Plants with altered flower color and method for producing same
By accumulating anthocyanidin pigments in plant petals through gene deletion and localization in the cytoplasm, the method achieves a significant shift from red to blue flower colors in Mandevilla plants, addressing the lack of blue flower varieties.
Patent Information
- Application Number
- JP2023170210
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2023-09-29
- Publication Date
- 2025-10-06
- Estimated Expiration
- 2043-09-29
AI Technical Summary
There is a need for developing plants with altered flower colors, particularly blue-colored Mandevilla plants, as existing methods primarily focus on white, pink, and red flower colors, with limited research on blue varieties.
A method involving the accumulation of anthocyanidin pigments in plant petals by partially deleting anthocyanidin-modifying enzyme genes, specifically targeting anthocyanidin glycosidase and/or anthocyanidin 3-glucoside glycosidase, and altering their promoter regions, such as those with sequences similar to SEQ ID NO: 1 and 3, to localize anthocyanidin pigments in the cytoplasm, thereby increasing their concentration to 30% or more of total cellular pigments.
This method enables the production of plants with significantly altered flower colors, notably shifting red flowers to blue by accumulating anthocyanidin pigments, as demonstrated in Mandevilla plants, using techniques like gamma irradiation and RNAi for gene deletion, and confirmed through HPLC and LC-MS analysis.
Smart Images

Figure 0007749630000005 
Figure 0007749630000006 
Figure 0007749630000007
Abstract
Description
[Technical Field]
[0001] The present invention relates to plants with altered flower color and methods for producing the same. [Background technology]
[0002] The flower industry strives to develop new and diverse varieties. One effective way to develop new varieties is to change flower color, and using classical breeding methods, most commercial varieties have been developed to exhibit a variety of flower colors.
[0003] A method for producing a plant with blue flower color has been reported so far, for example, in Patent Document 1. More specifically, the method of Patent Document 1 is a method for producing a plant with blue flower color, and is characterized by causing a delphinidin-type anthocyanin in which the 3' and 5' positions of the anthocyanin B ring are glycosylated to coexist with a flavone glycoside or a flavonol glycoside in plant cells.
[0004] Furthermore, Patent Document 2 discloses a novel Mandevilla plant having a flower color of a new tone that has not been produced before. More specifically, the novel Mandevilla plant of Patent Document 2 is a Mandevilla plant containing at least one type of carotenoid pigment in its petals, characterized in that the carotenoid pigment is neoxanthin or a derivative thereof. [Prior art documents] [Patent documents]
[0005] [Patent Document 1] International Publication No. 2017 / 169699 [Patent Document 2] Patent Publication No. 2021-175402 [Non-patent literature]
[0006] [Non-Patent Document 1] Tatsuzawa, F. et. al. Biochem. Systemat. Ecol. 99, 2021, 104347 [Non-patent document 2] Macz-Pop, GA et. al. Food Chem. 94, 2006, 448-456 [Non-patent document 3] Oyama, K. et. al. J. Agric. Food Chem. 63, 2015, 7630-7635 Summary of the Invention [Problem to be solved by the invention]
[0007] There remains a need for development of plants with altered flower color.
[0008] For example, until now, only varieties of Mandevilla plants have been known with white, pink, and red flower colors, and although Patent Document 2 provides new Mandevilla plants with colors containing carotenoid pigments, research on blue Mandevilla plants is still needed.
[0009] The present invention is intended to improve the above situation, and an object of the present invention is to provide a plant with altered flower color and a method for producing the same. [Means for solving the problem]
[0010] The present invention that achieves the above object is as follows.
[0011] <Aspect 1> A method for producing a plant, comprising: The method comprises accumulating anthocyanidin pigments in cells of petals of the plant in an amount of 30% by mass or more of the total amount of pigments present in the cells; and the flower color of the plant after accumulating the anthocyanidin pigment is compared with the flower color of the plant before accumulating the anthocyanidin pigment, * a* b * b in color space * The value of is decreasing. method. <Aspect 2> The method according to aspect 1, wherein the anthocyanidin pigment is accumulated by at least partially deleting an anthocyanidin-modifying enzyme gene. <Aspect 3> The method comprises deleting at least a portion of the promoter region of the anthocyanidin modifying enzyme gene; and The anthocyanidin modifying enzyme is selected from an anthocyanidin glycosidase gene and / or anthocyanidin 3-glucoside glycosidase. The method of embodiment 2. <Aspect 4> the anthocyanidin glycosidase is a galactosyltransferase; and In the promoter region of the galactosyltransferase gene, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 1, the sequence shown in SEQ ID NO: 2, and sequences having at least 90% identity thereto is deleted. The method of embodiment 3. <Aspect 5> the anthocyanidin 3-glucoside glycosidase is a xylosyltransferase; and At least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 3 and a sequence having at least 90% identity thereto is inserted into the promoter region of the xylosyltransferase gene. The method of embodiment 3. <Aspect 6> Aspect 6. The method according to any one of aspects 1 to 5, wherein the anthocyanidin pigment is cyanidin. <Aspect 7> Aspect 7. The method of any one of aspects 1 to 6, wherein the anthocyanidin pigment is localized in the cytoplasm of the cell. <Aspect 8> Aspect 8. The method according to any one of Aspects 1 to 7, wherein chlorogenic acid and aluminum ions are contained in cells of petals of the plant. <Aspect 9> Aspect 9. The method according to any one of Aspects 1 to 8, wherein the plant is at least one species selected from the group consisting of Apocynaceae plants, Solanaceae plants, Azollaceae plants, and Scrophulariaceae plants. <Aspect 10> Aspect 10. The method according to any one of aspects 1 to 9, wherein the plant is at least one species selected from the group consisting of plants of the genus Mandevilla, plants of the genus Petunia, and plants of the genus Torenia. <Aspect 11> 11. The method of claim 10, wherein the plant is a plant or a progeny thereof deposited at the National Institute of Technology and Evaluation, International Patent Organism Depositary (NITE-IPOD) under accession number FERM ABP-22483. <Aspect 12> In the cells of plant petals, The anthocyanidin pigment is accumulated in an amount of 30% by mass or more relative to the total amount of pigment present in the cells; and At least a portion of the anthocyanidin modifying enzyme gene is deleted. plant. <Aspect 13> 13. The plant of embodiment 12, wherein the anthocyanidin pigment is localized in the cytoplasm of the cell. <Aspect 14> The method comprises deleting at least a portion of the promoter region of the anthocyanidin modifying enzyme gene; and Aspect 14. The plant according to aspect 12 or 13, wherein the anthocyanidin-modifying enzyme is selected from anthocyanidin glycosidase and / or anthocyanidin 3-glucoside glycosidase. <Aspect 15> the anthocyanidin glycosidase is a galactosyltransferase; and In the promoter region of the galactosyltransferase gene, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 1, the sequence shown in SEQ ID NO: 2, and sequences having at least 90% identity thereto is deleted. 