Development of yeast strains for ethanol production.

Abstract

Disclosed herein are yeast strains and derivatives thereof, as well as compositions comprising the yeast strains for use in ethanol production. The disclosure also relates to processes for producing ethanol from biomass using the yeast strains and compositions. In particular, the yeast strains produce less glycerol and more ethanol, and have higher temperature tolerance and faster fermentation rates than strains and products currently used in ethanol production processes.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 421,115, filed October 31, 2022, the entire contents of which are incorporated herein by reference in their entirety.

[0002] Reference to the array to enumerate This application has been filed in a Sequence Listing XML in ST.26 XML format in accordance with 37 CFR § 1.821. The Sequence Listing XML file submitted to the USPTO Patent Center, "211879-0001-WO01.xml," was created on October 31, 2023, contains four sequences, has a file size of 4.51 kilobytes, and is incorporated by reference in its entirety. [Background technology]

[0003]

[0003] The present disclosure relates to non-naturally occurring yeast strains and derivatives thereof, as well as compositions comprising the yeast strains for use in ethanol production. The disclosure also relates to processes for producing ethanol from biomass using the yeast strains and compositions. In particular, the yeast strains produce higher ethanol and lower glycerol than strains and products currently used in ethanol production processes, exhibit higher fructose utilization, higher temperature tolerance and organic acid tolerance, and faster fermentation rates.

[0004] Introduction Ethanol can be produced from biological organisms using different biochemical pathways specific to the organism. Ethanol produced from biological organisms is called bioethanol, thereby distinguishing it from ethanol produced by purely chemical methods. Bioethanol is produced commercially and can be used as a liquid fuel in internal combustion engines (fuel ethanol), as a component in industrial products (industrial ethanol), or as a building block in alcoholic beverages (drinking ethanol).

[0005]

[0005] Biological organisms such as yeast produce bioethanol from various biomass, including sucrose, also known as sugar. Selected yeasts are advantageous for ethanol production from sucrose because they can optimize the production process and profitability. In biomass containing sucrose, a dimer of the sugars glucose and fructose, yeast cells utilize enzymes located in the cell wall to hydrolyze sucrose into glucose and fructose, both of which can be converted to ethanol by the yeast. Glucose is preferred over fructose by yeasts such as Saccharomyces cerevisiae, which preferentially use it and release high concentrations of fructose outside the cell. Yeast often cannot utilize the fructose that remains outside the cell, and this fructose represents a potential loss of ethanol produced from sucrose by the yeast. High ethanol concentrations adversely affect the limited utilization of fructose by yeast. There is a need for Saccharomyces cerevisiae that can effectively utilize fructose during fermentation.

[0006]

[0006] By-product formation by yeast during fermentation (e.g., glycerol) reduces the potential ethanol yield from sugars due to their use as substrates. Glycerol is an important metabolite with a protective role against several types of stress and is important for maintaining intracellular redox balance under anaerobic fermentation conditions. Glycerol formation varies considerably among strains of Saccharomyces cerevisiae. It is particularly useful to use yeast for fermentation that exhibits relatively low glycerol production while maintaining good protection against stress. In particular, yeast that exhibit a high ethanol-to-glycerol ratio, which maximizes ethanol production from sugars, is needed.

[0007]

[0007] During the fermentation process, yeast encounters different environments and conditions that limit its ability to produce ethanol, such as the presence of inhibitors like organic acids. The concentration of organic acids during fermentation varies depending on contamination of the fermenter and feedstock with microbial contaminants that produce organic acids. As the pH decreases during fermentation due to the production of carbon dioxide and carbonic acid, the toxicity of organic acids to yeast increases. At low pH, organic acids are protonated and enter the yeast cell, where they then acidify the interior of the cell. Therefore, yeast that can tolerate high organic acid conditions and low pH during fermentation is needed.

[0008]

[0008] Metabolic activity in yeast during fermentation generates heat, which raises the temperature of the fermentation medium. High temperatures during fermentation are detrimental to ethanol production. In industrial ethanol fermentation, fermenters must be cooled to maintain the optimal temperature range for yeast ethanol fermentation. Cooling the fermenter adds significant cost to the fermentation process, especially in plants located in areas that experience high temperatures and humidity, such as tropical and subtropical regions. In geographic regions with high humidity and temperature, ethanol plants cool the fermenter with cooling systems based on evaporative cooling, making ethanol fermentation less efficient and reducing ethanol yield. Therefore, yeast that can withstand high fermentation temperatures during fermentation is also needed.

[0009]

[0009] Yeast in products used for commercial ethanol production require several characteristics, including adequate ethanol metabolic yield, adequate ethanol tolerance, acceptable by-product yield, adequate fermentation kinetics, the ability to consume fructose, organic acid tolerance, and temperature tolerance during fermentation. Yeasts of the genus Saccharomyces exhibit some, but not all, of these characteristics necessary for commercial ethanol production. Commercially available yeast products containing Saccharomyces include Ethanol Red® (Fermentis®), Thermosacc® (Lallemand®), Angel Super Alcohol® (Angel®), 46EDV (Lallemand®), Superstart® (Lallemand®), DistilaMax® CN (Lallemand®), PE-2 (Fermentec), CAT-1 (Fermentec), and Fali® M (AB Mauri®). Although commercially available yeast strains and products have advantageous characteristics for the production of ethanol, there is an increasing need to improve the efficiency of ethanol production to reduce production costs.

[0010]

[0010] Improved efficiency of ethanol production can be achieved by selecting among yeast strains that exhibit genetic and phenotypic diversity. The phenotype or traits of a particular yeast strain can be altered by changes in the yeast strain's genetic material, or genome. Changes in the yeast genome can be achieved by several means known in the art. One means by which the genome and phenotype of a yeast strain can be modified is by subjecting the yeast to directed evolution to generate non-naturally occurring yeast strains. Directed evolution utilizes naturally occurring mutations in the yeast's genetic material (DNA) or genome, which occur spontaneously in all organisms, including yeasts such as Saccharomyces cerevisiae. By selecting yeast for desired beneficial phenotypes that arise through spontaneous random mutations in the yeast DNA, evolved yeast strains not otherwise found in nature are generated. The genome of the evolved strain is differentiated from the original strain before undergoing directed evolution. This differentiation can be revealed by DNA sequencing of the yeast genome.

[0011]

[0011] Natural mutations in the genome can be increased by treating yeast cells with mutagens, which are chemical or physical agents that cause mutations in DNA. Such mutagens include, but are not limited to, ultraviolet light, X-rays, and ethyl methanesulfonate. Following treatment of yeast with mutagens, beneficial traits resulting from mutations in the yeast genome can be selected, similar to directed evolution. Mutagenesis of yeast followed by selection for beneficial traits generates additional diversity in yeast, from which traits advantageous for ethanol production can be derived. The yeast strains resulting from mutagenesis are genomically distinct from the original strain prior to mutagenesis and are non-naturally occurring yeast strains not found in nature.

[0012]

[0012] The genomic and phenotypic diversity of yeast can be further enhanced through sexual reproduction of yeast, including Saccharomyces cerevisiae. In sexual reproduction of yeast, a single diploid yeast cell undergoes the process of meiosis to produce genetically distinct haploid spores. Hybridization haploid spores, or self-crossing, obtained from a single parent diploid yeast cell results in the production of diploid progeny that are genetically distinct from the original diploid parent cell and are not otherwise found in nature. More advantageously, haploid spores that exhibit distinct characteristics can be mated to form genomically distinct progeny. Hybridization spores from two parents, called directed mating, produce progeny with high genomic diversity. Even more advantageously, spores from three or more parent cells can be randomly mated in a process known as mass mating. Mass mating produces several progeny that are all genomically distinct from the parent strain. Thus, sexual reproduction in yeast by self-crossing, directed mating, or population mating increases the available genomic and phenotypic diversity from which traits advantageous for ethanol production can be derived. Yeast strains derived from sexual reproduction are not otherwise found in nature.

[0013] The genetic diversity of yeast strains obtained through spontaneous mutation, artificial mutagenesis, and sexual reproduction can be assessed by a variety of methods. These include, but are not limited to, genetic marker analysis, polymerase chain reaction (PCR) amplification of microsatellite DNA, next-generation sequencing techniques, or a combination thereof. Microsatellite DNA is a genetic locus composed of tandem repeats of one to six bases. Some microsatellite DNA loci have a high degree of allelic polymorphism and can therefore be used as genetic markers to assess strain diversity in yeast. PCR assays designed to detect such polymorphisms can provide a means to rapidly distinguish between strains and assess their genotypes. Another, more advantageous method for investigating the genetic diversity of yeast strains is through whole-genome sequencing, which can provide information about single nucleotide polymorphisms and structural variations such as genomic insertions or deletions. Taken together, these approaches can be used to assess the genetic diversity of yeast strains obtained through directed evolution, mutagenesis, and sexual reproduction.

[0014]

[0014] Thus, a need exists for new and improved strains of the genus Saccharomyces that produce new and improved yeast products. Improved yeast strains and products should be capable of improving the efficiency of commercial ethanol production by providing increased sugar conversion to ethanol, increased temperature tolerance, increased tolerance to fermentation inhibitors, and faster fermentation kinetics than currently commercially used yeast strains and products. There is also a need for increased genomic and phenotypic diversity in yeast strains through mutation or sexual reproduction to increase the number of yeasts exhibiting improved traits. Summary of the Invention [Means for solving the problem]

[0015]

[0015] In one aspect, the present disclosure relates to a non-naturally occurring yeast strain of Saccharomyces selected from (a) Saccharomyces strain Y2083, a representative sample of strains deposited under NRRL Patent Deposit Designation No. Y-68182; (b) Saccharomyces strain Y2084, a representative sample of strains deposited under NRRL Patent Deposit Designation No. Y-68183; (c) Saccharomyces strain Y2086, a representative sample of strains deposited under NRRL Patent Deposit Designation No. Y-68184; and (d) Saccharomyces strain Y2087, a representative sample of strains deposited under NRRL Patent Deposit Designation No. Y-68185.

[0016]

[0016] In a further aspect, the present disclosure relates to non-naturally occurring derivatives of a non-naturally occurring Saccharomyces yeast strain selected from (a) Saccharomyces strain Y2083, which is a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68182; (b) Saccharomyces strain Y2084, which is a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68183; (c) Saccharomyces strain Y2086, which is a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68184; and (d) Saccharomyces strain Y2087, which is a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68185.

