Gene therapy constructs and methods of use

Gene therapy vectors with optimized nucleic acid constructs enhance protein delivery and expression, overcoming the limitations of protein administration by ensuring targeted delivery and sustained remission for genetic disorders.

JP7749322B2Active Publication Date: 2025-10-06AMICUS THERAPEUTICS INC
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
JP2020560355
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2018-10-10
Filing Date
2019-04-30
Publication Date
2025-10-06
Estimated Expiration
2039-04-30

AI Technical Summary

Technical Problem

Current treatments for genetic disorders, such as protein administration, often fail to deliver therapeutic proteins to the correct organs, cells, or organelles, requiring frequent injections and lacking sustained remission.

Method used

Gene therapy vectors are designed with specific nucleic acid constructs that include translation initiation sequences, signal peptides, and internal ribosome entry sequences to enhance protein expression, cellular uptake, and subcellular targeting, using vectors like AAV to deliver therapeutic proteins directly to affected cells.

Benefits of technology

The gene therapy vectors effectively increase protein delivery and expression, potentially providing sustained remission with a single treatment, addressing the limitations of protein administration.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007749322000024
    Figure 0007749322000024
  • Figure 0007749322000025
    Figure 0007749322000025
  • Figure 0007749322000026
    Figure 0007749322000026
Patent Text Reader

Abstract

Provided herein, in some embodiments, are improved gene therapy vectors and methods of use that include sequences for improved expression and cellular targeting of therapeutic proteins. [Selected Figure] Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] cross reference This application claims the benefit of U.S. Provisional Application No. 62 / 664,741, filed April 30, 2018; U.S. Provisional Application No. 62 / 688,640, filed June 22, 2018; and U.S. Provisional Application No. 62 / 744,068, filed October 10, 2018, each of which is incorporated by reference in its entirety. [Background technology]

[0002] Genetic disorders are caused by genetic mutations or new mutations occurring in gene coding regions of the genome. In some cases, such genetic disorders are treated by administering proteins encoded by mutated genes in individuals with the genetic disorder. However, such treatments have challenges because protein administration does not necessarily result in the protein reaching the organs, cells, or organelles where it is needed. Furthermore, this treatment often requires twice-weekly injections, which is not required in gene therapy, which can provide sustained remission with a single treatment. Therefore, gene therapy has the potential to provide improved results compared to currently available treatments for genetic disorders. Summary of the Invention

[0003] Provided herein are compositions and methods for the treatment of genetic disorders using gene therapy. Also provided herein are gene therapy vector components and methods for use in gene therapy to improve protein expression, as well as to increase cellular uptake or delivery and intracellular or subcellular targeting, of therapeutic proteins provided by the gene therapy vector.

[0004] In certain aspects, gene therapy vectors are provided, e.g., gene therapy vectors comprising a nucleic acid construct comprising, in 5' to 3' order: (a) a translation initiation sequence and (b) a nucleic acid sequence encoding a therapeutic protein. In some embodiments, the translation initiation sequence comprises a Kozak sequence. In some embodiments, the translation initiation sequence and the nucleic acid sequence encoding a therapeutic protein can overlap, such that the last three nucleotides of the translation initiation sequence are also the initiation codon of the therapeutic protein. In some embodiments, the Kozak sequence comprises the sequence AX1X2ATGA (SEQ ID NO:28), where each of X1 and X2 is any nucleotide. In some embodiments, X1 comprises A. In some embodiments, X2 comprises G. In some embodiments, the Kozak sequence comprises a nucleic acid sequence at least 85% identical to AAGATGA (SEQ ID NO:29). In some embodiments, the Kozak sequence differs from the sequence of AAGATGA (SEQ ID NO:29) by one or two nucleotides. In some embodiments, the Kozak sequence comprises AAGATGA (SEQ ID NO:29). In some embodiments, the Kozak sequence comprises a nucleic acid sequence at least 85% identical to GCAAGATG (SEQ ID NO:44), where the last three nucleotides (ATG) are also the start codon for the Therapeutic protein. In some embodiments, the Kozak sequence differs from the sequence of GCAAGATG (SEQ ID NO:44) by one or two nucleotides. In some embodiments, the Kozak sequence comprises GCAAGATG (SEQ ID NO:44). In some embodiments, the Kozak sequence comprises a nucleic acid sequence at least 85% identical to CACCATG (SEQ ID NO:47). In some embodiments, the Kozak sequence differs from the sequence of CACCATG (SEQ ID NO:47) by one or two nucleotides. In some embodiments, the Kozak sequence comprises CACCATG (SEQ ID NO:47). In some embodiments, the nucleic acid construct further comprises a nucleic acid sequence encoding a signal peptide that can increase secretion of the Therapeutic protein compared to the Therapeutic protein without the signal peptide. In some embodiments, the signal peptide is selected from a binding immunoglobulin protein (BiP) signal peptide and a Gaussia signal peptide.In some embodiments, the BiP signal peptide comprises an amino acid sequence at least 90% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 13-17. In some embodiments, the signal peptide differs from a sequence selected from the group consisting of SEQ ID NOs: 13-17 by no more than 5 amino acids, no more than 4 amino acids, no more than 3 amino acids, no more than 2 amino acids, or no more than 1 amino acid. In some embodiments, the BiP signal peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 13-17. In some embodiments, the Gaussia signal peptide comprises an amino acid sequence at least 90% identical to SEQ ID NO: 32. In some embodiments, the signal peptide differs from the sequence of SEQ ID NO: 32 by no more than 5 amino acids, no more than 4 amino acids, no more than 3 amino acids, no more than 2 amino acids, or no more than 1 amino acid. In some embodiments, the Gaussia signal peptide comprises the amino acid sequence of SEQ ID NO: 32. In some embodiments, the nucleic acid construct further comprises an internal ribosome entry sequence (IRES). In some embodiments, the IRES is a cricket paralysis virus (CrPV) IRES. In some embodiments, the IRES comprises a nucleic acid sequence at least 90% identical to SEQ ID NO: 12. In some embodiments, the IRES comprises SEQ ID NO:12.

[0005] In a further aspect, a gene therapy vector is provided, comprising a nucleic acid construct comprising, in 5' to 3' order: (a) a nucleic acid sequence encoding a signal peptide; and (b) a nucleic acid sequence encoding a therapeutic protein, wherein the signal peptide is capable of increasing secretion of the therapeutic protein compared to the therapeutic protein without the signal peptide. In some embodiments, the signal peptide is selected from a binding immunoglobulin protein (BiP) signal peptide and a Gaussia signal peptide. In some embodiments, the BiP signal peptide comprises an amino acid sequence at least 90% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 13-17. In some embodiments, the signal peptide differs from a sequence selected from the group consisting of SEQ ID NOs: 13-17 by no more than 5 amino acids, no more than 4 amino acids, no more than 3 amino acids, no more than 2 amino acids, or no more than 1 amino acid. In some embodiments, the BiP signal peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 13-17. In some embodiments, the signal peptide comprises a Gaussia signal peptide. In some embodiments, the Gaussia signal peptide comprises an amino acid sequence at least 90% identical to SEQ ID NO: 32. In some embodiments, the signal peptide differs from the sequence of SEQ ID NO: 32 by no more than 5 amino acids, no more than 4 amino acids, no more than 3 amino acids, no more than 2 amino acids, or no more than 1 amino acid. In some embodiments, the Gaussia signal peptide comprises SEQ ID NO: 32. In some embodiments, the nucleic acid construct further comprises a translation initiation sequence. In some embodiments, the translation initiation sequence comprises a Kozak sequence comprising AX1X2ATGA (SEQ ID NO: 28), where each of X1 and X2 is any nucleotide. In some embodiments, X1 comprises A. In some embodiments, X2 comprises G. In some embodiments, the Kozak sequence comprises a nucleic acid sequence at least 85% identical to AAGATGA (SEQ ID NO: 29). In some embodiments, the Kozak sequence differs from the sequence of AAGATGA (SEQ ID NO: 29) by one or two nucleotides. In some embodiments, the Kozak sequence comprises AAGATGA (SEQ ID NO: 29).In some embodiments, the Kozak sequence comprises a nucleic acid sequence at least 85% identical to GCAAGATG (SEQ ID NO:44). In some embodiments, the Kozak sequence differs from the sequence of GCAAGATG (SEQ ID NO:44) by one or two nucleotides. In some embodiments, the Kozak sequence comprises GCAAGATG (SEQ ID NO:44). In some embodiments, the Kozak sequence comprises a nucleic acid sequence at least 85% identical to CACCATG (SEQ ID NO:47). In some embodiments, the Kozak sequence differs from the sequence of CACCATG (SEQ ID NO:47) by one or two nucleotides. In some embodiments, the Kozak sequence comprises CACCATG (SEQ ID NO:47). In some embodiments, the nucleic acid construct further comprises an internal ribosome entry sequence (IRES). In some embodiments, the IRES comprises an IRES selected from the group consisting of a cricket paralysis virus (CrPV) IRES, a picornavirus IRES, an aphthovirus IRES, a Kaposi's sarcoma-associated herpesvirus IRES, a hepatitis A IRES, a hepatitis C IRES, a pestivirus IRES, a Cripavirus IRES, a Rhopalosiphum padi virus IRES, and a Marek's disease virus IRES. In some embodiments, the IRES comprises a nucleic acid sequence at least 90% identical to SEQ ID NO: 12. In some embodiments, the IRES comprises SEQ ID NO: 12.

[0006] In a further aspect, a gene therapy vector is provided, comprising a nucleic acid construct comprising, in 5' to 3' order: (a) an internal ribosome entry sequence (IRES); and (b) a nucleic acid sequence encoding a therapeutic protein. In some embodiments, the IRES comprises an IRES selected from the group consisting of a cricket paralysis virus (CrPV) IRES, a picornavirus IRES, an aphthovirus IRES, a Kaposi's sarcoma-associated herpesvirus IRES, a hepatitis A IRES, a hepatitis C IRES, a pestivirus IRES, a Cripavirus IRES, a Rhopalosiphum padi virus IRES, and a Marek's disease virus IRES. In some embodiments, the IRES is a cricket paralysis virus (CrPV) IRES. In some embodiments, the IRES comprises a nucleic acid sequence at least 90% identical to SEQ ID NO: 12. In some embodiments, the IRES comprises SEQ ID NO: 12. In some embodiments, the nucleic acid construct further comprises a translation initiation sequence. In some embodiments, the translation initiation sequence comprises a Kozak sequence comprising AX1X2ATGA (SEQ ID NO:28), where each of X1 and X2 is any nucleotide. In some embodiments, X1 comprises A. In some embodiments, X2 comprises G. In some embodiments, the Kozak sequence comprises a nucleic acid sequence at least 90% identical to AAGATGA (SEQ ID NO:29). In some embodiments, the Kozak sequence comprises AAGATGA (SEQ ID NO:29). In some embodiments, the Kozak sequence comprises a nucleic acid sequence at least 85% identical to GCAAGATG (SEQ ID NO:44). In some embodiments, the Kozak sequence differs from the sequence of GCAAGATG (SEQ ID NO:44) by one or two nucleotides. In some embodiments, the Kozak sequence comprises GCAAGATG (SEQ ID NO:44). In some embodiments, the Kozak sequence comprises a nucleic acid sequence at least 85% identical to CACCATG (SEQ ID NO:47). In some embodiments, the Kozak sequence differs by one or two nucleotides from the sequence CACCATG (SEQ ID NO: 47). In some embodiments, the Kozak sequence comprises CACCATG (SEQ ID NO: 47).In some embodiments, the nucleic acid construct further comprises a signal nucleic acid sequence encoding a signal peptide that can increase secretion of the Therapeutic protein compared to the Therapeutic protein without the signal peptide. In some embodiments, the signal peptide is selected from a binding immunoglobulin protein (BiP) signal peptide and a Gaussia signal peptide. In some embodiments, the BiP signal peptide comprises an amino acid sequence at least 90% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 13-17. In some embodiments, the BiP signal peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 13-17. In some embodiments, the Gaussia signal peptide comprises an amino acid sequence at least 90% identical to SEQ ID NO: 32. In some embodiments, the Gaussia signal peptide comprises SEQ ID NO: 32.

[0007] In some embodiments, any of the nucleic acid constructs provided herein further comprise a nucleic acid sequence encoding a peptide that selectively binds with high affinity to the CI-MPR, wherein the therapeutic protein and the peptide that selectively binds to the CI-MPR are expressed as a fusion protein. In some embodiments, the nucleic acid construct further comprises a sequence encoding a linker peptide between the nucleic acid encoding the peptide that selectively binds to the CI-MPR nucleotide sequence and the nucleic acid sequence encoding the therapeutic protein. In some embodiments, the sequence of the linker peptide may overlap with the sequence of the therapeutic peptide, the sequence of the peptide that selectively binds to the CI-MPR, or both. In some embodiments, the peptide that binds with high affinity to the CI-MPR is a variant IGF2 peptide (vIGF2). In some embodiments, the vIGF2 peptide promotes cellular uptake. In some embodiments, the vIGF2 peptide comprises an amino acid sequence at least 90% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-11. In some embodiments, the vIGF2 peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 2-11. In some embodiments, the vIGF2 nucleotide sequence is located 5' to the nucleic acid sequence encoding a therapeutic protein. In some embodiments, the vIGF2 nucleotide sequence is located 3' to the nucleic acid sequence encoding a therapeutic protein. In some embodiments, the nucleic acid construct further comprises a sequence encoding a linker peptide between the vIGF2 nucleotide sequence and the nucleic acid sequence encoding a therapeutic protein. In some embodiments, the linker peptide consists of 5-20 amino acids, 5-15 amino acids, 5-10 amino acids, 8-12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker peptide comprises an amino acid sequence at least 90% identical to SEQ ID NO: 18-21, SEQ ID NO: 33, or SEQ ID NO: 37. In some embodiments, the linker peptide comprises SEQ ID NO: 18-21, SEQ ID NO: 33, or SEQ ID NO: 37. In some embodiments, the therapeutic protein is associated with a lysosomal storage disorder. In some embodiments, the therapeutic protein islysosomal enzymes or enzymatically active fragments thereof. In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfa In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosamine-6-sulfatase, galactosamine-6-sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or enzymatically active fragments thereof. In some embodiments, the therapeutic protein is α-galactosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is a palmitoylated protein thioesterase (PPT), including palmitoylated protein thioesterases 1 and 2 (PPT1 and PPT2, respectively). In some embodiments, the therapeutic protein is palmitoylated protein thioesterase 1. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the therapeutic protein is a protein involved in CDKL5 deficiency disorders, cystic fibrosis, α- and β-thalassemia,Associated with a genetic disorder selected from the group consisting of sickle cell anemia, Marfan syndrome, fragile X syndrome, Huntington's disease, hemochromatosis, congenital deafness (asymptomatic), Tay-Sachs disease, familial hypercholesterolemia, Duchenne muscular dystrophy, Stargardt disease, Usher syndrome, choroideremia, color blindness, X-linked retinoschisis, hemophilia, Wiskott-Aldrich syndrome, X-linked chronic granulomatous disease, aromatic L-amino acid decarboxylase deficiency, recessive dystrophic epidermolysis bullosa, alpha-1 antitrypsin deficiency, Hutchinson-Gilford progeria syndrome (HGPS), Noonan syndrome, and X-linked severe combined immunodeficiency (X-SCID). In some embodiments, the therapeutic protein is selected from the group consisting of CDKL5, connexin 26, hexosaminidase A, LDL receptor, dystrophin, CFTR, β-globulin, HFE, huntingtin, ABCA4, myosin VIIA (MYO7A), Rab escort protein-1 (REP1), cyclic nucleotide-gated channel β3 (CNGB3), retinoschisin 1 (RS1), hemoglobin subunit β (HBB), factor IX, WAS, cytochrome B-245 β chain, dopa decarboxylase (DDC), type VII collagen α1 chain (COL7A1), serpin family A member 1 (SERPINA1), LMNA, PTPN11, SOS1, RAF1, KRAS, and IL2 receptor γ genes. In some embodiments, the therapeutic protein can replace a defective or missing protein associated with a genetic disorder in a subject with the genetic disorder. In some embodiments, the genetic disorder is a lysosomal storage disorder. In some embodiments, the genetic disorder is aspartylglucosaminuria, Batten disease, cystinosis, Fabry disease, Gaucher disease type I, Gaucher disease type II, Gaucher disease type III, Pompe disease, Tay-Sachs disease, Sandhoff disease, metachromatic leukodystrophy, mucolipidosis type I, mucolipidosis type II, mucolipidosis type III, mucolipidosis type IV, Hurler disease, Hunter disease, Sanfilippo disease type A, Sanfilippo disease type B, Sanfilippo disease type C, Sanfilippo disease type D, Morquio disease type A, Morquio disease type B, Maroteaux-Lamy disease, Sly disease, Niemann-Pick disease type A, Niemann-Pick disease type B,In some embodiments, the lysosomal storage disorder is selected from the group consisting of Niemann-Pick disease type C1, Niemann-Pick disease type C2, Schindler disease type I, and Schindler disease type II. In some embodiments, the lysosomal storage disorder is selected from the group consisting of activator deficiency, GM2 gangliosidosis, GM2 gangliosidosis AB variant, α-mannosidosis (type 2, moderate; type 3, neonatal, severe), β-mannosidosis, lysosomal acid lipase deficiency, cystinosis (late-onset juvenile or adolescent nephropathic; childhood nephropathic), Shanarin-Dorfman syndrome, neutral lipid storage disease with myopathy, NLSDM, Danon disease, Fabry disease, Fabry disease type II, late-onset, Farber disease, Farber lipogranulomatosis, fucosidosis, galactosialidosis (neuraminidase and β-galactosidase inhibitors). Combined deficiency of cerebroside sulfatase; Gaucher disease; Type II Gaucher disease; Type III Gaucher disease; Type IIIC Gaucher disease; Atypical Gaucher disease, due to saposin C deficiency; GM1 gangliosidosis (late-onset infantile / juvenile GM1 gangliosidosis; adult / chronic GM1 gangliosidosis); Globoid cell leukodystrophy; Krabbe disease (late-onset infantile; juvenile; adult); Krabbe disease, atypical, due to saposin A deficiency; Metachromatic leukodystrophy (juvenile; adult); Partial cerebroside sulfatase deficiency; Pseudoarylsulfatase A deficiency; Metachromatic leukodystrophy due to saposin B deficiency; Mucopolysaccharidosis disorders: MPS I, Hurler syndrome; MPS I, Hurler-Scheie syndrome; MPS I, Scheie syndrome; MPS II, Hunter syndrome; MPS II, Hunter syndrome; Sanfilippo syndrome type A / MPS IIIA; Sanfilippo syndrome type B / MPS IIIB; Sanfilippo syndrome type C / MPS IIIC; Sanfilippo syndrome type D / MPS IIID; Morquio syndrome type A / MPS IVA; Morquio syndrome type B / MPS IVB; MPS IX / hyaluronidase deficiency; MPS VI / Maroteaux-Lamy syndrome; MPS VII / Sly syndrome; mucolipidosis type I, sialidosis type II; I-cell disease, Leroy disease,Mucolipidosis type II; Pseudo-Hurler polydystrophy / mucolipidosis type III; Mucolipidosis type IIIC / ML III gamma; Mucolipidosis type IV; Multiple sulfatase deficiency; Niemann-Pick disease (type B; type C1 / chronic neuropathic type; type C2; ​​type D / Nova) Scotian type); Neuronal ceroid lipofuscinosis: CLN6 disease (atypical late-onset infantile, late-onset variant, early juvenile); Batten-Spielmeyer-Vogt disease / juvenile NCL / CLN3 disease; Finnish variant late-onset infantile CLN5 disease; Jansky-Bielschowski disease / late-onset infantile CLN2 disease / TPP1 disease; Kuhus disease / adult NCL / CLN4 disease (type B); Northern epilepsy / late-onset infantile variant CLN8 disease; Santavuori-Haltia disease / infantile CLN1 disease / PPT disease; Pompe disease (glycogen storage disease type II); late-onset Pompe disease ;Pycnodysostosis;Sandhoff disease / GM2 gangliosidosis;Sandhoff disease / GM2 gangliosidosis;Sandhoff disease / GM2 gangliosidosis;Schindler disease (type III / intermediate, variable);Kanzaki disease;Sallah disease;Infantile free sialic acid storage disease (ISSD);Spinal muscular atrophy with progressive myoclonic epilepsy (SMAPME);Tay-Sachs disease / GM2 gangliosidosis;Juvenile Tay-Sachs disease;Late-onset Tay-Sachs disease;Christianson syndrome;Lowe oculocerebrorenal syndrome;Charcot-Marie-Tooth disease type 4J, CMT4J;, The genetic disorder is selected from the group consisting of Yunis-Varon syndrome; bilateral temporo-occipital polymicrogyria (BTOP); X-linked hypercalciuric nephrolithiasis, Dent disease type 1; and Dent disease type 2, adenosine deaminase-deficient severe combined immunodeficiency (ADA-SCID), and neuronal ceroid lipofuscinosis. In some embodiments, the genetic disorder is Pompe disease. In some embodiments, the genetic disorder is neuronal ceroid lipofuscinosis. In some embodiments, the neuronal ceroid lipofuscinosis is selected from the group consisting of infantile NCL (Santavuori-Haltia disease), late-onset infantile NCL (Jansky-Bielschowski disease), Batten disease, adult NCL (Koufus disease), Finnish late-onset infantile NCL, late-onset infantile variant NCL, CLN7, CLN8, Turkish late-onset infantile NCL, NCL type 9, and CLN10. In some embodiments, the gene therapy vector is a viral vector. In some embodiments, the viral vector is an adeno-associated viral vector, a retroviral vector, a lentiviral vector, a poxvirus vector, a vaccinia virus vector, an adenovirus vector, or a herpesvirus vector. In some embodiments, the viral vector is an AAV vector. In some embodiments, the AAV vector comprises an inverted terminal repeat (ITR). In some embodiments, the AAV vector is selected from the group consisting of an AAV1 vector, an AAV2 vector, an AAV3 vector, an AAV4 vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV8 vector, an AAV9 vector, an AAVrhS vector, an AAVrh10 vector, an AAVrh33 vector, an AAVrh34 vector, an AAVrh74 vector, an AAV / Anc80 vector, an AAVPHP.B vector, an AAVhu68 vector, and an AAV-DJ vector.

