-miR-301b-3p in Test Example 3. The vertical axis indicates sensitivity, and the horizontal axis indicates 1-specificity. The figure also shows the area under the curve (AUC) calculated based on the ROC curve. [Figure 5] This figure shows the receiver operating characteristic (ROC) curve for early rheumatoid arthritis patients (30 patients) when diagnosing with hsa-miR-762 in Test Example 3. The vertical axis indicates sensitivity, and the horizontal axis indicates 1-specificity. The figure also shows the area under the curve (AUC) calculated based on the ROC curve. [Figure 6] This figure shows the receiver operating characteristic (ROC) curve for patients with early rheumatoid arthritis (30 patients) when diagnosing by combining all biomarkers (hsa-miR-93-5p, hsa-miR-106b-5p, hsa-miR-301b-3p, hsa-miR-762) in Test Example 3. The vertical axis indicates sensitivity, and the horizontal axis indicates 1-specificity. The figure also shows the area under the curve (AUC) calculated based on the ROC curve. [Figure 7] This figure shows the receiver operating characteristic (ROC) curve for anti-CCP antibody-negative rheumatoid arthritis patients (14 patients) when diagnosing with hsa-miR-93-5p in Test Example 3. The vertical axis indicates sensitivity, and the horizontal axis indicates 1-specificity. The figure also shows the area under the curve (AUC) calculated based on the ROC curve. [Figure 8] This figure shows the receiver operating characteristic (ROC) curve for anti-CCP antibody-negative rheumatoid arthritis patients (14 patients) when diagnosing with hsa-miR-106b-5p in Test Example 3. The vertical axis indicates sensitivity, and the horizontal axis indicates 1-specificity. The figure also shows the area under the curve (AUC) calculated based on the ROC curve. [Figure 9]This figure shows the receiver operating characteristic (ROC) curve for anti-CCP antibody-negative rheumatoid arthritis patients (14 patients) when diagnosing with hsa-miR-301b-3p in Test Example 3. The vertical axis indicates sensitivity, and the horizontal axis indicates 1-specificity. The figure also shows the area under the curve (AUC) calculated based on the ROC curve. [Figure 10] This figure shows the receiver operating characteristic (ROC) curve for anti-CCP antibody-negative rheumatoid arthritis patients (14 patients) when diagnosing with hsa-miR-762 in Test Example 3. The vertical axis indicates sensitivity, and the horizontal axis indicates 1-specificity. The figure also shows the area under the curve (AUC) calculated based on the ROC curve. [Figure 11] This figure shows the receiver operating characteristic (ROC) curve for anti-CCP antibody-negative rheumatoid arthritis patients (14 patients) in Test Example 3 when diagnosing using a combination of all biomarkers (hsa-miR-93-5p, hsa-miR-106b-5p, hsa-miR-301b-3p, and hsa-miR-762). The vertical axis indicates sensitivity, and the horizontal axis indicates 1 minus specificity. The figure also shows the area under the curve (AUC) calculated based on the ROC curve. DETAILED DESCRIPTION OF THE INVENTION
[0027] In this specification, the expressions "contain" and "comprise" include the concepts of "contain", "include", "consist essentially of" and "consist only of".
[0028] 1. Rheumatoid arthritis testing methods In one aspect, the present invention relates to a method for testing for rheumatoid arthritis, which comprises the step of (1) detecting at least one biomarker selected from the group consisting of miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762 in a body fluid collected from a subject (also referred to herein as the "rheumatoid arthritis testing method of the present invention"). This will be described below.
[0029] 1-1. Process (1) The type of rheumatoid arthritis to be tested is not particularly limited. All classes, grades, and stages of rheumatoid arthritis according to the various classification criteria for rheumatoid arthritis are subject to testing. Rheumatoid arthritis also includes anti-CCP antibody-negative rheumatoid arthritis.
[0030] The subject is a living organism that is the target of the testing method of the present invention, and the species of the subject is not particularly limited. Examples of the subject species include various mammals such as humans, monkeys, mice, rats, dogs, cats, and rabbits, and preferably humans.
[0031] The condition of the subject is not particularly limited, and examples of the subject include a subject whose presence or absence of rheumatoid arthritis is unknown, a subject whose presence or absence has already been determined by another method to be associated with rheumatoid arthritis, a subject whose presence or absence has already been determined by another method to be not associated with rheumatoid arthritis, and a subject undergoing treatment for rheumatoid arthritis.