[0017] In one embodiment, the yeast strain or derivative comprises one or more distinct characteristics selected from: (a) a higher ethanol yield than Saccharomyces strain Y1027 under the same fermentation conditions; (b) a higher temperature tolerance compared to Saccharomyces strain Y1027; (c) a higher fructose utilization than Saccharomyces strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio than Saccharomyces strain Y1027 under the same fermentation conditions; (e) a higher organic acid tolerance compared to Saccharomyces strain Y1027 under the same fermentation conditions; and (f) a faster fermentation rate compared to Saccharomyces strain Y1027 under the same fermentation conditions. In another embodiment, the yeast strain or derivative has an ethanol yield that is at least about 3.3% higher than Saccharomyces cerevisiae strain Y1027 after 48 hours of fermentation. In another embodiment, the yeast strain or derivative has at least about 5% higher fructose utilization than Saccharomyces cerevisiae strain Y1027 after 48 hours of fermentation. In another embodiment, the yeast strain or derivative has at least about 11% higher ethanol to glycerol ratio than Saccharomyces cerevisiae strain Y1027 after 48 hours of fermentation. In another embodiment, the yeast strain or derivative has at least about 1.5% higher fermentation rate than Saccharomyces cerevisiae strain Y1027 after 24 hours of fermentation. In another embodiment, the yeast strain or derivative has higher temperature tolerance during fermentation than Saccharomyces cerevisiae strain Y1027 at fermentation temperatures ranging from 33°C to 38°C. In another embodiment, the fermentation temperature is 33°C. In another embodiment, the fermentation temperature is 38°C. In another embodiment, the yeast strain or derivative has higher organic acid tolerance compared to Saccharomyces cerevisiae strain Y1027 when the fermentation pH decreases from about 4.9 to about 4.0 with increasing amounts of organic acid in the fermentation medium. In another embodiment, the organic acid in the fermentation medium comprises 0.36% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.9. In another embodiment, the organic acid comprises lactic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, or a combination thereof.

[0018] Another aspect of the present disclosure is a method for producing a derivative of a yeast strain of the genus Saccharomyces described herein, comprising: (1) (a) (i) a first yeast strain selected from Saccharomyces sensu Y2083, Y2084, Y2086, Y2087, and derivatives thereof; and (ii) a Saccharomyces sensu (b) inducing sporulation of the first yeast strain and the second yeast strain; (c) screening and selecting spores from the first yeast strain and spores from the second yeast strain; (d) crossing spores of the selected first yeast strain with spores of the selected second yeast strain; and (e) screening or selecting derivative strains; or (2)(a)(i) a first yeast strain selected from Saccharomyces sensu Y2083, Y2084, Y2086, Y2087, and derivatives thereof; and (ii) Saccharomyces sensu (b) providing one or more additional yeast strains of the S. stricto clade; (b) inducing sporulation of the first yeast strain and the one or more additional yeast strains to produce spores; (c) mixing all of the spores of step (b) to allow spore hybridization; and (d) screening or selecting derivative strains. In one embodiment, step (1)(c) comprises screening or selecting spores that exhibit one or more distinctive characteristics of Saccharomyces strains Y2083, Y2084, Y2086, Y2087, or derivatives thereof, and step (1)(e) comprises screening or selecting hybrids that exhibit one or more distinctive characteristics of Saccharomyces strains Y2083, Y2084, Y2086, Y2087, or derivatives thereof. In another embodiment, step (2)(d) comprises screening or selecting hybrids that exhibit one or more defining characteristics of Saccharomyces strain Y2083, Y2084, Y2086, or Y2087.

[0019] Another aspect of the present disclosure provides mutant yeasts of the yeast strains described herein or derivatives described herein.

[0020] Another aspect of the present disclosure provides a method of producing a mutant yeast described herein, wherein the mutant yeast is mutated by contacting the yeast strain with a mutagen. In one embodiment, the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methyl methanesulfonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3-(ethyl-2-chloroethyl)aminopropylamino]acridine 2 (ICR-170), or nitrogen mustard.

[0020]

[0021] Another aspect of the present disclosure provides a method of producing a mutant yeast described herein, wherein the mutant yeast is mutated by contacting the derivative with a mutagen. In one embodiment, the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methyl methanesulfonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3-(ethyl-2-chloroethyl)aminopropylamino]acridine 2 (ICR-170), or nitrogen mustard.

[0021]

[0022] Another aspect of the present disclosure provides evolved yeast strains of the yeast strains described herein or derivatives described herein.

[0023] Another aspect of the present disclosure provides a method of producing an evolved yeast as described herein, wherein the evolution is induced by applying selective pressure to the yeast strain.

[0022]

[0024] Another aspect of the present disclosure provides a method of producing an evolved yeast as described herein, wherein evolution is induced by applying selective pressure to a derivative.

[0025] Another aspect of the present disclosure provides a genetically modified yeast of the yeast strain described herein or a derivative described herein. In one embodiment, the nucleic acid sequence of the genetically modified yeast is altered using gene editing.

[0023]

[0026] Another aspect of the present disclosure provides a recombinant yeast of the yeast strain described herein or a derivative described herein, in one embodiment, the recombinant yeast comprises a modification that silences expression of a gene, enhances expression of a gene, introduces a gene, or deletes a gene.

[0024]

[0027] Another aspect of the present disclosure provides a process for producing ethanol from a substrate by contacting the substrate with a fermenting organism, wherein the fermenting organism is selected from (a) Saccharomyces sp. strain Y2083, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68182, or a derivative thereof; (b) Saccharomyces sp. strain Y2084, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68183, or a derivative thereof; (c) Saccharomyces sp. strain Y2086, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68184, or a derivative thereof; or (d) Saccharomyces sp. strain Y2087, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68185, or a derivative thereof. In one embodiment, the substrate comprises or is derived from sugarcane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof. In another embodiment, the yeast comprises one or more distinguishing characteristics selected from: (a) a higher ethanol yield than Saccharomyces strain Y1027 under the same fermentation conditions; (b) a higher temperature tolerance compared to Saccharomyces strain Y1027; (c) a higher fructose utilization than Saccharomyces strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio than Saccharomyces strain Y1027 under the same fermentation conditions; (e) a higher organic acid tolerance compared to Saccharomyces strain Y1027 under the same fermentation conditions; and (f) a faster fermentation rate compared to Saccharomyces strain Y1027 under the same fermentation conditions. In another embodiment, the yeast has a higher temperature tolerance during fermentation than Saccharomyces cerevisiae strain Y1027 at a fermentation temperature ranging from 33° C. to 38° C. In another embodiment, the fermentation temperature is 33° C. In another embodiment, the fermentation temperature is 38° C. In another embodiment, the yeast has a higher organic acid tolerance than Saccharomyces cerevisiae strain Y1027 in a fermentation medium at a pH that decreases from about 4.9 to about 4.0 in the presence of increasing organic acids. In another embodiment, the organic acids in the fermentation medium include 0.36% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.9.In another embodiment, the organic acids in the fermentation medium comprise 0.9% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.2. In another embodiment, the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof. In another embodiment, the ethanol is produced using starch. In another embodiment, simultaneous saccharification and fermentation (SSF) or continuous fermentation is used to produce ethanol. In another embodiment, the ethanol is produced using sugars. In another embodiment, batch fermentation or continuous fermentation is used to produce ethanol. In another embodiment, the ethanol is produced using lignocellulosic sugars. In another embodiment, simultaneous saccharification and fermentation (SSF) or separate hydrolysis and fermentation (SHF) is used to produce ethanol.

[0025]

[0028] Another aspect of the present disclosure provides a composition comprising a yeast strain described herein or a derivative described herein and one or more components selected from surfactants, emulsifiers, gums, sweeteners, protectants, and antioxidants. In one embodiment, the composition comprises one or more distinct characteristics selected from: (a) a higher ethanol yield than Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (b) a higher temperature tolerance compared to Saccharomyces cerevisiae strain Y1027; (c) a higher fructose utilization rate than Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (e) a higher organic acid tolerance compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; and (f) a faster fermentation rate compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions. In another embodiment, the yeast has a higher temperature tolerance than Saccharomyces cerevisiae strain Y1027 at 33°C to 38°C. In another embodiment, the temperature is 33°C. In another embodiment, the temperature is 38°C. In another embodiment, the yeast has a higher organic acid tolerance than Saccharomyces cerevisiae strain Y1027 at a pH that decreases from about 4.9 to about 4.0 in the presence of increasing amounts of organic acid. In another embodiment, the organic acid comprises 0.36% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.9. In another embodiment, the organic acid comprises 0.9% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.2. Another aspect of the present disclosure provides a process for producing ethanol from biomass by contacting the biomass with a composition described herein. In one embodiment, the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof. In another embodiment, the ethanol is produced using starch. In another embodiment, simultaneous saccharification and fermentation (SSF) or continuous fermentation is used to produce ethanol. In another embodiment, ethanol is produced using sugars. In another embodiment, batch fermentation or continuous fermentation is used to produce ethanol. In another embodiment, ethanol is produced using lignocellulosic sugars.In another embodiment, simultaneous saccharification and fermentation (SSF) or separate hydrolysis and fermentation (SHF) is used to produce ethanol.

[0026]

[0029] Another aspect of the disclosure provides a method for producing a fermentation product from a substrate by contacting the substrate with a fermenting organism, wherein the fermenting organism is selected from (a) Saccharomyces sp. strain Y2083, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68182, or a derivative thereof; (b) Saccharomyces sp. strain Y2084, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68183, or a derivative thereof; (c) Saccharomyces sp. strain Y2086, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68184, or a derivative thereof; or (d) Saccharomyces sp. strain Y2087, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68185, or a derivative thereof. In one embodiment, the substrate comprises or is derived from sugarcane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof. In another embodiment, the fermentation product is ethanol. In another embodiment, the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof. In another embodiment, batch fermentation, continuous fermentation, simultaneous saccharification and fermentation (SSF), or separate hydrolysis and fermentation (SHF) are used to produce the fermentation product.

[0027]

[0030] The present disclosure provides other aspects and embodiments that will become apparent in light of the following detailed description and accompanying drawings. [Brief explanation of the drawings]

[0028] [Figure 1A]

[0031] Figures 1A-D are schematic diagrams showing a process for generating new yeast strains. Figure 1A is a schematic diagram showing directed mating. Figure 1B is a schematic diagram showing collective mating. Figure 1C is a schematic diagram showing directed evolution of a yeast strain. Figure 1D is a schematic diagram showing mutagenesis of a yeast strain. [Figure 1B] Figures 1A-D are schematic diagrams showing a process for generating new yeast strains. Figure 1A is a schematic diagram showing directed mating. Figure 1B is a schematic diagram showing collective mating. Figure 1C is a schematic diagram showing directed evolution of a yeast strain. Figure 1D is a schematic diagram showing mutagenesis of a yeast strain. [Figure 1C] Figures 1A-D are schematic diagrams showing a process for generating new yeast strains. Figure 1A is a schematic diagram showing directed mating. Figure 1B is a schematic diagram showing collective mating. Figure 1C is a schematic diagram showing directed evolution of a yeast strain. Figure 1D is a schematic diagram showing mutagenesis of a yeast strain. [Figure 1D] Figures 1A-D are schematic diagrams showing a process for generating new yeast strains. Figure 1A is a schematic diagram showing directed mating. Figure 1B is a schematic diagram showing collective mating. Figure 1C is a schematic diagram showing directed evolution of a yeast strain. Figure 1D is a schematic diagram showing mutagenesis of a yeast strain. [Figure 2A]