[0008] In certain aspects, gene therapy vectors are provided, such as gene therapy vectors comprising (a) a nucleic acid sequence encoding a therapeutic protein and (b) a nucleic acid sequence encoding a peptide that binds with high affinity to the CI-MPR. In some embodiments, the peptide is a variant IGF2 (vIGF2) peptide. In some embodiments, the vIGF2 peptide comprises an amino acid sequence that is at least 90% identical to SEQ ID NO: 1 and has at least one substitution at one or more positions selected from the group consisting of 6, 26, 27, 43, 48, 49, 50, 54, 55, and 65 of SEQ ID NO: 1. In some embodiments, the at least one substitution is selected from the group consisting of E6R, F26S, Y27L, V43L, F48T, R49S, S50I, A54R, L55R, and K65R of SEQ ID NO: 1. In some embodiments, the vIGF2 peptide comprises at least two substitutions at two or more positions selected from the group consisting of positions 6, 26, 27, 43, 48, 49, 50, 54, and 55 of SEQ ID NO:1. In some embodiments, the at least two substitutions are selected from the group consisting of E6R, F26S, Y27L, V43L, F48T, R49S, S50I, A54R, and L55R of SEQ ID NO:1. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion at position 1 of SEQ ID NO:1. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion at positions 1-2 of SEQ ID NO:1. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion at positions 1-3 of SEQ ID NO:1. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion at positions 1-4 of SEQ ID NO:1. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion of positions 1-4 of SEQ ID NO: 1 and substitutions of E6R, Y27L, and K65R. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion of positions 1-4 of SEQ ID NO: 1 and substitutions of E6R and Y27L. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion of positions 1-5 of SEQ ID NO: 1. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion of positions 1-6 of SEQ ID NO: 1. In some embodiments, the vIGF2 peptide comprisesThe vIGF2 peptide comprises an N-terminal deletion of positions 1-7 of SEQ ID NO:1. In some embodiments, the vIGF2 peptide has reduced or no affinity for the insulin receptor and IGF1R compared to native IGF2 peptide. In some embodiments, the vIGF2 peptide can promote uptake of a therapeutic protein into cells. In some embodiments, the vIGF2 peptide can promote uptake of a therapeutic protein into lysosomes. In some embodiments, the therapeutic protein can replace a defective or missing protein associated with a genetic disorder in a subject with the genetic disorder. In some embodiments, the therapeutic protein is a lysosomal enzyme or an enzymatically active fragment thereof. In some embodiments, the genetic disorder is a lysosomal storage disorder. In some embodiments, the genetic disorder is selected from the group consisting of aspartylglucosaminuria, Batten disease, cystinosis, Fabry disease, Gaucher disease type I, Gaucher disease type II, Gaucher disease type III, Pompe disease, Tay-Sachs disease, Sandhoff disease, metachromatic leukodystrophy, mucolipidosis type I, mucolipidosis type II, mucolipidosis type III, mucolipidosis type IV, Hurler disease, Hunter disease, Sanfilippo disease type A, Sanfilippo disease type B, Sanfilippo disease type C, Sanfilippo disease type D, Morquio disease type A, Morquio disease type B, Maroteaux-Lamy disease, Sly disease, Niemann-Pick disease type A, Niemann-Pick disease type B, Niemann-Pick disease type C1, Niemann-Pick disease type C2, Schindler disease type I, and Schindler disease type II. In some embodiments, the lysosomal storage disorder is activator deficiency, GM2 gangliosidosis; GM2 gangliosidosis AB variant; α-mannosidosis (type 2, moderate; type 3, neonatal, severe); β-mannosidosis; lysosomal acid lipase deficiency; cystinosis (late-onset juvenile or adolescent nephropathic; childhood nephropathic); Shanarin-Dorfman syndrome; neutral lipid storage disease with myopathy; NLSDM; Danon disease; Fabry disease; Fabry disease type II,Late-onset; Farber disease; Farber lipogranulomatosis; Fucosidosis; Galactosialidosis (combined neuraminidase and β-galactosidase deficiency); Gaucher disease; Type II Gaucher disease; Type III Gaucher disease; Type IIIC Gaucher disease; Atypical Gaucher disease, due to saposin C deficiency; GM1 gangliosidosis (late-onset infantile / juvenile GM1 gangliosidosis; adult / chronic GM1 gangliosidosis); Globoid cell leukodystrophy; Krabbe disease (late-onset infantile; juvenile; adult); Krabbe disease, atypical, due to saposin A deficiency; Metachromatic leukodystrophy (juvenile; adult); Partial cerebroside sulfatase deficiency; Pseudoarylsulfatase A deficiency; Metachromatic leukodystrophy due to saposin B deficiency; Mucopolysaccharidosis disorders: MPS I, Hurler syndrome; MPS MPS I, Hurler-Scheie syndrome; MPS I, Scheie syndrome; MPS II, Hunter syndrome; MPS II, Hunter syndrome; Sanfilippo syndrome type A / MPS IIIA; Sanfilippo syndrome type B / MPS IIIB; Sanfilippo syndrome type C / MPS IIIC; Sanfilippo syndrome type D / MPS IIID; Morquio syndrome type A / MPS IVA; Morquio syndrome type B / MPS IVB; MPS IX / hyaluronidase deficiency; MPS VI / Maroteaux-Lamy syndrome; MPS VII / Sly syndrome; mucolipidosis type I, sialidosis type II; I-cell disease, Leroy disease, mucolipidosis type II; pseudo-Hurler polydystrophy / mucolipidosis type III; mucolipidosis type IIIC / ML III gamma; mucolipidosis type IV; multiple sulfatase deficiency; Niemann-Pick disease (type B; type C1 / chronic neuronopathic; type C2; ​​type D / Nova Scotian); neuronal ceroid lipofuscinosis; CLN6 disease (atypical late-onset infantile type, late-onset variant,Early juvenile type); Batten-Spielmeyer-Vogt disease / juvenile NCL / CLN3 disease; Finnish variant late-onset infantile CLN5 disease; Jansky-Bielschowski disease / late-onset infantile CLN2 disease / TPP1 disease; Kuhs disease / adult NCL / CLN4 disease (type B); Northern epilepsy / late-onset infantile variant CLN8 disease; Santavuori-Haltia disease / infantile CLN1 disease / PPT disease; Pompe disease (glycogen storage disease type II); late-onset Pompe disease; pyknodysostosis; Sandhoff disease / GM2 gangliosidosis; Sandhoff disease / GM2 gangliosidosis; Sandhoff disease / GM2 gangliosidosis; Schindler disease (type III / intermediate, variable); Kanzaki The genetic disorder is selected from the group consisting of Salla disease, infantile free sialic acid storage disease (ISSD), spinal muscular atrophy with progressive myoclonic epilepsy (SMAPME), Tay-Sachs disease / GM2 gangliosidosis, juvenile Tay-Sachs disease, late-onset Tay-Sachs disease, Christianson syndrome, Lowe's oculocerebrorenal syndrome, Charcot-Marie-Tooth disease type 4J, CMT4J, Yunis-Varon syndrome, bilateral temporo-occipital polymicrogyria (BTOP), X-linked hypercalciuric nephrolithiasis, Dent disease type 1, and Dent disease type 2, adenosine deaminase-deficient severe combined immunodeficiency (ADA-SCID), chronic granulomatous disease (CGD), and neuronal ceroid lipofuscinosis. In some embodiments, the genetic disorder is Pompe disease. In some embodiments, the genetic disorder is neuronal ceroid lipofuscinosis. In some embodiments, the neuronal ceroid lipofuscinosis is selected from the group consisting of infantile NCL (Santavuori-Haltia disease), late-onset infantile NCL (Jansky-Bielschowski disease), Batten disease, adult NCL (Koufus disease), late-onset Finnish infantile NCL, late-onset infantile atypical NCL, CLN7, CLN8, late-onset Turkish infantile NCL, NCL type 9, and CLN10. In some embodiments, the therapeutic protein is a soluble lysosomal enzyme. In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase,Lysosomal enzymes include acid sphingomyelinase, formylglycine synthase, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosamine-6-sulfatase, N-acetylgalactosamine-6-sulfatase, and glycosaminoglycan N-acetylgalactosamine. The therapeutic protein includes an enzyme selected from the group consisting of 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or enzymatically active fragments thereof. In some embodiments, the therapeutic protein is α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the palmitoylated protein thioesterase is palmitoylated protein thioesterase 1 (PPT1) or 2 (PPT2). In some embodiments, the palmitoylated protein thioesterase is palmitoylated protein thioesterase 1. In some embodiments, the nucleic acid construct further comprises a translation initiation sequence. In some embodiments, the translation initiation sequence comprises a Kozak sequence. In some embodiments, the Kozak sequence comprises the sequence AX1X2ATGA (SEQ ID NO: 28), where each of X1 and X2 is any nucleotide. In some embodiments, X1 comprises an A. In some embodiments, X2 comprises G. In some embodiments, the Kozak sequence comprises a nucleic acid sequence at least 90% identical to AAGATGA (SEQ ID NO:29). In some embodiments, the Kozak sequence comprises AAGATGA (SEQ ID NO:29). In some embodiments, the Kozak sequence comprises a nucleic acid sequence at least 85% identical to GCAAGATG (SEQ ID NO:44). In some embodiments, the Kozak sequence differs from the sequence of GCAAGATG (SEQ ID NO:44) by one or two nucleotides. In some embodiments, the Kozak sequence comprises GCAAGATG (SEQ ID NO:44). In some embodiments, the Kozak sequence comprises a nucleic acid sequence at least 85% identical to CACCATG (SEQ ID NO:47). In some embodiments, the Kozak sequence differs from the sequence of CACCATG (SEQ ID NO:47) by one or two nucleotides. In some embodiments, the Kozak sequence comprises CACCATG (SEQ ID NO:47). In some embodiments, the nucleic acid construct further comprises a nucleic acid sequence encoding a signal peptide that can increase secretion of a Therapeutic protein compared to a Therapeutic protein without the signal peptide. In some embodiments, the nucleic acid construct further comprises a nucleic acid sequence encoding a signal peptide that can increase secretion of a Therapeutic protein compared to a Therapeutic protein with a native signal peptide. In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a non-native signal peptide that can increase secretion of a Therapeutic protein compared to the Therapeutic protein's native signal peptide. In some embodiments, the signal peptide is selected from a binding immunoglobulin protein (BiP) signal peptide and a Gaussia signal peptide. In some embodiments, the BiP signal peptide comprises an amino acid sequence at least 90% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 13-17. In some embodiments, the BiP signal peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 13-17. In some embodiments, the signal peptide comprises a Gaussia signal peptide.In some embodiments, the Gaussia signal peptide comprises an amino acid sequence at least 90% identical to SEQ ID NO: 32. In some embodiments, the Gaussia signal peptide comprises SEQ ID NO: 32. In some embodiments, the vIGF2 nucleic acid sequence is located 5' to the nucleic acid sequence encoding a therapeutic protein. In some embodiments, the vIGF2 nucleic acid sequence is located 3' to the nucleic acid sequence encoding a therapeutic protein. In some embodiments, the nucleic acid construct further comprises a sequence encoding a linker peptide between the vIGF2 nucleotide sequence and the nucleic acid sequence encoding a therapeutic protein. In some embodiments, the linker is comprised of 5-20 amino acids, 5-15 amino acids, 5-10 amino acids, 8-12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker peptide comprises SEQ ID NO: 18-21 or SEQ ID NO: 33. In some embodiments, the gene therapy vector is a viral vector. In some embodiments, the viral vector is an adenoviral vector, an adeno-associated viral (AAV) vector, a retroviral vector, a lentiviral vector, or a herpes viral vector. In some embodiments, the viral vector is an AAV vector. In some embodiments, the AAV vector comprises an inverted terminal repeat (ITR). In some embodiments, the AAV vector is selected from the group consisting of an AAV1 vector, an AAV2 vector, an AAV3 vector, an AAV4 vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV8 vector, an AAV9 vector, an AAVrhS vector, an AAVrh10 vector, an AAVrh33 vector, an AAVrh34 vector, an AAVrh74 vector, an AAV / Anc80 vector, an AAVPHP.B vector, an AAVhu68 vector, and an AAV-DJ vector.

[0009] A gene therapy vector comprising a nucleic acid construct comprising (a) a nucleic acid sequence encoding a therapeutic protein and (b) a nucleic acid sequence encoding a peptide that increases endocytosis of the therapeutic protein. In some embodiments, the peptide that increases endocytosis of the therapeutic protein is a peptide that binds to CI-MPR. In some embodiments, the peptide is a variant IGF2 (vIGF2) peptide, HIRMab, or TfRMab, or other peptide or protein that targets cells. In some embodiments, the peptide is vIGF2. In some embodiments, the vIGF2 peptide comprises an amino acid sequence that is at least 90% identical to SEQ ID NO:1 and has at least one substitution at one or more positions selected from the group consisting of positions 6, 26, 27, 43, 48, 49, 50, 54, 55, and 65 of SEQ ID NO:1. In some embodiments, the at least one substitution is selected from the group consisting of E6R, F26S, Y27L, V43L, F48T, R49S, S50I, A54R, L55R, and K65R of SEQ ID NO: 1. In some embodiments, the at least one substitution is selected from the group consisting of E6R, F26S, Y27L, V43L, F48T, R49S, S50I, A54R, and L55R of SEQ ID NO: 1. In some embodiments, the vIGF2 peptide comprises at least two substitutions at two or more positions selected from the group consisting of 6, 26, 27, 43, 48, 49, 50, 54, and 55 of SEQ ID NO: 1. In some embodiments, the at least two substitutions are selected from the group consisting of E6R, F26S, Y27L, V43L, F48T, R49S, S50I, A54R, and L55R of SEQ ID NO: 1. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion of position 1 of SEQ ID NO: 1. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion of positions 1-6 of SEQ ID NO: 1. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion of positions 1-2 of SEQ ID NO: 1. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion of positions 1-3 of SEQ ID NO: 1. In some embodiments, the vIGF2 peptide comprisesThe vIGF2 peptide comprises an N-terminal deletion of positions 1-4 of SEQ ID NO: 1. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion of positions 1-4 of SEQ ID NO: 1 and substitutions of E6R, Y27L, and K65R. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion of positions 1-4 of SEQ ID NO: 1 and substitutions of E6R and Y27L. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion of positions 1-5 of SEQ ID NO: 1. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion of positions 1-6 of SEQ ID NO: 1. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion of positions 1-7 of SEQ ID NO: 1. In some embodiments, the vIGF2 peptide has increased specificity for the cation-independent M6P receptor (CI-MPR) compared to native IGF2 peptide. In some embodiments, the vIGF2 peptide can promote uptake of a therapeutic protein into lysosomes within a cell. In some embodiments, the therapeutic protein can replace a defective or missing protein associated with a genetic disorder in a subject with the genetic disorder. In some embodiments, the therapeutic protein is a lysosomal enzyme or an enzymatically active fragment thereof. In some embodiments, the genetic disorder is a lysosomal storage disorder. In some embodiments, the genetic disorder is selected from the group consisting of aspartylglucosaminuria, Batten disease, cystinosis, Fabry disease, Gaucher disease type I, Gaucher disease type II, Gaucher disease type III, Pompe disease, Tay-Sachs disease, Sandhoff disease, metachromatic leukodystrophy, mucolipidosis type I, mucolipidosis type II, mucolipidosis type III, mucolipidosis type IV, Hurler disease, Hunter disease, Sanfilippo disease type A, Sanfilippo disease type B, Sanfilippo disease type C, Sanfilippo disease type D, Morquio disease type A, Morquio disease type B, Maroteaux-Lamy disease, Sly disease, Niemann-Pick disease type A, Niemann-Pick disease type B, Niemann-Pick disease type C1, Niemann-Pick disease type C2, Schindler disease type I, and Schindler disease type II. In some embodiments, the lysosomal storage disorder is activator deficiency, GM2 gangliosidosis; GM2 gangliosidosis AB variant; α-mannosidosis (type 2, moderate; type 3, neonatal;Severe); β-mannosidosis; Lysosomal acid lipase deficiency; Cystinosis (late-onset juvenile or adolescent nephropathic; pediatric nephropathic); Shanarin-Dorfman syndrome; Neutral lipid storage disease with myopathy; NLSDM; Danon disease; Fabry disease; Fabry disease type II, late-onset; Farber disease; Farber lipogranulomatosis; Fucosidosis; Galactosialidosis (combined deficiency of neuraminidase and β-galactosidase); Gaucher disease; Type II Gaucher disease; Type III Gaucher disease; Type IIIC Gaucher disease; Atypical Krabbe disease, due to saposin C deficiency; GM1 gangliosidosis (late-onset infantile / juvenile GM1 gangliosidosis; adult / chronic GM1 gangliosidosis); globoid cell leukodystrophy; Krabbe disease (late-onset infantile; juvenile; adult); Krabbe disease, atypical, due to saposin A deficiency; metachromatic leukodystrophy (juvenile; adult); partial cerebroside sulfatase deficiency; pseudoarylsulfatase A deficiency; metachromatic leukodystrophy due to saposin B deficiency; mucopolysaccharidosis disorders: MPS MPS I, Hurler syndrome; MPS I, Hurler-Scheie syndrome; MPS I, Scheie syndrome; MPS II, Hunter syndrome; MPS II, Hunter syndrome; Sanfilippo syndrome type A / MPS IIIA; Sanfilippo syndrome type B / MPS IIIB; Sanfilippo syndrome type C / MPS IIIC; Sanfilippo syndrome type D / MPS IIID; Morquio syndrome type A / MPS IVA; Morquio syndrome type B / MPS IVB; MPS IX / hyaluronidase deficiency; MPS VI / Maroteaux-Lamy syndrome; MPS VII / Sly syndrome; mucolipidosis type I, sialidosis type II; I-cell disease, Leroy disease, mucolipidosis type II; pseudo-Hurler polydystrophy / mucolipidosis type III; mucolipidosis type IIIC / ML III gamma; mucolipidosis type IV; multiple sulfatase deficiency; Niemann-Pick disease (type B; type C1 / chronic neuronopathic; type C2; ​​type D / Nova Scotian); neuronal ceroid lipofuscinosis; CLN6 disease (atypical late-onset infantile type, late-onset variant,Early juvenile type); Batten-Spielmeyer-Vogt disease / juvenile NCL / CLN3 disease; Finnish variant late-onset infantile CLN5 disease; Jansky-Bielschowski disease / late-onset infantile CLN2 disease / TPP1 disease; Kuhs disease / adult NCL / CLN4 disease (type B); Northern epilepsy / late-onset infantile variant CLN8 disease; Santavuori-Haltia disease / infantile CLN1 disease / PPT disease; Pompe disease (glycogen storage disease type II); late-onset Pompe disease; pyknodysostosis; Sandhoff disease / GM2 gangliosidosis; Sandhoff disease / GM2 carcinoma Gliosidosis; Sandhoff disease / GM2 gangliosidosis; Schindler disease (type III / intermediate, variable); Kanzaki disease; Salla disease; infantile free sialic acid storage disease (ISSD); spinal muscular atrophy with progressive myoclonic epilepsy (SMAPME); Tay-Sachs disease / GM2 gangliosidosis; juvenile Tay-Sachs disease; late-onset Tay-Sachs disease; Christianson syndrome; Lowe oculocerebrorenal syndrome; Charcot-Marie-Tooth disease type 4J, CMT4J; Yunis-Varon syndrome; bilateral temporo-occipital polymicrogyria (BTOP); The genetic disorder is selected from the group consisting of X-linked hypercalciuric nephrolithiasis, Dent's disease type 1; and Dent's disease type 2, adenosine deaminase-deficient severe combined immunodeficiency (ADA-SCID), chronic granulomatous disease (CGD), and neuronal ceroid lipofuscinosis. In some embodiments, the genetic disorder is Pompe disease. In some embodiments, the genetic disorder is neuronal ceroid lipofuscinosis. In some embodiments, the neuronal ceroid lipofuscinosis is selected from the group consisting of infantile NCL (Santavuori-Haltia disease), late-onset infantile NCL (Jansky-Bielschowski disease), Batten disease, adult NCL (Koufus disease), Finnish late-onset infantile NCL, late-onset infantile variant NCL, CLN7, CLN8, Turkish late-onset infantile NCL, NCL type 9, and CLN10. In some embodiments, the therapeutic protein is a soluble lysosomal enzyme or an enzymatically active fragment thereof.In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, , galactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or enzymatically active fragments thereof. In some embodiments, the therapeutic protein is α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the palmitoylated protein thioesterase is palmitoylated protein thioesterase 1 (PPT1) or 2 (PPT2). In some embodiments, the palmitoylated protein thioesterase is palmitoylated protein thioesterase 1. In some embodiments, the nucleic acid construct further comprises a translation initiation sequence. In some embodiments, the translation initiation sequence comprises a Kozak sequence.In some embodiments, the Kozak sequence comprises the sequence AX1X2ATGA (SEQ ID NO:28), where each of X1 and X2 is any nucleotide. In some embodiments, X1 comprises A. In some embodiments, X2 comprises G. In some embodiments, the Kozak sequence comprises a nucleic acid sequence at least 90% identical to AAGATGA (SEQ ID NO:29). In some embodiments, the Kozak sequence comprises AAGATGA (SEQ ID NO:29). In some embodiments, the Kozak sequence comprises a nucleic acid sequence at least 85% identical to GCAAGATG (SEQ ID NO:44). In some embodiments, the Kozak sequence differs from the sequence of GCAAGATG (SEQ ID NO:44) by one or two nucleotides. In some embodiments, the Kozak sequence comprises GCAAGATG (SEQ ID NO:44). In some embodiments, the Kozak sequence comprises a nucleic acid sequence at least 85% identical to CACCATG (SEQ ID NO:47). In some embodiments, the Kozak sequence differs by one or two nucleotides from the sequence CACCATG (SEQ ID NO:47). In some embodiments, the Kozak sequence comprises CACCATG (SEQ ID NO:47). In some embodiments, the nucleic acid construct further comprises a signal nucleic acid sequence encoding a signal peptide that can increase secretion of the therapeutic protein compared to the therapeutic protein without the signal peptide. In some embodiments, the signal peptide is selected from a binding immunoglobulin protein (BiP) signal peptide and a Gaussia signal peptide. In some embodiments, the BiP signal peptide comprises an amino acid sequence at least 90% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 13-17. In some embodiments, the BiP signal peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 13-17. In some embodiments, the signal peptide comprises a Gaussia signal peptide. In some embodiments, the Gaussia signal peptide comprises an amino acid sequence at least 90% identical to SEQ ID NO:32. In some embodiments, the Gaussia signal peptide comprises SEQ ID NO:32. In some embodiments, the vIGF2 nucleic acid sequence is 5' to a nucleic acid sequence encoding a therapeutic protein.In some embodiments, the vIGF2 nucleic acid sequence is located 3' to the nucleic acid sequence encoding the therapeutic protein. In some embodiments, the nucleic acid construct further comprises a linker sequence encoding a linker peptide between the vIGF2 nucleotide sequence and the nucleic acid sequence encoding the therapeutic protein. In some embodiments, the linker is comprised of 5 to 20 amino acids, 5 to 15 amino acids, 5 to 10 amino acids, 8 to 12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker peptide comprises SEQ ID NOs: 18-21 or SEQ ID NO: 33. In some embodiments, the gene therapy vector is a viral vector. In some embodiments, the viral vector is an adenoviral vector, an adeno-associated viral (AAV) vector, a retroviral vector, a lentiviral vector, or a herpes viral vector. In some embodiments, the viral vector is an AAV vector. In some embodiments, the AAV vector comprises inverted terminal repeats (ITRs). In some embodiments, the AAV vector is selected from the group consisting of an AAV1 vector, an AAV2 vector, an AAV3 vector, an AAV4 vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV8 vector, an AAV9 vector, an AAVrhS vector, an AAVrh10 vector, an AAVrh33 vector, an AAVrh34 vector, an AAVrh74 vector, an AAV / Anc80 vector, an AAVPHP.B vector, an AAVhu68 vector, and an AAV-DJ vector.