15. The plant of embodiment 14. <Aspect 16> the anthocyanidin 3-glucoside glycosidase is a xylosyltransferase; and In the promoter region of the xylosyltransferase gene, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 3 and a sequence having at least 90% identity thereto is inserted. 15. The plant of embodiment 14. <Aspect 17> 17. The plant according to any one of aspects 12 to 16, wherein the anthocyanidin pigment is cyanidin. <Aspect 18> 18. The plant according to any one of aspects 12 to 17, wherein chlorogenic acid and aluminum ions are contained in cells of petals of the plant. <Aspect 19> 19. The plant according to any one of aspects 12 to 18, wherein the plant is at least one species selected from the group consisting of plants of the Apocynaceae family, plants of the Solanaceae family, plants of the Apocynaceae family, and plants of the Scrophulariaceae family. <Aspect 20> 20. The plant according to any one of aspects 12 to 19, wherein the plant is at least one species selected from the group consisting of plants of the genus Mandevilla, plants of the genus Petunia, and plants of the genus Torenia. <Aspect 21> 21. The plant according to aspect 20, wherein the Mandevilla plant is a plant or a progeny thereof deposited at the National Institute of Technology and Evaluation, International Patent Organism Depositary (NITE-IPOD) under accession number FERM ABP-22483. <Aspect 22> 22. A progeny of the plant according to any one of embodiments 12 to 21. <Aspect 23> 22. Propagation material of the plant according to any one of aspects 12 to 21. <Aspect 24> A part, tissue or cell of the plant according to any one of aspects 12 to 21. [Effects of the Invention]
[0012] According to the present invention, a plant having a changed flower color can be provided. [Brief explanation of the drawings]
[0013] [Figure 1] FIG. 1 shows the results of pigment analysis in Example 1. [Figure 2] FIG. 2 shows the results of HPLC analysis in Example 1. [Figure 3] FIG. 3 is a diagram showing the results of the structural analysis in Example 2. [Figure 4] FIG. 4 shows the expression analysis of the galactosyltransferase gene and the xylosyltransferase gene in Example 3. [Figure 5] FIG. 5 shows the results of LC-MS analysis in Example 4. [Figure 6] FIG. 6 shows the results of extraction using various solvents in Example 5. [Figure 7] FIG. 7 shows the experiment of Example 6. [Figure 8] FIG. 8 shows the results of analysis and alignment of the nucleotide sequences of galactosyltransferase genes in Example 7. [Figure 9] FIG. 9 shows the results of analysis of the nucleotide sequences of xylosyltransferase genes and their alignment in Example 7. [Figure 10] FIG. 10 shows the design for creating the genetic markers in Example 7. [Figure 11] FIG. 11 shows the PCR amplification results in Example 7. [Figure 12] FIG. 12 shows the intracellular localization of the dye in Example 8. DETAILED DESCRIPTION OF THE INVENTION
[0014] DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be described in detail below with reference to the preferred embodiments. However, the present invention is not limited to the following embodiments, and various modifications can be made within the scope of the present invention.
[0015] <<Plant Creation Method>> The method for producing a plant of the present invention (hereinafter also referred to simply as the "method of the present invention") comprises: The method comprises accumulating anthocyanidin pigments in the cells of plant petals at 30% by mass or more of the total amount of pigments present in the cells; Compared to the flower color of plants before anthocyanidin pigments were accumulated, the flower color of plants after anthocyanidin pigments were accumulated was CIE L * a * b * b in color space * The value of is decreasing. method is.
[0016] There has been a technical idea of accumulating glycoside-form anthocyanin pigments and the like in petal cells, as described in the above-mentioned Patent Document 1. Furthermore, it is known that aglycone-form pigments are generally unstable and are stabilized in cells by undergoing modifications such as glycosylation and acylation. Therefore, there have been no reports of the technical idea of accumulating anthocyanidin pigments, i.e., aglycone-form pigments, in petal cells, nor have there been any reports of anthocyanidin pigments being accumulated in plant petal cells.
[0017] Therefore, the technical idea of the present invention, which is to accumulate anthocyanidin pigments in an amount of 30 mass% or more of the total amount of pigments present in the petal cells of a plant, is novel, and the results of Examples 1 to 8 described below suggest that the method of the present invention makes it possible to accumulate anthocyanidin pigments in the petal cells of a plant (particularly in the cytoplasm).
[0018] According to the method of the present invention, anthocyanidin pigments can be accumulated in plant petal cells at a concentration of 30% by mass or more relative to the total amount of pigment present in the cells. More specifically, the amount of accumulated anthocyanidin pigments can be 30% by mass or more, 35% by mass or more, 40% by mass or more, 45% by mass or more, 50% by mass or more, 55% by mass or more, 60% by mass or more, 65% by mass or more, 70% by mass or more, 75% by mass or more, 80% by mass or more, 85% by mass or more, 90% by mass or more, 95% by mass or more, 99% by mass or more, or approximately 100% by mass relative to the total amount of pigment present in the cells. The amount of accumulated anthocyanidin pigments and the total amount of pigment present in the cells can be determined, for example, by extracting pigments from freeze-dried petals with a mixture of trifluoroacetic acid and acetonitrile and performing HPLC analysis. More specifically, see Examples 1 and 2 described below.