[0032] Figures 2A-E are graphs showing fermentation results from yeast products derived from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in standard diluted molasses medium (SDM) at pH 4.9 containing 0.36% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 33°C. Figure 2A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 2B is a graph showing ethanol yield after 48 hours of fermentation; Figure 2C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 2D is a graph showing fructose concentration after 48 hours of fermentation. Figure 2E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 2B]Figures 2A-E are graphs showing fermentation results from yeast products derived from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in standard diluted molasses medium (SDM) at pH 4.9 containing 0.36% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 33°C. Figure 2A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 2B is a graph showing ethanol yield after 48 hours of fermentation; Figure 2C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 2D is a graph showing fructose concentration after 48 hours of fermentation. Figure 2E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 2C] Figures 2A-E are graphs showing fermentation results from yeast products derived from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in standard diluted molasses medium (SDM) at pH 4.9 containing 0.36% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 33°C. Figure 2A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 2B is a graph showing ethanol yield after 48 hours of fermentation; Figure 2C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 2D is a graph showing fructose concentration after 48 hours of fermentation. Figure 2E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 2D] Figures 2A-E are graphs showing fermentation results from yeast products derived from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in standard diluted molasses medium (SDM) at pH 4.9 containing 0.36% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 33°C. Figure 2A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 2B is a graph showing ethanol yield after 48 hours of fermentation; Figure 2C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 2D is a graph showing fructose concentration after 48 hours of fermentation. Figure 2E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 2E] Figures 2A-E are graphs showing fermentation results from yeast products derived from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in standard diluted molasses medium (SDM) at pH 4.9 containing 0.36% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 33°C. Figure 2A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 2B is a graph showing ethanol yield after 48 hours of fermentation; Figure 2C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 2D is a graph showing fructose concentration after 48 hours of fermentation. Figure 2E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 3A]

[0033] Figures 3A-E are graphs showing fermentation results from yeast products from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in acidified diluted molasses medium (ALM) at pH 4.2 containing 0.90% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 33°C. Figure 3A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 3B is a graph showing ethanol yield after 48 hours of fermentation; Figure 3C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 3D is a graph showing fructose concentration after 48 hours of fermentation. Figure 3E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 3B]Figures 3A-E are graphs showing fermentation results from yeast products from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in acidified diluted molasses medium (ALM) at pH 4.2 containing 0.90% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 33°C. Figure 3A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 3B is a graph showing ethanol yield after 48 hours of fermentation; Figure 3C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 3D is a graph showing fructose concentration after 48 hours of fermentation. Figure 3E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 3C] Figures 3A-E are graphs showing fermentation results from yeast products from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in acidified diluted molasses medium (ALM) at pH 4.2 containing 0.90% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 33°C. Figure 3A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 3B is a graph showing ethanol yield after 48 hours of fermentation; Figure 3C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 3D is a graph showing fructose concentration after 48 hours of fermentation. Figure 3E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 3D] Figures 3A-E are graphs showing fermentation results from yeast products from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in acidified diluted molasses medium (ALM) at pH 4.2 containing 0.90% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 33°C. Figure 3A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 3B is a graph showing ethanol yield after 48 hours of fermentation; Figure 3C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 3D is a graph showing fructose concentration after 48 hours of fermentation. Figure 3E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 3E] Figures 3A-E are graphs showing fermentation results from yeast products from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in acidified diluted molasses medium (ALM) at pH 4.2 containing 0.90% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 33°C. Figure 3A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 3B is a graph showing ethanol yield after 48 hours of fermentation; Figure 3C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 3D is a graph showing fructose concentration after 48 hours of fermentation. Figure 3E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 4A]

[0034] Figures 4A-E are graphs showing fermentation results from yeast products from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in standard diluted molasses medium (SDM) at pH 4.9 containing 0.36% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 38°C. Figure 4A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 4B is a graph showing ethanol yield after 48 hours of fermentation; Figure 4C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 4D is a graph showing fructose concentration after 48 hours of fermentation. Figure 4E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 4B]Figures 4A-E are graphs showing fermentation results from yeast products from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in standard diluted molasses medium (SDM) at pH 4.9 containing 0.36% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 38°C. Figure 4A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 4B is a graph showing ethanol yield after 48 hours of fermentation; Figure 4C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 4D is a graph showing fructose concentration after 48 hours of fermentation. Figure 4E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 4C] Figures 4A-E are graphs showing fermentation results from yeast products from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in standard diluted molasses medium (SDM) at pH 4.9 containing 0.36% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 38°C. Figure 4A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 4B is a graph showing ethanol yield after 48 hours of fermentation; Figure 4C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 4D is a graph showing fructose concentration after 48 hours of fermentation. Figure 4E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 4D] Figures 4A-E are graphs showing fermentation results from yeast products from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in standard diluted molasses medium (SDM) at pH 4.9 containing 0.36% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 38°C. Figure 4A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 4B is a graph showing ethanol yield after 48 hours of fermentation; Figure 4C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 4D is a graph showing fructose concentration after 48 hours of fermentation. Figure 4E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 4E] Figures 4A-E are graphs showing fermentation results from yeast products from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in standard diluted molasses medium (SDM) at pH 4.9 containing 0.36% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 38°C. Figure 4A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 4B is a graph showing ethanol yield after 48 hours of fermentation; Figure 4C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 4D is a graph showing fructose concentration after 48 hours of fermentation. Figure 4E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 5A]

[0035] Figures 5A-E are graphs showing fermentation results from yeast products from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in acidified diluted molasses medium (ALM) at pH 4.2 containing 0.90% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 38°C. Figure 5A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 5B is a graph showing ethanol yield after 48 hours of fermentation; Figure 5C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 5D is a graph showing fructose concentration after 48 hours of fermentation. Figure 5E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 5B]Figures 5A-E are graphs showing fermentation results from yeast products from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in acidified diluted molasses medium (ALM) at pH 4.2 containing 0.90% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 38°C. Figure 5A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 5B is a graph showing ethanol yield after 48 hours of fermentation; Figure 5C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 5D is a graph showing fructose concentration after 48 hours of fermentation. Figure 5E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 5C] Figures 5A-E are graphs showing fermentation results from yeast products from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in acidified diluted molasses medium (ALM) at pH 4.2 containing 0.90% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 38°C. Figure 5A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 5B is a graph showing ethanol yield after 48 hours of fermentation; Figure 5C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 5D is a graph showing fructose concentration after 48 hours of fermentation. Figure 5E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 5D] Figures 5A-E are graphs showing fermentation results from yeast products from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in acidified diluted molasses medium (ALM) at pH 4.2 containing 0.90% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 38°C. Figure 5A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 5B is a graph showing ethanol yield after 48 hours of fermentation; Figure 5C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 5D is a graph showing fructose concentration after 48 hours of fermentation. Figure 5E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 5E] Figures 5A-E are graphs showing fermentation results from yeast products from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 in acidified diluted molasses medium (ALM) at pH 4.2 containing 0.90% w / v lactic acid and 0.25% w / v acetic acid at a fermentation temperature of 38°C. Figure 5A is a graph showing ethanol concentration after 48 hours of fermentation; Figure 5B is a graph showing ethanol yield after 48 hours of fermentation; Figure 5C is a graph showing ethanol to glycerol ratio after 48 hours of fermentation; and Figure 5D is a graph showing fructose concentration after 48 hours of fermentation. Figure 5E is a graph showing the rate, defined as mass loss, over 24 hours of fermentation. [Figure 6]

[0036] FIG. 6 is an image of a gel generated by QIAxcel ScreenGel 1.6.0 software incorporating results from capillary electrophoresis of PCR amplification products of microsatellite DNA for the YPL009C and YOR267C loci. The loading order was as follows: 1) Y2083; 2) Y2084; 3) Y2086; 4) Y2087; 5) Y1027; 6) Indian Yeast Company HRC3; 7) Zillo Lorenzetti Group BG1; 8) Mauri Brasil Industria Ltd C7; 9) Fleischmann's LTU-26; 10) Fermentec Brasil PE-2; 11) Fermentec Brasil CAT-1; 12) Lallemand EDV46; 13) Fermentis Ethanol Red; 14) Radico Indian Molasses strain; 15) Nature Biochem Y-Max isolate C1; 16) Angel Super Alcohol; 17) Novozymes Innova Fit; 18) Rymco Pty Ltd (Anchor Yeast) Thermosacc XL; 19) No template control; and 20) salmon DNA (20 ng). Fragment sizing was performed using QX DNA size markers 100bp-2.5kb (Qiagen catalog number: 929559) and QX alignment markers 15bp / 5kb (Qiagen catalog number: 929524). [Figure 7A]

[0037] Figures 7A-B are heat maps comparing nucleotide matches between strains. Figure 7A is a heat map of the percentage of identical nucleotide matches for each strain relative to Y1027 for 56 open reading frame (ORF) sequences. Figure 7B is a heat map of the percentage of identical nucleotide matches for each strain relative to Y2083 relative to Y2084 for 16 additional ORF sequences. [Figure 7B]Figures 7A-B are heat maps comparing nucleotide matches between strains. Figure 7A is a heat map of the percentage of identical nucleotide matches for each strain relative to Y1027 for 56 open reading frame (ORF) sequences. Figure 7B is a heat map of the percentage of identical nucleotide matches for each strain relative to Y2083 relative to Y2084 for 16 additional ORF sequences. DETAILED DESCRIPTION OF THE INVENTION

[0029]

[0038] Described herein are fermenting organisms that contain distinct characteristics, including higher ethanol yields, higher fructose utilization, higher temperature and inhibitor tolerance, and faster fermentation rates, relative to current industry-standard yeasts used in yeast products such as Fali® M under the same fermentation conditions. Also described herein are yeast strains of the genus Saccharomyces that have improved properties compared to the yeast strains used in Fali® M. The disclosure relates to processes for producing yeast products from the yeast strains. The disclosure also relates to improved processes for producing ethanol from different fermentable biomass materials using the fermenting organisms described herein.

[0030] 1.Definition

[0039] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. In case of conflict, the present document, including definitions, will prevail. Preferred methods and materials are described below, but methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and are not intended to be limiting.

[0031]

[0040] The terms "comprise(s)," "include(s)," "having," "has," "can," "contain(s)," and variations thereof, as used herein, are intended to be open-ended, transitional phrases, terms, or words that do not exclude the possibility of additional actions or structures. The singular forms "a," "an," and "the" include plural references unless the content clearly dictates otherwise. The present disclosure also contemplates other embodiments that "comprise," "consist of," and "consist essentially of" the embodiments or elements presented herein, whether explicitly stated or not.

[0032]

[0041] For purposes of describing numerical ranges herein, each intervening number with the same precision is expressly contemplated. For example, for the range of 6 to 9, the numbers 7 and 8 are contemplated in addition to 6 and 9; for the range of 6.0 to 7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are expressly contemplated; and for the range of 1 to 5, the numbers 2, 3, and 4 are contemplated in addition to 1 and 5. The terms "about" or "approximately," as used herein as applied to one or more values ​​of interest, refer to a value that is similar to a stated reference value or within a given error range for a particular value as determined by one of ordinary skill in the art, depending in part on how the value is measured or determined, such as the limitations of the measurement system. In certain embodiments, the term "about," unless otherwise stated or apparent from the context, refers to a range of values ​​that is within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater or less) of the stated reference value (except when such value exceeds 100% of the possible values). Alternatively, "about" can mean within 3 or more than 3 standard deviations according to the practice in the art. Alternatively, for example, with respect to biological systems or processes, the term "about" can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold of a value.