[0010] In a further aspect, provided are pharmaceutical compositions comprising (i) a therapeutically effective amount of any of the gene therapy vectors described herein and (ii) a pharmaceutically acceptable carrier or excipient. In some embodiments, the carrier or excipient comprises a non-ionic, low osmolarity compound, a buffer, a polymer, a salt, or a combination thereof.

[0011] In a further aspect, provided are methods of treating a genetic disorder, comprising administering any of the gene therapy vectors provided herein or any of the pharmaceutical compositions provided herein to a subject in need thereof, hi some embodiments, the genetic disorder is a lysosomal storage disorder. In some embodiments, the genetic disorder is selected from the group consisting of aspartylglucosaminuria, Batten disease, cystinosis, Fabry disease, Gaucher disease type I, Gaucher disease type II, Gaucher disease type III, Pompe disease, Tay-Sachs disease, Sandhoff disease, metachromatic leukodystrophy, mucolipidosis type I, mucolipidosis type II, mucolipidosis type III, mucolipidosis type IV, Hurler disease, Hunter disease, Sanfilippo disease type A, Sanfilippo disease type B, Sanfilippo disease type C, Sanfilippo disease type D, Morquio disease type A, Morquio disease type B, Maroteaux-Lamy disease, Sly disease, Niemann-Pick disease type A, Niemann-Pick disease type B, Niemann-Pick disease type C1, Niemann-Pick disease type C2, Schindler disease type I, and Schindler disease type II. In some embodiments, the lysosomal storage disorder is activator deficiency, GM2 gangliosidosis; GM2 gangliosidosis AB variant; α-mannosidosis (type 2, moderate; type 3, neonatal, severe); β-mannosidosis; lysosomal acid lipase deficiency; cystinosis (late-onset juvenile or adolescent nephropathic; pediatric nephropathic); Shanarin-Dorfman syndrome; neutral lipid storage disease with myopathy; NLSDM; Danon disease; Fabry disease; Fabry disease type II, late-onset; Farber disease; Farber lipogranulomatosis; fucosidosis; galactosialidosis (Neuro- Combined deficiency of laminidase and β-galactosidase; Gaucher disease; Type II Gaucher disease; Type III Gaucher disease; Type IIIC Gaucher disease; Atypical Gaucher disease, due to saposin C deficiency; GM1 gangliosidosis (late-onset infantile / juvenile GM1 gangliosidosis; adult / chronic GM1 gangliosidosis); Globoid cell leukodystrophy, Krabbe disease (late-onset infantile; juvenile; adult); Atypical Krabbe disease, due to saposin A deficiency; Metachromatic leukodystrophy (juvenile; adult); Partial cerebroside sulfatase deficiency; Pseudoarylsulfatase A deficiency;Metachromatic leukodystrophy due to saposin B deficiency; Mucopolysaccharidosis disorders: MPS I, Hurler syndrome; MPS I, Hurler-Scheie syndrome; MPS I, Scheie syndrome; MPS II, Hunter syndrome; MPS II, Hunter syndrome; Sanfilippo syndrome type A / MPS IIIA; Sanfilippo syndrome type B / MPS IIIB; Sanfilippo syndrome type C / MPS IIIC; Sanfilippo syndrome type D / MPS IIID; Morquio syndrome type A / MPS IVA; Morquio syndrome type B / MPS IVB; MPS IX / hyaluronidase deficiency; MPS VI / Maroteaux-Lamy syndrome; MPS VII / Sly syndrome; Mucolipidosis type I, Sialidosis type II; I-cell disease, Leroy disease, Mucolipidosis type II; Pseudo-Hurler polydystrophy / Mucolipidosis type III; Mucolipidosis type IIIC / ML III γ; Mucolipidosis type IV; Multiple sulfatase deficiency; Niemann-Pick disease (type B; type C1 / chronic neuropathic type; type C2; ​​type D / Nova) Scotian type); Neuronal ceroid lipofuscinosis: CLN6 disease (atypical late-onset infantile, late-onset variant, early juvenile type); Batten-Spielmeyer-Vogt disease / juvenile NCL / CLN3 disease; Finnish variant late-onset infantile CLN5 disease; Jansky-Bielschowski disease / late-onset infantile CLN2 disease / TPP1 disease; Kuhus disease / adult NCL / CLN4 disease (type B); Northern epilepsy / late-onset infantile variant CLN8 disease; Santavuori-Haltia disease / infantile CLN1 disease / PPT disease; Pompe disease (glycogen storage disease type II); late-onset Pompe disease; pyknodysostosis; Sandhoff disease / GM2 gangliosidosis; Sandhoff disease / GM2 gangliosidosis; Sandhoff disease / GM2 gangliosidosis; Schindler disease (type III / intermediate, variable); Kanzaki disease; Salla disease; infantile free sialic acid storage disease (ISSD); spinal muscular atrophy with progressive myoclonic epilepsy (SMAPME); Tay-Sachs disease / GM2 gangliosidosis; juvenile Tay-Sachs disease; late-onset Tay-Sachs disease; Christianson syndrome; Lowe oculocerebrorenal syndrome; Charcot-Marie-Tooth disease type 4J, CMT4J; Yunis-Varon syndrome; bilateral temporo-occipital polymicrogyria (BTOP); X-linked hypercalciuric nephrolithiasis, Dent disease type 1;and Dent disease type 2, adenosine deaminase-deficient severe combined immunodeficiency (ADA-SCID), chronic granulomatous disease (CGD), CDKL5 deficiency, and neuronal ceroid lipofuscinosis. In some embodiments, the genetic disorder is Pompe disease. In some embodiments, the genetic disorder is neuronal ceroid lipofuscinosis. In some embodiments, the neuronal ceroid lipofuscinosis is selected from the group consisting of infantile NCL (Santavuori-Haltia disease), late-onset infantile NCL (Jansky-Bielschowski disease), Batten disease, adult NCL (Koufus disease), Finnish late-onset infantile NCL, late-onset infantile variant NCL, CLN7, CLN8, Turkish late-onset infantile NCL, NCL type 9, and CLN10. In some embodiments, administration is intrathecal, intraocular, intravitreal, retinal, intravenous, intramuscular, intracerebroventricular, intracerebral, intracerebellar, intraventricular, intraparenchymal, ocular, subcutaneous, or a combination thereof. In some embodiments, administration is intrathecal. In some embodiments, administration is intraocular, intravitreal, or retinal.

[0012] In a further aspect, provided is a pharmaceutical composition comprising any of the gene therapy vectors herein and a pharmaceutically acceptable carrier or excipient for use in treating a genetic disorder. In a further aspect, provided is a pharmaceutical composition comprising any of the gene therapy vectors herein and a pharmaceutically acceptable carrier or excipient for use in preparing a medicament for treating a genetic disorder. In some embodiments, the genetic disorder is a lysosomal storage disorder. In some embodiments, the genetic disorder is selected from the group consisting of aspartylglucosaminuria, Batten disease, cystinosis, Fabry disease, Gaucher disease type I, Gaucher disease type II, Gaucher disease type III, Pompe disease, Tay-Sachs disease, Sandhoff disease, metachromatic leukodystrophy, mucolipidosis type I, mucolipidosis type II, mucolipidosis type III, mucolipidosis type IV, Hurler disease, Hunter disease, Sanfilippo disease type A, Sanfilippo disease type B, Sanfilippo disease type C, Sanfilippo disease type D, Morquio disease type A, Morquio disease type B, Maroteaux-Lamy disease, Sly disease, Niemann-Pick disease type A, Niemann-Pick disease type B, Niemann-Pick disease type C1, Niemann-Pick disease type C2, Schindler disease type I, and Schindler disease type II. In some embodiments, the lysosomal storage disorder is activator deficiency, GM2 gangliosidosis; GM2 gangliosidosis AB variant; α-mannosidosis (type 2, moderate; type 3, neonatal, severe); β-mannosidosis; lysosomal acid lipase deficiency; cystinosis (late-onset juvenile or adolescent nephropathic; pediatric nephropathic); Shanarin-Dorfman syndrome; neutral lipid storage disease with myopathy; NLSDM; Danon disease; Fabry disease; Fabry disease type II, late-onset; Farber disease; Farber syndrome. Lipoid granulomatosis; fucosidosis; galactosialidosis (combined neuraminidase and β-galactosidase deficiency); Gaucher disease; type II Gaucher disease; type III Gaucher disease; type IIIC Gaucher disease; atypical Gaucher disease due to saposin C deficiency; GM1 gangliosidosis (late-onset infantile / juvenile GM1 gangliosidosis; adult / chronic GM1 gangliosidosis); globoid cell leukodystrophy, Krabbe disease (late-onset infantile; juvenile; adult); atypical Krabbe disease due to saposin A deficiency;Metachromatic leukodystrophy (juvenile; adult); partial cerebroside sulfatase deficiency; pseudoarylsulfatase A deficiency; metachromatic leukodystrophy due to saposin B deficiency; mucopolysaccharidosis disorders: MPS I, Hurler syndrome; MPS I, Hurler-Scheie syndrome; MPS I, Scheie syndrome; MPS II, Hunter syndrome; MPS II, Hunter syndrome; Sanfilippo syndrome type A / MPS IIIA; Sanfilippo syndrome type B / MPS IIIB; Sanfilippo syndrome type C / MPS IIIC; Sanfilippo syndrome type D / MPS IIID; Morquio syndrome type A / MPS IVA; Morquio syndrome type B / MPS IVB; MPS IX / hyaluronidase deficiency; MPS VI / Maroteaux-Lamy syndrome; MPS VII / Sly syndrome; mucolipidosis type I, sialidosis type II; I-cell disease, Leroy disease, mucolipidosis type II; pseudo-Hurler polydystrophy / mucolipidosis type III; mucolipidosis type IIIC / ML III gamma; mucolipidosis type IV; multiple sulfatase deficiency; Niemann-Pick disease (type B; type C1 / chronic neuropathic type; type C2; ​​type D / Nova) Scotian type; Neuronal ceroid lipofuscinosis: CLN6 disease (atypical late-onset infantile, late-onset variant, early juvenile); Batten-Spielmeyer-Vogt disease / juvenile NCL / CLN3 disease; Finnish variant late-onset infantile CLN5 disease; Jansky-Bielschowski disease / late-onset infantile CLN2 disease / TPP1 disease; Kuhus disease / adult NCL / CLN4 disease (type B); Northern epilepsy / late-onset infantile variant CLN8 disease; Santavuori-Haltia disease / infantile CLN1 disease / PPT disease; Pompe disease (glycogen accumulation) Type II); Late-onset Pompe disease; Pycnodysostosis; Sandhoff disease / GM2 gangliosidosis; Sandhoff disease / GM2 gangliosidosis; Sandhoff disease / GM2 gangliosidosis; Schindler disease (type III / intermediate, variable); Kanzaki disease; Salla disease; Infantile free sialic acid storage disease (ISSD); Spinal muscular atrophy with progressive myoclonic epilepsy (SMAPME); Tay-Sachs disease / GM2 gangliosidosis; Juvenile Tay-Sachs disease; Late-onset Tay-Sachs disease; Christianson syndrome; Lowe oculocerebrorenal syndrome;The genetic disorder is selected from the group consisting of Charcot-Marie-Tooth disease type 4J, CMT4J; Yunis-Varon syndrome; bilateral temporo-occipital polymicrogyria (BTOP); X-linked hypercalciuric nephrolithiasis, Dent disease type 1; and Dent disease type 2, adenosine deaminase-deficient severe combined immunodeficiency (ADA-SCID), chronic granulomatous disease (CGD), CDKL5 deficiency, and neuronal ceroid lipofuscinosis. In some embodiments, the genetic disorder is Pompe disease. In some embodiments, the genetic disorder is neuronal ceroid lipofuscinosis. In some embodiments, the neuronal ceroid lipofuscinosis is selected from the group consisting of infantile NCL (Santavuori-Haltia disease), late-onset infantile NCL (Jansky-Bielschowski disease), Batten disease, adult-onset NCL (Koufus disease), late-onset Finnish infantile NCL, late-onset infantile atypical NCL, CLN7, CLN8, late-onset Turkish infantile NCL, NCL type 9, and CLN10. In some embodiments, the composition is formulated for intrathecal, intraocular, intravitreal, retinal, intravenous, intramuscular, intraventricular, intracerebral, intracerebellar, ocular, or subcutaneous administration. In some embodiments, the composition is formulated for intrathecal administration. In some embodiments, the composition is formulated for intrathecal administration to treat a neurodegenerative disorder. In some embodiments, the composition is formulated for ocular, intravitreal, or retinal administration.

[0013] Provided herein are gene therapy vectors comprising a nucleic acid construct encoding a polypeptide comprising: (a) a therapeutic protein; (b) a peptide that binds with high affinity to the cation-independent mannose 6-phosphate (M6P) receptor (CI-MPR); and (c) a linker between the therapeutic protein and the peptide that binds to the CI-MPR. In some embodiments, the peptide is a variant IGF2 (vIGF2) peptide. In some embodiments, the vIGF2 peptide comprises an amino acid sequence that is at least 90% identical to SEQ ID NO: 1 and has at least one substitution at one or more positions selected from the group consisting of: 6, 26, 27, 43, 48, 49, 50, 54, 55, and 65 of SEQ ID NO: 1. In some embodiments, the at least one substitution is selected from the group consisting of E6R, F26S, Y27L, V43L, F48T, R49S, S50I, A54R, L55R, and K65R of SEQ ID NO: 1. In some embodiments, the vIGF2 peptide comprises at least two substitutions at two or more positions selected from the group consisting of positions 6, 26, 27, 43, 48, 49, 50, 54, 55, and 65 of SEQ ID NO: 1. In some embodiments, the at least two substitutions are selected from the group consisting of E6R, F26S, Y27L, V43L, F48T, R49S, S50I, A54R, L55R, and K65R of SEQ ID NO: 1. In some embodiments, the vIGF2 peptide comprises an N-terminal deletion at positions 1-4 of SEQ ID NO: 1. In some embodiments, the vIGF2 peptide has reduced affinity for the insulin receptor and IGF1R compared to the native IGF2 peptide. In some embodiments, the vIGF2 peptide can promote the uptake of a therapeutic protein into cells. In some embodiments, the vIGF2 peptide can promote the uptake of a therapeutic protein into lysosomes. In some embodiments, the therapeutic protein can replace a defective or missing protein associated with a genetic disorder in a subject with the genetic disorder, hi some embodiments, the genetic disorder is a lysosomal storage disorder.In some embodiments, the genetic disorder is aspartylglucosaminuria, Batten disease, cystinosis, Fabry disease, Gaucher disease type I, Gaucher disease type II, Gaucher disease type III, Pompe disease, Tay-Sachs disease, Sandhoff disease, metachromatic leukodystrophy, mucolipidosis type I, mucolipidosis type II, mucolipidosis type III, mucolipidosis type IV, Hurler disease, Hunter disease, Sanfilippo disease type A, Sanfilippo disease type B, The genetic disorder is selected from the group consisting of Sanfilippo disease type C, Sanfilippo disease type D, Morquio disease type A, Morquio disease type B, Maroteaux-Lamy disease, Sly disease, Niemann-Pick disease type A, Niemann-Pick disease type B, Niemann-Pick disease type C1, Niemann-Pick disease type C2, Schindler disease type I, Schindler disease type II, adenosine deaminase-deficient severe combined immunodeficiency (ADA-SCID), chronic granulomatous disease (CGD), and neuronal ceroid lipofuscinosis. In some embodiments, the genetic disorder is Pompe disease. In some embodiments, the genetic disorder is CLN1 disease. In some embodiments, the therapeutic protein comprises a soluble lysosomal enzyme or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises a lysosomal enzyme or an enzymatically active fragment thereof, wherein the lysosomal enzyme is selected from the group consisting of α-galactosidase A, β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, glycosaminoglycan α-L-iduronohydrolase, iduronate-2-sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, palmitoylated protein thioesterase, cyclin-dependent kinase-like 5, and α-glucosidase. In some embodiments, the therapeutic protein is α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is palmitoylated protein thioesterase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is palmitoylated protein thioesterase-1 or an enzymatically active fragment thereof. In some embodiments, the nucleic acid construct further comprises a translation initiation sequence. In some embodiments, the translation initiation sequence comprises a Kozak sequence.In some embodiments, the nucleic acid construct further comprises a nucleic acid sequence encoding a signal peptide that can increase secretion of the therapeutic protein compared to the therapeutic protein without the signal peptide. In some embodiments, the signal peptide is selected from a binding immunoglobulin protein (BiP) signal peptide and a Gaussia signal peptide. In some embodiments, the BiP signal peptide comprises an amino acid sequence at least 90% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 13-17. In some embodiments, the vIGF2 peptide comprises the sequence of SEQ ID NO: 31. In some embodiments, the construct comprises SEQ ID NO: 36. In some embodiments, the polypeptide comprises SEQ ID NO: 23. In some embodiments, the construct comprises SEQ ID NO: 38. In some embodiments, vIGF2 is present at the N-terminus of the polypeptide. In some embodiments, vIGF2 is present at the C-terminus of the polypeptide. In some embodiments, the linker peptide comprises SEQ ID NOs: 18-21 or SEQ ID NO: 33. In some embodiments, the gene therapy vector is a viral vector selected from the group consisting of an adenoviral vector, an adeno-associated viral (AAV) vector, a retroviral vector, a lentiviral vector, a poxvirus vector, a vaccinia viral vector, an adenovirus vector, and a herpesvirus vector.

[0014] In certain aspects, fusion proteins, such as fusion proteins, comprising a variant IGF2 peptide and a therapeutic protein are provided. In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker is comprised of 5 to 20 amino acids, 5 to 15 amino acids, 5 to 10 amino acids, 8 to 12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence of GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), GGGGSGGGGS (SEQ ID NO: 37, also referred to herein as "2GS"), or GGSGSGSTS (SEQ ID NO: 33). In some embodiments, the fusion protein further comprises a signal peptide. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the fusion protein is encoded by a nucleic acid comprising a cricket paralysis virus internal ribosome entry sequence (CrPV IRES).In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the fusion protein is encoded by a nucleic acid comprising a Kozak sequence.

[0015] In a further aspect, a fusion protein is provided comprising a signal peptide and a therapeutic protein, wherein the signal peptide is post-translationally removed upon secretion from a cell. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker consists of 5-20 amino acids, 5-15 amino acids, 5-10 amino acids, 8-12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), GGGGSGGGGS (SEQ ID NO: 37), or GGSGSGSTS (SEQ ID NO: 33). In some embodiments, the fusion protein further comprises a variant IGF2 peptide. In some embodiments, the fusion protein is encoded by a nucleic acid comprising a cricket paralysis virus internal ribosome entry sequence (CrPV IRES).In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the fusion protein is encoded by a nucleic acid comprising a Kozak sequence.

[0016] In a further aspect, a nucleic acid sequence is provided that encodes a fusion protein comprising a therapeutic protein, wherein the fusion protein is encoded by a nucleic acid comprising a cricket paralysis virus internal ribosome entry sequence (CrPV IRES). In some embodiments, the fusion protein further comprises a signal peptide. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the fusion protein further comprises a variant IGF2 peptide. In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker consists of 5 to 20 amino acids, 5 to 15 amino acids, 5 to 10 amino acids, 8 to 12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence of GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), GGGGSGGGGS (SEQ ID NO: 37), or GGSGSGSTS (SEQ ID NO: 33).In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the fusion protein is encoded by a nucleic acid comprising a Kozak sequence.

[0017] In a further aspect, a fusion protein comprising a Therapeutic protein is provided, wherein the fusion protein is encoded by a nucleic acid comprising a Kozak sequence. In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker is comprised of 5 to 20 amino acids, 5 to 15 amino acids, 5 to 10 amino acids, 8 to 12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), or GGSGSGSTS (SEQ ID NO: 33). In some embodiments, the fusion protein further comprises a signal peptide. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the fusion protein further comprises a variant IGF2 peptide.In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the fusion protein is encoded by a nucleic acid comprising a cricket paralysis virus internal ribosome entry sequence (CrPV IRES).

[0018] In a further aspect, nucleic acids encoding fusion proteins, such as nucleic acids encoding fusion proteins comprising a variant IGF2 peptide and a therapeutic protein, are provided. In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker is comprised of 5 to 20 amino acids, 5 to 15 amino acids, 5 to 10 amino acids, 8 to 12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), GGGGSGGGGS (SEQ ID NO: 37), or GGSGSGSTS (SEQ ID NO: 33). In some embodiments, the fusion protein further comprises a signal peptide. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the nucleic acid further comprises a cricket paralysis virus internal ribosome entry sequence (CrPV IRES). In some embodiments, the nucleic acid further comprises a Kozak sequence.In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the nucleic acid is comprised within a viral vector. In some embodiments, the viral vector comprises a retrovirus, adenovirus, adeno-associated virus, lentivirus, or herpesvirus.