[0032] The body fluid is not particularly limited. Examples of body fluids include whole blood, serum, plasma, cerebrospinal fluid, saliva, synovial fluid, urine, tissue fluid (including bronchoalveolar lavage fluid), sweat, tears, sputum, and nasal discharge. Preferred examples include whole blood, serum, plasma, and cerebrospinal fluid, and more preferred examples include whole blood, serum, and plasma. The body fluid is preferably a body fluid containing peripheral blood mononuclear cells. One type of body fluid may be used alone, or two or more types may be used in combination.
[0033] Body fluids can be collected from a subject by methods known to those skilled in the art. For example, whole blood can be collected by drawing blood using a syringe or the like. Serum is a portion of whole blood from which blood cells and specific blood coagulation factors have been removed, and can be obtained, for example, as the supernatant after clotting of whole blood. Plasma is a portion of whole blood from which blood cells have been removed, and can be obtained, for example, as the supernatant when whole blood is centrifuged under conditions that do not cause clotting.
[0034] The detection target in step (1) is at least one biomarker selected from the group consisting of miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762 (these may be collectively referred to as "target biomarkers" in this specification).
[0035] The target biomarkers are those whose expression levels change in rheumatoid arthritis, and can be used as indicators to differentiate rheumatoid arthritis.
[0036] Among the target biomarkers, at least one biomarker (BM1) selected from the group consisting of miR-93-5p, miR-106b-5p, and miR-301b-3p is a target biomarker whose amount in rheumatoid arthritis samples is lower than that in healthy samples.
[0037] Among the target biomarkers, miR-762 (BM2) is a target biomarker whose amount in rheumatoid arthritis samples is higher than that in healthy samples.
[0038] The base sequence of the target biomarker can be identified in a publicly known database (for example, miRBase: http: / / www.mirbase.org / ). For example, in the case of humans, the base sequence is as follows: >hsa-miR-93-5p MIMAT0000093 CAAAGUGCUGUUCGUGCAGGUAG (SEQ ID NO: 1) >hsa-miR-106b-5p MIMAT0000680 UAAAGUGCUGACAGUGCAGAU (SEQ ID NO: 2) >hsa-miR-301b-3p MIMAT0004958 CAGUGCAAUGAUAUUGUCAAAGC (SEQ ID NO: 3) >hsa-miR-762 MIMAT0010313 GGGGCUGGGGCCGGGGCCGAGC (SEQ ID NO: 4).
[0039] The target biomarker is preferably a mature miRNA, but may also be a precursor (eg, pri-miRNA, pre-miRNA, etc.).
[0040] The number of target biomarkers in step (1) may be only one, or may be a combination of two or more, three or more, or four. Combining more target biomarkers enables more accurate testing for rheumatoid arthritis, etc.
[0041] Furthermore, the target biomarker in step (1) preferably includes at least one selected from the group consisting of miR-106b-5p, miR-301b-3p, and miR-762.
[0042] Detection is typically achieved by measuring the amount or concentration of the target biomarker. "Concentration" does not necessarily mean absolute concentration, but may also include relative concentration, weight per unit volume, or raw data measured to determine absolute concentration.
[0043] The method for detecting a target biomarker is not particularly limited as long as it can specifically detect part or all of the target biomarker, and specific examples of the detection method include RNA-seq analysis, RT-PCR, nucleic acid chip analysis, and Northern blotting.
[0044] When using RNA-seq analysis, specifically, cDNA is prepared from RNA derived from the subject according to standard methods, and sequence analysis is performed using a next-generation sequencer, etc., and mapping, gene expression analysis, expression level analysis, etc. are performed based on the obtained data to obtain expression level information.
[0045] When RT-PCR is used, a specific example is a method in which cDNA is prepared from RNA derived from a subject according to standard methods, and a pair of primers (a positive strand that binds to the above-mentioned cDNA (-strand), and a reverse strand that binds to the + strand) is hybridized to this as a template so that the target region can be amplified, PCR is performed according to standard methods, and the resulting amplified double-stranded DNA is detected. The amplified double-stranded DNA can be detected by performing the above-mentioned PCR using primers that have been labeled in advance with RI or a fluorescent substance, detecting labeled double-stranded DNA produced by the PCR, or by transferring the produced double-stranded DNA to a nylon membrane or the like according to standard methods, and then hybridizing it with a labeled probe for detection.