[0019] Furthermore, in the present invention, the amount of anthocyanidin pigments in a plant after accumulation of the anthocyanidin pigments is not particularly limited, and may be, for example, 0.05 mg or more, 0.1 mg or more, 0.2 mg or more, 0.3 mg or more, 0.4 mg or more, 0.5 mg or more, 0.6 mg or more, 0.7 mg or more, 0.8 mg or more, 0.9 mg or more, 1.0 mg or more, 1.0 mg or more, 1.2 mg or more, 1.3 mg or more, 1.4 mg or more, 1.5 mg or more, or 2.0 mg or more, or 2.5 mg or less, 2.0 mg or less, 1.8 mg or less, 1.5 mg or less, or 1.1 mg or less, per 1 g of petals.
[0020] In the present invention, the indicator of change in flower color of a plant before and after accumulation of anthocyanidin pigments is CIE L * a * b * b in color space * More specifically, the flower color of a plant after accumulating anthocyanidin pigments can be evaluated by the CIE L * a * b * b in color space * It is sufficient that the value of decreases.
[0021] where CIE L * a * b * The color system is a color system standardized by the International Commission on Illumination (CIE) and is widely known as a method of expressing color tones. * a * b * ) color system. * a * b * In the color system, lightness is expressed as L * and chromaticity, which indicates hue and saturation, is expressed as a * and b * It is expressed as a * and b * indicates the color direction, and a * is red direction, -a * is the green direction, b * is the yellow direction, and -b * indicates the blue direction. * , a * and b * Each value of can be obtained from the tristimulus values X, Y, and Z using the following equations: L * = 116 (Y / Y0) 1 / 3 - 16; a * = 500 [(X / X0) 1 / 3 - (Y / Y0) 1 / 3 ]; and b * = 200 [(Y / Y0) 1 / 3 - (Z / Z0) 1 / 3 ] However, X / X 0、 Y / Y0 and Z / Z0 are > 0.008856, where X0, Y0, and Z0 represent the tristimulus values of the standard illuminant.
[0022] Also, CIE L * a * b * Color analysis using the color system can be easily performed using an integrating sphere type spectrocolorimeter, for example, a commercially available spectrophotometer (CM-2022, Konica Minolta).
[0023] According to the method of the present invention, this b * A decrease in the value of b means that the flower color of the plant after accumulating anthocyanidin pigments shifts to a bluer color. * The degree of decrease in the value is not particularly limited, and may be, for example, 5.0 or more, 10.0 or more, 15.0 or more, 20.0 or more, 25.0 or more, 30.0 or more, 35.0 or more, 40.0 or more, 45.0 or more, or 50.0 or more.
[0024] In the present invention, the flower color of the plant after the accumulation of anthocyanidin pigments is b * The value of b is not particularly limited, and may be, for example, 20.0 or less, 15.0 or less, 10.0 or less, 5.0 or less, 1.0 or less, or 0 or less. * The value of b may preferably be less than 0. * When the value of is less than 0, more specifically, the absolute value may be, for example, 1.0 or more, 5.0 or more, 10.0 or more, 15.0 or more, 20.0 or more, 25.0 or more, or 30.0 or more.
[0025] In one embodiment, according to the method of the present invention, when a Mandevilla plant having a red flower color is used, the flower color of the Mandevilla plant after accumulating anthocyanidin pigments is compared to the flower color (red) of the Mandevilla plant before accumulating anthocyanidin pigments, and the flower color of the Mandevilla plant after accumulating anthocyanidin pigments is CIE L * a * b * b in color space * The value of can be changed from "20.9" to "-30.9" decreasingly, that is, shifted to the blue side.
[0026] Plants that can be used in the method of the present invention are not particularly limited, and may be, for example, at least one species selected from the group consisting of plants of the Apocynaceae family, the Solanaceae family, the Linderniaceae family, and the Scrophulariaceae family.
[0027] Furthermore, plants applicable to the method of the present invention may be at least one species selected from the group consisting of Mandevilla plants, Petunia plants, and Torenia plants, but are not limited to these.
[0028] Generally, the red, blue, and purple flower colors found in plants are known to be derived from anthocyanin pigments. Anthocyanin pigments are formed when sugars are added to anthocyanidin (aglycone) pigments by glycosyltransferases or other enzymes.
[0029] In the present invention, an anthocyanidin pigment is an aglycone of an anthocyanin pigment, and has the structure of a compound represented by the following general formula (I): [ka] (In formula (I), R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , and R 7 may each independently be a hydrogen atom, an —OH group, or an —OCH group.
[0030] In general formula (I), anthocyanin pigments are classified into three types: pelargodinin, cyanidin, and delphinidin, depending on the number of hydroxy groups in the B ring of the anthocyanidin moiety. In addition, various anthocyanin pigments can exist depending on the type and number of sugars added to the A ring and the C ring of the anthocyanidin moiety.
[0031] In the method of the present invention, the anthocyanidin pigment may be cyanidin, which has the structure shown in formula (II): [ka]
[0032] In the method of the present invention, for example, when a Mandevilla plant with red flowers is used, it is preferable to accumulate cyanidin in the petal cells of the plant, which allows the flower color of the Mandevilla plant after accumulating cyanidin to change to blue compared to the flower color (red) of the Mandevilla plant before accumulating cyanidin.
[0033] In the present invention, anthocyanidin pigments may be localized in the cytoplasm of plant petal cells, and particularly may be localized in the cytoplasm of plant petal epidermal cells.In contrast, anthocyanin pigments are generally localized in the vacuole of petal cells.In addition, the intracellular localization location (i.e., the location where pigments exist) can be confirmed by, for example, preparing protoplasts from petals, and observing them with a phase-contrast microscope using a hemocytometer slide.
[0034] In the method of the present invention, anthocyanidin pigments can be accumulated in plant petal cells by at least partially deleting an anthocyanidin-modifying enzyme gene. Here, the anthocyanidin-modifying enzyme may be an enzyme that can modify anthocyanidins in the aglycone state, such as an enzyme that glycosylates anthocyanidins or an enzyme that acylates anthocyanidins.