[0033]

[0042] As used herein, the term "biomass" refers to any organic matter of plant origin that can be converted into a carbohydrate source. Preferably, the biomass can be derived from agricultural or food processing products and / or co-products. In particular, the biomass can be rich in sucrose or starch and can be selected from or derived from, for example, sorghum, sugarcane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a mixture thereof.

[0034]

[0043] As used herein, "combining DNA" between yeast strains refers to combining all or part of the genome of yeast strains.Combining DNA between yeast strains can be by any suitable method for combining the DNA of at least two yeast cells, and can include, for example, mating methods, including sporulation of yeast strains to generate haploid cells, and then hybridizing or mating compatible haploid cells; cytoduction; or cell fusion, such as protoplast fusion.

[0035]

[0044] As used herein, a "derivative" is a yeast strain (e.g., a member of the genus Saccharomyces or Saccharomyces sensu stricto clade) derived from a yeast strain disclosed herein, including by sporulation, hybridization, mutagenesis, recombinant DNA techniques, genome editing techniques, mating, cell fusion, or cytoduction between yeast strains. A derivative strain can be a direct passage (i.e., the product of a cross between a strain of the invention and another strain or itself).

[0036]

[0045] As used herein, "ethanol yield from glucose" is the yield of ethanol achieved from glucose alone or in combination with other fermentable sugars present in the biomass expressed as "glucose equivalents." In one embodiment, the ethanol yield from glucose is expressed in terms of one molecule of glucose yielding two molecules of ethanol and two molecules of carbon dioxide. In another embodiment, the ethanol yield from glucose is expressed in terms of one molecule of glucose yielding two molecules of ethanol and two molecules of carbon dioxide. 12 O6 → 2C2H5OH + 2CO2, where C6H 12O6 is the chemical formula for glucose and fructose, CHOH is the chemical formula for ethanol, and CO2 is the chemical formula for carbon dioxide. In another embodiment, the ethanol yield from glucose is expressed on a mass basis, where 1.0 gram of glucose or fructose yields 0.511 grams of ethanol and 0.489 grams of carbon dioxide. The highest ethanol yield from glucose or fructose is two molecules of ethanol from one molecule of glucose or fructose. The highest ethanol yield by mass is 0.511 grams of ethanol from one gram of glucose or fructose.

[0037]

[0046] As used herein, the term "glucose equivalent" or "multiple glucose equivalents" refers to the mass of a fermentable molecule other than glucose expressed as an equivalent mass of glucose. For example, 1.0 gram of sucrose is equivalent to 1.053 grams of glucose, and 1 gram of ethanol is equivalent to 1.955 grams of glucose.

[0038]

[0047] The term "control" is used interchangeably with "Y1027" or "Fali® M strain" when discussing the yeast strain, and with "Fali® M" when discussing the yeast product. Strain Y1027 is used to produce the yeast product Fali® M. Fali® M can be produced as an active dry yeast product, a brittle yeast product, and a liquid yeast product for use in the fermentation of substrates to produce fuel ethanol, industrial ethanol, and potable ethanol. Fali® M is particularly well suited for use in the fermentation of sugars released from biomass containing sucrose, glucose, and fructose, as well as in the fermentation of sugars released from starch-containing biomass following the release of sugars by enzymatic or chemical processes. Fali® M can be used in batch, continuous, and simultaneous saccharification and fermentation of starch substrates. It has high tolerance to released glucose, adequate ethanol and temperature tolerance, and adequate organic acid tolerance. It rehydrates well with direct pitch applications and can be used with glucoamylase and alpha amylase enzyme systems. Fali® M has optimal performance within a pH range of 4.0-5.0, but can ferment well at pHs between 3.5 and 6.0. The optimal fermentation temperature for Fali® M depends on the stresses present (e.g., organic acids, ethanol, and pH), but generally ferments well in a temperature range of approximately 32°C to 34°C. Fali® M is commercially available from AB Mauri®.

[0039]

[0048] The term "fermentation medium" refers to an environment in which fermentation using a fermenting organism occurs and contains a fermentable substrate, i.e., a carbohydrate source (e.g., sucrose, glucose, or fructose), that can be metabolized by the fermenting organism into a desired fermentation product, such as ethanol. The fermentation medium may contain fermentation nutrients for the fermenting organism. Fermentation nutrients are widely used in the field of fermentation and include nitrogen sources (e.g., ammonia, urea), vitamins, minerals, or combinations thereof. A "feed" is a fermentation medium, although the feed may have a different composition than the fermentation medium.

[0040]

[0049] "High-yield ethanol production," as used herein, refers to ethanol production by fermentation, where the ethanol yield approaches the theoretical ethanol yield from glucose or other fermentable sugars. For sugar substrates that include or consist of sucrose, fructose, and glucose, high-yield ethanol production requires the ability to utilize fructose. High-yield ethanol production requires limited formation of by-products such as glycerol and yeast growth during fermentation.

[0041]

[0050] The terms "improved," "increased," "enhanced," or "greater," as used herein, refer to the enhancement or improvement of a particular characteristic or trait compared to other similar organisms, controls, or wild-type organisms. Typically, this is an advantageous trait for fermentation.

[0042]

[0051] The term "inoculum" is intended to mean a quantity of microorganisms that is added to a main fermentor to start the fermentation process. In the case of a fermentation process that uses a seed fermentor, the inoculum is typically a preculture of an amount equivalent to 5-20% of the volume of the main fermentor.

[0043]

[0052] The term "isolated" refers to a substance in a form or setting that does not occur in nature. Non-limiting examples of isolated substances include: (1) any non-naturally occurring substance; (2) any substance, including but not limited to, any enzyme, mutant, nucleic acid, protein, peptide, or cofactor, that is at least partially removed from one or more or all of the naturally occurring components with which it is naturally associated; (3) any substance that has been modified by the hand of man relative to the substance found in nature; or (4) any substance that has been modified by increasing the amount of the substance relative to other components that naturally accompany it (e.g., recombinant production in yeast; multiple copies of the gene encoding the substance; and use of a stronger promoter than that naturally associated with the gene encoding the substance). In particular, an isolated substance can be an isolated yeast cell, yeast culture, or yeast product containing viable yeast (e.g., active dried yeast). An isolated substance can be present in a fermentation broth sample; for example, the yeast can be genetically modified to express a particular polypeptide. A fermentation broth derived from yeast contains the isolated polypeptide.

[0044]

[0053] The term "low pH," as used herein, refers to a pH of about 2.5 to about 4.5. A low pH is preferably less than about 4.5. The term "normal pH," as used herein, refers to a pH of about 4.0 to about 6.0. A normal pH is preferably about 5.0.

[0045]

[0054] The term "primary fermentor," as used herein, refers to the final fermentor used in a fermentation process to produce a fermentation product, where the intended fermentation product is produced.

[0046]

[0055] The term "parental" or "parent" strain refers to the yeast strain from which a derivative strain is derived. In some embodiments, a derivative can also be a parent.

[0056] The term "pre-culture" is understood as a liquid containing an actively growing culture of microorganisms (i.e., yeast) used to inoculate the main fermenter. Active growth is intended to mean that the culture is at a stage where the microorganisms are increasing in cell number. A pre-culture is generally used as an inoculum to avoid or reduce the lag phase in the main fermenter. In fermentations to produce ethanol, the cells in the pre-fermenter are typically conditioned. The idea is to not generate yeast biomass, so the carbon in the biomass reduces the carbon that becomes ethanol. Although growth to ferment is present, it is not desirable to promote aerobic growth (e.g., using a seed fermenter). Alternatively, yeast can be added directly to the main fermenter by "direct pitch."

[0047]

[0057] As used herein, the terms "traits" and "distinctive characteristics" of the Saccharomyces cerevisiae strains detailed herein include at least increased ethanol yield compared to a control (i.e., Fali® M or Y1027) under the same processing conditions. Other "traits" and "distinctive characteristics" include, among others, high temperature tolerance, fast fermentation rate, high organic acid tolerance, high ethanol production, and low glycerol production. For example, the fermentation organisms described herein used in the processes described herein can have one or more of the above-mentioned "traits" and "distinctive characteristics."

[0048]

[0058] The term "pre-fermentor" is intended to mean a fermenter in which a pre-culture is formed by fermenting microorganisms until the yeast is activated and conditioned for inoculation of the main fermentor. If a pre-fermentor is not used, a "direct pitch" is used.

[0049]

[0059] As used herein, a "substrate" is a molecule that can be metabolized directly or indirectly to ethanol by fermentation by Saccharomyces or any of the yeast or yeast products described herein.

[0050]

[0060] The term "wild-type," as used herein, refers to a typical form of a normally occurring organism or its genetic material, as distinguished from a selected organism.

[0061] The terms "yeast product" and "composition" are used interchangeably herein and, as used herein, refer to a composition comprising, inter alia, dry yeast, starch, and an emulsifier. The yeast product may also be a liquid composition comprising, inter alia, cream yeast, glycerol, and xanthan gum.

[0051]

[0062] Unless otherwise defined herein, technical and scientific terms used in connection with this disclosure have the meanings commonly understood by those skilled in the art. For example, any nomenclature related to and used in cell biology, molecular biology, microbiology, genetics, and protein and nucleic acid chemistry described herein is a nomenclature well known and commonly used in the art. The meaning and scope of the terms should be clear, but in the event of any potential ambiguity, the definitions set forth herein take precedence over any dictionary or external definitions. Furthermore, unless otherwise required by context, singular terms include pluralities, and plural terms include the singular.

[0052] 2. Yeast Strains and Yeast Strain Derivatives

[0063] Yeast strains and yeast strain derivatives, as used herein, can be any yeast effective for ethanol production, including, but not limited to, Saccharomyces, Zygosaccharomyces, Brettanomyces, and Kluyveromyces. Preferably, the yeast can be a Saccharomyces species, and even more preferably, Saccharomyces cerevisiae.

[0053]

[0064] Additionally, the yeast strains of the genus Saccharomyces and derivatives thereof described herein can be readily distinguished from (a) naturally occurring strains of Saccharomyces; (b) contaminating strains of Saccharomyces; and (c) other strains used in the ethanol industry that do not possess the ethanol production capabilities and distinct characteristics of the strains described herein.

[0054]

[0065] In some embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher ethanol yield than a typical yeast strain used in fermentation (e.g., Saccharomyces strain Y1027). In some embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher ethanol yield than a typical yeast strain used in fermentation (e.g., Saccharomyces strain Y1027) at a temperature ranging from 20°C to 40°C, preferably from 33°C to 38°C. In particular embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher ethanol yield than a typical yeast strain used in fermentation (e.g., Saccharomyces strain Y1027) at a temperature of 33°C. In another embodiment, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher ethanol yield than a typical yeast strain used in fermentation (e.g., Saccharomyces strain Y1027) at a temperature of 38°C. The inventors surprisingly find that the yeast strains described herein provide statistically significantly higher ethanol yields than Y1027 under the same fermentation conditions. The inventors also surprisingly find that the derivatives described herein provide statistically significantly higher ethanol yields overall than Y1027 under the same conditions.