[0046] When nucleic acid chip analysis is used, a method can be used in which a nucleic acid chip with a nucleic acid probe (single-stranded or double-stranded) attached thereto is prepared, and this is hybridized with RNA derived from the subject or nucleic acid prepared from the RNA by conventional methods, and the formed double strand is detected.
[0047] When using the Northern blot method, a specific example is a method in which a probe is labeled with a radioactive isotope (such as 32P, 33P: RI) or a fluorescent substance, and then hybridized with mRNA derived from the above-mentioned expression system that has been transferred to a nylon membrane or the like in accordance with standard methods.Then, the formed double strand of the diagnostic agent and the mRNA derived from the subject's sample is detected and measured by detecting the signal derived from the label of the probe (such as RI or a fluorescent substance) using a radiation detector or a fluorescence detector.
[0048] According to the testing method of the present invention including step (1), the amount and / or concentration of a target biomarker that is an indicator for detecting rheumatoid arthritis can be provided, thereby assisting in the detection of rheumatoid arthritis, etc.
[0049] The test results obtained by the test method of the present invention including step (1) can be used to assess therapeutic efficacy, clarify the pathology of rheumatoid arthritis, predict the prognosis of rheumatoid arthritis, stratify patients, select treatment methods (personalized medicine, treatment responsiveness), etc.
[0050] 1-2. Process (2) In one embodiment, when the detected biomarkers include at least one biomarker (BM1) selected from the group consisting of miR-93-5p, miR-106b-5p, and miR-301b-3p, the testing method of the present invention further comprises: (2a) determining that the subject is suffering from rheumatoid arthritis when the amount or concentration of BM1 detected in the step (1) is equal to or lower than a cutoff value; According to the testing method of the present invention including step 2a, it is possible to diagnose rheumatoid arthritis.
[0051] In one embodiment, when the detected biomarker includes miR-762 (BM2), the testing method of the present invention further comprises: (2b) determining that the subject is suffering from rheumatoid arthritis when the amount or concentration of the BM2 detected in the step (1) is equal to or greater than a cutoff value; According to the testing method of the present invention including step 2b, it is possible to diagnose rheumatoid arthritis.
[0052] In one embodiment, when the detected biomarkers include at least one biomarker (BM1) selected from the group consisting of miR-93-5p, miR-106b-5p, and miR-301b-3p, and miR-762 (BM2), the testing method of the present invention further comprises: (2c) determining that the subject is suffering from rheumatoid arthritis when the amount or concentration of BM1 detected in the step (1) is equal to or less than a cutoff value and the amount or concentration of BM2 detected in the step (1) is equal to or more than a cutoff value; According to the testing method of the present invention including step 2c, it is possible to diagnose rheumatoid arthritis.
[0053] The cutoff value can be appropriately set by a person skilled in the art from the viewpoints of sensitivity, specificity, positive predictive value, negative predictive value, etc., and can be a value determined on a case-by-case basis or a predetermined value based on the amount and / or concentration of the target biomarker in body fluid collected from a subject not suffering from rheumatoid arthritis. The cutoff value can be, for example, 0.5 to 1.5 times the amount and / or concentration of the target biomarker in body fluid collected from a subject not suffering from rheumatoid arthritis (the average value, median value, etc., when there are multiple subjects).
[0054] In a preferred embodiment of step (2), when the subject is undergoing treatment for rheumatoid arthritis, the therapeutic effect can be assessed by setting the cutoff value based on, for example, the amount and / or concentration of the target biomarker in a previous sample from the same subject.
[0055] 2. Higher accuracy in diagnosing rheumatoid arthritis When a subject is determined to have rheumatoid arthritis by the test method of the present invention including step (2), rheumatoid arthritis can be diagnosed with higher accuracy by combining the test method of the present invention with a step of having a doctor diagnose rheumatoid arthritis. Furthermore, since the test method of the present invention can detect rheumatoid arthritis more accurately, combining the test method of the present invention with the above step can more efficiently and accurately diagnose "having rheumatoid arthritis."