[0035] In one embodiment of the present invention, the anthocyanidin-modifying enzyme may be selected from anthocyanidin glycosidase and / or anthocyanidin 3-glucoside glycosidase. In this case, in the method of the present invention, anthocyanidin pigments can be accumulated by at least partially deleting the anthocyanidin glycosidase gene and / or the anthocyanidin 3-glucoside glycosidase gene, and preferably, anthocyanidin pigments can be accumulated by at least partially deleting both the anthocyanidin glycosidase gene and the anthocyanidin 3-glucoside glycosidase gene.
[0036] Without being limited by theory, for example, by at least partially deleting the anthocyanidin glycosidase gene and the anthocyanidin 3-glucoside glycosidase gene in the cells of plant petals, anthocyanidin pigments cannot be converted to their glycosides, anthocyanins, and as a result, anthocyanidin pigments may accumulate. Note that the deletion sites of the anthocyanidin glycosidase gene and the anthocyanidin 3-glucoside glycosidase gene are not particularly limited and may be, for example, the respective promoter regions.
[0037] Furthermore, the deletion of an anthocyanidin modifying enzyme gene may be achieved using techniques conventional in the art, such as mutagenesis by irradiation with gamma rays, heavy ion beams, or the like, RNAi, genome editing, etc. More specifically, the deletion may be achieved by deleting, inserting, substituting, and / or adding at least a portion of the DNA sequence in the anthocyanidin modifying enzyme gene.
[0038] In the method of the present invention, the anthocyanidin glycosidase may specifically be, for example, a galactosyltransferase. The galactosyltransferase gene may have the DNA sequence shown in SEQ ID NO: 4 and the amino acid sequence shown in SEQ ID NO: 5. Furthermore, the anthocyanidin 3-glucoside glycosidase may specifically be, for example, a xylosyltransferase. The xylosyltransferase gene may have the DNA sequence shown in SEQ ID NO: 6 and the amino acid sequence shown in SEQ ID NO: 7.
[0039] For example, when cyanidin is treated with galactosyltransferase and xylosyltransferase, the cyanidin can undergo a two-step saccharification reaction to become the cyanidin glycoside shown in formula (III): In the first step, galactose is added to the 3-position of cyanidin by the galactosyltransferase to form cyanidin 3-galactoside. In the second step, xylose can be further added to cyanidin 3-galactoside by the xylosyltransferase.
[0040] [ka] (In formula (III), Gal represents galactose, and Xyl represents xylose.)
[0041] Furthermore, in the method of the present invention, when the anthocyanidin glycosyltransferase is a galactosyltransferase, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 1, the sequence shown in SEQ ID NO: 2, and sequences having at least 90% identity thereto may be deleted in the promoter region of the galactosyltransferase gene.
[0042] Furthermore, to identify whether a galactosyltransferase gene has a sequence deletion, PCR primers may be designed to span the deleted portion, compared to a gene without a deleted sequence. PCR is then performed using the designed primers, and if an amplified fragment of the desired length is obtained, the gene can be identified as having a deleted sequence.
[0043] In the method of the present invention, when the anthocyanidin 3-glucoside glycosidase is a xylosyltransferase, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 3 and sequences having at least 90% identity thereto may be inserted into the promoter region of the xylosyltransferase gene.
[0044] Furthermore, to identify whether a sequence has been inserted in a xylosyltransferase, PCR primers may be designed from the inserted portion, compared to a gene without an inserted sequence. PCR is then performed using the designed primers, and if an amplified fragment of the desired length is obtained, the sequence can be identified as having been inserted.
[0045] In the present invention, the term "identity" refers to the amount (number) of amino acid residues or bases that can be determined to be identical between two chains of a polypeptide sequence (or amino acid sequence) or a polynucleotide sequence (or base sequence) in terms of their matching relationship with each other, and refers to the degree of sequence correlation between two polypeptide sequences or two polynucleotide sequences, and "identity" can be easily calculated. Numerous methods for measuring identity between two polynucleotide or polypeptide sequences are known, and the term "identity" is well known to those skilled in the art (see, e.g., Lesk, AM (Ed.), Computational Molecular Biology, Oxford University Press, New York, (1988); Smith, DW (Ed.), Biocomputing: Informatics and Genome Projects, Academic Press, New York, (1993); Griffin, AM & Griffin, HG (Ed.), Computer Analysis of Sequence Data: Part I, Human Press, New Jersey, (1994); von Heinje, G., Sequence Analysis in Molecular Biology, Academic Press, New York, (1987); Gribskov, M. & Devereux, J. (Ed.), Sequence Analysis Primer, M-Stockton Press, New York, (1991)).
[0046] Furthermore, unless otherwise specified, the "identity" values described herein may be values calculated using identity search programs known to those skilled in the art, but are preferably values calculated using the ClustalW program in the MacVector application (version 9.5, Oxford Molecular Ltd., Oxford, England). In the present invention, the degree of "identity" between each sequence may be, for example, about 90% or more, 91% or more, 92% or more, 93% or more, or 94% or more, preferably 95% or more, more preferably 96% or more, even more preferably 97% or more, particularly preferably 98% or more, and most preferably 99% or more.
[0047] In the present invention, chlorogenic acid and aluminum ions may be contained in the petal cells of a plant. The presence of chlorogenic acid and aluminum ions can cause a stronger change in flower color due to the copigment effect. For example, when a Mandevilla plant with red flower color is used, the presence of chlorogenic acid and aluminum ions in the petal cells of the plant can cause the flower color of the Mandevilla plant after accumulating cyanidin to change more strongly to blue compared to the flower color (red) of the Mandevilla plant before accumulating cyanidin.
[0048] "plant" The present invention also provides a plant. The plant of the present invention comprises: In the cells of plant petals, The anthocyanidin pigment is accumulated at 30% by mass or more of the total amount of pigment present in the cell, and At least a portion of the anthocyanidin modifying enzyme gene is deleted. It is a plant.
[0049] The plant of the present invention may be produced by the method of the present invention described above. Therefore, for an explanation of the anthocyanidin-modifying enzyme, the description of the method of the present invention may be referred to as appropriate.