[0055]

[0066] In some embodiments, one or more of the yeast strains and derivatives thereof described herein exhibit a % or less of soluble cellulose (cellulose) content of at least about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0%, 21.0%, 22.0%, 23.0%, 24.0%, 25.0%, 26.0%, 27.0%, 28.0%, 29.0%, 30.0%, 31.0%, 32.0%, 33.0%, 34.0%, 35.0%, 36.0%, 37.0%, 38.0%, 39.0%, 40.0%, 41.0%, 42.0%, 43.0%, 44.0%, 45.0%, 46.0%, 47.0%, 48.0%, 49.0%, 50.0%, 51.0%, 52.0%, 53.0%, 54.0%, 55.0%, 56.0%, 57.0%, 58.0%, 59.0%, 60.0%, 61.0%, 62.0%, 63.0%, 64.0%, 65.0%, 66.0%, 67.0%, 68.0%, 69.0%, 70.0%, 71.0%, 72.0%, 73.0%, having a 20.0%, 21.0%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75% higher ethanol yield. In some embodiments, one or more of the yeast strains and derivatives thereof described herein exhibit at most about 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0%, 21.0%, 22.0%, 23.0%, 24.0%, 25.0%, 26.0%, 27.0%, 28.0%, 29.0%, 30.0%, 31.0%, 32.0%, 33.0%, 34.0%, 35.0%, 36.0%, 37.0%, 38.0%, 39.0%, 40.0%, 41.0%, 42.0%, 43.0%, 44.0%, 45.0%, 46.0%, 47.0%, 48.0%, 49.0%, 50.0%, 51.0%, 52.0%, 53.0%, 54.0%, 55.0%, 56.0%, 57.0%, 58.0%, 59.0%, 60.0%, 61.0%, 62.0%, 63.0%, 64.0%, 65.0%, 66.0%, 67.0%, 68.0%, 69.0%, 70.0%, 71.0%, 72.0%, 73.0%, 74.0%, 75.0%, 76.0%, 77.0%, 78.0%, 79.0%, 80.0%, 81.0%, 82.0%, 83.0%,0%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75% higher ethanol yield. In some embodiments, one or more of the yeast strains and derivatives thereof described herein exhibit a yield of about 0.1% to 75% (i.e., about 0.1% to about 75%), 0.2% to 75%, 0.3% to 75%, 0.4% to 75%, 0.5% to 75%, 0.6% to 75%, 0.7% to 75%, 0.8% to 75%, 0.9% to 75%, 10% to 10% or 11% of a typical yeast strain used in fermentation (e.g., Saccharomyces sp. strain Y1027) after 48 hours of fermentation. 7%~75%, 0.8%~75%, 0.9%~75%, 1%~75%, 2%~75%, 3%~75%, 4%~75%, 5%~75%, 6%~75%, 7%~75%, 8%~75%, 9%~75%, 10%~75%, 15%~75%, 20%~75%, 25%~75%, 30%~75%, 35%~75%, 40%~75%, 45%~75%, 50%~75%, 5 5%~75%, 60%~75%, 0.1%~70%, 0.2%~70%, 0.3%~70%, 0.4%~70%, 0.5%~70%, 0.6%~70%, 0.7%~70%, 0.8%~70%, 0.9%~70%, 1%~70%, 2%~70%, 3%~70%, 4%~70%, 5%~70%, 6%~70%, 7%~70%, 8%~70%, 9%~70%, 1 0%~70%, 15%~70%, 20%~70%, 25%~70%, 30%~70%, 35%~70%, 40%~70%, 45%~70%, 50%~70%, 55%~70%, 60%~70%, 0.1%~60%, 0.2%~60%, 0.3%~60%, 0.4%~60%, 0.5%~60%, 0.6%~60%, 0.7%~60%, 0.8%~60%, 0.9%~60%、1%~60%、2%~60%、3%~60%、4%~60%%、5%~60%、6%~60%、7%~60%、8%~60%、9%~60%、10%~60%、15%~60%、20%~60%、25%~60%、30%~60%、35%~60%、40%~60%、45%~60%、50%~60%、0.1%~50%、0.2%~50%、0.3%~50%、0.4%~50%、0.5%~50%、0.6%~50%、0.7%~50%、0.8%~50%、0.9%~50%、1%~50%、2%~50%、3%~50%、4%~50%%、5%~50%、6%~50%、7%~50%、8%~50%、9%~50%、10%~50%、15%~50%、20%~50%、25%~50%、30%~50%、35%~50%、40%~50%、0.1%~40%、0.2%~40%、0.3%~40%、0.4%~40%、0.5%~40%、0.6%~40%、0.7%~40%、0.8%~40%、0.9%~40%、1%~40%、2%~40%、3%~40%、4%~40%%、5%~40%、6%~40%、7%~40%、8%~40%、9%~40%、10%~40%、15%~40%、20%~40%、25%~40%、30%~40%、0.1%~30%、0.2%~30%、0.3%~30%、0.4%~30%、0.5%~30%、0.6%~30%、0.7%~30%、0.8%~30%、0.9%~30%、1%~30%、2%~30%、3%~30%、4%~30%%、5%~30%、6%~30%、7%~30%、8%~30%、9%~30%、10%~30%、15%~30%、20%~30%、0.1%~20%、0.2%~20%、0.3%~20%、0.4%~20%、0.5%~20%、0.6%~20%、0.7%~20%、0.8%~20%、0.9%~20%、1%~20%、2%~20%、3%~20%、4%~20%、5%~20%、6%~20%、7%~20%、8%~20%、9%~20%、10%~20%、0.2%~19%、0.3%~19%、0.4%~19%、0.5%~19%、0.6%~19%、0.7%~19%、0.8%~19%、0.9%~19%、1%~19%、2%~19%、3%~19%、4%~19%、5%~19%、6%~19%、7%~19%、8%~19%、9%~19%、10%~19%、0.2%~18%、0.3%~18%、0.4%~18%、0.5%~18%、0.6%~18%、0.7%~18%、0.8%~18%、0.9%~18%、1%~18%、2%~18%、3%~18%、4%~18%、5%~18%、6%~18%、7%~18%、8%~18%、9%~18%、10%~18%、0.2%~17%、0.3%~17%、0.4%~17%、0.5%~17%、0.6%~17%、0.7%~17%、0.8%~17%、0.9%~17%、1%~17%、2%~17%、3%~17%、4%~17%、5%~17%、6%~17%、7%~17%、8%~17%、9%~17%、10%~17%、0.2%~16%、0.3%~16%、0.4%~16%、0.5%~16%、0.6%~16%、0.7%~16%、0.8%~16%、0.9%~16%、1%~16%、2%~16%、3%~16%、4%~16%、5%~16%、6%~16%、7%~16%、8%~16%、9%~16%、10%~16%、0.2%~15%、0.3%~15%、0.4%~15%、0.5%~15%、0.6%~15%、0.7%~15%、0.8%~15%、0.9%~15%、1%~15%、2%~15%、3%~15%、4%~15%、5%~15%、6%~15%、7%~15%、8%~15%、9%~15%、10%~15%、0.1%~14%、0.2%~14%、0.3%~14%、0.4%~14%、0.5%~14%、0.6%~14%、0.7%~14%、0.8%~14%、0.9%~14%、1%~14%、2%~14%、3%~14%、4%~14%、5%~14%、6%~14%、7%~14%、8%~14%、9%~14%、10%~14%、0.1%~13%、0.2%~13%、0.3%~13%、0.4%~13%、0.5%~13%、0.6%~13%、0.7%~13%、0.8%~13%、0.9%~13%、1%~13%、2%~13%、3%~13%、4%~13%、5%~13%、6%~13%、7%~13%、8%~13%、9%~13%、10%~13%、0.1%~12%、0.2%~12%、0.3%~12%、0.4%~12%、0.5%~12%、0.6%~12%、0.7%~12%、0.8%~12%、0.9%~12%, 1%~12%, 2%~12%, 3%~12%, 4%~12%, 5%~12%, 6%~12%, 7%~12%, 8%~12%, 9%~12%, 10%~12%, 0.1%~11%, 0.2%~11%, 0.3%~11%, 0.4%~11%, 0.5%~11%, 0.6%~11%, 0.7%~11%, 0.8%~11%, 0.9%~11%, 1%~11%, 2%~11%, 3%~11%, 4%~11%, 5%~11%, 6%~11 %, 7%-11%, 8%-11%, 9%-11%, 10%-11%, 0.1%-0.2%, 0.1%-0.3%, 0.1%-0.4%, 0.1%-0.5%, 0.1%-0.6%, 0.1%-0.7%, 0.1%-0.8%, 0.1%-0.9%, 0.1%-1%, 0.1%-2%, 0.1%-3%, 0.1%-4%, 0.1%-5%, 0.1%-6%, 0.1%-7%, 0.1%-8%, or 0.1%-9% higher ethanol yield.

[0056]

[0067] In some embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher fructose utilization than a typical yeast strain used in fermentation (e.g., Saccharomyces strain Y1027). In some embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher relative fructose utilization than a typical yeast strain used in fermentation (e.g., Saccharomyces strain Y1027) at a temperature in the range of 20°C to 40°C, preferably in the range of 33°C to 38°C. In particular embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher fructose utilization than a typical yeast strain used in fermentation (e.g., Saccharomyces strain Y1027) at a temperature of 33°C. In another embodiment, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher fructose utilization than a typical yeast strain used in fermentation (e.g., Saccharomyces strain Y1027) at a temperature of 38°C. The inventors have surprisingly found that one or more of the yeast strains described herein result in statistically significantly higher fructose utilization than Y1027 under the same fermentation conditions. The inventors have also surprisingly found that the derivatives described herein result in statistically significantly higher fructose utilization than Y1027 under the same conditions.

[0057]