[0056] 3. Treatment of rheumatoid arthritis If a subject is determined to have rheumatoid arthritis by the testing method of the present invention including step (2), or if a subject is diagnosed with rheumatoid arthritis as described above in "2. Diagnosis of rheumatoid arthritis with higher accuracy," the testing method of the present invention can be further combined with the step of having a doctor's diagnosis, and (3) the step of treating the subject determined or diagnosed to have rheumatoid arthritis can be further performed, thereby making it possible to treat the subject's disease. Furthermore, since the testing method of the present invention can detect rheumatoid arthritis more accurately, by combining step 3 with the testing method of the present invention or the combination of the testing method of the present invention with the step of having a doctor's diagnosis, the subject suffering from rheumatoid arthritis can be treated more efficiently and more reliably.
[0057] The method for treating rheumatoid arthritis is not particularly limited, but a representative example is medication. The pharmaceuticals used for medication are not particularly limited, but examples include antirheumatic drugs, biological preparations (biopharmaceuticals), nonsteroidal anti-inflammatory drugs, steroids (corticosteroids), etc. One, two, or three or more types of pharmaceuticals can be used in combination.
[0058] 4. Rheumatoid arthritis test kit In one aspect, the present invention relates to a diagnostic agent for rheumatoid arthritis (also referred to herein as the "test agent of the present invention"), which comprises a detector for at least one biomarker selected from the group consisting of miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762 (also referred to herein as the "test agent of the present invention"). This will be explained below.
[0059] The definitions of miR-93-5p, miR-106b-5p, miR-301b-3p, miR-762, rheumatoid arthritis, etc. are the same as those in "1. Test method for rheumatoid arthritis" above.
[0060] The detecting agent of the present invention is not particularly limited as long as it can specifically detect a target biomarker. Examples of the detecting agent include primers and probes for the target biomarker.
[0061] The detection agent of the present invention may be modified, as long as its function is not significantly impaired. Modifications include the addition of labels such as fluorescent dyes, enzymes, proteins, radioisotopes, chemiluminescent substances, biotin, etc.
[0062] Fluorescent dyes suitable for use in the present invention include those commonly used to label nucleotides for the detection and quantification of nucleic acids. Examples include, but are not limited to, HEX (4,7,2',4',5',7'-hexachloro-6-carboxylfluorescein, a green fluorescent dye), fluorescein, NED (trade name, manufactured by Applied Biosystems, a yellow fluorescent dye), 6-FAM (trade name, manufactured by Applied Biosystems, a yellow-green fluorescent dye), and rhodamine or its derivatives (e.g., tetramethylrhodamine (TMR)). Nucleotides can be labeled with fluorescent dyes using any suitable known labeling method (see Nature Biotechnology, 14, 303-308 (1996)). Alternatively, commercially available fluorescent labeling kits (e.g., Oligonucleotide ECL 3'-Oligolabeling System, manufactured by Amersham-Pharmacia) can be used.
[0063] The detection agent of the present invention can also be used by immobilizing it on any solid phase, and therefore the test agent of the present invention can be provided in the form of a substrate on which the detection agent is immobilized (for example, a microarray chip on which a probe is immobilized).
[0064] The solid phase used for immobilization is not particularly limited as long as it can immobilize polynucleotides, etc., and examples thereof include glass plates, nylon membranes, microbeads, silicon chips, capillaries, and other substrates. The immobilization of the detection agent to the solid phase is not particularly limited. For example, in the case of a microarray, a commercially available spotter (e.g., manufactured by Amersham) can be used. Immobilization methods are well known in the art depending on the type of immobilized probe (e.g., photolithographic technology (Affymetrix) or in situ synthesis of oligonucleotides using inkjet technology (Rosetta Inpharmatics)).
[0065] Primers, probes, etc. are not particularly limited as long as they selectively (specifically) recognize a target biomarker or a nucleic acid derived therefrom. Here, "selectively (specifically) recognize" means, for example, in Northern blotting, that the target biomarker can be specifically detected, or in RT-PCR, that the target biomarker or a nucleic acid derived therefrom (cDNA, etc.) is specifically amplified. However, the present invention is not limited thereto, and any primer or probe may be used as long as a person skilled in the art can determine that the detected or amplified product is derived from the target biomarker.