[0050] In addition, in the plant of the present invention, at least a portion of the promoter region of the anthocyanidin-modifying enzyme gene may be deleted. The anthocyanidin-modifying enzyme may be selected from anthocyanidin glycosidase and / or anthocyanidin 3-glucoside glycosidase. Furthermore, when the anthocyanidin glycosidase is a galactosyltransferase, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 1, the sequence shown in SEQ ID NO: 2, and sequences having at least 90% identity thereto may be deleted in the promoter region of the galactosyltransferase gene. Furthermore, when the anthocyanidin 3-glucoside glycosidase is a xylosyltransferase, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 3 and sequences having at least 90% identity thereto may be inserted in the promoter region of the xylosyltransferase gene.
[0051] The anthocyanidin pigment in the plant of the present invention may be localized in the cytoplasm of the cells of the plant's petals, and the anthocyanidin pigment in the plant of the present invention may be cyanidin.
[0052] The plant of the present invention may be at least one species selected from the group consisting of Apocynaceae plants, Solanaceae plants, Azollaceae plants, and Scrophulariaceae plants, and more specifically, may be at least one species selected from the group consisting of Mandevilla plants, Petunia plants, and Torenia plants.
[0053] The Mandevilla plant of the present invention can be produced from a Mandevilla plant deposited with the National Institute of Technology and Evaluation, International Patent Organism Depositary (NITE-IPOD) under accession number FERM ABP-22483 or its progeny using conventional plant breeding techniques. Such conventional techniques may include conventional propagation techniques such as vegetative propagation and seed propagation, as well as tissue culture techniques for culturing plant cells, tissues, or organs, and genetic recombination techniques for directly introducing useful traits. The Mandevilla plant of the present invention can typically be produced by vegetative propagation of a Mandevilla plant or its progeny deposited with the National Institute of Technology and Evaluation, International Patent Organism Depositary (NITE-IPOD) under accession number FERM ABP-22483 on September 22, 2023. "Vegetative propagation" can be achieved by techniques such as cuttings (including leaf cuttings), layering, stem laying (pressing method), division, grafting, etc., as well as clone seedlings created by tissue culture, but cuttings are particularly preferred.
[0054] "Cutting" is an asexual propagation method in which a part of a plant that does not have a stem or roots is cut off and trained to become an independent plant with a stem and roots. Depending on the part used, cuttings can be branch cuttings, trunk cuttings (stem cuttings), root cuttings, leaf cuttings, etc. Cuttings are typically performed by inserting a part of the branch or trunk (stem) of a parent plant into soil and leaving a part of it above ground. In the present invention, there are no particular limitations on the part used for "cutting."
[0055] Alternatively, cuttings may be taken from a Mandevilla plant or its progeny, which has been deposited with the National Institute of Technology and Evaluation (NITE-IPOD) under accession number FERM ABP-22483. "Mutation" refers to a phenomenon in which flowers, shoots, leaves, etc., on a single branch of a plant develop genetic traits that differ from those of the individual due to a mutation in the meristem, or to an individual that exhibits such a phenomenon. As the plant develops from the meristem to the next, the mutated part may be differentiated from the unmutated part and become fixed as a trait. Therefore, by taking cuttings from a branch of a mutant meristem bearing at least one altered flower, it is possible to create a new Mandevilla plant with other traits while maintaining a desired trait (e.g., blue flower color).
[0056] In another aspect, the present invention provides propagation materials (vegetative propagation materials such as cuttings, seeds, etc.), plant parts (flowers, stems, branches, leaves, roots, etc.), tissues, or cells of the above-mentioned Mandevilla plant or its progeny.
[0057] In a further aspect, the present invention provides a product derived from the Mandevilla plant or a descendant thereof, typically a potted plant, a cut flower, or a processed product made from the cut flower.
[0058] As used herein, the term "progeny" includes self- or allo-pollinated progeny of the Mandevilla plant deposited with the National Institute of Technology and Evaluation (NITE-IPOD) under accession number FERM ABP-22483, and includes not only the first generation but all generations of progeny of the Mandevilla plant deposited with the National Institute of Technology and Evaluation (NITE-IPOD) under accession number FERM ABP-22483. Furthermore, as used herein, the term "progeny" includes those derived from the parent Mandevilla plant based on conventional plant breeding techniques. For example, progeny may be derived from conventional propagation techniques such as vegetative propagation and seed propagation of the parent plant, tissue culture techniques for cultivating plant cells, tissues, or organs, or recombinant DNA techniques that can directly introduce useful traits, as well as mutants such as branch mutations of the parent Mandevilla plant. Preferably, such progeny possess desired characteristics derived from the parent Mandevilla plant. [Example]
[0059] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.
[0060] Example 1 In Example 1, the pigment compositions contained in the petal cells of the blue cultivar (MW65) of mandevilla with blue flower color, the red cultivar (173) of mandevilla with red flower color, and a hybrid (13918) of these mandevillas, all of which were owned by Suntory Flowers Ltd., were analyzed by HPLC. Here, the hybrid (13918) was bred using the blue cultivar (MW65) as the mother and a cultivar from a different lineage than the red cultivar (173) as the father.
[0061] In addition, the above varieties (blue varieties, red varieties, and their hybrids) are CIE L * a * b * The color analysis using the color system was carried out using a commercially available spectrophotometer (CM-2022, Konica Minolta). The results are shown in Table 1 below.
[0062] [Table 1]
[0063] Non-Patent Document 1 reports that cyanidin is the main anthocyanidin in the petal cells of plants of the genus Mandevilla. Therefore, the anthocyanin pigments in the petals of each of the above varieties (blue variety, red variety, and their hybrids) were analyzed as follows.
[0064] (test solution preparation) 4 mL of 0.1% TFA / 50% acetonitrile was added to 0.5 mg of each freeze-dried petal, and anthocyanin pigments were extracted for 20 minutes under ultrasound. The extract was analyzed directly by HPLC for glycoside analysis. For the analysis of aglycones excluding sugars, the extract was dried overnight in a desiccator, dissolved in 6N HCl, saponified in a boiling water bath for 20 minutes, extracted with amyl alcohol, and then analyzed by HPLC.