[0068] In some embodiments, one or more of the yeast strains and derivatives thereof described herein exhibit a fermentation yield of at least about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 1109, 1110, 112%, 113%, 114%, 115%, 116%, 11 %, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% higher fructose utilization. In some embodiments, one or more of the yeast strains and derivatives thereof described herein have at most about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% greater fructose utilization after 48 hours of fermentation relative to a typical yeast strain used in fermentation (e.g., Saccharomyces sp. strain Y1027). In some embodiments, one or more of the yeast strains and derivatives thereof described herein exhibit a yield of about 0.5% to 55% (i.e., about 0.5%) after 48 hours of fermentation relative to a typical yeast strain used in fermentation (e.g., Saccharomyces sp. strain Y1027).5%~approximately 55%), 1%~55%, 2%~55%, 3%~55%, 4%~55%, 5%~55%, 6%~55%, 7%~55%, 8%~55%, 9%~55%, 10%~55%, 11%~55%, 12%~55%, 13%~55%, 14%~55%, 15%~55%, 16%~55%, 17%~55%, 18%~55%, 19%~55%, 20%~55%, 21%~55%, 22%~55%, 23%~55%, 24%~55%, 25%~55%, 26%~55% %, 27%~55%, 28%~55%, 29%~55%, 30%~55%, 31%~55%, 32%~55%, 33%~55%, 34%~55%, 35%~55%, 36%~55%, 37%~55%, 38%~55%, 39%~55%, 40%~55%, 41%~55%, 42%~55%, 43%~55%, 44%~55%, 45%~55%, 46%~55%, 47%~55%, 48%~55%, 49%~55%, 50%~55%, 51%~55%, 52%~5 5%, 53%~55%, 54%~55%, 0.5%~50%, 1%~50%, 2%~50%, 3%~50%, 4%~50%, 5%~50%, 6%~50%, 7%~50%, 8%~50%, 9%~50%, 10%~50%, 11%~50%, 12%~50%, 13%~50%, 14%~50%, 15%~50%, 16%~50%, 17%~50%, 18%~50%, 19%~50%, 20%~50%, 21%~50%, 22%~50%, 23%~50%, 24% ~50%, 25%~50%, 26%~50%, 27%~50%, 28%~50%, 29%~50%, 30%~50%, 31%~50%, 32%~50%, 33%~50%, 34%~50%, 35%~50%, 36%~50%, 37%~50%, 38%~50%, 39%~50%, 40%~50%, 41%~50%, 42%~50%, 43%~50%, 44%~50%, 45%~50%, 46%~50%, 47%~50%, 48%~50%, 49%~50%, 0.5%~45%、1%~45%、2%~45%、3%~45%、4%~45%、5%~45%、6%~45%、7%~45%、8%~45%、9%~45%、10%~45%、11%~45%、12%~45%、13%~45%、14%~45%、15%~45%、16%~45%、17%~45%、18%~45%、19%~45%、20%~45%、21%~45%、22%~45%、23%~45%、24%~45%、25%~45%、26%~45%、27%~45%、28%~45%、29%~45%、30%~45%、31%~45%、32%~45%、33%~45%、34%~45%、35%~45%、36%~45%、37%~45%、38%~45%、39%~45%、40%~45%、41%~45%、42%~45%、43%~45%、44%~45%、0.5%~40%、1%~40%、2%~40%、3%~40%、4%~40%、5%~40%、6%~40%、7%~40%、8%~40%、9%~40%、10%~40%、11%~40%、12%~40%、13%~40%、14%~40%、15%~40%、16%~40%、17%~40%、18%~40%、19%~40%、20%~40%、21%~40%、22%~40%、23%~40%、24%~40%、25%~40%、26%~40%、27%~40%、28%~40%、29%~40%、40%~40%、31%~40%、32%~40%、33%~40%、34%~40%、35%~40%、36%~40%、37%~40%、38%~40%、39%~40%、0.5%~35%、1%~35%、2%~35%、3%~35%、4%~35%、5%~35%、6%~35%、7%~35%、8%~35%、9%~35%、10%~35%、11%~35%、12%~35%、13%~35%、14%~35%、15%~35%、16%~35%、17%~35%、18%~35%、19%~35%、20%~35%、21%~35%、22%~35%、23%~35%、24%~35%、25%~35%、26%~35%、27%~35%、28%~35%、29%~35%、35%~35%、31%~35%、32%~35%、33%~35%、34%~35%、0.5%~30%、1%~30%、2%~30%、3%~30%、4%~30%、5%~30%、6%~30%、7%~30%、8%~30%、9%~30%、10%~30%、11%~30%、12%~30%、13%~30%、14%~30%、15%~30%、16%~30%、17%~30%、18%~30%、19%~30%、20%~30%、21%~30%、22%~30%、23%~30%、24%~30%、25%~30%、26%~30%、27%~30%、28%~30%、29%~30%、0.5%~29%、1%~29%、2%~29%、3%~29%、4%~29%、5%~29%、6%~29%、7%~29%、8%~29%、9%~29%、10%~29%、11%~29%、12%~29%、13%~29%、14%~29%、15%~29%、16%~29%、17%~29%、18%~29%、19%~29%、20%~29%、21%~29%、22%~29%、23%~29%、24%~29%、25%~29%、26%~29%、27%~29%、28%~29%、0.5%~28%、1%~28%、2%~28%、3%~28%、4%~28%、5%~28%、6%~28%、7%~28%、8%~28%、9%~28%、10%~28%、11%~28%、12%~28%、13%~28%、14%~28%、15%~28%、16%~28%、17%~28%、18%~28%、19%~28%、20%~28%、21%~28%、22%~28%、23%~28%、24%~28%、25%~28%、26%~28%、27%~28%、0.5%~27%、1%~27%、2%~27%、3%~27%、4%~27%、5%~27%、6%~27%、7%~27%、8%~27%、9%~27%、10%~27%、11%~27%、12%~27%、13%~27%、14%~27%、15%~27%、16%~27%、17%~27%、18%~27%、19%~27%、20%~27%、21%~27%、22%~27%、23%~27%、24%~27%、25%~27%、26%~27%、0.5%~26%、1%~26%、2%~26%、3%~26%、4%~26%、5%~26%、6%~26%、7%~26%、8%~26%、9%~26%、10%~26%、11%~26%、12%~26%、13%~26%、14%~26%、15%~26%、16%~26%、17%~26%、18%~26%、19%~26%、20%~26%、21%~26%、22%~26%、23%~26%、24%~26%、25%~26%、0.5%~25%、1%~25%、2%~25%、3%~25%、4%~25%、5%~25%、6%~25%、7%~25%、8%~25%、9%~25%、10%~25%、11%~25%、12%~25%、13%~25%、14%~25%、15%~25%、16%~25%、17%~25%、18%~25%、19%~25%、20%~25%、21%~25%、22%~25%、23%~25%、24%~25%、0.5%~24%、1%~24%、2%~24%、3%~24%、4%~24%、5%~24%、6%~24%、7%~24%、8%~24%、9%~24%、10%~24%、11%~24%、12%~24%、13%~24%、14%~24%、15%~24%、16%~24%、17%~24%、18%~24%、19%~24%、20%~24%、21%~24%、22%~24%、23%~24%、0.5%~23%、1%~23%、2%~23%、3%~23%、4%~23%、5%~23%、6%~23%、7%~23%、8%~23%、9%~23%、10%~23%、11%~23%、12%~23%、13%~23%、14%~23%、15%~23%、16%~23%、17%~23%、18%~23%、19%~23%、20%~23%、21%~23%、22%~23%、0.5%~22%、1%~22%、2%~22%、3%~22%、4%~22%、5%~22%、6%~22%、7%~22%、8%~22%、9%~22%、10%~22%、11%~22%、12%~22%、13%~22%、14%~22%、15%~22%、16%~22%、17%~22%、18%~22%、19%~22%、20%~22%、21%~22%、0.5%~21%、1%~21%、2%~21%、3%~21%、4%~21%、5%~21%、6%~21%、7%~21%、8%~21%、9%~21%、10%~21%、11%~21%、12%~21%、13%~21%、14%~21%、15%~21%、16%~21%、17%~21%、18%~21%、19%~21%、20%~21%、0.5%~20%、1%~20%、2%~20%、3%~20%、4%~20%、5%~20%、6%~20%、7%~20%、8%~20%、9%~20%、10%~20%、11%~20%、12%~20%、13%~20%、14%~20%、15%~20%、16%~20%、17%~20%、18%~20%、19%~20%、0.5%~19%、1%~19%、2%~19%、3%~19%、4%~19%、5%~19%、6%~19%、7%~19%、8%~19%、9%~19%、10%~19%、11%~19%、12%~19%、13%~19%、14%~19%、15%~19%、16%~19%、17%~19%、18%~19%、0.5%~18%、1%~18%、2%~18%、3%~18%、4%~18%、5%~18%、6%~18%、. 7%~18%、8%~18%、9%~18%、10%~18%、11%~18%、12%~18%、13%~18%、14%~18%、15%~18%、16%~18%、17%~18%、0.5%~17%、1%~17%、2%~17%、3%~17%、4%~17%、5%~17%、6%~17%、7%~17%、8%~17%、9%~17%、10%~17%、11%~17%、12%~17%、13%~17%、14%~17%、15%~17%、16%~17%、0.5%~16%、1%~16%、2%~16%、3%~16%、4%~16%、5%~16%、6%~16%、7%~16%、8%~16%、9%~16%、10%~16%、11%~16%、12%~16%、13%~16%、14%~16%、15%~16%、0.5%~15%、1%~15%、2%~15%、3%~15%、4%~15%、5%~15%、6%~15%、7%~15%、8%~15%、9%~15%、10%~15%、11%~15%、12%~15%、13%~15%、14%~15%、0.5%~14%、1%~14%、2%~14%、3%~14%、4%~14%、5%~14%、6%~14%、7%~14%、8%~14%、9%~14%、10%~14%、11%~14%、12%~14%、13%~14%、0.5%~13%、1%~13%、2%~13%、3%~13%、4%~13%、5%~13%、6%~13%、7%~13%、8%~13%、9%~13%、10%~13%、11%~13%、12%~13%、0.5%~12%、1%~12%、2%~12%、3%~12%、4%~12%、5%~12%、6%~12%、7%~12%、8%~12%、9%~12%、10%~12%、11%~12%、0.5%~11%、1%~11%、2%~11%、3%~11%、4%~11%、5%~11%、6%~11%、7%~11%、8%~11%、9%~11%、10%~11%、0.5%~10%、1%~10%、2%~10%、3%~10%、4%~10%、5%~10%、6%~10%、7%~10%、8%~10%、9%~10%、0.5%~9%、1%~9%、2%~9%、3%~9%、4%~9%、5%~9%、6%~9%、7%~9%、8%~9%、0.5%~8%、1%~8%、2%~8%、3%~8%、4%~8%、5%~8%、6%~8%、7%~8%、0.5%-7%, 1%-7%, 2%-7%, 3%-7%, 4%-7%, 5%-7%, 6%-7%, 0.5%-6%, 1%-6%, 2%-6%, 3%-6%, 4%-6%, 5%-6%, 0.5%-5%, 1%-5%, 2%-5%, 3%-5%, 4%-5%, 0.5%-4%, 1%-4%, 2%-4%, 3%-4%, 0.5%-3%, 1%-3%, 2%-3%, 0.5%-2%, 1%-2%, or 0.5%-1% higher fructose utilization.

[0058]

[0069] In some embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher ethanol to glycerol ratio than a typical yeast strain used in fermentation (e.g., Saccharomyces strain Y1027). In some embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher ethanol to glycerol ratio than a typical yeast strain used in fermentation (e.g., Saccharomyces strain Y1027) at a temperature in the range of 20°C to 40°C, preferably in the range of 33°C to 38°C. In particular embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher ethanol to glycerol ratio than a typical yeast strain used in fermentation (e.g., Saccharomyces strain Y1027) at a temperature of 33°C. In another embodiment, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher ethanol to glycerol ratio than a typical yeast strain used in fermentation (e.g., Saccharomyces strain Y1027) at a temperature of 38°C. The inventors surprisingly find that the yeast strains described herein produce a statistically significantly higher ethanol to glycerol ratio compared to Y1027 under the same fermentation conditions. The inventors also surprisingly find that the derivatives described herein produce a statistically significantly higher ethanol to glycerol ratio overall compared to Y1027 under the same conditions.