[0066] Specific examples of primers and probes include the polynucleotides described in (a) below and the polynucleotides described in (b) below: (a) a polynucleotide having at least 15 consecutive bases in the base sequence of a target biomarker and / or a polynucleotide complementary to the polynucleotide; and (b) a polynucleotide having at least 15 bases that hybridizes under stringent conditions to the base sequence of the target biomarker or a base sequence complementary thereto; At least one selected from the group consisting of:
[0067] A complementary polynucleotide or complementary base sequence (complementary strand, reverse strand) refers to a polynucleotide or base sequence that is complementary to the full-length polynucleotide sequence of a target biomarker, or a partial sequence thereof having at least 15 consecutive bases in length (for convenience, these are also referred to as the "positive strand" herein), based on base pairing such as A:T and G:C. However, such a complementary strand is not limited to a completely complementary sequence to the base sequence of the target positive strand, but may also have a complementary relationship to the target positive strand that allows hybridization under stringent conditions. Here, stringent conditions can be determined based on the melting temperature (Tm) of the nucleic acid to which the complex or probe binds, as taught by Berger and Kimmel (1987, Guide to Molecular Cloning Techniques Methods in Enzymology, Vol. 152, Academic Press, San Diego, CA). For example, typical post-hybridization washing conditions include approximately 1×SSC, 0.1% SDS, and 37°C. It is preferable that the complementary strand maintains its hybridization state with the target positive strand even when washed under these conditions. While not particularly limited, more stringent hybridization conditions include approximately 0.5×SSC, 0.1% SDS, and 42°C, and even more stringent hybridization conditions include approximately 0.1×SSC, 0.1% SDS, and 65°C. Specifically, examples of such complementary strands include a strand consisting of a nucleotide sequence that is completely complementary to the nucleotide sequence of the target positive strand, and a strand consisting of a nucleotide sequence that shares at least 90%, preferably 95%, more preferably 98% or more, and even more preferably 99% or more identity with the target positive strand.
[0068] Primers, probes, etc. can be designed, for example, based on the nucleotide sequence of a target biomarker using various design programs. Specifically, candidate sequences for primers or probes obtained by applying the nucleotide sequence of the target biomarker to a design program, or sequences containing at least a portion of such sequences, can be used as primers or probes.
[0069] The base length of a primer, probe, etc. is not particularly limited as long as it has a length of at least 15 consecutive bases as described above, and can be appropriately set depending on the application. For example, when used as a primer, the base length can be, for example, 15 to 35 bases, and when used as a probe, the base length can be, for example, 15 to 35 bases.
[0070] The test agent of the present invention may contain a detection agent other than the detection agent of the present invention (for example, a probe for detecting nucleic acids such as other miRNAs, an antibody, etc.). In this case, the test agent of the present invention may be a test agent that can test for other diseases or conditions in addition to rheumatoid arthritis. In this case, the detection agent of the present invention is included as a detection agent for testing for rheumatoid arthritis. From this perspective, in one aspect, the test agent of the present invention is a test agent for testing for rheumatoid arthritis, which includes a detection agent for testing for rheumatoid arthritis consisting of the detection agent of the present invention.
[0071] The test agent of the present invention may be in the form of a composition. The composition may contain other components as needed. Examples of other components include bases, carriers, solvents, dispersants, emulsifiers, buffers, stabilizers, excipients, binders, disintegrants, lubricants, thickeners, moisturizers, colorants, fragrances, chelating agents, etc.
[0072] The test agent of the present invention may be in the form of a kit. In addition to the detection agent or the composition containing the same, the kit may contain other materials that can be used to detect target biomarkers in the body fluids of a subject. Specific examples of such materials include various reagents (e.g., buffer solutions), instruments (e.g., instruments for purifying and separating body fluids), etc.
[0073] 5. Screening method for active ingredients of preventive or therapeutic agents for rheumatoid arthritis In one aspect, the present invention relates to a method for screening for an active ingredient of a prophylactic or therapeutic agent for rheumatoid arthritis (sometimes referred to herein as the "active ingredient screening method of the present invention"), which uses as an index the amount or concentration of at least one biomarker selected from the group consisting of miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762 in a body fluid collected from an animal treated with a test substance. This method is described below.