[0065] (HPLC analysis) The analytical equipment used was a Shimadzu Prominence HPLC system (LC-20AD, SIL-20AC, CBM-20A, CTO-20AC, SPD-M20A, SPD-20A). For glycoside analysis, an RSpak DE-413L (250 mm x 4.6 mm ID, Shodex) column was used. The LC mobile phases were 0.5% TFA / water for mobile phase A and 0.5% TFA-containing 50% CH3CN / water for mobile phase B. The binary gradient gradient was changed from 20% to 100% over 15 minutes, and then the mobile phase B concentration was kept at 100% for 10 minutes at a flow rate of 0.4 mL / min. For the analysis of aglycones, a YMC-Pack ODS-A column (150 mm x 6 mm ID, YMC) was used, and the LC mobile phase was acetic acid / methanol / water (15 / 17.5 / 67.5, vol / vol) at a flow rate of 1.0 mL / min. The peaks were identified and quantified using cyanidin, delphinidin, pelargonidin, malvidin, peonidin, and petunidin as standard substances.
[0066] As a result, as shown in Figure 1, it was found that cyanidin was the major anthocyanidin in both the blue variety (MW65) and the red variety (173) in the samples from which sugars had been removed by acid hydrolysis. This result is consistent with the report in Non-Patent Document 1.
[0067] Furthermore, as shown in Figure 2, in the analysis with sugar attached, specific high peaks (Peak A and Peak B) were detected in the red variety (173) and the blue variety (MW65), respectively. In the hybrid variety (13918), both peaks (Peak A and Peak B) were detected. In Example 2 described below, structural analysis was performed on these peaks.
[0068] Example 2 The structures of peaks A and B in the red variety (173) and blue variety (MW65) in Example 1 above were estimated by LC-MS.
[0069] Specifically, petal extracts were prepared using 5% AcOH, 50% MeCN-5% AcOH, and MeCN-5% AcOH. LC-MS experiments were performed using a Shimadzu LCMS-IT-TOF column (YMC-Triart C18, 3 μm, 2.1 x 100 mm, YMC). The LC mobile phases were 0.1% formic acid / water (mobile phase A) and 0.1% formic acid / acetonitrile (mobile phase B). A binary gradient gradient was run from 20% to 100% B over 15 min, followed by 100% B for 10 min at a flow rate of 0.4 mL / min. Anthocyanin peaks were extracted from the chromatogram at 530 nm, and structural analysis was performed based on MS and MS / MS spectra.
[0070] As a result, as shown in Figure 3, peak A of the red variety (173) was found to be cyanidin 3-O-[2-O-(xylosyl)-galactoside], as described in Non-Patent Document 1.
[0071] On the other hand, peak B of the blue variety (MW65) was surprisingly found to be completely unmodified cyanidin (aglycone) = anthocyanidin (Figure 3). There were almost no known examples of aglycones highly accumulating in plants, and this analytical result overturned conventional wisdom.
[0072] Furthermore, Non-Patent Document 2 reports that anthocyanidins accumulate in the pericarp of some kidney bean varieties, but the percentage is only 22%. In contrast, it was found that cyanidin, shown by Peak B, accumulated in the blue variety (MW65) at 70% by mass or more of the total amount of pigment in the cytoplasm and vacuoles of petal cells.
[0073] Example 3 In the blue cultivar (MW65), we believe that high accumulation of anthocyanidins is due to reduced expression or enzymatic activity in the petals of the galactosyltransferase gene and xylosyltransferase gene, which are thought to be necessary for the synthesis of cyanidin 3-O-[2-O-(xylosyl)-galactoside] from cyanidin aglycone.
[0074] Therefore, we first identified the galactosyltransferase and xylosyltransferase genes in Mandevilla as follows. Glycosyltransferase genes were compiled from the gene cluster deduced from the Mandevilla genome sequence, and the amino acid sequences of the proteins they encode were aligned with previously reported anthocyanidin glycosyltransferase sequences using ClustalW. A phylogenetic tree was then constructed using ETE3. From the resulting phylogenetic tree, we inferred genes that are likely orthologs of previously reported galactosyltransferase and xylosyltransferase genes in other plants. Expression analysis of these gene clusters was performed using RNA-seq and RT-PCR.
[0075] (RNA-seq method) After pretreatment with Fruit-mate for RNA Purification (Takara Bio), total RNA was extracted from mandevilla petals using RNeasy Plant mini (Qiagen). An MGIEeasy RNA Directional Library Prep Set (MGI) was used to prepare libraries for RNA-Seq. 150-base paired-end sequence data was obtained using the MGI DNBSeq-G400RS. After removing low-quality sequences and adapter sequences, the sequences were mapped to the reference sequence to calculate expression levels.
[0076] (Quantitative RT-PCR method) The total RNA was subjected to reverse transcription using ReverTra Ace (Toyobo) to prepare cDNA. Quantitative PCR was performed using PowerUp SYBR Green Master Mix (Applied Biosystems) and the StepOnePlus real-time PCR system (Applied Biosystems). Expression levels were calculated using the actin gene as an endogenous control.
[0077] As a result, as shown in Figure 4, both genes (galactosyltransferase gene and xylosyltransferase gene) were highly expressed in the red cultivar (173), but their expression was barely observed in the blue cultivar (MW65). This result is consistent with the idea that in blue mandevilla, most of the cyanidin exists in the aglycone form without being modified with sugars.
[0078] Example 4 Aglycones are generally unstable and are known to be stabilized intracellularly by modifications such as glycosylation and acylation. One possible explanation for the stabilization of highly accumulated cyanidin aglycones is the copigment effect (see, for example, Non-Patent Document 3). The copigment effect is well known in hydrangeas, where anthocyanins combine with substances such as flavones (which are mostly colorless or pale yellow) and metal ions in vivo to enhance the blue color. We used LC-MS to search for substances that may be one of the causes of blue flower development in a blue cultivar (MW65).