[0019] In a further aspect, a nucleic acid is provided encoding a fusion protein comprising a signal peptide and a therapeutic protein. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker consists of 5 to 20 amino acids, 5 to 15 amino acids, 5 to 10 amino acids, 8 to 12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), GGGGSGGGGS (SEQ ID NO: 37), or GGSGSGSTS (SEQ ID NO: 33). In some embodiments, the fusion protein further comprises a variant IGF2 peptide. In some embodiments, the nucleic acid further comprises a cricket paralysis virus internal ribosome entry sequence (CrPV IRES). In some embodiments, the nucleic acid further comprises a Kozak sequence.In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the nucleic acid is comprised within a viral vector. In some embodiments, the viral vector comprises a retrovirus, adenovirus, adeno-associated virus, lentivirus, or herpesvirus.

[0020] In a further aspect, a nucleic acid is provided encoding a fusion protein comprising a therapeutic protein, the nucleic acid further comprising a cricket paralysis virus internal ribosome entry sequence (CrPV IRES). In some embodiments, the nucleic acid further comprises a Kozak sequence. In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker consists of 5 to 20 amino acids, 5 to 15 amino acids, 5 to 10 amino acids, 8 to 12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), GGGGSGGGGS (SEQ ID NO: 37), or GGSGSGSTS (SEQ ID NO: 33). In some embodiments, the fusion protein further comprises a signal peptide. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the fusion protein further comprises a variant IGF2 peptide.In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the nucleic acid is comprised within a viral vector. In some embodiments, the viral vector comprises a retrovirus, adenovirus, adeno-associated virus, lentivirus, or herpesvirus.

[0021] In a further aspect, a nucleic acid is provided encoding a fusion protein comprising a therapeutic protein, the nucleic acid further comprising a Kozak sequence. In some embodiments, the nucleic acid further comprises a Kozak sequence. In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker is comprised of 5 to 20 amino acids, 5 to 15 amino acids, 5 to 10 amino acids, 8 to 12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), GGGGSGGGGS (SEQ ID NO: 37), or GGSGSGSTS (SEQ ID NO: 33). In some embodiments, the fusion protein further comprises a signal peptide. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the fusion protein further comprises a variant IGF2 peptide.In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the nucleic acid is comprised within a viral vector. In some embodiments, the viral vector comprises a retrovirus, adenovirus, adeno-associated virus, lentivirus, or herpesvirus.

[0022] In a further aspect, a composition is provided comprising: (a) a nucleic acid encoding a fusion protein comprising a variant IGF2 peptide and a therapeutic protein; and (b) a buffer or excipient suitable for gene therapy. In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker is comprised of 5-20 amino acids, 5-15 amino acids, 5-10 amino acids, 8-12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), GGGGSGGGGS (SEQ ID NO: 37), or GGSGSGSTS (SEQ ID NO: 33). In some embodiments, the fusion protein further comprises a signal peptide. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the nucleic acid further comprises a cricket paralysis virus internal ribosome entry sequence (CrPV IRES). In some embodiments, the nucleic acid further comprises a Kozak sequence.In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the nucleic acid is comprised within a viral vector. In some embodiments, the viral vector comprises a retrovirus, adenovirus, adeno-associated virus, lentivirus, or herpesvirus. In some embodiments, the buffer or excipient suitable for gene therapy comprises a liposome, nanoparticle, or cell-penetrating peptide. In some embodiments, the buffer or excipient suitable for gene therapy comprises a viral coat protein.In some embodiments, the viral coat protein is selected from the group consisting of vesicular stomatitis virus coat protein, adenovirus coat protein, adeno-associated virus coat protein, murine leukemia virus coat protein, HIV coat protein, and influenza virus coat protein.

[0023] In a further aspect, compositions are provided that include (a) a nucleic acid encoding a fusion protein comprising a signal peptide and a therapeutic protein; and (b) a buffer or excipient suitable for gene therapy. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the fusion protein further comprises a variant IGF2 peptide. In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker consists of 5-20 amino acids, 5-15 amino acids, 5-10 amino acids, 8-12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence of GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), GGGGSGGGGS (SEQ ID NO: 37), or GGSGSGSTS (SEQ ID NO: 33). In some embodiments, the nucleic acid further comprises a cricket paralysis virus internal ribosome entry sequence (CrPV IRES). In some embodiments, the nucleic acid further comprises a Kozak sequence.In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the nucleic acid is comprised within a viral vector. In some embodiments, the viral vector comprises a retrovirus, adenovirus, adeno-associated virus, lentivirus, or herpesvirus. In some embodiments, the buffer or excipient suitable for gene therapy comprises a liposome, nanoparticle, or cell-penetrating peptide. In some embodiments, the buffer or excipient suitable for gene therapy comprises a viral coat protein.In some embodiments, the viral coat protein is selected from the group consisting of vesicular stomatitis virus coat protein, adenovirus coat protein, adeno-associated virus coat protein, murine leukemia virus coat protein, HIV coat protein, and influenza virus coat protein.

[0024] In a further aspect, provided are compositions comprising: (a) a nucleic acid encoding a fusion protein comprising a therapeutic protein; and (b) a buffer or excipient suitable for gene therapy, wherein the nucleic acid further comprises a cricket paralysis virus internal ribosome entry sequence (CrPV IRES). In some embodiments, the nucleic acid further comprises a Kozak sequence. In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker consists of 5 to 20 amino acids, 5 to 15 amino acids, 5 to 10 amino acids, 8 to 12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), GGGGSGGGGS (SEQ ID NO: 37), or GGSGSGSTS (SEQ ID NO: 33). In some embodiments, the fusion protein further comprises a signal peptide. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the fusion protein further comprises a variant IGF2 peptide.In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the nucleic acid is comprised within a viral vector. In some embodiments, the viral vector comprises a retrovirus, adenovirus, adeno-associated virus, lentivirus, or herpesvirus. In some embodiments, the buffer or excipient suitable for gene therapy comprises a liposome, nanoparticle, or cell-penetrating peptide. In some embodiments, the buffer or excipient suitable for gene therapy comprises a viral coat protein.In some embodiments, the viral coat protein is selected from the group consisting of vesicular stomatitis virus coat protein, adenovirus coat protein, adeno-associated virus coat protein, murine leukemia virus coat protein, HIV coat protein, and influenza virus coat protein.

[0025] In a further aspect, a composition is provided comprising: (a) a nucleic acid encoding a fusion protein comprising a therapeutic protein; and (b) a buffer or excipient suitable for gene therapy, wherein the nucleic acid further comprises a Kozak sequence. In some embodiments, the nucleic acid further comprises a cricket paralysis virus internal ribosome entry sequence (CrPV IRES). In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker consists of 5 to 20 amino acids, 5 to 15 amino acids, 5 to 10 amino acids, 8 to 12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), GGGGSGGGGS (SEQ ID NO: 37), or GGSGSGSTS (SEQ ID NO: 33). In some embodiments, the fusion protein further comprises a signal peptide. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the fusion protein further comprises a variant IGF2 peptide.In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the nucleic acid is comprised within a viral vector. In some embodiments, the viral vector comprises a retrovirus, adenovirus, adeno-associated virus, lentivirus, or herpesvirus. In some embodiments, the buffer or excipient suitable for gene therapy comprises a liposome, nanoparticle, or cell-penetrating peptide. In some embodiments, the buffer or excipient suitable for gene therapy comprises a viral coat protein.In some embodiments, the viral coat protein is selected from the group consisting of vesicular stomatitis virus coat protein, adenovirus coat protein, adeno-associated virus coat protein, murine leukemia virus coat protein, HIV coat protein, and influenza virus coat protein.

[0026] In a further aspect, methods are provided for treating a genetic disorder in an individual, comprising administering a composition comprising: (a) a nucleic acid encoding a fusion protein comprising a variant IGF2 peptide and a therapeutic protein; and (b) a buffer or excipient suitable for gene therapy. In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker consists of 5 to 20 amino acids, 5 to 15 amino acids, 5 to 10 amino acids, 8 to 12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), GGGGSGGGGS (SEQ ID NO: 37), or GGSGSGSTS (SEQ ID NO: 33). In some embodiments, the fusion protein further comprises a signal peptide. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the nucleic acid further comprises a cricket paralysis virus internal ribosome entry sequence (CrPV IRES). In some embodiments, the nucleic acid further comprises a Kozak sequence.In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the nucleic acid is comprised within a viral vector. In some embodiments, the viral vector comprises a retrovirus, adenovirus, adeno-associated virus, lentivirus, or herpesvirus. In some embodiments, the buffer or excipient suitable for gene therapy comprises a liposome, nanoparticle, or cell-penetrating peptide. In some embodiments, the buffer or excipient suitable for gene therapy comprises a viral coat protein.In some embodiments, the viral coat protein is selected from the group consisting of vesicular stomatitis virus coat protein, adenovirus coat protein, adeno-associated virus coat protein, murine leukemia virus coat protein, HIV coat protein, and influenza virus coat protein. In some embodiments, the genetic disorder is a lysosomal storage disorder. In some embodiments, the genetic disorder is aspartylglucosaminuria, Batten disease, cystinosis, Fabry disease, Gaucher disease type I, Gaucher disease type II, Gaucher disease type III, Pompe disease, Tay-Sachs disease, Sandhoff disease, metachromatic leukodystrophy, mucolipidosis type I, mucolipidosis type II, mucolipidosis type III, mucolipidosis type IV, Hurler disease, Hunter disease, Sanfilippo disease type A, Sanfrancis disease, or the like. In some embodiments, the cell is selected from the group consisting of Sanfilippo disease type B, Sanfilippo disease type C, Sanfilippo disease type D, Morquio disease type A, Morquio disease type B, Maroteaux-Lamy disease, Sly disease, Niemann-Pick disease type A, Niemann-Pick disease type B, Niemann-Pick disease type C1, Niemann-Pick disease type C2, Schindler disease type I, Schindler disease type II, adenosine deaminase-deficient severe combined immunodeficiency (ADA-SCID), and chronic granulomatous disease (CGD). In some embodiments, cells from an individual are treated ex vivo and administered to the individual after the ex vivo treatment.

[0027] In a further aspect, methods are provided for treating a genetic disorder in an individual, comprising administering a composition comprising: (a) a nucleic acid encoding a fusion protein comprising a signal peptide and a therapeutic protein; and (b) a buffer or excipient suitable for gene therapy. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker consists of 5-20 amino acids, 5-15 amino acids, 5-10 amino acids, 8-12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence of GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), GGGGSGGGGS (SEQ ID NO: 37), or GGSGSGSTS (SEQ ID NO: 33). In some embodiments, the fusion protein further comprises a variant IGF2 peptide. In some embodiments, the nucleic acid further comprises a cricket paralysis virus internal ribosome entry sequence (CrPV IRES). In some embodiments, the nucleic acid further comprises a Kozak sequence.In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the nucleic acid is comprised within a viral vector. In some embodiments, the viral vector comprises a retrovirus, adenovirus, adeno-associated virus, lentivirus, or herpesvirus. In some embodiments, the buffer or excipient suitable for gene therapy comprises a liposome, nanoparticle, or cell-penetrating peptide. In some embodiments, the buffer or excipient suitable for gene therapy comprises a viral coat protein.In some embodiments, the viral coat protein is selected from the group consisting of vesicular stomatitis virus coat protein, adenovirus coat protein, adeno-associated virus coat protein, murine leukemia virus coat protein, HIV coat protein, and influenza virus coat protein. In some embodiments, the genetic disorder is a lysosomal storage disorder. In some embodiments, the genetic disorder is aspartylglucosaminuria, Batten disease, cystinosis, Fabry disease, Gaucher disease type I, Gaucher disease type II, Gaucher disease type III, Pompe disease, Tay-Sachs disease, Sandhoff disease, metachromatic leukodystrophy, mucolipidosis type I, mucolipidosis type II, mucolipidosis type III, mucolipidosis type IV, Hurler disease, Hunter disease, Sanfilippo disease type A, Sanfrancis disease, or the like. In some embodiments, the cell is selected from the group consisting of Sanfilippo disease type B, Sanfilippo disease type C, Sanfilippo disease type D, Morquio disease type A, Morquio disease type B, Maroteaux-Lamy disease, Sly disease, Niemann-Pick disease type A, Niemann-Pick disease type B, Niemann-Pick disease type C1, Niemann-Pick disease type C2, Schindler disease type I, Schindler disease type II, adenosine deaminase-deficient severe combined immunodeficiency (ADA-SCID), and chronic granulomatous disease (CGD). In some embodiments, cells from an individual are treated ex vivo and administered to the individual after the ex vivo treatment.

[0028] In a further aspect, methods are provided for treating a genetic disorder in an individual, comprising administering a composition comprising: (a) a nucleic acid encoding a fusion protein comprising a therapeutic protein and a targeting peptide; and (b) a buffer or excipient suitable for gene therapy, wherein the nucleic acid further comprises a cricket paralysis virus internal ribosome entry sequence (CrPV IRES). In some embodiments, the nucleic acid further comprises a Kozak sequence. In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker consists of 5 to 20 amino acids, 5 to 15 amino acids, 5 to 10 amino acids, 8 to 12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence of GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), GGGGSGGGGS (SEQ ID NO: 37), or GGSGSGSTS (SEQ ID NO: 33). In some embodiments, the fusion protein further comprises a signal peptide. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the fusion protein further comprises a variant IGF2 peptide.In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the nucleic acid is comprised within a viral vector. In some embodiments, the viral vector comprises a retrovirus, adenovirus, adeno-associated virus, lentivirus, or herpesvirus. In some embodiments, the buffer or excipient suitable for gene therapy comprises a liposome, nanoparticle, or cell-penetrating peptide. In some embodiments, the buffer or excipient suitable for gene therapy comprises a viral coat protein.In some embodiments, the viral coat protein is selected from the group consisting of vesicular stomatitis virus coat protein, adenovirus coat protein, adeno-associated virus coat protein, murine leukemia virus coat protein, HIV coat protein, and influenza virus coat protein. In some embodiments, the genetic disorder is a lysosomal storage disorder. In some embodiments, the genetic disorder is aspartylglucosaminuria, Batten disease, cystinosis, Fabry disease, Gaucher disease type I, Gaucher disease type II, Gaucher disease type III, Pompe disease, Tay-Sachs disease, Sandhoff disease, metachromatic leukodystrophy, mucolipidosis type I, mucolipidosis type II, mucolipidosis type III, mucolipidosis type IV, Hurler disease, Hunter disease, Sanfilippo disease type A, Sanfrancis disease, or the like. In some embodiments, the cell is selected from the group consisting of Sanfilippo disease type B, Sanfilippo disease type C, Sanfilippo disease type D, Morquio disease type A, Morquio disease type B, Maroteaux-Lamy disease, Sly disease, Niemann-Pick disease type A, Niemann-Pick disease type B, Niemann-Pick disease type C1, Niemann-Pick disease type C2, Schindler disease type I, Schindler disease type II, adenosine deaminase-deficient severe combined immunodeficiency (ADA-SCID), and chronic granulomatous disease (CGD). In some embodiments, cells from an individual are treated ex vivo and administered to the individual after the ex vivo treatment.

[0029] In a further aspect, there is provided a method for treating a genetic disorder in an individual, comprising administering a composition comprising: (a) a nucleic acid encoding a fusion protein comprising a therapeutic protein; and (b) a buffer or excipient suitable for gene therapy, wherein the nucleic acid further comprises a Kozak sequence. In some embodiments, the nucleic acid further comprises a cricket paralysis virus internal ribosome entry sequence (CrPV IRES). In some embodiments, the fusion protein further comprises a signal peptide. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the fusion protein further comprises a variant IGF2 peptide. In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The protein comprises at least one enzyme selected from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuroprotein 6), or enzymatically active fragments thereof.In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the nucleic acid is comprised within a viral vector. In some embodiments, the viral vector comprises a retrovirus, adenovirus, adeno-associated virus, lentivirus, or herpesvirus. In some embodiments, the buffer or excipient suitable for gene therapy comprises a liposome, a nanoparticle, or a cell-penetrating peptide. In some embodiments, the buffer or excipient suitable for gene therapy comprises a viral coat protein. In some embodiments, the viral coat protein is selected from the group consisting of vesicular stomatitis virus coat protein, adenovirus coat protein, adeno-associated virus coat protein, murine leukemia virus coat protein, HIV coat protein, and influenza virus coat protein. In some embodiments, the genetic disorder is a lysosomal storage disorder. In some embodiments, the genetic disorder is aspartylglucosaminuria, Batten disease, cystinosis, Fabry disease, Gaucher disease type I, Gaucher disease type II, Gaucher disease type III, Pompe disease, Tay-Sachs disease, Sandhoff disease, metachromatic leukodystrophy, mucolipidosis type I, mucolipidosis type II, mucolipidosis type III, mucolipidosis type IV, Hurler disease, Hunter disease, Sanfilippo disease type A, Sanfrancis disease, In some embodiments, the cell is selected from the group consisting of Sanfilippo disease type B, Sanfilippo disease type C, Sanfilippo disease type D, Morquio disease type A, Morquio disease type B, Maroteaux-Lamy disease, Sly disease, Niemann-Pick disease type A, Niemann-Pick disease type B, Niemann-Pick disease type C1, Niemann-Pick disease type C2, Schindler disease type I, Schindler disease type II, adenosine deaminase-deficient severe combined immunodeficiency (ADA-SCID), and chronic granulomatous disease (CGD). In some embodiments, cells from an individual are treated ex vivo and administered to the individual after the ex vivo treatment.

[0030] In a further aspect, methods are provided for treating a genetic disorder in an individual, comprising administering a cell containing a nucleic acid encoding a fusion protein comprising a variant IGF2 peptide and a therapeutic protein. In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker is comprised of 5-20 amino acids, 5-15 amino acids, 5-10 amino acids, 8-12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), GGGGSGGGGS (SEQ ID NO: 37), or GGSGSGSTS (SEQ ID NO: 33). In some embodiments, the fusion protein further comprises a signal peptide. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the nucleic acid further comprises a cricket paralysis virus internal ribosome entry sequence (CrPV IRES). In some embodiments, the nucleic acid further comprises a Kozak sequence.In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the nucleic acid is comprised within a viral vector. In some embodiments, the viral vector comprises a retrovirus, adenovirus, adeno-associated virus, lentivirus, or herpesvirus. In some embodiments, the buffer or excipient suitable for gene therapy comprises a liposome, nanoparticle, or cell-penetrating peptide. In some embodiments, the buffer or excipient suitable for gene therapy comprises a viral coat protein.In some embodiments, the viral coat protein is selected from the group consisting of vesicular stomatitis virus coat protein, adenovirus coat protein, adeno-associated virus coat protein, murine leukemia virus coat protein, HIV coat protein, and influenza virus coat protein. In some embodiments, the genetic disorder is a lysosomal storage disorder. In some embodiments, the genetic disorder is aspartylglucosaminuria, Batten disease, cystinosis, Fabry disease, Gaucher disease type I, Gaucher disease type II, Gaucher disease type III, Pompe disease, Tay-Sachs disease, Sandhoff disease, metachromatic leukodystrophy, mucolipidosis type I, mucolipidosis type II, mucolipidosis type III, mucolipidosis type IV, Hurler disease, Hunter disease, Sanfilippo disease type A, Sanfrancis disease, or the like. In some embodiments, the cell is selected from the group consisting of Sanfilippo disease type B, Sanfilippo disease type C, Sanfilippo disease type D, Morquio disease type A, Morquio disease type B, Maroteaux-Lamy disease, Sly disease, Niemann-Pick disease type A, Niemann-Pick disease type B, Niemann-Pick disease type C1, Niemann-Pick disease type C2, Schindler disease type I, Schindler disease type II, adenosine deaminase-deficient severe combined immunodeficiency (ADA-SCID), and chronic granulomatous disease (CGD). In some embodiments, the cell is derived from an individual.

[0031] In a further aspect, methods are provided for treating a genetic disorder in an individual, comprising administering a cell containing a nucleic acid encoding a fusion protein comprising a signal peptide and a therapeutic protein. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker consists of 5-20 amino acids, 5-15 amino acids, 5-10 amino acids, 8-12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), GGGGSGGGGS (SEQ ID NO: 37), or GGSGSGSTS (SEQ ID NO: 33). In some embodiments, the fusion protein further comprises a variant IGF2 peptide. In some embodiments, the nucleic acid further comprises a cricket paralysis virus internal ribosome entry sequence (CrPV IRES). In some embodiments, the nucleic acid further comprises a Kozak sequence.In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the nucleic acid is comprised within a viral vector. In some embodiments, the viral vector comprises a retrovirus, adenovirus, adeno-associated virus, lentivirus, or herpesvirus. In some embodiments, the buffer or excipient suitable for gene therapy comprises a liposome, nanoparticle, or cell-penetrating peptide. In some embodiments, the buffer or excipient suitable for gene therapy comprises a viral coat protein.In some embodiments, the viral coat protein is selected from the group consisting of vesicular stomatitis virus coat protein, adenovirus coat protein, adeno-associated virus coat protein, murine leukemia virus coat protein, HIV coat protein, and influenza virus coat protein. In some embodiments, the genetic disorder is a lysosomal storage disorder. In some embodiments, the genetic disorder is aspartylglucosaminuria, Batten disease, cystinosis, Fabry disease, Gaucher disease type I, Gaucher disease type II, Gaucher disease type III, Pompe disease, Tay-Sachs disease, Sandhoff disease, metachromatic leukodystrophy, mucolipidosis type I, mucolipidosis type II, mucolipidosis type III, mucolipidosis type IV, Hurler disease, Hunter disease, Sanfilippo disease type A, Sanfrancis disease, or the like. In some embodiments, the cell is selected from the group consisting of Sanfilippo disease type B, Sanfilippo disease type C, Sanfilippo disease type D, Morquio disease type A, Morquio disease type B, Maroteaux-Lamy disease, Sly disease, Niemann-Pick disease type A, Niemann-Pick disease type B, Niemann-Pick disease type C1, Niemann-Pick disease type C2, Schindler disease type I, Schindler disease type II, adenosine deaminase-deficient severe combined immunodeficiency (ADA-SCID), and chronic granulomatous disease (CGD). In some embodiments, the cell is derived from an individual.