[0074] The definitions of body fluids, miR-93-5p, miR-106b-5p, miR-301b-3p, miR-762, rheumatoid arthritis, and measurement of the amount or concentration of the target biomarker are the same as those in "1. Testing method for rheumatoid arthritis" above.
[0075] The animal species is not particularly limited, and examples of the animal species include various mammals such as humans, monkeys, mice, rats, dogs, cats, and rabbits.
[0076] A wide range of test substances can be used, regardless of whether they are naturally occurring or artificially produced. Furthermore, not only purified compounds but also compositions containing a variety of compounds and animal and plant extracts can be used. Compounds are not limited to low-molecular-weight compounds, but also include high-molecular-weight compounds such as proteins, nucleic acids, and polysaccharides.
[0077] More specifically, the method for screening for an active ingredient of the present invention includes a step of selecting the test substance as an active ingredient of a preventive or therapeutic agent for rheumatoid arthritis (or a candidate substance for an active ingredient of a preventive or therapeutic agent for rheumatoid arthritis) when the value of the indicator is at least one biomarker (BM1) selected from the group consisting of miR-93-5p, miR-106b-5p, and miR-301b-3p, and the value of the indicator is higher than the amount or concentration (control value) of the corresponding biomarker in body fluid collected from an animal that has not been treated with the test substance.
[0078] In another specific example, when the biomarker used as an indicator is miR-762 (BM2), the method for screening an active ingredient of the present invention includes a step of selecting the test substance as an active ingredient of a preventive or therapeutic agent for rheumatoid arthritis (or a candidate substance for an active ingredient of a preventive or therapeutic agent for rheumatoid arthritis) if the value of the indicator is lower than the amount or concentration (control value) of the corresponding biomarker in body fluid collected from an animal that has not been treated with the test substance.
[0079] The corresponding biomarker means the same miRNA as the target biomarker being used as an indicator.
[0080] "High" means, for example, that the index value is 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold higher than the control value.
[0081] "Low" means, for example, that the index value is 1 / 2, 1 / 5, 1 / 10, 1 / 20, 1 / 50, or 1 / 100 of the control value.
[0082] 6. Method for evaluating the induction or aggravation of rheumatoid arthritis In one aspect, the present invention relates to a method for evaluating the inducibility or exacerbation of rheumatoid arthritis using, as an indicator, the amount or concentration of at least one biomarker selected from the group consisting of miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762 in a body fluid collected from an animal treated with a test substance (also referred to herein as the "toxicity evaluation method of the present invention"). This will be described below.
[0083] The definitions of body fluid, miR-93-5p, miR-106b-5p, miR-301b-3p, miR-762, rheumatoid arthritis, measurement of the amount or concentration of the target biomarker, animal species, test substance, etc. are the same as those in "1. Testing method for rheumatoid arthritis" and "6. Screening method for active ingredients of prophylactic or therapeutic agents for rheumatoid arthritis" above.
[0084] More specifically, when the biomarker used as an indicator is at least one biomarker (BM1) selected from the group consisting of miR-93-5p, miR-106b-5p, and miR-301b-3p, the toxicity evaluation method of the present invention includes a step of determining that the test substance has the ability to induce or exacerbate rheumatoid arthritis if the value of the indicator is lower than the amount or concentration (control value) of the corresponding biomarker in body fluid collected from an animal that has not been treated with the test substance.
[0085] In another specific example, when the biomarker used as an indicator is miR-762 (BM2), the toxicity evaluation method of the present invention includes a step of determining that the test substance has the ability to induce or exacerbate rheumatoid arthritis if the value of the indicator is higher than the amount or concentration (control value) of the corresponding biomarker in body fluid collected from an animal that has not been treated with the test substance.
[0086] The corresponding biomarker means the same miRNA as the target biomarker being used as an indicator.
[0087] "High" means, for example, that the index value is 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold higher than the control value.
[0088] "Low" means, for example, that the index value is 1 / 2, 1 / 5, 1 / 10, 1 / 20, 1 / 50, or 1 / 100 of the control value. [Example]
[0089] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.