[0079] (LC-MS) Petal extracts were prepared using 5% AcOH, 50% MeCN-5% AcOH, and MeCN-5% AcOH. LC-MS experiments were performed using an LCMS-IT-TOF (Shimadzu) column with a YMC-Triart C18 (3 μm, 2.1 x 100 mm, YMC) column. The LC mobile phases were 0.1% formic acid / water (mobile phase A) and 0.1% formic acid / acetonitrile (mobile phase B). A binary gradient gradient was run from 20% to 100% B over 15 min, followed by 100% B for 10 min at a flow rate of 0.4 mL / min. A large peak was observed at around 6.3 min in the chromatogram at 325 nm for blue-hued Mandevilla. Structural analysis of this peak was performed based on MS and MS / MS spectra.
[0080] As a result, as shown in Figure 5, it was found that chlorogenic acid (3-CQA) accumulated at high concentrations in the blue cultivar (MW65). This suggests that chlorogenic acid (3-CQA) may contribute to the blue color of the blue cultivar (MW65).
[0081] Example 5 When 2 g of blue mandevilla flower petals were squeezed using a garlic press, red juice was obtained at pH 3.7 (see Figure 6(a)). This result suggests that cyanidin aglycone is red at low pH and that it may need to be localized in the cytoplasm to produce the blue color.
[0082] When the petals of the blue cultivar Mandevilla were treated with various solvents, all of the pigments were extracted into the methanol when extracted with amphiphilic methanol, turning the petals white and revealing that all of the pigments had been extracted (see Figure 6 (b)). This is thought to be due to the extraction of both cyanidin aglycone and glycoside, and the methanol containing the pigments turned blue.
[0083] On the other hand, when extraction was performed using the organic solvent hexane (hydrophobic), the hexane was colorless and transparent, but the petals turned red (see Figure 6 (c)). This is thought to be because the fat-soluble aglycone was extracted, but the glycoside remained, causing the petals to turn red.
[0084] Example 6 In vitro pigment reconstitution experiments were performed to observe color development under neutral conditions simulating the cytoplasmic environment. Cyanidin chloride (ChromaDex) and 3-O-Caffeoylquinic acid (Nagara Science) were dissolved in DMSO to a concentration of 10 mM. Reconstitution experiments using cyanidin alone were performed by adding the above cyanidin chloride solution to 50 mM phosphate buffer (pH 4.4-9.3) to a concentration of 0.5 mM, mixing, and allowing the mixture to react at room temperature. Reconstitution experiments using co-pigments and metal ions were performed by adding the above cyanidin chloride solution and 3-O-Caffeoylquinic acid solution to 50 mM phosphate buffer (pH 4.4-9.3) to a concentration of 0.5 mM, adding aluminum ion solution (1 mM ammonium aluminum sulfate solution) to a concentration of 0.1 mM, mixing, and allowing the mixture to react at room temperature (see the table in Figure 7).
[0085] As a result, it was observed that cyanidin aglycone alone produced a blue color at neutral pH (see Figure 7). This strongly suggests that when cyanidin aglycone is present in the cytoplasm, it can produce a blue color on its own without the action of copigments or metal ions.
[0086] Example 7 To create a marker specific to the blue variety (MW65), we analyzed the base sequences of the galactosyltransferase gene, xylosyltransferase gene, and their neighboring regions. The results revealed two deletions (16 bp and 30 bp) in the promoter region of the galactosyltransferase gene and a 173 bp insertion in the promoter region of the xylosyltransferase gene, both of which are specific to the blue variety (see Figures 8 and 9). Two sequences, paternally and maternal, were obtained from the red variety (173), and these were named 173-h1 and 173-h2, respectively. The galactosyltransferase gene of red variety 173-h1 has the sequence shown in SEQ ID NO: 8, and the galactosyltransferase gene of red variety 173-h2 has the sequence shown in SEQ ID NO: 9. The xylosyltransferase gene of red variety 173-h1 has the sequence shown in SEQ ID NO: 10, and the xylosyltransferase gene of red variety 173-h2 has the sequence shown in SEQ ID NO: 11.
[0087] For the galactosyltransferase gene, PCR primers were designed to span this deleted region (g21571-F7 (SEQ ID NO: 12): ACTGGCCTCGCCATTAACG, g21571-R5 (SEQ ID NO: 13): GTAATTTAATTAAGATGCGTAATTCTCTG) (see Figure 10).
[0088] Furthermore, for the xylosyltransferase gene, PCR primers were designed within this insert (g19028-F7 (SEQ ID NO: 14): AGTGTCTCTTCCTTAGTTCCTG, g19028-R5 (SEQ ID NO: 15): CTGAATTTTAAGAGATCGTTCATAATACG) (see FIG. 10).
[0089] DNA extracted from leaves of the blue variety (MW65), red variety (173), and hybrid variety (13918) using NucleoSpin Plant II (MACHEREY-NAAGEL) was used as a template for PCR using the primers described above. PCR was performed using Tks gflex DNA polymerase (Takara Bio) under the following conditions: 98°C for 15 seconds, 60°C for 20 seconds, and 68°C for 30 seconds (30 cycles).
[0090] As a result, a 122-bp amplified fragment was obtained for the galactosyltransferase gene in the blue cultivar (MW65) and the hybrid cultivar (13918), whereas no amplification was observed in the red cultivar (173) (see Figure 11(a)). A 121-bp amplified fragment was obtained for the xylosyltransferase gene in the blue cultivar (MW65) and the hybrid cultivar (13918), whereas no amplification was observed in the red cultivar (173) (see Figure 11(b)).
[0091] Thus, it was found that by performing PCR using these primers and examining whether an amplified fragment of the desired length was obtained, it was possible to easily distinguish the blue variety (MW65) and its progeny.
[0092] Example 8 To confirm the intracellular localization of the pigments, protoplasts were prepared from petals of the blue cultivar (MW65), red cultivar (173), and hybrid cultivar (13918), and the location of the pigments was confirmed.