[0032] In a further aspect, methods are provided for treating a genetic disorder in an individual, comprising administering cells containing a nucleic acid encoding a fusion protein comprising a therapeutic protein, wherein the nucleic acid further comprises a cricket paralysis virus internal ribosome entry sequence (CrPV IRES). In some embodiments, the nucleic acid further comprises a Kozak sequence. In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker consists of 5 to 20 amino acids, 5 to 15 amino acids, 5 to 10 amino acids, 8 to 12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), GGGGSGGGGS (SEQ ID NO: 37), or GGSGSGSTS (SEQ ID NO: 33). In some embodiments, the fusion protein further comprises a signal peptide. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the fusion protein further comprises a variant IGF2 peptide.In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the nucleic acid is comprised within a viral vector. In some embodiments, the viral vector comprises a retrovirus, adenovirus, adeno-associated virus, lentivirus, or herpesvirus. In some embodiments, the buffer or excipient suitable for gene therapy comprises a liposome, nanoparticle, or cell-penetrating peptide. In some embodiments, the buffer or excipient suitable for gene therapy comprises a viral coat protein.In some embodiments, the viral coat protein is selected from the group consisting of vesicular stomatitis virus coat protein, adenovirus coat protein, adeno-associated virus coat protein, murine leukemia virus coat protein, HIV coat protein, and influenza virus coat protein. In some embodiments, the genetic disorder is a lysosomal storage disorder. In some embodiments, the genetic disorder is aspartylglucosaminuria, Batten disease, cystinosis, Fabry disease, Gaucher disease type I, Gaucher disease type II, Gaucher disease type III, Pompe disease, Tay-Sachs disease, Sandhoff disease, metachromatic leukodystrophy, mucolipidosis type I, mucolipidosis type II, mucolipidosis type III, mucolipidosis type IV, Hurler disease, Hunter disease, Sanfilippo disease type A, Sanfrancis disease, or the like. In some embodiments, the cell is selected from the group consisting of Sanfilippo disease type B, Sanfilippo disease type C, Sanfilippo disease type D, Morquio disease type A, Morquio disease type B, Maroteaux-Lamy disease, Sly disease, Niemann-Pick disease type A, Niemann-Pick disease type B, Niemann-Pick disease type C1, Niemann-Pick disease type C2, Schindler disease type I, Schindler disease type II, adenosine deaminase-deficient severe combined immunodeficiency (ADA-SCID), and chronic granulomatous disease (CGD). In some embodiments, the cell is derived from an individual.

[0033] In a further aspect, methods are provided for treating a genetic disorder in an individual, comprising administering cells containing a nucleic acid encoding a fusion protein comprising a therapeutic protein, wherein the nucleic acid further comprises a Kozak sequence. In some embodiments, the nucleic acid further comprises a cricket paralysis virus internal ribosome entry sequence (CrPV IRES). In some embodiments, the fusion protein further comprises a linker. In some embodiments, the linker consists of 5 to 20 amino acids, 5 to 15 amino acids, 5 to 10 amino acids, 8 to 12 amino acids, or about 7, 8, 9, 10, 11, 12, or 13 amino acids. In some embodiments, the linker comprises the amino acid sequence GGGGSGGGG (SEQ ID NO: 18), GGGGS (SEQ ID NO: 19), GGGSGGGGS (SEQ ID NO: 20), GGGGSGGGS (SEQ ID NO: 21), GGGGSGGGGS (SEQ ID NO: 37), or GGSGSGSTS (SEQ ID NO: 33). In some embodiments, the fusion protein further comprises a signal peptide. In some embodiments, the signal peptide comprises a binding immunoglobulin protein (BiP) signal peptide. In some embodiments, the fusion protein further comprises a variant IGF2 peptide.In some embodiments, the therapeutic protein is selected from the group consisting of α-galactosidase (A or B), β-galactosidase, β-hexosaminidase (A or B), galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase, arylsulfatase (A or B), β-glucocerebrosidase, lysosomal acid lipase, the lysosomal enzyme acid sphingomyelinase, formylglycine generating enzyme, iduronidase (e.g., α-L), acetyl-CoA:α-glucosaminide N-acetyltransferase, glycosaminoglycan α-L-iduronohydrolase, heparan N-sulfatase, N-acetyl-α-D-glucosaminidase (NAGLU), iduronate-2-sulfatase, galactosylceramidase ... The therapeutic protein comprises at least one enzyme from the group consisting of lactosamine-6-sulfate sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronidase, α-N-acetylneuraminidase (sialidase), ganglioside sialidase, phosphotransferase, α-glucosidase, α-D-mannosidase, β-D-mannosidase, aspartylglucosaminidase, α-L-fucosidase, battenin, palmitoylated protein thioesterase, and other Batten disease-related proteins (e.g., ceroid lipofuscinosis neuronal protein 6), or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein comprises α-glucosidase or an enzymatically active fragment thereof. In some embodiments, the therapeutic protein is N-acetyl-α-D-glucosaminidase (NAGLU). In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the nucleic acid is comprised within a viral vector. In some embodiments, the viral vector comprises a retrovirus, adenovirus, adeno-associated virus, lentivirus, or herpesvirus. In some embodiments, a buffer or excipient suitable for gene therapy. In some embodiments, the buffer or excipient suitable for gene therapy comprises a viral coat protein.In some embodiments, the viral coat protein is selected from the group consisting of vesicular stomatitis virus coat protein, adenovirus coat protein, adeno-associated virus coat protein, murine leukemia virus coat protein, HIV coat protein, and influenza virus coat protein. In some embodiments, the genetic disorder is a lysosomal storage disorder. In some embodiments, the genetic disorder is aspartylglucosaminuria, Batten disease, cystinosis, Fabry disease, Gaucher disease type I, Gaucher disease type II, Gaucher disease type III, Pompe disease, Tay-Sachs disease, Sandhoff disease, metachromatic leukodystrophy, mucolipidosis type I, mucolipidosis type II, mucolipidosis type III, mucolipidosis type IV, Hurler disease, Hunter disease, Sanfilippo disease type A, Sanfrancis disease, or the like. In some embodiments, the cell is selected from the group consisting of Sanfilippo disease type B, Sanfilippo disease type C, Sanfilippo disease type D, Morquio disease type A, Morquio disease type B, Maroteaux-Lamy disease, Sly disease, Niemann-Pick disease type A, Niemann-Pick disease type B, Niemann-Pick disease type C1, Niemann-Pick disease type C2, Schindler disease type I, Schindler disease type II, adenosine deaminase-deficient severe combined immunodeficiency (ADA-SCID), and chronic granulomatous disease (CGD). In some embodiments, the cell is derived from an individual.

[0034] Further provided herein is a fusion protein comprising a native signal peptide, an ER protein cleavage domain, a variant IGF2 peptide, and an α-glucosidase lacking the native signal peptide, wherein the fusion protein is encoded by a nucleic acid comprising a Kozak sequence.

[0035] Additionally provided herein is a fusion protein comprising a binding immunoglobulin protein (BiP) signal peptide, a variant IGF2 peptide, and α-glucosidase, wherein the fusion protein is encoded by a nucleic acid comprising a Kozak sequence.

[0036] Additionally provided herein is a fusion protein comprising a binding immunoglobulin protein (BiP) signal peptide, a variant IGF2 peptide, and an α-glucosidase lacking its native signal peptide, wherein the fusion protein is encoded by a nucleic acid comprising a cricket paralysis virus internal ribosome entry sequence (CrPV IRES).

[0037] Additionally, provided herein are nucleic acids encoding fusion proteins comprising a native signal peptide, an ER protein cleavage domain, a variant IGF2 peptide, and an α-glucosidase lacking the native signal peptide.

[0038] Additionally provided herein is a nucleic acid encoding a fusion protein comprising a binding immunoglobulin protein (BiP) signal peptide, a variant IGF2 peptide, and an α-glucosidase lacking its native signal peptide, the nucleic acid further comprising a Kozak sequence.

[0039] Additionally provided herein is a nucleic acid encoding a fusion protein comprising a variant IGF2 peptide and α-glucosidase, the nucleic acid further comprising a cricket paralysis virus internal ribosome entry sequence (CrPV IRES).

[0040] Additionally, provided herein are compositions comprising: (a) a nucleic acid encoding a fusion protein comprising a native signal peptide, an ER protein cleavage domain, a variant IGF2 peptide, and an α-glucosidase lacking the native signal peptide; and (b) a buffer or excipient suitable for gene therapy.

[0041] Additionally, provided herein are compositions comprising: (a) a nucleic acid encoding a fusion protein comprising a binding immunoglobulin protein (BiP) signal peptide, a variant IGF2 peptide, and an α-glucosidase lacking its native signal peptide, the nucleic acid further comprising a Kozak sequence; and (b) a buffer or excipient suitable for gene therapy.

[0042] Additionally, provided herein are compositions comprising: (a) a nucleic acid encoding a fusion protein comprising a variant IGF2 peptide and α-glucosidase, the nucleic acid further comprising a cricket paralysis virus internal ribosome entry sequence (CrPV IRES); and (b) a buffer or excipient suitable for gene therapy.

[0043] Additionally, provided herein are methods of treating Pompe disease in an individual, comprising administering a composition comprising: (a) a nucleic acid encoding a fusion protein comprising a native signal peptide, an ER protein cleavage domain, a variant IGF2 peptide, and an α-glucosidase lacking the native signal peptide; and (b) a buffer or excipient suitable for gene therapy.

[0044] Additionally provided herein are methods of treating Pompe disease in an individual, comprising administering a composition comprising: (a) a nucleic acid encoding a fusion protein comprising a binding immunoglobulin protein (BiP) signal peptide, a variant IGF2 peptide, and an α-glucosidase lacking its native signal peptide, the nucleic acid further comprising a Kozak sequence; and (b) a buffer or excipient suitable for gene therapy.

[0045] Additionally, provided herein are methods of treating Pompe disease in an individual, comprising administering a composition comprising: (a) a nucleic acid encoding a fusion protein comprising a variant IGF2 peptide and α-glucosidase, the nucleic acid further comprising a cricket paralysis virus internal ribosome entry sequence (CrPV IRES); and (b) a buffer or excipient suitable for gene therapy.

[0046] Additionally, provided herein are methods of treating Pompe disease in an individual comprising administering a cell comprising a nucleic acid encoding a fusion protein comprising a native signal peptide, an ER protein cleavage domain, a variant IGF2 peptide, and an α-glucosidase lacking the native signal peptide.

[0047] Additionally, provided herein are methods of treating Pompe disease in an individual, comprising administering a cell containing a nucleic acid encoding a fusion protein comprising a binding immunoglobulin protein (BiP) signal peptide, a variant IGF2 peptide, and an α-glucosidase or an enzymatically active fragment thereof, wherein the nucleic acid further comprises a Kozak sequence.

[0048] Additionally, provided herein are methods of treating Pompe disease in an individual comprising administering a cell containing a nucleic acid encoding a fusion protein comprising a variant IGF2 peptide and α-glucosidase, the nucleic acid further comprising a cricket paralysis virus internal ribosome entry sequence (CrPV IRES).

[0049] Incorporation by Reference All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0050] The patent application file contains at least one drawing executed in color. Copies of this patent application with color drawing(s) will be provided by the Patent Office upon request and payment of the necessary fee. The features and advantages of the present disclosure will be understood by reference to the following detailed description that sets forth illustrative embodiments in which the principles of the present disclosure are utilized, and the accompanying drawings, in which: [Brief explanation of the drawings]

[0051] [Figure 1]Figure 1 shows the GAA activity of rhGAA, an alglucosidase-α, with and without M6P. Figure 1 shows the percentage of commercially available ERT that can bind to the CI-MPR. The first peak is rhGAA that lacks any M6P-containing glycans and is therefore unable to be taken up and delivered to lysosomes. The second peak is the fraction containing at least one phosphorylated glycan, which has the potential to be taken up by cells and delivered to lysosomes for glycogen hydrolysis. [Figure 2] 1 shows the structure of the CI-MPR, which contains different binding domains for IGF2 and mono- and bis-phosphorylated oligosaccharides. [Figure 3] The sequence and structure of the mature human IGF2 peptide are shown. Site-specific amino acid substitutions have been proposed to affect binding to other receptors. [Figure 4] 1 shows binding of wild-type IGF2 (wtIGF2) peptide to CI-MPR as measured by surface plasmon resonance. [Figure 5] 1 shows binding of variant IGF2 (vIGF2) peptides to CI-MPR as measured by surface plasmon resonance. [Figure 6] 1 shows the benefit of adding vIGF2 to alglucosidase alpha to increase binding to the IGF2 / CI-MPR. [Figure 7] Figure 1 shows the benefit of adding vIGF2 to recombinant human N-acetyl-α-D-glucosaminidase (rhNAGLU) to increase binding to the IGF2 / CI-MPR. [Figure 8] Binding of wild-type human IGF2 to the insulin receptor. [Figure 9] There is no detectable binding of vIGF2 to the insulin receptor. [Figure 10] Binding of wild-type IGF2 to the insulin-like growth factor 1 receptor is shown. [Figure 11] FIG. 1 shows reduced binding of the vIGF2 peptide to the insulin-like growth factor 1 receptor compared to wild-type IGF2. [Figure 12]Two examples of gene therapy expression cassettes encoding native hGAA and modified hGAA are shown. Native hGAA has insufficient phosphorylation, resulting in poor CIMPR binding and cellular uptake. The modified hGAA has an additional element (vIGF2) for improved CIMPR binding, a 2GS linker to reduce steric hindrance of the vIGF2-GAA protein with CIMPR, and a BiP signal peptide to improve secretion. [Figure 13] Western blots of PPT1 from cells expressing recombinant human PPT1 (PPT1-1), cells expressing recombinant human PPT1 with a vIGF2 targeting domain (PPT1-2), and cells expressing recombinant human PPT1 with a vIGF2 targeting domain and a BiP signal sequence (PPT1-29) are shown. [Figure 14] Binding of PPT1 constructs to CI-MPR is shown. [Figure 15] GAA activity of conditioned medium from CHO cells expressing modified or native hGAA is shown. [Figure 16] 1 shows the study design for a 4-week mouse study of gene therapy in GAA knockout mice. [Figure 17] Plasma GAA activity is shown for untreated wild-type ("normal") mice or GAA knockout mice administered gene therapy vector or vehicle as indicated. [Figure 18] Shown are GAA levels measured in untreated wild-type ("normal") mice or GAA knockout mice administered gene therapy vector or vehicle as indicated. [Figure 19] 1 shows cell surface receptor binding of rhGAA from plasma samples obtained from mice treated as indicated. [Figure 20] Shown are GAA activity and quadriceps glycogen / histopathology scores in the tibialis anterior muscle of untreated wild-type ("normal") mice or GAA knockout mice administered gene therapy vector or vehicle as indicated. [Figure 21]Glycogen (PAS) staining of tibialis anterior muscle from untreated wild-type mice or GAA knockout mice administered gene therapy vector or vehicle as indicated is shown. [Figure 22] 1 shows hGAA immunohistochemistry of tibialis anterior muscle from untreated wild-type mice or GAA knockout mice administered gene therapy vector or vehicle as indicated. [Figure 23] Shown are brain GAA activity, brain glycogen, and spinal cord glycogen / histopathology scores in the brain and spinal cord of untreated wild-type ("normal") mice or GAA knockout mice administered gene therapy vector or vehicle as indicated. [Figure 24] Glycogen (PAS) staining of brains from untreated wild-type mice or GAA knockout mice administered gene therapy vector or vehicle as indicated is shown. [Figure 25] Shown is hGAA immunohistochemistry of the brainstem and choroid plexus of untreated wild-type ("normal") mice or GAA knockout mice administered gene therapy vector or vehicle as indicated. [Figure 26] Glycogen (PAS) staining of the spinal cord of untreated wild-type mice or GAA knockout mice administered gene therapy vector or vehicle as indicated is shown. [Figure 27] Shown is hGAA immunohistochemistry of the spinal cord from untreated wild-type mice or GAA knockout mice administered gene therapy vector or vehicle as indicated. [Figure 28] Shown are GAA activity and glycogen / histopathology scoring in quadriceps muscles of untreated wild-type ("normal") mice or GAA knockout mice administered gene therapy vector or vehicle as indicated. [Figure 29] Glycogen (luxol / PAS) staining of quadriceps muscles from untreated wild-type mice or GAA knockout mice administered gene therapy vector or vehicle as indicated is shown. [Figure 30]1 shows hGAA immunohistochemistry of quadriceps muscles from untreated wild-type mice or GAA knockout mice administered gene therapy vector or vehicle as indicated. [Figure 31] Shown are GAA activity and histopathological scoring in the triceps muscles of untreated wild-type ("normal") mice or GAA knockout mice administered gene therapy vector or vehicle as indicated. [Figure 32] Glycogen (luxol / PAS) staining of triceps muscles from untreated wild-type mice or GAA knockout mice administered gene therapy vector or vehicle as indicated is shown. [Figure 33] 1 shows hGAA immunohistochemistry of triceps muscles from untreated wild-type mice or GAA knockout mice administered gene therapy vector or vehicle as indicated. DETAILED DESCRIPTION OF THE INVENTION

[0052] Gene therapy for single-gene genetic disorders offers a promising one-time treatment for diseases or disorders, some of which have devastating symptoms that can appear at an early age and, in some cases, result in lifelong disability. Genetic neurological disorders, such as lysosomal storage disorders, are often treated with enzyme replacement therapy, in which patients are administered a therapeutic protein that is an active form of a protein that is defective or missing in the disease or disorder state. However, current treatments have challenges, including frequent treatments, the development of immune responses to the therapeutic protein, and difficulty in targeting the therapeutic protein to affected tissues, cells, or intracellular compartments. Gene therapy offers advantages, including reduced treatment frequency and sustained efficacy.

[0053] Provided herein are components for gene therapy vectors that provide improvements to gene therapy, such as providing more therapeutic protein where it is needed, thereby improving the efficacy of treatment. Such challenges are addressed herein by improving the expression and cellular uptake or delivery of therapeutic proteins and intracellular or organelle targeting. Specific tools or components provided herein include, but are not limited to, signal peptides to increase secretion (e.g., binding immunoglobulin protein (BiP) and Gaussia signal peptides) and peptides to increase endocytosis of therapeutic proteins (e.g., peptides that bind with high affinity to the CI-MPR to increase cellular uptake and lysosomal delivery). Such peptides are fused to a therapeutic protein encoded by the gene therapy vector. In some embodiments, the peptide is an IGF2 (insulin-like growth factor 2) peptide or a variant thereof. It is contemplated that the gene therapy vectors provided herein, in some embodiments, comprise a nucleic acid encoding a therapeutic protein fused to a peptide that binds with high affinity to the CI-MPR to optimize the efficacy of gene therapy.

[0054] A gene therapy construct for enzyme replacement gene therapy has been designed. A translation initiation sequence, including but not limited to a Kozak sequence or an IRES sequence such as the CrPV IRES, is located at the 5' end of the construct, followed by a nucleic acid encoding a signal peptide selected from one or more of the GAA signal peptides, a nucleic acid encoding an antitrypsin inhibitor, and a nucleic acid encoding a BiP sequence. These are followed by a nucleic acid encoding a cell-targeting domain, which may be vIGF-2, HIRMab, or TfRMab, or other cell-targeting peptide or protein. The gene therapy construct further includes a nucleic acid encoding a linker and a nucleic acid encoding a corrective enzyme or an enzymatically active fragment thereof, wherein the linker connects the cell-targeting domain to the corrective enzyme or an enzymatically active fragment thereof. Suitable corrective enzymes include, but are not limited to, α-glucosidase (GAA), α-galactosidase (GLA), iduronidase (IDUA), iduronate-2-sulfatase (IDS), PPT1, or enzymatically active fragments thereof, and other enzymes found to be deficient in an individual.

[0055] Intracellular targeting of therapeutic proteins The N-linked glycans of most lysosomal proteins are modified to contain a special glycan structure called mannose 6-phosphate (M6P). M6P is a biological signal that enables the transport of lysosomal proteins to lysosomes via the membrane-bound M6P receptor. Enzyme replacement therapy for lysosomal storage disorders utilizes the M6P receptor for the uptake and delivery of therapeutic proteins to lysosomes. Some therapeutics that do not utilize the M6P receptor, including Cerezyme® and other versions of recombinant human GCase, utilize a mannose receptor that can bind to the terminal mannose on the glycan of proteins and deliver them to lysosomes. A problem faced by some enzyme replacement therapies is that the low amount of M6P present in enzyme therapeutics requires higher doses to achieve therapeutic efficacy. This significantly prolongs infusion times, increases the likelihood of immune reactions to the therapeutic, increases drug demand, and necessitates increased protein production, thereby increasing costs.

[0056] The CI-MPR scavenges M6P-containing lysosomal enzymes from the circulation. This receptor has distinct binding domains for M6P and insulin-like growth factors (domains 1-3 and 7-9, see Figure 2), and is therefore also known as the IGF2 / mannose 6-phosphate receptor or IGF2 / CI-MPR. This receptor can be utilized to target enzyme replacement therapies containing M6P, IGF2, or IGF2 variants. The binding affinity of this receptor for these ligands, including insulin-like growth factors, is provided in Table 1. Notably, IGF2 peptides have higher binding affinity for the CI-MPR than mono- or bis-phosphorylated oligosaccharides. TIFF0007749322000001.tif73170

[0057] Therapeutic fusion proteins for gene therapy Provided herein are therapeutic fusion proteins produced from gene therapy vectors. In some embodiments, the fusion proteins are secreted by cells transduced with a gene therapy vector encoding the fusion protein. In some embodiments, the transduced cells are present within a tissue or organ (e.g., the liver). Once secreted from the cells, the fusion protein is transported by the patient's vascular system and reaches the tissue of interest. In some embodiments, the therapeutic fusion protein is modified to have improved secretion. In some embodiments, the fusion protein comprises a corresponding therapeutic protein or a therapeutic protein but includes a signal peptide to improve secretion levels compared to a fusion protein lacking the signal peptide.