[0090] Test Example 1. Rheumatoid Arthritis Biomarker Screening 1 The MIGWAS analysis pipeline uses multiple algorithms to create a list of predicted target genes for microRNAs registered in the database. For both the gene encoding the target microRNA and the target gene, the gene-level P-value calculated from summary statistics in a genome-wide association study of the disease is below a threshold, indicating disease susceptibility. Furthermore, microRNA expression profile information measured for each cell tissue registered in the database is obtained, and the microRNA expression information is normalized for each tissue to identify microRNAs with high tissue-specific expression levels. By running the MIGWAS analysis pipeline for each tissue on these microRNAs, it becomes possible to preferentially screen for microRNAs that function in specific tissues in the actual body.
[0091] We applied the MlGWAS analysis pipeline to the results of a large-scale genome-wide association study of rheumatoid arthritis (19,243 patients and 61,565 controls), and identified 48 microRNAs as potential biomarkers.
[0092] Test Example 2. Rheumatoid Arthritis Biomarker Screening 2 We investigated the expression information of microRNA fractions extracted from peripheral blood mononuclear cells collected from an independent group of 30 rheumatoid arthritis patients and 33 control subjects. Detailed expression information was obtained using the next-generation sequencer HiSeq2500, and 94 microRNAs were identified as potential biomarkers whose expression levels were significantly different in rheumatoid arthritis patients compared to healthy controls.
[0093] Test Example 3. Analysis of screening results Four miRNAs overlapping between the candidate miRNAs obtained in Test Example 1 and Test Example 2 were extracted as highly reliable biomarkers (hsa-miR-93-5p, hsa-miR-106b-5p, hsa-miR-301b-3p, hsa-miR-762, FDR-corrected Q value <0.05). Figure 1 shows a volcano plot evaluating the expression levels of each miRNA in rheumatoid arthritis patients and healthy individuals. Expression levels of three microRNAs (hsa-miR-93-5p, hsa-miR-106b-5p, hsa-miR-301b-3p) were significantly lower in the patient group, while expression levels of one microRNA (hsa-miR-762) were significantly higher in the patient group. The microRNAs included in the present invention (hsa-miR-93-5p, hsa-miR-106b-5p, hsa-miR-301b-3p, hsa-miR-762) have different expression levels between rheumatoid arthritis patients and control groups, with odds ratios of 0.696, 0.570, 0.516, and 2.23, respectively. Detailed data are shown in Table 1.
[0094] [Table 1]
[0095] Combining these four microRNAs makes it possible to distinguish between patient and control groups with a high ratio of 10.86 times, which is thought to contribute to the diagnosis of rheumatoid arthritis. Furthermore, receiver operating characteristic (ROC) curves were created for early rheumatoid arthritis patients (30 patients) when diagnosing with each of the identified biomarkers and when diagnosing with all of them combined, and the results are shown in Figures 2 to 6. In particular, when diagnosing with all of them combined, high accuracy was confirmed, with a sensitivity of 70% and a specificity of 70%.
[0096] Furthermore, the above analysis was also performed on anti-CCP antibody-negative rheumatoid arthritis patients. The microRNAs included in the present invention (hsa-miR-93-5p, hsa-miR-106b-5p, hsa-miR-301b-3p, hsa-miR-762) had different expression levels between anti-CCP antibody-negative rheumatoid arthritis patients and control groups, with the odds ratios being 0.733, 0.641, 0.567, and 2.65, respectively. Detailed data are shown in Table 2.
[0097] [Table 2]
[0098] Combining these four microRNAs makes it possible to distinguish between anti-CCP antibody-negative rheumatoid arthritis and control groups with a high ratio of 9.95 times. Furthermore, Figures 7-11 show the results of receiver operating characteristic (ROC) curves created for anti-CCP antibody-negative rheumatoid arthritis patients (14 patients) when diagnosing with each of the identified biomarkers and when diagnosing with all of them combined. In particular, when diagnosing with all of them combined, high accuracy was confirmed, with a sensitivity of 50% and a specificity of 94%. This means that it is possible to diagnose false negatives (missed cases) due to anti-CCP antibodies in patients with early rheumatoid arthritis.