[0093] Protoplasts were prepared as follows: 0.1 g of petal segments and 10 mL of enzyme solution (1% (w / v) Cellulase “ONOZUKA” RS (Yakult Pharmaceutical Co., Ltd.), 1% (w / v) Mecerozyme (Yakult Pharmaceutical Co., Ltd.), 180 mM KCl, 20 mM CaCl2, 20 mM MgCl2, pH 5.5) were added to a 100 mL Erlenmeyer flask and incubated for 90 minutes in an incubator at 30°C with reciprocal shaking at 40 mm amplitude and 50 strokes per minute. The mixture was then transferred to a 50 mL round-bottom glass centrifuge tube and centrifuged at 100 × g (730 rpm) for 2 minutes to precipitate the protoplasts. The precipitate was then gently suspended in the remaining solution using a pipette. 10 mL of 0.5 M mannitol was added to the suspension, which was then used as a sample for observation. The sample was placed on a hemocytometer slide and observed under a phase contrast microscope BX40 (Olympus).
[0094] In the red cultivar (173), the red pigment was uniformly distributed throughout the vacuoles (see Figure 12(a) and (b)), whereas in the blue cultivar (MW65), the cytoplasm, rather than the vacuoles, was observed to be stained blue, and blue granular structures were also occasionally observed (see Figure 12(e) and (f)).
[0095] Both states were observed in the hybrid (13918), with the vacuoles uniformly stained red, while blue granular structures were observed localized in the cytoplasm (see Figure 12 (c) and (d)). This revealed that cyanidin aglycone is localized in the cytoplasm, rather than in the vacuoles where glycosides are localized, and that it forms granular structures in some areas. This localization of the pigment in the cytoplasm is a previously unknown phenomenon and is thought to be a characteristic trait of the blue variety (MW65) and its progeny.
Claims
1. A method for producing a plant, comprising: The method comprises accumulating an anthocyanidin pigment in cells of petals of the plant in an amount of 30% by mass or more of the total amount of pigment present in the cells; and the flower color of the plant after accumulating the anthocyanidin pigment is compared with the flower color of the plant before accumulating the anthocyanidin pigment, * a * b * b in the color system * The value of decreases, The method includes at least partially deleting an anthocyanidin modifying enzyme gene to accumulate the anthocyanidin pigment, The method comprises: The method comprises deleting at least a portion of the promoter region of the anthocyanidin modifying enzyme gene; and the anthocyanidin-modifying enzyme is selected from anthocyanidin glycosidase and / or anthocyanidin 3-glucoside glycosidase; the anthocyanidin glycosidase is a galactosyltransferase; and In the promoter region of the galactosyltransferase gene, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 1, the sequence shown in SEQ ID NO: 2, and sequences having at least 90% identity thereto is deleted, the anthocyanidin 3-glucoside glycosidase is a xylosyltransferase, and Inserting at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 3 and a sequence having at least 90% identity thereto in the promoter region of the xylosyltransferase gene; The plant is a Mandevilla plant. method.
2. 2. The method of claim 1, wherein the anthocyanidin pigment is cyanidin.
3. 3. The method of claim 1 or 2, wherein the anthocyanidin pigment is localized in the cytoplasm of the cell.
4. The method according to claim 1 or 2, wherein chlorogenic acid and aluminum ions are contained in the cells of the petals of the plant.
5. The method according to claim 1, wherein the Mandevilla plant is a plant having accession number FERM BP-22483 deposited at the National Institute of Technology and Evaluation, International Patent Organism Depositary (NITE-IPOD) under accession number FERM ABP-22483, or a progeny thereof.
6. In the cells of plant petals, The anthocyanidin pigment is accumulated in an amount of 30% by mass or more relative to the total amount of pigment present in the cells; and At least a portion of the anthocyanidin modifying enzyme gene is deleted, The method comprises deleting at least a portion of the promoter region of the anthocyanidin modifying enzyme gene; and the anthocyanidin-modifying enzyme is selected from anthocyanidin glycosidase and / or anthocyanidin 3-glucoside glycosidase; the anthocyanidin glycosidase is a galactosyltransferase; and In the promoter region of the galactosyltransferase gene, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 1, the sequence shown in SEQ ID NO: 2, and sequences having at least 90% identity thereto is deleted; the anthocyanidin 3-glucoside glycosidase is a xylosyltransferase; and At least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 3 and a sequence having at least 90% identity thereto is inserted in the promoter region of the xylosyltransferase gene, The plant is a Mandevilla plant. plant.
7. The plant of claim 6 , wherein the anthocyanidin pigment is localized in the cytoplasm of the cell.
8. The plant of claim 6, wherein the anthocyanidin pigment is cyanidin.
9. The plant according to claim 6, wherein chlorogenic acid and aluminum ions are contained in the cells of the petals of the plant.
10. the Mandevilla plant is a plant having accession number FERM BP-22483, which has been deposited at the National Institute of Technology and Evaluation, International Patent Organism Depositary (NITE-IPOD) under accession number FERM ABP-22483, or a progeny thereof; In the progeny, anthocyanidin pigments are accumulated in the cells of the petals of the plant in an amount of 30% by mass or more of the total amount of pigments present in the cells, and at least a portion of the anthocyanidin modifying enzyme gene is deleted. The plant according to claim 6.
11. A progeny of the plant according to any one of claims 6 to 10, In the progeny, anthocyanidin pigments are accumulated in the cells of the petals of the plant in an amount of 30% by mass or more of the total amount of pigments present in the cells, and at least a portion of the anthocyanidin modifying enzyme gene is deleted. descendants.
12. Propagation material of the plant according to any one of claims 6 to 10, In the plant, anthocyanidin pigments are accumulated in the cells of the petals of the plant in an amount of 30% by mass or more of the total amount of pigments present in the cells, and at least a portion of anthocyanidin modifying enzyme genes is deleted. Breeding material.
13. A part, tissue or cell of the plant according to any one of claims 6 to 10, In the plant, anthocyanidin pigments are accumulated in the cells of the petals of the plant in an amount of 30% by mass or more of the total amount of pigments present in the cells, and at least a portion of anthocyanidin modifying enzyme genes is deleted. A part, tissue or cell of a plant.
Citation Information
Patent Citations
Method for bluing petal cell for creating blue flower
JP2010022365A
Plants with altered flower parts
JP2012511916A
Novel mandevilla plant and production method
JP2021175402A
Rose containing flavone and delphinidin, and method for production thereof
WO2008156214A1
Method for cultivating lilies containing delphinin in the petals thereof
WO2012036290A1