[0058] In some embodiments, the provided gene therapy vectors are modified to address problems associated with gene therapy related to the delivery of therapeutic proteins. For example, in some cases, gene therapy may produce sufficient amounts of therapeutic protein within the patient's body but not achieve the intended treatment if an insufficient amount of therapeutic protein is delivered to cells requiring the therapeutic protein, e.g., due to physical and / or biological barriers that prevent distribution of the therapeutic protein to the required site. Thus, even if gene therapy is able to flood the blood or tissue with high concentrations of therapeutic protein to the saturation point, the gene therapy may not be sufficiently therapeutically effective. In addition, undesirable clearance pathways may remove most of the therapeutic protein. Even if the therapeutic protein is transported from the vasculature to the interstitial space within tissues (e.g., muscle fibers), adequate therapeutic efficacy is not guaranteed. For effective treatment of lysosomal storage disorders, a therapeutically effective amount of the therapeutic protein must undergo cellular endocytosis and lysosomal delivery to provide meaningful efficacy. The present disclosure addresses these problems by providing gene therapy vectors encoding fusion proteins containing peptides that enable endocytosis of the therapeutic protein into target cells for treatment, thereby providing effective treatment. In some embodiments, the peptide that enables endocytosis is a peptide that binds to the CI-MPR. In some embodiments, the peptide that binds to the CI-MPR is a vIGF2 peptide.

[0059] Provided herein are gene therapy vectors encoding fusion proteins containing peptides that enable endocytosis of a therapeutic protein into target cells for treatment. In some embodiments, the gene therapy vector encodes a fusion protein containing a therapeutic protein and a peptide that binds to the CI-MPR. When expressed from the gene therapy vector, such fusion proteins target therapeutic proteins, such as enzyme replacement therapeutics, to cells where they are needed, increase delivery to or cellular uptake by such cells, and target the therapeutic protein to an intracellular location (e.g., lysosomes). In some embodiments, the peptide is an IGF2 peptide or a variant thereof, which can target the therapeutic protein to lysosomes. In some embodiments, the fusion proteins herein further comprise a signal peptide, such as a BiP signal peptide or a Gaussia signal peptide, that increases secretion. In some embodiments, the fusion protein comprises a linker sequence. In some embodiments, the nucleic acid encoding the fusion protein herein comprises an internal ribosome entry sequence.

[0060] Provided herein are therapeutic proteins for use in gene therapy, including vIGF2 peptides. Exemplary proteins are provided in Table 2 below. TIFF0007749322000002.tif254170TIFF0007749322000003.tif253170TIFF0007749322000004.tif253170TIFF0007749322000005.tif64170

[0061] The components of the fusion proteins provided herein are further described below.

[0062] Peptides that bind to the CI-MPR (e.g., vIGF2 peptide) Provided herein are peptides that bind to the CI-MPR. Fusion proteins comprising such peptides and a therapeutic protein, when expressed from a gene therapy vector, target the therapeutic protein to cells where it is needed, increase cellular uptake by such cells, and target the therapeutic protein to an intracellular location (e.g., lysosomes). In some embodiments, the peptide is fused to the N-terminus of the therapeutic peptide. In some embodiments, the peptide is fused to the C-terminus of the therapeutic protein. In some embodiments, the peptide is a vIGF2 peptide. Some vIGF2 peptides maintain high-affinity binding to the CI-MPR while their affinity for IGF1 receptor, insulin receptor, and IGF-binding proteins (IGFBPs) is reduced or eliminated. Thus, some variant IGF2 peptides are substantially more selective and have reduced safety risks compared to wild-type IGF2. Examples of vIGF2 peptides herein include those having the amino acid sequence of SEQ ID NO: 31. Variant IGF2 peptides further include those having a different amino acid at positions 6, 26, 27, 43, 48, 49, 50, 54, 55, or 65 compared to wild-type IGF2 (SEQ ID NO: 1). In some embodiments, the vIGF2 peptide has a sequence with one or more substitutions selected from the group consisting of E6R, F26S, Y27L, V43L, F48T, R49S, S50I, A54R, L55R, and K65R. In some embodiments, the vIGF2 peptide has a sequence with an E6R substitution. In some embodiments, the vIGF2 peptide has a sequence with an F26S substitution. In some embodiments, the vIGF2 peptide has a sequence with a Y27L substitution. In some embodiments, the vIGF2 peptide has a sequence with a V43L substitution. In some embodiments, the vIGF2 peptide has a sequence with an F48T substitution. In some embodiments, the vIGF2 peptide has a sequence with a substitution of R49S. In some embodiments, the vIGF2 peptide has a sequence with a substitution of S50I. In some embodiments, the vIGF2 peptide has a sequence with a substitution of A54R.In some embodiments, the vIGF2 peptide has a sequence with an L55R substitution. In some embodiments, the vIGF2 peptide has a sequence with a K65R substitution. In some embodiments, the vIGF2 peptide has a sequence with E6R, F26S, Y27L, V43L, F48T, R49S, S50I, A54R, and L55R substitutions. In some embodiments, the vIGF2 peptide has an N-terminal deletion. In some embodiments, the vIGF2 peptide has a 1 amino acid N-terminal deletion. In some embodiments, the vIGF2 peptide has a 2 amino acid N-terminal deletion. In some embodiments, the vIGF2 peptide has a 3 amino acid N-terminal deletion. In some embodiments, the vIGF2 peptide has a 4 amino acid N-terminal deletion and E6R, Y27L, and K65R substitutions. In some embodiments, the vIGF2 peptide has a 4 amino acid N-terminal deletion and E6R and Y27L substitutions. In some embodiments, the vIGF2 peptide has a 5 amino acid N-terminal deletion. In some embodiments, the vIGF2 peptide has a 6 amino acid N-terminal deletion. In some embodiments, the vIGF2 peptide has a 7 amino acid N-terminal deletion. In some embodiments, the vIGF2 peptide has a 7 amino acid N-terminal deletion and Y27L and K65R substitutions. TIFF0007749322000006.tif47170TIFF0007749322000007.tif207170TIFF0007749322000008.tif136170

[0063] Internal ribosome entry sequence Provided herein are gene therapy constructs useful for treating disorders, further comprising an internal ribosome entry sequence (IRES) to increase gene expression by bypassing a translation initiation bottleneck. Suitable internal ribosome entry sequences for optimizing expression for gene therapy include, but are not limited to, cricket paralysis virus (CrPV) IRES, picornavirus IRES, aphthovirus IRES, Kaposi's sarcoma-associated herpesvirus IRES, hepatitis A IRES, hepatitis C IRES, pestivirus IRES, Cripavirus IRES, Rhopalosiphum padi virus IRES, Marek's disease virus IRES, and other suitable IRES sequences. In some embodiments, the gene therapy construct comprises a CrPV IRES. In some embodiments, the CrPV IRES has the nucleic acid sequence AAAAATGTGATCTTGCTTGTAAATACAATTTTGAGAGGTTAATAAATTACAAGTAGTGCTATTTTTGTATTTAGGTTAGCTATTTAGCTTTACGTTCCAGGATGCCTAGTGGCAGCCCCACAATATCCAGGAAGCCCTCTCTGCGGTTTTTCAGATTAGGTAGTCGAAAAACCTAAGAAATTTACCTGCT (SEQ ID NO: 12). In some embodiments, the CrPV IRES sequence is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 12.

[0064] signal peptide In some embodiments, the gene therapy constructs provided herein further comprise a signal peptide that improves secretion of a therapeutic protein from cells transduced with the gene therapy construct. In some embodiments, the signal peptide improves protein processing of the therapeutic protein, promotes translocation of the nascent polypeptide-ribosome complex to the ER, and ensures proper co- and post-translational modifications. In some embodiments, the signal peptide is located (i) upstream of the signal translation initiation sequence, (ii) between the translation initiation sequence and the therapeutic protein, or (iii) downstream of the therapeutic protein. Signal peptides useful in gene therapy constructs include, but are not limited to, the binding immunoglobulin protein (BiP) signal peptide of the HSP70 protein family (e.g., HSPA5, heat shock protein family A member 5) and the Gaussia signal peptide, and variants thereof. These signal peptides have extremely high affinity for the signal recognition particle. Exemplary amino acid sequences of BiP and Gaussia are provided below in Table 5. In some embodiments, the signal peptide has an amino acid sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 13-17. In some embodiments, the signal peptide differs from a sequence selected from the group consisting of SEQ ID NOs: 13-17 by no more than 5 amino acids, no more than 4 amino acids, no more than 3 amino acids, no more than 2 amino acids, or no more than 1 amino acid. TIFF0007749322000009.tif78170

[0065] BiP signal peptide-signal recognition particle (SRP) interaction promotes translocation to the ER. This interaction is shown in Figure 20.

[0066] The Gaussia signal peptide is derived from Gaussia princeps luciferase and directs increased protein synthesis and secretion of a therapeutic protein fused to the signal peptide. In some embodiments, the Gaussia signal peptide has an amino acid sequence at least 90% identical to SEQ ID NO: 32. In some embodiments, the signal peptide differs from SEQ ID NO: 32 by no more than 5 amino acids, no more than 4 amino acids, no more than 3 amino acids, no more than 2 amino acids, or no more than 1 amino acid.

[0067] Linker In some embodiments, the gene therapy constructs provided herein include a linker between the targeting peptide and the therapeutic protein. In some embodiments, such a linker maintains proper spacing and reduces steric clashes between the vIGF2 peptide and the therapeutic protein. In some embodiments, the linker includes repeating glycine residues, repeating glycine-serine residues, and combinations thereof. In some embodiments, the linker is composed of 5-20 amino acids, 5-15 amino acids, 5-10 amino acids, 8-12 amino acids, or about 5, 6, 7, 8, 9, 10, 11, 12, or 13 amino acids. Suitable linkers for the gene therapy constructs provided herein include, but are not limited to, those provided in Table 6 below. TIFF0007749322000010.tif56170

[0068] Translation initiation sequence Gene therapy constructs provided herein include nucleic acids having a translation initiation sequence, such as a Kozak sequence, that aids in the initiation of mRNA translation. Kozak sequences contemplated herein have the consensus sequence (gcc)RccATGG (SEQ ID NO:27), where lowercase letters indicate the most common base at this position; this base is variable, and uppercase letters indicate highly conserved bases that vary only rarely. R indicates that a purine (adenine or guanine) is always observed at that position. Sequences in brackets (gcc) are of unknown significance. In some embodiments, the Kozak sequence comprises the sequence AX1X2ATGA (SEQ ID NO:28), where each of X1 and X2 is any nucleotide. In some embodiments, X1 comprises A. In some embodiments, X2 comprises G. In some embodiments, the Kozak sequence comprises a nucleic acid sequence at least 85% identical to AAGATGA (SEQ ID NO:29). In some embodiments, the Kozak sequence differs from the sequence of AAGATGA (SEQ ID NO:29) by one or two nucleotides. In some embodiments, the Kozak sequence provided herein has a sequence of AAGATGA (SEQ ID NO:29). In some embodiments, the Kozak sequence comprises a nucleic acid sequence at least 85% identical to GCAAGATG (SEQ ID NO:44). In some embodiments, the Kozak sequence differs from the sequence of GCAAGATG (SEQ ID NO:44) by one or two nucleotides. In some embodiments, the Kozak sequence comprises GCAAGATG (SEQ ID NO:44). In some embodiments, the Kozak sequence comprises a nucleic acid sequence at least 85% identical to CACCATG (SEQ ID NO:47). In some embodiments, the Kozak sequence differs from the sequence of CACCATG (SEQ ID NO:47) by one or two nucleotides. In some embodiments, the Kozak sequence comprises CACCATG (SEQ ID NO:47).

[0069] Therapeutic Proteins The gene therapy constructs provided herein comprise a nucleic acid encoding a therapeutic protein for treating a genetic disorder resulting from a genetic defect that results in the absence or incomplete expression of the protein in an individual. The therapeutic protein expressed from the gene therapy construct replaces the absent or incomplete protein. Thus, the therapeutic protein is selected based on the genetic defect requiring treatment in the individual. In some embodiments, the therapeutic protein is a structural protein. In some embodiments, the therapeutic protein is an enzyme. In some embodiments, the therapeutic protein is a regulatory protein. In some embodiments, the therapeutic protein is a receptor. In some embodiments, the therapeutic protein is a peptide hormone. In some embodiments, the therapeutic protein is a cytokine or chemokine.

[0070] In some embodiments, the gene therapy constructs herein encode an enzyme, such as an enzyme that is genetically deficient in an individual with a lysosomal storage disorder, hi some embodiments, the gene therapy construct encodes a lysosomal enzyme, e.g., a glycosidase, protease, or sulfatase. In some embodiments, the enzymes encoded by the gene therapy constructs provided herein include α-D-mannosidase; N-aspartyl-β-glucosaminidase; β-galactosidase; ceramidase; fucosidase; galactocerebrosidase; arylsulfatase A; N-acetylglucosamine-1-phosphotransferase; iduronate sulfatase; N-acetylglucosaminidase; acetyl-CoA:α-glucosaminide acetyltransferase; N-acetylglucosamine 6-sulfatase; β-glucuronidase; hyaluronidase; sialidase; sulfatase; sphingomyelinase; acid β-mannosidase; cathepsin K; 3-hexosaminidase A; β-hexosaminidase. Enzymes encoding the enzymes include, but are not limited to, α-glucosidase B, α-N-acetylgalactosaminidase, sialin, hexosaminidase A, β-glucosidase, α-iduronidase, α-galactosidase A, β-glucocerebrosidase, lysosomal acid lipase, glycosaminoglycan α-L-iduronohydrolase, iduronate-2-sulfatase, N-acetylgalactosamine-6-sulfatase, glycosaminoglycan N-acetylgalactosamine 4-sulfatase, α-glucosidase, heparan sulfamidase, gp-91 subunit of NADPH oxidase, adenosine deaminase, cyclin-dependent kinase-like 5, and palmitoylated protein thioesterase 1. In some embodiments, the enzyme encoded by the gene therapy constructs provided herein comprises α-glucosidase.In some embodiments, the therapeutic protein is associated with a genetic disorder selected from the group consisting of CDKL5 deficiency disorders, cystic fibrosis, alpha and beta thalassemia, sickle cell anemia, Marfan syndrome, fragile X syndrome, Huntington's disease, hemochromatosis, congenital deafness (asymptomatic), Tay-Sachs disease, familial hypercholesterolemia, Duchenne muscular dystrophy, Stargardt disease, Usher syndrome, choroideremia, color blindness, X-linked retinoschisis, hemophilia, Wiskott-Aldrich syndrome, X-linked chronic granulomatous disease, aromatic L-amino acid decarboxylase deficiency, recessive dystrophic epidermolysis bullosa, alpha 1-antitrypsin deficiency, Hutchinson-Gilford progeria syndrome (HGPS), Noonan syndrome, and X-linked severe combined immunodeficiency (X-SCID). In some embodiments, the therapeutic protein is selected from the group consisting of CDKL5, connexin 26, hexosaminidase A, LDL receptor, dystrophin, CFTR, beta-globin, HFE, huntingtin, ABCA4, myosin VIIA (MYO7A), Rab escort protein-1 (REP1), cyclic nucleotide-gated channel beta 3 (CNGB3), retinoschisin 1 (RS1), hemoglobin subunit beta (HBB), factor IX, WAS, cytochrome B-245 beta chain, dopa decarboxylase (DDC), type VII collagen alpha 1 chain (COL7A1), serpin family A member 1 (SERPINA1), LMNA, PTPN11, SOS1, RAF1, KRAS, and IL2 receptor gamma genes.

[0071] Examples of gene therapy vectors

[0072] Gene Therapy Vectors and Compositions Provided herein is a gene therapy vector in which a nucleic acid such as DNA encodes a therapeutic fusion protein, such as a vIGF2 fusion, optionally with a signal peptide. The gene therapy vector optionally contains an internal ribosome entry sequence. Vectors derived from retroviruses, such as lentiviruses, are suitable tools for achieving long-term gene transfer because they allow long-term stable integration of the transgene and its propagation in daughter cells. Compared with vectors derived from oncoretroviruses, such as murine leukemia viruses, lentivirus and adeno-associated virus vectors have the additional advantage that they can transduce non-proliferating cells, such as hepatocytes and neurons. They also have the additional advantage of low immunogenicity.

[0073] Exemplary gene therapy vectors herein encode therapeutic fusion proteins comprising a therapeutic protein and a vIGF2 peptide. Nucleic acids encoding the amino acid sequences of exemplary fusion proteins are provided in Table 7 below. TIFF0007749322000011.tif253170TIFF0007749322000012.tif253170TIFF0007749322000013.t if253170TIFF0007749322000014.tif253170TIFF0007749322000015.tif236170TIFF0007749322 000016.tif101170TIFF0007749322000017.tif245170TIFF0007749322000018.tif252170TIFF00 07749322000019.tif253170TIFF0007749322000020.tif253170TIFF0007749322000021.tif28170

[0074] In some embodiments, the vector containing the nucleic acid encoding the desired therapeutic fusion protein provided herein, such as a vIGF2 fusion or a signal peptide fusion, and optionally having an internal ribosome entry sequence, is an adeno-associated virus vector (A5 / 35).

[0075] In some embodiments, nucleic acids encoding a desired therapeutic fusion protein, such as a vIGF2 fusion, and optionally having an internal ribosome entry sequence, are cloned into a number of types of vectors. For example, in some embodiments, the nucleic acid is cloned into a vector, including, but not limited to, a plasmid, a phagemid, a phage derivative, an animal virus, and a cosmid. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.

[0076] Furthermore, in some embodiments, an expression vector encoding a therapeutic fusion protein, such as a vIGF2 fusion or a signal peptide fusion, and optionally having an internal ribosome entry sequence, is provided to cells in the form of a viral vector. Viral vector technology is described, for example, in Sambrook et al., 2012, Molecular Cloning: A Laboratory Manual, volumes 1-4, Cold Spring Harbor Press, NY, and other manuals on virology and molecular biology. Viruses useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses. In general, suitable vectors contain an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers (e.g., WO01 / 96584; WO01 / 29058; and U.S. Patent No. 6,326,193).

[0077] Also provided herein are compositions and systems for gene transfer. Numerous virus-based systems have been developed for gene transfer into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. In some embodiments, a selected gene is inserted into a vector using suitable technology and packaged into retroviral particles. The recombinant virus is then isolated and delivered to the subject's cells in vivo or ex vivo. Many retroviral systems are suitable for gene therapy. In some embodiments, adenoviral vectors are used. Many adenoviral vectors are suitable for gene therapy. In some embodiments, adeno-associated viral vectors are used. Many adeno-associated viruses are suitable for gene therapy. In one embodiment, a lentiviral vector is used.

[0078] Gene therapy constructs provided herein include vectors (or gene therapy expression vectors) into which a gene of interest has been cloned or which contain the gene of interest in such a manner that the nucleotide sequence of the vector allows for expression of the gene of interest (constitutive or regulated in some manner).Vector constructs provided herein include any suitable gene expression vector that can be delivered to a tissue of interest and provide expression of the gene of interest in a selected tissue of interest.

[0079] In some embodiments, the vector is an adeno-associated virus (AAV) vector due to its ability to cross the blood-brain barrier and transduce neural tissue. Any serotype of AAV is contemplated for use in the methods provided herein. In certain embodiments, the serotype of the viral vector used is selected from the group consisting of AAV1 vector, AAV2 vector, AAV3 vector, AAV4 vector, AAV5 vector, AAV6 vector, AAV7 vector, AAV8 vector, AAV9 vector, AAVrhS vector, AAVrh10 vector, AAVrh33 vector, AAVrh34 vector, AAVrh74 vector, AAV / Anc80 vector, AAVPHP.B vector, AAVhu68 vector, AAV-DJ vector, and others suitable for gene therapy.

[0080] AAV vectors are DNA parvoviruses that are non-pathogenic to mammals. Briefly, AAV-based vectors have the rep and cap viral genes, which account for 96% of the viral genome, removed, leaving two adjacent 145-bp inverted terminal repeats (ITRs) that are used to initiate viral DNA replication, packaging, and integration.

[0081] Further embodiments include the use of other serotype capsids to generate AAV1 vectors, AAV2 vectors, AAV3 vectors, AAV4 vectors, AAV5 vectors, AAV6 vectors, AAV7 vectors, AAV8 vectors, AAV9 vectors, AAVrhS vectors, AAVrh10 vectors, AAVrh33 vectors, AAVrh34 vectors, AAVrh74 vectors, AAV / Anc80 vectors, AAVPHP.B vectors, AAV-DJ vectors, and others suitable for gene therapy. Optionally, the AAV viral capsid is AAV2 / 9, AAV9, AAVrhS, AAVrh10, AAVAnc80, or AAVPHP.B.

[0082] Additional promoter elements, such as enhancers, regulate the frequency of transcription initiation. Typically, these are located 30–110 bp upstream of the start site, although many promoters have been shown to contain functional elements downstream of the start site. Often, the spacing between promoter elements is flexible, so that promoter function is maintained even when elements are inverted or moved relative to one another. In the thymidine kinase (tk) promoter, promoter elements can often be spaced up to 50 bp apart without attenuation of activity. Depending on the promoter, individual elements appear to activate transcription either cooperatively or independently.

[0083] An example of a promoter capable of expressing a therapeutic fusion protein or transgene, such as a vIGF2 fusion or a signal peptide fusion, optionally with an internal ribosome entry sequence in mammalian T cells is the EF1a promoter. The native EF1a promoter drives the expression of the α subunit of the elongation factor 1 complex, which is responsible for the enzymatic delivery of aminoacyl-tRNA to ribosomes. The EF1a promoter is widely used in mammalian expression plasmids and has been shown to be effective in driving expression from transgenes cloned into lentiviral vectors (see, for example, Milone et al., Mol. Ther. 17(8):1453-1464 (2009)). Another example of a promoter is the cytomegalovirus (CMV) immediate early promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high-level expression of any operably linked polynucleotide sequence. However, other constitutive promoter sequences are also optionally used, including, but not limited to, the chicken β-actin promoter, P546 promoter, simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, and human gene promoters such as the actin promoter, myosin promoter, elongation factor-1a promoter, hemoglobin promoter, and creatine kinase promoter. Furthermore, gene therapy vectors are not intended to be limited to the use of constitutive promoters. Inducible promoters are also contemplated herein. The use of an inducible promoter provides a molecular switch that can turn on expression of an operably linked polynucleotide sequence when such expression is desired or turn off expression when expression is not desired.Examples of inducible promoters include, but are not limited to, a metallothionein promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline-inducible promoter.