Claims
1. A method for assisting in testing for rheumatoid arthritis, comprising: (1) detecting at least one biomarker selected from the group consisting of miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762 in a body fluid collected from a subject; When the detected biomarkers include at least one biomarker (BMα) selected from the group consisting of miR-93-5p and miR-106b-5p, (2aa) assisting in determining that the subject is suffering from rheumatoid arthritis when the amount or concentration of the BMα detected in the step (1) is equal to or lower than a cutoff value; A method comprising:
2. When the detected biomarkers include at least one biomarker (BM1) selected from the group consisting of miR-93-5p, miR-106b-5p, and miR-301b-3p, (2a) assisting in determining that the subject is suffering from rheumatoid arthritis when the amount or concentration of BM1 detected in the step (1) is equal to or lower than a cutoff value; The method of claim 1 , comprising:
3. If the detected biomarkers include miR-762 (BM2), (2b) assisting in determining that the subject is suffering from rheumatoid arthritis when the amount or concentration of the BM2 detected in the step (1) is equal to or greater than a cutoff value; The method of claim 1 , comprising:
4. When the detected biomarkers include at least one biomarker (BM1) selected from the group consisting of miR-93-5p, miR-106b-5p, and miR-301b-3p, and miR-762 (BM2), (2c) assisting in determining that the subject is suffering from rheumatoid arthritis when the amount or concentration of BM1 detected in the step (1) is equal to or less than a cutoff value and the amount or concentration of BM2 detected in the step (1) is equal to or more than a cutoff value; The method of claim 1 , comprising:
5. The method according to any one of claims 1 to 4, wherein the body fluid is at least one selected from the group consisting of whole blood, plasma, and serum.
6. The method according to any one of claims 1 to 5, wherein the subject is a human.
7. A diagnostic agent for rheumatoid arthritis for use in the method of any one of claims 1 to 6, comprising a detection agent for at least one biomarker selected from the group consisting of miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762.
8. A test kit for rheumatoid arthritis for use in the method of any one of claims 1 to 6, comprising a detection agent for at least one biomarker selected from the group consisting of miR-93-5p, miR-106b-5p, miR-301b-3p, and miR-762.
9. The method includes using the amount or concentration of at least one biomarker selected from the group consisting of miR-106b-5p, miR-301b-3p, and miR-762 in a body fluid collected from an animal (excluding humans) treated with a test substance as an index, and further includes using the amount or concentration of at least one biomarker selected from the group consisting of miR-106b-5p, miR-301b-3p, and miR-762 as an index. When the biomarker used as an indicator contains miR-106b-5p or miR-301-3p, if the amount or concentration of miR-106b-5p or miR-301-3p is higher than the amount or concentration of miR-106b-5p or miR-301-3p in body fluid collected from an animal not treated with the test substance, selecting the test substance as an active ingredient of an agent for preventing or treating rheumatoid arthritis; or When the biomarker to be used as an indicator includes miR-762, selecting the test substance as an active ingredient for a preventive or therapeutic agent for rheumatoid arthritis when the amount or concentration of miR-762 is lower than the amount or concentration of miR-762 in a body fluid collected from an animal not treated with the test substance; Including, A method for screening an active ingredient of a preventive or therapeutic agent for rheumatoid arthritis.
10. The method includes using the amount or concentration of at least one biomarker selected from the group consisting of miR-106b-5p, miR-301b-3p, and miR-762 in a body fluid collected from an animal (excluding humans) treated with a test substance as an index, and further includes using the amount or concentration of at least one biomarker selected from the group consisting of miR-106b-5p, miR-301b-3p, and miR-762 as an index. When the biomarker used as an indicator includes miR-106b-5p or miR-301-3p, if the amount or concentration of miR-106b-5p or miR-301-3p is lower than the amount or concentration of miR-106b-5p or miR-301-3p in body fluid collected from an animal not treated with the test substance, determining that the test substance has the ability to induce or exacerbate rheumatoid arthritis; or when the biomarker used as an indicator includes miR-762, determining that the test substance has the ability to induce or exacerbate rheumatoid arthritis when the amount or concentration of miR-762 is higher than the amount or concentration of miR-762 in a body fluid collected from an animal not treated with the test substance; Including, A method for assessing the induction or aggravation of rheumatoid arthritis.
Citation Information
Patent Citations
Application of exosomes-loaded miR-93-5p in treatment of rheumatoid arthritis
CN107243012A
Contact validation and trusted contact updating in mobile wireless communications devices
WO2004034685A1
Diagnosis of rheumatoid arthritis by microrna
WO2014034685A1