[0059]

[0070] In some embodiments, one or more of the yeast strains and derivatives thereof described herein exhibit at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 1 %, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90% higher ethanol to glycerol ratios. In some embodiments, one or more of the yeast strains and derivatives thereof described herein exhibit at most about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125 having a 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90% higher ethanol to glycerol ratio. In some embodiments, the yeast strains and derivatives thereof described herein exhibit a fermentation yield of 100% or more of the following after 48 hours of fermentation relative to typical yeast strains used in fermentation (e.g., Saccharomyces sp. strain Y1027):Approximately 1% to 90% (i.e., approximately 1% to approximately 90%), 2% to 90%, 3% to 90%, 4% to 90%, 5% to 90%, 6% to 90%, 7% to 90%, 8% to 90%, 9% to 90%, 10% to 90%, 11% to 90%, 12% to 90%, 13% to 90%, 14% to 90%, 15% to 90% %, 16%~90%, 17%~90%, 18%~90%, 19%~90%, 20%~90%, 21%~90%, 22%~90%, 23%~90%, 24%~90%, 25%~90%, 26%~90%, 27%~90%, 28%~90%, 29%~90%, 30%~90%, 31% ~90%, 32%~90%, 33%~90%, 34%~90%, 35%~90%, 36%~90%, 37%~90%, 38%~90%, 39%~90%, 40%~90%, 41%~90%, 42%~90%, 43%~90%, 44%~90%, 45%~90%, 46%~90% , 47%~90%, 48%~90%, 49%~90%, 50%~90%, 51%~90%, 52%~90%, 53%~90%, 54%~90%, 55%~90%, 56%~90%, 57%~90%, 58%~90%, 59%~90%, 60%~90%, 61%~90%, 62%~ 90%, 63%~90%, 64%~90%, 65%~90%, 66%~90%, 67%~90%, 68%~90%, 69%~90%, 70%~90%, 71%~90%, 72%~90%, 73%~90%, 74%~90%, 75%~90%, 76%~90%, 77%~90%, 78%~90%, 79%~90%, 80%~90%, 81%~90%, 82%~90%, 83%~90%, 84%~90%, 85%~90%, 86%~90%, 87%~90%, 88%~90%, 89%~90%, 1%~80%, 2%~80%, 3%~80%, 4%~80%, 5%~80%, %~80%, 6%~80%, 7%~80%, 8%~80%, 9%~80%, 10%~80%, 11%~80%, 12%~80%, 13%~80%, 14%~80%, 15%~80%, 16%~80%, 17%~80%, 18%~80%, 19%~80%, 20%~80%, 21% ~80%, 22%~80%, 23%~80%, 24%~80%, 25%~80%, 26%~80%, 27%~80%, 28%~80%, 29%~80%, 30%~80%, 31%~80%, 32%~80%, 33%~80%, 34%~80%, 35%~80%, 36%~80%,37%~80%、38%~80%、39%~80%、40%~80%、41%~80%、42%~80%、43%~80%、44%~80%、45%~80%、46%~80%、47%~80%、48%~80%、49%~80%、50%~80%、51%~80%、52%~80%、53%~80%、54%~80%、55%~80%、56%~80%、57%~80%、58%~80%、59%~80%、60%~80%、61%~80%、62%~80%、63%~80%、64%~80%、65%~80%、66%~80%、67%~80%、68%~80%、69%~80%、70%~80%、71%~80%、72%~80%、73%~80%、74%~80%、75%~80%、76%~80%、77%~80%、78%~80%、79%~80%、1%~70%、2%~70%、3%~70%、4%~70%、5%~70%、6%~70%、7%~70%、8%~70%、9%~70%、10%~70%、11%~70%、12%~70%、13%~70%、14%~70%、15%~70%、16%~70%、17%~70%、18%~70%、19%~70%、20%~70%、21%~70%、22%~70%、23%~70%、24%~70%、25%~70%、26%~70%、27%~70%、28%~70%、29%~70%、30%~70%、31%~70%、32%~70%、33%~70%、34%~70%、35%~70%、36%~70%、37%~70%、38%~70%、39%~70%、40%~70%、41%~70%、42%~70%、43%~70%、44%~70%、45%~70%、46%~70%、47%~70%、48%~70%、49%~70%、50%~70%、51%~70%、52%~70%、53%~70%、54%~70%、55%~70%、56%~70%、57%~70%、58%~70%、59%~70%、60%~70%、61%~70%、62%~70%、63%~70%、64%~70%、65%~70%、66%~70%、67%~70%、68%~70%、69%~70%、1%~60%、2%~60%、3%~60%、4%~60%、5%~60%、6%~60%、7%~60%、8%~60%、9%~60%、10%~60%、11%~60%、12%~60%、13%~60%、14%~60%、15%~60%、16%~60%、17%~60%、18%~60%、19%~60%、20%~60%、21%~60%、22%~60%、23%~60%、24%~60%、25%~60%、26%~60%、27%~60%、28%~60%、29%~60%、30%~60%、31%~60%、32%~60%、33%~60%、34%~60%、35%~60%、36%~60%、37%~60%、38%~60%、39%~60%、40%~60%、41%~60%、42%~60%、43%~60%、44%~60%、45%~60%、46%~60%、47%~60%、48%~60%、49%~60%、50%~60%、51%~60%、52%~60%、53%~60%、54%~60%、55%~60%、56%~60%、57%~60%、58%~60%、59%~60%、1%~50%、2%~50%、3%~50%、4%~50%、5%~50%、6%~50%、7%~50%、8%~50%、9%~50%、10%~50%、11%~50%、12%~50%、13%~50%、14%~50%、15%~50%、16%~50%、17%~50%、18%~50%、19%~50%、20%~50%、21%~50%、22%~50%、23%~50%、24%~50%、25%~50%、26%~50%、27%~50%、28%~50%、29%~50%、30%~50%、31%~50%、32%~50%、33%~50%、34%~50%、35%~50%、36%~50%、37%~50%、38%~50%、39%~50%、40%~50%、41%~50%、42%~50%、43%~50%、44%~50%、45%~50%、46%~50%、47%~50%、48%~50%、49%~50%、1%~40%、2%~40%、3%~40%、4%~40%、5%~40%、6%~40%、7%~40%、8%~40%、9%~40%、10%~40%、11%~40%、12%~40%、13%~40%、14%~40%、15%~40%、16%~40%、17%~40%、18%~40%、19%~40%、20%~40%、21%~40%、22%~40%、23%~40%、24%~40%、25%~40%、26%~40%、27%~40%、28%~40%、29%~40%、30%~40%、31%~40%、32%~40%、33%~40%、34%~40%、35%~40%、36%~40%、37%~40%、38%~40%、39%~40%、1%~30%、2%~30%、3%~30%、4%~30%、5%~30%、6%~30%、7%~30%、8%~30%、9%~30%、10%~30%、11%~30%、12%~30%、13%~30%、14%~30%、15%~30%、16%~30%、17%~30%、18%~30%、19%~30%、20%~30%、21%~30%、22%~30%、23%~30%、24%~30%、25%~30%、26%~30%、27%~30%、28%~30%、29%~30%、1%~29%、2%~29%、3%~29%、4%~29%、5%~29%、6%~29%、7%~29%、8%~29%、9%~29%、10%~29%、11%~29%、12%~29%、13%~29%、14%~29%、15%~29%、16%~29%、17%~29%、18%~29%、19%~29%、20%~29%、21%~29%、22%~29%、23%~29%、24%~29%、25%~29%、26%~29%、27%~29%、28%~29%、1%~28%、2%~28%、3%~28%、4%~28%、5%~28%、6%~28%、7%~28%、8%~28%、9%~28%、10%~28%、11%~28%、12%~28%、13%~28%、14%~28%、15%~28%、16%~28%、17%~28%、18%~28%、19%~28%、20%~28%、21%~28%、22%~28%、23%~28%、24%~28%、25%~28%、26%~28%、27%~28%、1%~27%、2%~27%、3%~27%、4%~27%、5%~27%、6%~27%、 7%~27%、8%~27%、9%~27%、10%~27%、11%~27%、12%~27%、13%~27%、14%~27%、15%~27%、16%~27%、17%~27%、18%~27%、19%~27%、20%~27%、21%~27%、22%~27%、23%~27%、24%~27%、25%~27%、26%~27%、1%~26%、2%~26%、3%~26%、4%~26%、5%~26%、6%~26%、7%~26%、8%~26%、9%~26%、10%~26%、11%~26%、12%~26%、13%~26%、14%~26%、15%~26%、16%~26%、17%~26%、18%~26%、19%~26%、20%~26%、21%~26%、22%~26%、23%~26%、24%~26%、25%~26%、1%~25%、2%~25%、3%~25%、4%~25%、5%~25%、6%~25%、7%~25%、8%~25%、9%~25%、10%~25%、11%~25%、12%~25%、13%~25%、14%~25%、15%~25%、16%~25%、17%~25%、18%~25%、19%~25%、20%~25%、21%~25%、22%~25%、23%~25%、24%~25%、1%~24%、2%~24%、3%~24%、4%~24%、5%~24%、6%~24%、7%~24%、8%~24%、9%~24%、10%~24%、11%~24%、12%~24%、13%~24%、14%~24%、15%~24%、16%~24%、17%~24%、18%~24%、19%~24%、20%~24%、21%~24%、22%~24%、23%~24%、1%~23%、2%~23%、3%~23%、4%~23%、5%~23%、6%~23%、7%~23%、8%~23%、9%~23%、10%~23%、11%~23%、12%~23%、13%~23%、14%~23%、15%~23%、16%~23%、17%~23%、18%~23%、19%~23%、20%~23%、21%~23%、22%~23%、1%~22%、2%~22%、3%~22%、4%~22%、5%~22%、6%~22%、7%~22%、8%~22%、9%~22%、10%~22%、11%~22%、12%~22%、13%~22%、14%~22%、15%~22%、16%~22%、17%~22%、18%~22%、19%~22%、20%~22%、21%~22%、1%~21%、2%~21%、3%~21%、4%~21%、5%~21%、6%~21%、7%~21%、8%~21%、9%~21%、10%~21%、11%~21%、12%~21%、13%~21%、14%~21%、15%~21%、16%~21%、17%~21%、18%~21%、19%~21%、20%~21%、1%~20%、2%~20%、3%~20%、4%~20%、5%~20%、6%~20%、7%~20%、8%~20%、9%~20%、10%~20%、11%~20%、12%~20%、13%~20%、14%~20%、15%~20%、16%~20%、17%~20%、18%~20%、19%~20%、1%~19%、2%~19%、3%~19%、4%~19%、5%~19%、6%~19%、7%~19%、8%~19%、9%~19%、10%~19%、11%~19%、12%~19%、13%~19%、14%~19%、15%~19%、16%~19%、17%~19%、18%~19%、1%~18%、2%~18%、3%~18%、4%~18%、5%~18%、6%~18%、7%~18%、8%~18%、9%~18%、10%~18%、11%~18%、12%~18%、13%~18%、14%~18%、15%~18%、16%~18%、17%~18%、1%~17%、2%~17%、3%~17%、4%~17%、5%~17%、6%~17%、7%~17%、8%~17%、9%~17%、10%~17%、11%~17%、12%~17%、13%~17%、14%~17%、15%~17%、16%~17%、1%~16%、2%~16%、3%~16%、4%~16%、5%~16%、6%~16%、7%~16%、8%~16%、9%~16%、10%~16%、11%~16%、12%~16%、13%~16%、14%~16%、15%~16%、1%~15%、2%~15%、3%~15%、4%~15%、5%~15%、6%~15%、7%~15%、8%~15%、9%~15%、10%~15%、11%~15%、12%~15%、13%~15%、14%~15%、1%~14%、2%~14%、3%~14%、4%~14%、5%~14%、6%~14%、7%~14%、8%~14%、9%~14%、10%~14%、11%~14%、12%~14%, 13%~14%, 1%~13%, 2%~13%, 3%~13%, 4%~13%, 5%~13%, 6%~13%, 7%~13%, 8%~13%, 9%~13%, 10%~13%, 11%~13%, 12%~13%, 1%~12%, 2%~12%, 3%~12%, 4%~12%, 5%~12%, 6 %~12%, 7%~12%, 8%~12%, 9%~12%, 10%~12%, 11%~12%, 1%~11%, 2%~11%, 3%~11%, 4%~11%, 5%~11%, 6%~11%, 7%~11%, 8%~11%, 9%~11%, 10%~11%, 1%~10%, 2%~10%, 3%~10%, 4%~10 %, 5%~10%, 6%~10%, 7%~10%, 8%~10%, 9%~10%, 1%~9%, 2%~9%, 3%~9%, 4%~9%, 5%~9%, 6%~9%, 7%~9%, 8%~9%, 1%~8%, 2%~8%, 3%~8%, 4%~8%, 5%~8%, 6%~8%, 7%~8%, 1%~7%, 2%~7%, with a 3%-7%, 4%-7%, 5%-7%, 6%-7%, 1%-6%, 2%-6%, 3%-6%, 4%-6%, 5%-6%, 1%-5%, 2%-5%, 3%-5%, 4%-5%, 1%-4%, 2%-4%, 3%-4%, 1%-3%, 2%-3%, or 1%-2% higher ethanol to glycerol ratio.