[0084] For the purpose of evaluating the expression of therapeutic fusion proteins, such as vIGF fusions or signal peptide fusions, optionally having an internal ribosome entry sequence or a portion thereof, the expression vector introduced into cells often contains a selectable marker gene or a reporter gene, or both, to facilitate the identification and selection of expressing cells from a population of cells to be transfected or infected with a viral vector. In other embodiments, the selectable marker is often carried on a separate DNA fragment and used in co-transfection procedures. Both the selectable marker gene and the reporter gene are optionally flanked by appropriate regulatory sequences to enable expression in the host cell. Useful selectable markers include, for example, antibiotic resistance genes, such as neo.

[0085] Methods and compositions for introducing and expressing genes in cells are suitable for the methods herein. With respect to expression vectors, the vectors are readily introduced into host cells, such as mammalian cells, bacterial cells, yeast cells, or insect cells, by any method known in the art. For example, the expression vectors are introduced into host cells by physical, chemical, or biological means.

[0086] Physical methods and compositions for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, gene gun, electroporation, etc. Methods for producing cells containing vectors and / or exogenous nucleic acids are suitable for the methods herein (see, for example, Sambrook et al., 2012, Molecular Cloning: A Laboratory Manual, volumes 1-4, Cold Spring Harbor Press, NY). One method for introducing polynucleotides into host cells is calcium phosphate transfection.

[0087] Chemical means and compositions for introducing polynucleotides into host cells include colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, nucleic acid-lipid particles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., artificial membrane vesicle). Other state-of-the-art methods for targeted delivery of nucleic acids are available, such as delivery of polynucleotides via targeted nanoparticles or other suitable submicron-sized delivery systems.

[0088] When a non-viral delivery system is utilized, an exemplary delivery vehicle is a liposome. The use of lipid formulations for the introduction of nucleic acids into host cells (in vitro, ex vivo, or in vivo) is contemplated. In another aspect, the nucleic acid is associated with a lipid. In some embodiments, the lipid-associated nucleic acid is encapsulated within the aqueous interior of the liposome, dispersed within the lipid bilayer of the liposome, attached to the liposome via a linking molecule associated with both the liposome and the oligonucleotide, entrapped within the liposome, complexed with the liposome, dispersed in a solution containing lipids, mixed with lipids, combined with lipids, contained in a lipid as a suspension, contained in or complexed with micelles, or otherwise associated with lipids. Lipid, lipid / DNA, or lipid / expression vector associated compositions are not limited to any particular structure in solution. For example, in some embodiments, they exist in a bilayer structure, as micelles, or as a "collapsed" structure. Alternatively, they are simply dispersed in the solution, possibly forming aggregates that are not uniform in size or shape. Lipids refer to fatty substances that, in some embodiments, are naturally occurring lipids or synthetic lipids. For example, lipids include the naturally occurring lipid droplets in cytoplasm, as well as classes of compounds that contain long-chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, aminoalcohols, and aldehydes.

[0089] Lipids suitable for use are obtained from commercial sources. For example, in some embodiments, dimyristyl phosphatidylcholine ("DMPC") is obtained from Sigma, St. Louis, Mo.; in some embodiments, diacetyl phosphate ("DCP") is obtained from K & K Laboratories (Plainview, NY); in some embodiments, cholesterol ("Chol") is obtained from Calbiochem-Behring; and dimyristyl phosphatidylglycerol ("DMPG") and other lipids are often obtained from Avanti Polar Lipids, Inc. (Birmingham, Ala.). Stock solutions of lipids in chloroform or chloroform / methanol are often stored at about -20°C. Chloroform is used as the sole solvent because it evaporates more readily than methanol. "Liposome" is a generic term that encompasses a variety of unilamellar and multilamellar lipid vesicles formed by the formation of closed lipid bilayers or aggregates. Liposomes are often characterized as vesicular structures with a phospholipid bilayer membrane and an internal aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous media. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement, followed by the formation of a closed structure, entrapping water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5:505-10). However, compositions with structures in solution that differ from the typical vesicular structure are also encompassed. For example, in some embodiments, lipids are in micellar structures or simply exist as heterogeneous aggregates of lipid molecules. Lipofectamine-nucleic acid complexes are also contemplated.

[0090] Regardless of the method used to introduce exogenous nucleic acid into host cells or to expose cells to therapeutic fusion proteins, such as the vIGF2 fusions or signal peptide fusions provided herein, optionally with internal ribosome entry sequences, various assays are contemplated to be performed to confirm the presence of the recombinant DNA sequence in the host cells. Such assays include, for example, "molecular biological" assays suitable for the methods herein, such as Southern and Northern blotting, RT-PCR, and PCR; "biochemical" assays, such as detecting the presence or absence of specific peptides by immunological means (ELISA and Western blot), or by the assays described herein to identify agents within the scope of the present invention.

[0091] The present disclosure further provides a vector comprising a nucleic acid molecule encoding a therapeutic fusion protein, such as a vIGF2 fusion or a signal peptide fusion, optionally having an internal ribosome entry sequence. In one aspect, the therapeutic fusion protein vector is capable of being directly transduced into a cell. In one aspect, the vector is a cloning vector or an expression vector, including, but not limited to, one or more plasmids (e.g., expression plasmids, cloning vectors, small circular DNAs, minivectors, double minute chromosomes), retroviral vector constructs, and lentiviral vector constructs. In one aspect, the vector is capable of expressing the vIGF2-therapeutic fusion protein construct in a mammalian cell. In one aspect, the mammalian cell is a human cell.

[0092] Methods of Use and Treatment Also provided herein are methods for treating genetic disorders using gene therapy, comprising administering to an individual a nucleic acid encoding a therapeutic fusion protein (e.g., a vIGF2 fusion or a signal peptide fusion or a signal peptide-vIGF2 fusion), optionally having an internal ribosome entry sequence, as disclosed herein. Genetic disorders suitable for treatment using the methods herein include disorders in individuals caused by one or more mutations in the genome that result in the lack of expression or expression of a dysfunctional protein by a mutated gene.

[0093] Also provided herein are pharmaceutical compositions for use in preparing a medicament for treating a genetic disorder, comprising a gene therapy vector, such as a gene therapy vector comprising a nucleic acid encoding a therapeutic fusion protein (e.g., a vIGF2 fusion or a signal peptide fusion or a signal peptide-vIGF2 fusion) disclosed herein, optionally having an internal ribosome entry sequence, and a pharmaceutically acceptable carrier or excipient.

[0094] Genetic disorders suitable for treatment by the methods herein include achondroplasia, alpha-1 antitrypsin deficiency, antiphospholipid syndrome, autosomal dominant polycystic kidney disease, Charcot-Marie-Tooth disease, colon cancer, cri-a-cat syndrome, Crohn's disease, cystic fibrosis, Dercum's disease, Duane's syndrome, Duchenne muscular dystrophy, Factor V Leiden thrombophilia, and the like. Thrombophilia), familial hypercholesterolemia, familial Mediterranean fever, fragile X syndrome, Gaucher disease, hemochromatosis, hemophilia, holoprosencephaly, Huntington's disease, Klinefelter syndrome, Marfan syndrome, myotonic dystrophy, neurofibromatosis, Noonan syndrome, osteogenesis imperfecta, Parkinson's disease, phenylketonuria, Poland syndrome, porphyria, progeria, retinitis pigmentosa, severe combined immunodeficiency (SCID), sickle cell disease, spinal muscular atrophy, Tay-Sachs disease, thalassemia, trimethylaminuria, Turner syndrome, palatocardiofacial syndrome, WAGR syndrome, or Wilson's disease. In some embodiments, the genetic disorder is selected from the group consisting of CDKL5 deficiency, cystic fibrosis, alpha and beta thalassemia, sickle cell anemia, Marfan syndrome, fragile X syndrome, Huntington's disease, hemochromatosis, congenital deafness (asymptomatic), Tay-Sachs disease, familial hypercholesterolemia, Duchenne muscular dystrophy, Stargardt disease, Usher syndrome, choroideremia, color blindness, X-linked retinoschisis, hemophilia, Wiskott-Aldrich syndrome, X-linked chronic granulomatous disease, aromatic L-amino acid decarboxylase deficiency, recessive dystrophic epidermolysis bullosa, alpha 1-antitrypsin deficiency, Hutchinson-Gilford progeria syndrome (HGPS), Noonan syndrome, and X-linked severe combined immunodeficiency (X-SCID).

[0095] In some embodiments, the genetic disorder suitable for treatment using the methods provided herein is a lysosomal storage disorder. In some embodiments, the lysosomal storage disorder is treated herein using gene therapy to deliver a missing or defective enzyme to a patient. In some embodiments, the methods herein deliver the enzyme fused to vIGF2 or a signal peptide to a patient to deliver the enzyme to cells where it is needed. In some embodiments, the lysosomal storage disorder is selected from the group consisting of aspartylglucosaminuria, Batten disease, cystinosis, Fabry disease, Gaucher disease type I, Gaucher disease type II, Gaucher disease type III, Pompe disease, Tay-Sachs disease, Sandhoff disease, metachromatic leukodystrophy, mucolipidosis type I, mucolipidosis type II, mucolipidosis type III, mucolipidosis type IV, Hurler disease, Hunter disease, Sanfilippo disease type A, Sanfilippo disease type B, Sanfilippo disease type C, Sanfilippo disease type D, Morquio disease type A, Morquio disease type B, Maroteaux-Lamy disease, Sly disease, Niemann-Pick disease type A, Niemann-Pick disease type B, Niemann-Pick disease type C1, Niemann-Pick disease type C2, Schindler disease type I, and Schindler disease type II. In some embodiments, the lysosomal storage disorder is activator deficiency, GM2 gangliosidosis; GM2 gangliosidosis AB variant; α-mannosidosis (type 2, moderate; type 3, neonatal, severe); β-mannosidosis; aspartylglucosaminuria; lysosomal acid lipase deficiency; cystinosis (late-onset juvenile or adolescent nephropathic; pediatric nephropathic); Shanarin-Dorfman syndrome; neutral lipid storage disease with myopathy; NLSDM; Danon disease; Fabry disease; Fabry disease Type II, late-onset; Farber disease; Farber lipogranulomatosis; fucosidosis; galactosialidosis (combined neuraminidase and β-galactosidase deficiency); Gaucher disease; Type II Gaucher disease; Type III Gaucher disease; Type IIIC Gaucher disease; atypical Gaucher disease, due to saposin C deficiency; GM1 gangliosidosis (late-onset infantile / juvenile GM1 gangliosidosis; adult / chronic GM1 gangliosidosis); globoid cell leukodystrophy, Krabbe disease (late-onset infantile; juvenile;Adult form); Krabbe disease, atypical, due to saposin A deficiency; Metachromatic leukodystrophy (juvenile; adult); Partial cerebroside sulfatase deficiency; Pseudoarylsulfatase A deficiency; Metachromatic leukodystrophy due to saposin B deficiency; Mucopolysaccharidosis disorders: MPS I, Hurler syndrome; MPS I, Hurler-Scheie syndrome; MPS I, Scheie syndrome; MPS II, Hunter syndrome; MPS II, Hunter syndrome; Sanfilippo syndrome type A / MPS IIIA; Sanfilippo syndrome type B / MPS IIIB; Sanfilippo syndrome type C / MPS IIIC; Sanfilippo syndrome type D / MPS IIID; Morquio syndrome type A / MPS IVA; Morquio syndrome type B / MPS IVB; MPS IX / hyaluronidase deficiency; MPS VI / Maroteaux-Lamy syndrome; MPS VII / Sly syndrome; mucolipidosis type I, sialidosis type II; I-cell disease, Leroy disease, mucolipidosis type II; pseudo-Hurler polydystrophy / mucolipidosis type III; mucolipidosis type IIIC / ML III gamma; mucolipidosis type IV; multiple sulfatase deficiency; Niemann-Pick disease (type B; type C1 / chronic neuropathic type; type C2; ​​type D / Nova) Scotian type; Neuronal ceroid lipofuscinosis: CLN6 disease (atypical late-onset infantile, late-onset variant, early juvenile); Batten-Spielmeyer-Vogt disease / juvenile NCL / CLN3 disease; Finnish variant late-onset infantile CLN5 disease; Jansky-Bielschowski disease / late-onset infantile CLN2 disease / TPP1 disease; Kuhus disease / adult NCL / CLN4 disease (type B); Northern epilepsy / late-onset infantile variant CLN8 disease; Santavuori-Haltia disease / infantile CLN1 disease / PPT disease; Pompe disease (Glycolic acidosis) Cogen storage disease type II); Late-onset Pompe disease; Pycnodysostosis; Sandhoff disease / GM2 gangliosidosis; Sandhoff disease / GM2 gangliosidosis; Sandhoff disease / GM2 gangliosidosis; Schindler disease (type III / intermediate, variable); Kanzaki disease; Salla disease; Infantile free sialic acid storage disease (ISSD); Spinal muscular atrophy with progressive myoclonic epilepsy (SMAPME); Tay-Sachs disease / GM2 gangliosidosis; Juvenile Tay-Sachs disease; Late-onset Tay-Sachs disease; Christianson syndrome;Lowe's oculocerebral renal syndrome; Charcot-Marie-Tooth disease type 4J, CMT4J; Yunis-Varon syndrome; bilateral temporo-occipital polymicrogyria (BTOP); X-linked hypercalciuric nephrolithiasis, Dent disease type 1; and Dent disease type 2. In some embodiments, the therapeutic protein is associated with a lysosomal storage disorder, and the therapeutic protein is selected from the group consisting of GM2-activating protein; α-mannosidase; MAN2B1; lysosomal β-mannosidase; glycosylasparaginase; lysosomal acid lipase; cystinosin; CTNS; PNPLA2; lysosomal-associated membrane protein 2; α-galactosidase A; GLA; acid ceramidase; α-L-fucosidase; defense protein / cathepsin A; acid β-glucosidase; GBA; PSAP; β-galactosidase-1; GLB1; galactosylceramide β-galactosidase; GALC; PSAP; arylsulfatase A; ARSA; α-L-isopropyl erythritol; The enzyme is selected from the group consisting of: duronidase; iduronate 2-sulfatase; heparan N-sulfatase; N-α-acetylglucosaminidase; heparan acetyl-CoA:α-glucosaminide acetyltransferase; N-acetylglucosamine 6-sulfatase; galactosamine-6-sulfate sulfatase; β-galactosidase; hyaluronidase; arylsulfatase B; β-glucuronidase; neuraminidase; NEU1; the gamma subunit of N-acetylglucosamine-1-phosphotransferase; mucolipin-1; sulfatase-modifying factor-1; acid sphingomyelinase; SMPD1; NPC1; and NPC2;

[0096] In some embodiments, treatment by the methods herein delivers a gene encoding a therapeutic protein to cells in need of the therapeutic protein. In some embodiments, treatment delivers the gene to all somatic cells of an individual. In some embodiments, treatment replaces a defective gene in targeted cells. In some embodiments, cells engineered ex vivo to express a therapeutic protein are delivered to an individual.

[0097] The gene therapy for disorders disclosed herein provides superior treatment results to conventional treatments, including enzyme replacement therapy, because it does not require prolonged infusion treatments, and it also reduces the risk of an individual developing an immune reaction to the therapeutic protein, which is often experienced by individuals undergoing enzyme replacement therapy.

[0098] definition As used herein, "ex vivo gene therapy" refers to a method in which a patient's cells are genetically modified outside of the subject, for example, to express a therapeutic gene. The cells with the new genetic information are then returned to the subject from which they originated.

[0099] As used herein, "in vivo gene therapy" refers to a method in which a vector carrying a therapeutic gene(s) is directly administered to a subject.

[0100] As used herein, "fusion protein" and "therapeutic fusion protein" are used interchangeably herein and refer to a therapeutic protein having at least one additional protein, peptide, or polypeptide linked to the therapeutic protein. In some instances, a fusion protein is a single protein molecule containing two or more proteins or fragments thereof covalently linked by peptide bonds in the respective peptide chains of the two or more proteins or fragments thereof without a chemical linker. In some embodiments, the fusion protein comprises a therapeutic protein and a signal peptide, a peptide that increases endocytosis of the fusion protein, or both. In some embodiments, the peptide that increases endocytosis is a peptide that binds to the CI-MPR.

[0101] As used herein, the terms "vector" and "gene therapy vector" are used interchangeably herein to refer to a gene therapy delivery vehicle or carrier that delivers a therapeutic gene to a cell. A gene therapy vector is any vector suitable for use in gene therapy, for example, any vector suitable for therapeutic delivery of a nucleic acid polymer (encoding a polypeptide or its variant) to a patient's target cell (e.g., a sensory neuron). In some embodiments, the gene therapy vector delivers a nucleic acid encoding a therapeutic protein or a therapeutic fusion protein to a cell where the therapeutic protein or fusion is expressed and secreted. The vector can be of any type, for example, the vector can be a plasmid vector or a small circular DNA. Typically, the vector is a viral vector. These include gene-disabled viruses such as adenoviruses and non-viral vectors such as liposomes. For example, viral vectors can be derived from adeno-associated viruses (AAV), retroviruses, lentiviruses, herpes simplex viruses, or adenoviruses. AAV-derived vectors. The vector can contain the AAV genome or its derivatives.

[0102] As used herein, a "construct" refers to a nucleic acid molecule or sequence that encodes a therapeutic protein or a fusion protein and optionally includes additional sequences such as a translation initiation sequence or an IRES sequence.

[0103] As used herein, "plasmid" refers to a circular, double-stranded unit of DNA that replicates within a cell independently of chromosomal DNA.

[0104] As used herein, "promoter" refers to a site on DNA to which the enzyme RNA polymerase binds and initiates transcription of DNA into RNA.

[0105] As used herein, "somatic therapy" refers to a method of manipulating gene expression in cells that is corrective to the patient but not inherited by future generations. Somatic cells include all non-reproductive cells of the human body.

[0106] As used herein, "somatic cells" refers to all cells of the body except germ cells.

[0107] As used herein, "tropism" refers to the selectivity of a vector, such as a virus, for a specific cell or tissue type. Various factors determine the ability of a vector to infect a specific cell. For example, a virus must bind to a specific cell surface receptor to enter a cell. Typically, if a cell does not express the required receptor, the virus cannot infect the cell.

[0108] The term "transduction" is used to refer to the administration / delivery of a nucleic acid encoding a therapeutic protein to a target cell either in vivo or in vitro by a replication-deficient rAAV of the present disclosure, resulting in expression of a functional polypeptide by the recipient cell. Transduction of a cell with a gene therapy vector, such as the rAAV of the present disclosure, results in sustained expression of the polypeptide or RNA encoded by the rAAV. Thus, the present disclosure provides methods for administering / delivering a gene therapy vector, such as an rAAV, encoding a therapeutic protein to a subject via intrathecal, intraretinal, intraocular, intravitreal, intracerebroventricular, intraparenchymal, or intravenous routes, or any combination thereof. "Intrathecal" delivery refers to delivery into the subarachnoid space of the brain or spinal cord. In some embodiments, intrathecal administration is by intracisternal administration.

[0109] The terms "recipient," "individual," "subject," "host," and "patient" are used interchangeably herein and, in some instances, refer to any mammalian subject, particularly humans, for whom diagnosis, treatment, or therapy is desired. A "mammal" for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, as well as laboratory, zoo, sport, or pet animals, such as dogs, horses, cats, cows, sheep, goats, pigs, mice, rats, rabbits, guinea pigs, monkeys, etc. In some embodiments, the mammal is a human.

[0110] As used herein, the terms "treatment," "treating," "ameliorating symptoms," and the like refer to administering an agent or performing a procedure with the intent of achieving a therapeutic effect, which in some instances includes inhibiting, attenuating, reducing, preventing, or altering at least one aspect or indicator of a disorder in a statistically significant or clinically significant manner. The terms "ameliorate" or "treat" do not state or imply a cure of the underlying condition. As used herein, "treatment" or "ameliorating" (and the like) can include treating a mammal, particularly a human, and can include (a) preventing a disorder or a symptom of a disorder from occurring in a subject who may be predisposed to, but has not yet been diagnosed with, the disorder (including, for example, a disorder that may be related to or caused by, a primary disorder); (b) inhibiting the disorder, i.e., suppressing its development; (c) alleviating the disorder, i.e., causing regression of the disorder; and (d) ameliorating at least one symptom of the disorder. Treating can refer to any indication of success in treating, improving, or preventing a disorder, including any objective or subjective parameter such as remission; a tendency toward remission; a decrease in symptoms or making the condition of the disorder more tolerable to the patient; a slowing down of the rate of degeneration or decay; or the final stage of degeneration becoming less debilitating.Treatment or improvement of symptoms is based on one or more objective or subjective parameters, including the results of a physician's examination.Therefore, the term "treating" includes the administration of a compound or agent of the present invention to prevent or delay, alleviate, or suppress or inhibit the onset of symptoms or conditions related to the disorder.The term "therapeutic effect" refers to the reduction, elimination, or prevention of the disorder, the symptoms of the disorder, or the secondary effects of the disorder in a subject.

[0111] The term "affinity" refers to the strength of binding between a molecule and its binding partner or receptor.

[0112] As used herein, the phrase "high affinity" refers to, for example, a therapeutic fusion containing such a peptide that binds to the CI-MPR having an affinity for the CI-MPR that is about 100-1,000-fold or 500-1,000-fold higher than the affinity for the CI-MPR of the therapeutic protein without the peptide. In some embodiments, the affinity is at least 100-fold, at least 500-fold, or at least 1,000-fold higher than without the peptide. For example, when the therapeutic protein and the CI-MPR are mixed at relatively equal concentrations, a high affinity peptide will bind to the available CI-MPR in a manner that shifts the equilibrium toward a higher concentration of the resulting complex.

[0113] As used herein, "secretion" refers to the release of a protein from a cell, for example, into the bloodstream for delivery to a tissue of interest or the site of action of the therapeutic protein. When gene therapy products are secreted into the interstitial space of an organ, secretion can allow for cross-complementation of adjacent cells.

[0114] As used herein, "delivery" refers to drug delivery. In some embodiments, the delivery process refers to the transport of a drug substance (e.g., a therapeutic protein or fusion protein produced from a gene therapy vector) from outside the cell (e.g., blood, tissue, or interstitial space) to a target cell for the drug substance's therapeutic activity.

[0115] As used herein, "modifying" or "protein modification" refers to the manipulation of the structure of a protein by providing an appropriate nucleic acid sequence encoding the protein, so as to result in the synthesis of a protein with desired properties or a particular structure.

[0116] In some instances, a "therapeutically effective amount" means the amount that, when administered to a subject for treating a disorder, is sufficient to effect treatment for that disorder.

[0117] As used herein, the term "about" a numerical value refers to a range ranging from 10% less than that numerical value to 10% more than that numerical value, including values ​​within that range, such as the numerical value itself.

[0118] As used herein, the term "comprising" one or more elements of a claim refers to those elements but does not exclude the inclusion of one or more additional elements. [Example]

[0119] The following examples are provided to illustrate various embodiments of the present invention and are not intended to limit the invention in any way. The examples of the present invention, together with the methods described herein, represent preferred embodiments and are exemplary and are not intended to limit the scope of the invention. Those skilled in the art will recognize modifications and other uses that are encompassed within the spirit and scope of the invention as defined by the claims.

[0120] Example 1: Binding of variant IGF2 peptides to the CI-MPR receptor Surface plasmon resonance (SPR) experiments were performed using Biacore to measure the binding of wild-type IGF2 and variant IGF2 (vIGF2) to the CI-MPR receptor. The wild-type human mature IGF2 peptide (wt IGF2) has the sequence set forth in SEQ ID NO: 1. The vIGF2 sequence differs from wt IGF2 in that it lacks residues 1-4 and contains the following mutations: E6R, Y27L, and K65R. vIGF2 has the following amino acid sequence: SRTLCGGELVDTLQFVCGDRGFLFSRPASRVSRRSRGIVEECCFRSCDLALLETYCATPARSE (SEQ ID NO: 31). vIGF2 also has an N-terminal linker with the sequence GGGGSGGGG (SEQ ID NO: 18). The linked sequence is GGGGSGGGGSRTLCGGELVDTLQFVCGDRGFLFSRPASRVSRRSRGIVEECCFRSCDLALLETYCATPARSE (SEQ ID NO: 43). Figure 4 shows that, as expected, the wild-type IGF2 peptide binds to the CI-MPR receptor with high affinity (0.2 nM). Figure 5 shows that the variant IGF2 peptide (vIGF2) also binds to the CI-MPR receptor with high affinity (0.5 nM). These data indicate that the vIGF2 peptide has high affinity for the CI-MPR receptor, which is intended for targeting therapeutic agents to the lysosome.

[0121] To assess potential side effects, SPR was used to measure peptide binding to the insulin receptor. Insulin binds to the insulin receptor with high affinity (approximately 8 nM; data not shown). Wild-type IGF2 and vIGF2 were tested, where vIGF2 had the sequence SRTLCGGELVDTLQFVCGDRGFLFSRPASRVSRRSRGIVEECCFRSCDLALLETYCATPARSE (SEQ ID NO: 31) and an N-terminal linker with the sequence GGGGSGGGG (SEQ ID NO: 18). Figure 8 shows that wild-type IGF2 also binds to the insulin receptor with relatively high affinity (approximately 100 nM). An IGF2 peptide derived from the Biomarin / Zystor IGF2-GAA fusion protein (BMN-701) also binds to the insulin receptor with high affinity and has been shown to cause hypoglycemia in clinical trials. Figure 9 shows no measurable binding of the vIGF2 peptide to the insulin receptor. These data indicate that the vIGF2 peptide confers a superior safety profile compared to the wt IGF2 peptide fusion.

[0122] Similar SPR binding analysis was used to characterize the interaction of the vIGF2 peptide with the IGF1 receptor. Figure 10 shows that the wild-type IGF2 peptide binds to the IGF1 receptor with relatively high affinity (approximately 100 nM). Figure 11 shows no measurable binding of the vIGF2 peptide to the IGF1 receptor, indicating an improved safety profile compared to wt IGF2. TIFF0007749322000022.tif42170

[0123] Example 2: vIGF2 converts low-affinity ligands into high-affinity ERTs for the CI-MPR To determine whether the vIGF2 peptide could improve affinity for the CI-MPR, we chemically conjugated the vIGF2 peptide (SEQ ID NO: 31) with an N-terminal linker (SEQ ID NO: 18) to alglucosidase-α (referred to herein as vIGF2-alglucosidase-α). As shown in Figure 6, we directly compared the binding affinities of alglucosidase-α and vIGF2-alglucosidase-α using a CI-MPR plate binding assay in a 96-well ELISA plate coated with CI-MPR. Unbound enzyme was washed away before measuring the activity of the bound enzyme. Different concentrations of both enzyme preparations were used with or without free WT IGF2 peptide. vIGF2 significantly improved affinity for the CI-MPR. Furthermore, vIGF2-alglucosidase-α binding was inhibited by free WT IGF2, indicating that binding was IGF2-dependent (data not shown). Binding of the vIGF2 peptide did not impair GAA enzyme activity.

[0124] vIGF2 was conjugated with recombinant human N-acetyl-α-D-glucosaminidase (rhNAGLU). To determine whether the peptide could convert a nonligand into a high-affinity ligand for the CI-MPR, we used rhNAGLU, a lysosomal enzyme lacking M6P. In this experiment, rhNAGLU and vIGF2-rhNAGLU were directly compared using a CI-MPR plate binding assay utilizing CI-MPR-coated plates. Unbound enzyme was washed away before measuring the activity of the bound enzyme. Different concentrations of both enzyme preparations were used with or without free vIGF2 peptide. As shown in Figure 7, vIGF2-rhNAGLU has significantly higher affinity for the CI-MPR than rhNAGLU lacking vIGF2. Furthermore, vIGF2-rhNAGLU binding was inhibited by free vIGF2 peptide, indicating that receptor binding was specific to the IGF2 peptide. These results indicate that the vIGF2 peptide can be used to improve drug targeting to lysosomes.

[0125] Example 3: Uptake of vIGF2-GAA fusion protein by myoblasts A vIGF2-GAA fusion protein (same sequence as in Examples 1-2) was administered, and the uptake of the enzyme by L6 myoblasts was measured. Figure 6 shows the superior uptake of vIGF2-rhGAA compared to rhGAA and M6P-GAA. Thus, vIGF2 is effective in targeting GAA to cells.

[0126] Example 4: Constructs for ERT delivered by gene therapy Two different constructs are shown in Figure 12. In the top panel is a construct encoding "native hGAA" (SEQ ID NO:45), which contains nucleic acid encoding recombinant human GAA with a Kozak sequence and native signal peptide (SEQ ID NO:45). In the middle panel is a construct encoding "modified hGAA" (SEQ ID NO:23), Kozak-BiP-vIGF2-2GS-GAA. This construct features nucleic acid encoding a Kozak sequence, a BiP signal peptide, a nucleic acid encoding a vIGF2 peptide having the sequence set forth in SEQ ID NO:31, and a 2GS linker (SEQ ID NO:18), followed by nucleic acid encoding recombinant human GAA with the N-terminal 60 amino acids removed to prevent premature processing and removal of vIGF2 (SEQ ID NO:46).

[0127] Example 5: Enhanced secretion of gene therapy constructs The modified hGAA is more secreted and can interact with cell surface receptors appropriate for cellular uptake and lysosomal targeting. CHO cells expressing modified hGAA or native hGAA, as described in more detail below, were cultured, and conditioned medium was collected for measurement of GAA activity. Figure 15 shows the relative activity of modified hGAA and native hGAA, indicating that the modified hGAA has increased activity compared to native hGAA, indicating more efficient secretion of the modified hGAA.

[0128] Example 6: Analysis of PPT1 in conditioned medium Cloning of PPT1 constructs PPT1 constructs were cloned into the pcDNA3.1 expression vector (ThermoFisher cat#V79020) containing a CMV promoter. Constructs tested included PPT1-1 (WT-PPT1) (SEQ ID NO: 24); PPT1-2 (WT-vIGF2-PPT1) (SEQ ID NO: 25); and PPT1-29 (BiP2aa-vIGF2-PPT1) (SEQ ID NO: 26).

[0129] Secretion and binding of PPT1 The PPT1 construct was transiently expressed in HEK293T cells for 3 days, and PPT1 was secreted into the culture medium. Secreted PPT1 was quantified by Western blotting, and binding to the CI-MPR was analyzed using established methods. Secreted PPT1 is shown in Figure 13. Binding to the CI-MPR is shown in Figure 14.

[0130] Example 7: Testing of gene therapy vectors in animal models of Pompe disease

[0131] Gene therapy for Pompe disease: Preclinical proof-of-concept study design

[0132] Preclinical studies were conducted in GAA knockout (GAA KO) mice using a high dose for an initial comparison of the constructs. The constructs are shown in Figure 12. Mice were administered vehicle or one of two constructs (native hGAA or modified hGAA). Mice were dosed at 5e11 gc / mouse (approximately 2.5e13 gc / kg). GAA knockout mice were used at 2 months of age. Normal (wild-type) mice were used as controls. A schematic of the study design is shown in Figure 16.

[0133] Pompe disease gene therapy: plasma

[0134] Plasma was collected from wild-type (normal) mice or GAA KO mice administered vehicle or gene therapy vector, as indicated, and GAA activity and cell surface binding were measured. The data are summarized in Figures 17, 27, and 19. Similar high GAA levels were observed in mice administered the gene therapy vector (Figures 17 and 18). However, greater receptor binding due to cell targeting was observed with the modified construct (Figure 19).

[0135] Pompe disease gene therapy: quadriceps

[0136] GAA activity and glycogen accumulation / cytoplasmic vacuolation were evaluated in normal (wild-type) and treated GAA KO mice (Figure 28). GAA activity in the quadriceps was approximately 20-fold higher than in wild-type mice. Glycogen (PAS) staining (Figure 29) and immunohistochemistry (Figure 30) were also evaluated. Immunohistology staining demonstrated higher lysosomal targeting of the modified hGAA compared to wild-type mice. Glycogen reduction was more consistent in the modified hGAA by PAS staining.

[0137] Pompe disease gene therapy: triceps

[0138] GAA activity and glycogen accumulation / cytoplasmic vacuolization were evaluated in normal (wild-type) and treated GAA KO mice (Figure 31). GAA activity was approximately 10-15 times higher than in wild-type mice. Immunohistochemical staining and glycogen (PAS) staining were also evaluated (Figures 32 and 33). Immunohistochemical staining demonstrated greater lysosomal targeting of the modified hGAA compared to wild-type GAA. Glycogen reduction, as measured by PAS staining, was more consistent in the modified hGAA.

[0139] Gene therapy for Pompe disease: tibialis anterior (Ta) muscle

[0140] GAA activity and glycogen accumulation / cytoplasmic vacuolization were evaluated in normal (wild-type) mice and treated GAA KO mice (Figure 20). GAA activity in TA was approximately 15-20 times higher than in wild-type mice. Immunohistochemical staining and glycogen (PAS) were also evaluated (Figures 21 and 22). Immunohistochemical staining demonstrated higher lysosomal targeting of the modified hGAA compared to wild-type GAA. Glycogen levels were close to wild-type levels. PAS staining revealed that glycogen reduction was more consistent in the modified hGAA.

[0141] Gene therapy for Pompe disease: Brain and spinal cord

[0142] GAA activity, glycogen content, and glycogen accumulation / cytoplasmic vacuolization were evaluated in normal (wild-type) and treated GAA KO mice (Figure 23). GAA activity in the brain was approximately 5-fold lower than in wild-type mice. Immunohistochemical staining and glycogen (PAS) were also evaluated (Figures 24, 25, 26, and 27). Immunohistochemical staining indicated that direct transduction of some cells may have occurred. However, little or no glycogen clearance was achieved with the native construct. With the modified construct, glycogen levels were close to wild-type levels, even though activity was only 20% of wild-type. PAS staining of the spinal cord demonstrated little or no glycogen clearance with the native construct. With the modified construct, glycogen levels close to wild-type were observed in the ventral horn, including motor neurons. Immunohistochemical staining demonstrated direct transduction in spinal neurons. The modified hGAA produced by the choroid plexus and nerve cells was able to reduce glycogen by cross-correction in the spinal cord, whereas almost no reduction in glycogen was observed with native hGAA.

[0143] conclusion

[0144] Overall, the data in this example demonstrate that the modified gene therapy construct dramatically improves tissue uptake and glycogen reduction compared to wild-type GAA used in conventional treatments, including effects in the brain and spinal cord.

[0145] Example 8: Animal Testing Protocol AAVhu68 vectors were produced and titered by the Penn Vector Core as described (Lock, Alvira et al. 2010, "Rapid, simple, and versatile manufacturing of recombinant adeno-associated viral vectors at scale." Hum Gene Ther 21(10):1259-1271).

[0146] Gaa knockout Pompe disease mice (Mus musculus) on a C57BL / 6 / 129 background were purchased from Jackson Labs (stock #004154, also known as 6neo mice).

[0147] 5 x 10 in 0.1 mL 11 GC (approx. 2.5×10 13 Mice administered 100 mg / kg (1000 ng / kg) of AAVhu68.CAG.hGAA (containing native hGAA (SEQ ID NO: 45) or modified hGAA (SEQ ID NO: 38)) via a lateral tail vein were bled for serum isolation on days 7 and 21 after vector administration, and a final blood draw (for plasma isolation) 28 days after injection, at which time the mice were euthanized by exsanguination. Tissues were harvested immediately afterward, starting with the brain.

[0148] GAA activity Plasma was mixed with 5.6 mM 4-MU-α-glucopyranoside (pH 4.0) and incubated at 37°C for 3 hours. The reaction was stopped with 0.4 M sodium carbonate (pH 11.5). Relative fluorescence units (RFU) were measured using a Victor3 fluorometer (excitation 355 nm and emission 460 nm). Activity in nmol / mL / hr was calculated by interpolation from the 4-MU standard curve. Activity in individual tissue samples was further normalized based on the total protein content in the homogenate.

[0149] GAA signature peptides by LC / MS Plasma was precipitated with 100% methanol and centrifuged. The supernatant was discarded. The pellet was spiked with a stable isotope-labeled hGAA-specific peptide as an internal standard, resuspended in trypsin, and incubated at 37°C for 1 hour. Digestion was stopped with 10% formic acid. Tryptic peptides were separated by C-18 reverse-phase chromatography and identified and quantified by ESI mass spectrometry. Total GAA plasma concentrations were calculated from the signature peptide concentrations.

[0150] Cell surface receptor binding assay A 96-well plate was coated with receptor, washed, and blocked with BSA. Day 28 plasma from AAV-treated mice was serially diluted to obtain a decreasing concentration series and incubated with the bound receptor. After incubation, the plate was washed to remove any unbound hGAA, and 4-MU-α-glucopyranoside was added for 1 hour at 37°C. The reaction was stopped with 1.0 M glycine (pH 10.5), and RFUs were read using a Spectramax fluorometer (excitation 370 nm and emission 460 nm). The RFUs of each sample were converted to activity (nmol / mL / hr) by interpolation from a 4-MU standard curve. Nonlinear regression was performed using GraphPad Prism.

[0151] Histological examination Tissues were formalin-fixed and paraffin-embedded. Muscle slides were stained with PAS, and CNS slides were stained with Luxol Fast Blue / Periodic Acid Schiff (PAS). A board-certified veterinary pathologist (JH) blindly evaluated the tissue slides. Semiquantitative estimates of the overall percentage of cells with glycogen accumulation and cytoplasmic vacuolation were performed on the examined slides. A score of 0 to 4 was assigned as described in the table below. TIFF0007749322000023.tif48170

[0152] Immunohistochemistry (IHC) We investigated the expression and cellular localization of the transgene by immunostaining slides using anti-human GAA antibody (Sigma HPA029126).

[0153] Example 9: Histological examination (tissue processing) protocol and results in an animal model of Pompe disease

[0154] All tissues were fixed in 10% NBF (Neutral Buffered Formalin). The assays (PAS and IHC) are routinely used in the field.

[0155] PAS staining of quadriceps and triceps muscles (Figures 29 and 32). Tissues were fixed in 10% NBF and embedded in paraffin. Sections were post-fixed in 1% periodic acid and stained with Schiff's reagent. Sections were then counterstained with hematoxylin. Glycogen appears as magenta aggregates (lysosome-associated) or dispersed pink (cytoplasmic), with nuclei in blue. Based on the images and assuming each is representative of the group, the rank order in terms of glycogen clearance is modified hGAA > native hGAA. The modified hGAA construct produced more image-wide staining compared to the rest, indicating improved endocytosis of the GAA protein mediated by binding of vIGF2 to the CI-MPR.

[0156] PAS staining of spinal cord (Figure 26). Tissues were fixed in 10% NBF. Post-fixation with 1% periodic acid could be performed before or after paraffin embedding. Sections were stained with Schiff's reagent and possibly counterstained with methylene blue. Glycogen appears as magenta aggregates (associated with lysosomes), and nerve fibers appear blue. Images focused on glycogen accumulation in the anterior horn and motor neurons of the spinal cord. The modified hGAA appeared to be the most effective among the constructs at reducing glycogen.

[0157] IHC of GAA (Figures 22, 25, 27, 30, and 35). Tissues were fixed in 10% NBF and embedded in paraffin. Sections were incubated with anti-GAA primary antibody, followed by a secondary antibody that recognizes the primary antibody and carries an enzyme tag, HRP. An enzymatic reaction was then performed, resulting in the formation of a brown precipitate. Sections were then counterstained with hematoxylin. The constructs showed GAA incorporation into muscle fibers (Figure 31). Modified hGAA > native hGAA. The BiP-vIGF2 construct had more dispersed staining throughout the image compared to the rest.

[0158] Compared to other vectors, the modified hGAA resulted in more GAA IHC signals with a punctate appearance within muscle fibers, indicating much more effective lysosomal targeting (Figure 22).

[0159] Overall, the modified hGAA consistently demonstrated superiority among constructs in tissue uptake, lysosomal targeting, and glycogen reduction in a variety of tissues.

[0160] While preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will readily occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments described herein may be used. The following claims define the scope of the invention, and it is intended that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims

1. (a) a therapeutic protein; (b) a variant IGF2 (vIGF2) peptide comprising the amino acid sequence of SEQ ID NO: 31; (c) a linker between the therapeutic protein and the vIGF2 peptide, and (d) a signal peptide selected from a binding immunoglobulin protein (BIP) signal peptide and a Gaussia signal peptide. A gene therapy vector comprising a nucleic acid construct encoding a polypeptide comprising: A gene therapy vector wherein the therapeutic protein is alpha-glucosidase (GAA).

2. 2. The gene therapy vector of claim 1, wherein the vIGF2 peptide has a reduced affinity for the insulin receptor and IGF1R compared to the native IGF2 peptide.

3. The gene therapy vector of claim 1 , wherein the vIGF2 peptide is capable of promoting uptake of the therapeutic protein into cells.

4. The gene therapy vector of claim 1 , wherein the vIGF2 peptide is capable of promoting uptake of the therapeutic protein into lysosomes.

5. 10. The gene therapy vector of claim 1, wherein the therapeutic protein is capable of replacing a defective or missing protein associated with a genetic disorder in a subject with the genetic disorder.

6. The gene therapy vector of claim 5, wherein the genetic disorder is a lysosomal storage disorder.

7. The genetic disorder is aspartylglucosaminuria, Batten disease, cystinosis, Fabry disease, Gaucher disease type I, Gaucher disease type II, Gaucher disease type III, Pompe disease, Tay-Sachs disease, Sandhoff disease, metachromatic leukodystrophy, mucolipidosis type I, mucolipidosis type II, mucolipidosis type III, mucolipidosis type IV, Hurler disease, Hunter disease, Sanfilippo disease type A, Sanfilippo disease type B, Sanfilippo disease type C, Sanfilippo disease type D, Sanfilippo disease type E, Sanfilippo disease type F, Sanfilippo disease type I, Sanfilippo disease type II, Sanfilippo disease type III, Sanfilippo disease type IV, Sanfilippo disease type F ...

6. The gene therapy vector of claim 5, wherein the gene therapy vector is selected from the group consisting of Lipoprotein D, Morquio disease, Morquio disease, Maroteaux-Lamy disease, Sly disease, Niemann-Pick disease, Niemann-Pick disease, Niemann-Pick disease, Niemann-Pick disease, C1, C2, Schindler disease, Schindler disease, Adenosine deaminase-deficient severe combined immunodeficiency (ADA-SCID), chronic granulomatous disease (CGD), and neuronal ceroid lipofuscinosis.

8. The gene therapy vector of claim 5 , wherein the genetic disorder is Pompe disease.

9. The gene therapy vector of claim 5 , wherein the genetic disorder is CLN1 disease.

10. The gene therapy vector of claim 1 , wherein the therapeutic protein comprises a soluble lysosomal enzyme or an enzymatically active fragment thereof.

11. The gene therapy vector of claim 1 , wherein the nucleic acid construct further comprises a translation initiation sequence.

12. The gene therapy vector of claim 1, wherein the nucleic acid construct further comprises a nucleic acid sequence encoding a signal peptide, the signal peptide being capable of increasing secretion of the therapeutic protein compared to the therapeutic protein without the signal peptide.

13. 13. The gene therapy vector of claim 12, wherein the signal peptide is selected from a binding immunoglobulin protein (BiP) signal peptide and a Gaussia signal peptide.

14. The gene therapy vector of claim 1 , wherein the construct comprises SEQ ID NO:

36.

15. The gene therapy vector of claim 1 , wherein the polypeptide comprises SEQ ID NO:

23.

16. The gene therapy vector of claim 1 , wherein the construct comprises SEQ ID NO:

38.

17. The gene therapy vector of claim 1 , wherein the vIGF2 peptide is fused to the N-terminus of a therapeutic protein.

18. The gene therapy vector of claim 1 , wherein the vIGF2 peptide is fused to the C-terminus of a therapeutic protein.

19. The gene therapy vector of claim 1, wherein the linker peptide comprises a sequence selected from the group consisting of SEQ ID NOs: 18-21 and SEQ ID NO:

33.

20. The gene therapy vector of claim 1 , wherein the linker peptide comprises the amino acid sequence of SEQ ID NO:

18.

21. The gene therapy vector of claim 1, wherein the gene therapy vector is a viral vector selected from the group consisting of an adenovirus vector, an adeno-associated virus (AAV) vector, a retrovirus vector, a lentivirus vector, a poxvirus vector, a vaccinia virus vector, an adenovirus vector, and a herpesvirus vector.

Citation Information

Patent Citations

  • protein expression system

    JP2007520200A

  • Novel signaling sequences that improve the protein expression and secretion of recombinant enzymes and other proteins.

    JP2014503198A

  • Targeted therapeutic lysosomal enzyme fusion proteins and uses thereof

    JP2016505539A

  • Chemical crosslinking agent

    JP2016515510A