[0060]

[0071] In some embodiments, one or more of the yeast strains and derivatives thereof described herein have a faster fermentation rate than a typical yeast strain used in fermentation (e.g., Saccharomyces strain Y1027). In some embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly faster fermentation rate than a typical yeast strain used in fermentation (e.g., Saccharomyces strain Y1027) at temperatures between 20°C and 40°C, preferably between 33°C and 38°C. In particular embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly faster fermentation rate than a typical yeast strain used in fermentation (e.g., Saccharomyces strain Y1027) at a temperature of 33°C. In another embodiment, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly faster fermentation rate than a typical yeast strain used in fermentation (e.g., Saccharomyces strain Y1027) at a temperature of 38°C. The inventors surprisingly find that the yeast strains described herein result in statistically significantly faster fermentation rates than Y1027 under the same fermentation conditions. The inventors surprisingly find that the derivatives described herein result in statistically significantly faster fermentation rates than Y1027 under the same conditions.

[0061]

[0072] In some embodiments, one or more of the yeast strains and derivatives thereof described herein exhibit at least about 0%, 1%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150% or less of the methylation product of a typical yeast strain used in fermentation (e.g., Saccharomyces sp. strain Y1027) after 24 hours of fermentation. , 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, or 450% faster fermentation rate. In some embodiments, one or more of the yeast strains and derivatives thereof described herein exhibit at most about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 410%, 420%, 430%, 440%, 450%, 460%, 470%, 480%, 490%, 500%, 510%, 520%, 530%, 540%, 550%, 560%, 570%, 580%, 590%, 600%, 610%, 620%, 630%, 640%, 650%, 660%, 670%, 680%, 690%, 700%, 710%, 720%, 730%, 740%, 750%, 760%, 770%, 780%, 790%, 800%, 810%, 820%, 830%, 840%, 850%, 860%, 870%, 880%, 890%, 900%, 910%, 920%, 930%, 940%, 950%, 960%, 970%, 980%, 990%, 1000%, 1010%, %, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, or 450% faster fermentation rate. In some embodiments, one or more of the yeast strains and derivatives thereof described herein exhibit a yield of about 0% to 450% (i.e., about 0% to about 450%), 1% to 450%, 10% to 450%, 20% to 450%, 30% to 450%, 40% to 450%, 50% to 450%, 60% to 450%, 70% to 750%, 80% to 850%, 90% to 950%, 100% to 1000%, 110% to 1100%, 120% to 1200%, 130% to 1300%, 140% to 1400%, 150% to 1500%, 160% to 1600%, 170% to 1700%, 180% to 1800%, 190% to 1900%, 210% to 2100%, 220% to 2200%, 230% to 2300%, 240% to 2400%, 250% to 2500%, 260% to 2600%, 270% to 2700%, 280% to 2800%, 290% to 2900%, 300% to 3000%, 310% to 3100%, 320% to 3200%, 330% to 3300%, 340% to 3400%, 350% to 3500%, 360% to 3600%, 370% to 3700%, 380% to 3800%, 390% to 3900%, 400% to 4000%, 4 %~450%, 80%~450%, 90%~450%, 100%~450%, 110%~450%, 120%~450%, 130%~450%, 140%~450%, 150%~450%, 160%~450%, 170%~450%, 180%~450%, 190%~450%, 200%~450%, 210%~450%, 220%~450%, 230%~450%, 240%~450%,250%~450%、260%~450%、270%~450%、280%~450%、290%~450%、300%~450%、310%~450%、320%~450%、330%~450%、340%~450%、350%~450%、360%~450%、370%~450%、380%~450%、390%~450%、400%~450%、410%~450%、420%~450%、430%~450%、440%~450%、0%~400%、1%~400%、10%~400%、20%~400%、30%~400%、40%~400%、50%~400%、60%~400%、70%~400%、80%~400%、90%~400%、100%~400%、110%~400%、120%~400%、130%~400%、140%~400%、150%~400%、160%~400%、170%~400%、180%~400%、190%~400%、200%~400%、210%~400%、220%~400%、230%~400%、240%~400%、250%~400%、260%~400%、270%~400%、280%~400%、290%~400%、300%~400%、310%~400%、320%~400%、330%~400%、340%~400%、350%~400%、360%~400%、370%~400%、380%~400%、390%~400%、0%~300%、1%~300%、10%~300%、20%~300%、30%~300%、40%~300%、50%~300%、60%~300%、70%~300%、80%~300%、90%~300%、100%~300%、110%~300%、120%~300%、130%~300%、140%~300%、150%~300%、160%~300%、170%~300%、180%~300%、190%~300%、200%~300%、210%~300%、220%~300%、230%~300%、240%~300%、250%~300%、260%~300%、270%~300%、280%~300%、290%~300%、0%~200%、1%~200%、10%~200%、20%~200%、30%~200%、40%~200%、50%~200%、60%~200%、70%~200%、80%~200%、90%~200%、100%~200%、110%~200%, 120%~200%, 130%~200%, 140%~200%, 150%~200%, 160%~200%, 170%~200%, 180%~200%, 190%~200%, 0%~100%, 1%~100%, 10%~100%, 20%~100%, 30%~10 0%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 0% to 50%, 1% to 50%, 10% to 50%, 20% to 50%, 30% to 50%, 40% to 50%, 0% to 10%, or 1% to 10% faster fermentation rate.

[0062]

[0073] In some embodiments, one or more of the yeast strains and derivatives thereof described herein have statistically significantly higher temperature tolerance than typical yeast strains used in fermentation (e.g., Saccharomyces sp. strain Y1027). Temperature tolerance can be exhibited by one or more of: high ethanol yield, high fructose utilization, high ethanol to glycerol ratio, and fast fermentation rate. In certain embodiments, one or more of the yeast strains and derivatives thereof described herein can tolerate temperatures of about 20°C, about 21°C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, about 30°C, about 31°C, about 32°C, about 33°C, about 34°C, about 35°C, about 36°C, about 37°C, about 38°C, about 39°C, and / or about 40°C. The inventors surprisingly find that the yeast strains described herein and their derivatives have a statistically significantly higher temperature tolerance compared to Y1027 under the same fermentation conditions.

[0063]

[0074] In some embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher organic acid tolerance at low pH than typical yeast strains used in fermentation (e.g., Saccharomyces sp. strain Y1027). Organic acid tolerance at low pH can be exhibited by one or more of: high ethanol yield, high fructose utilization, high ethanol to glycerol ratio, and fast fermentation rate. In some embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher organic acid tolerance at low pH than typical yeast strains used in fermentation (e.g., Saccharomyces sp. strain Y1027) at acetic acid concentrations of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, lactic acid concentrations of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. In certain embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher tolerance to lactic acid and acetic acid at low pH at a temperature of 33° C. than a typical yeast strain used in fermentation (e.g., Saccharomyces strain Y1027). In another embodiment, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher tolerance to lactic acid and acetic acid at low pH at a temperature of 38° C. than a typical yeast strain used in fermentation (e.g., Saccharomyces strain Y1027). The inventors surprisingly found that the yeast strains and derivatives thereof described herein have a statistically significantly higher organic acid tolerance at low pH compared to Y1027 under the same fermentation conditions. Examples of organic acids include, but are not limited to, lactic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, other carboxylic acids, or combinations thereof.

[0064]

[0075] In some embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher ethanol yield than typical yeast strains used in fermentation (e.g., Saccharomyces sp. strain Y1027) at acetic acid concentrations of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at lactic acid concentrations of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. In certain embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher ethanol yield than typical yeast strains used in fermentation (e.g., Saccharomyces sp. strain Y1027) at a temperature of 33° C., at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. In another embodiment, one or more of the yeast strains and derivatives thereof described herein have statistically significantly higher ethanol yields than typical yeast strains used in fermentation (e.g., Saccharomyces sp. strain Y1027) at a temperature of 38°C, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. The inventors surprisingly find that the yeast strains described herein produce statistically significantly higher ethanol yields at low pH with organic acids compared to Y1027 under the same fermentation conditions. The inventors also surprisingly find that the derivatives described herein produce statistically significantly higher ethanol yields at low pH with organic acids overall compared to Y1027 under the same conditions.

[0065]

[0076] In some embodiments, one or more of the yeast strains and derivatives thereof described herein exhibit a lactic acid concentration of at least about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0%, 21.0%, 22.0%, 23.0%, 24.0%, 25.0%, 26.0%, 27.0%, 28.0%, 29.0%, 30.0%, 31.0%, 32.0%, 33.0%, 34.0%, 35.0%, 36.0%, 37.0%, 38.0%, 39.0%, 40.0%, 41.0%, 42.0%, 43.0%, 44.0%, 45.0%, 46.0%, 47.0%, 48.0%, 49.0%, 50.0%, 51.0%, 52.0%, 53.0%, 54.0%, 55.0%, 56.0%, 57.0%, 58.0%, 59.0%, 60.0%, 61.0%, 62.0%, 63.0%, 64.0%, 65.0%, 66.0%, 67.0%, 68.0%, 69.0%, 70.0%, 71.0%, 72.0%, 73.0%, 74.0%, 75 %, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0%, 21.0%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41% , 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75% higher ethanol yield. In some embodiments, one or more of the yeast strains and derivatives thereof described herein are fermented at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. For typical yeast strains used in (e.g., Saccharomyces strain Y1027), after 48 hours of fermentation, the yields were at most approximately 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0%, and 21.0%.0%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75% higher ethanol yield. In some embodiments, one or more of the yeast strains and derivatives thereof described herein can be grown at acetic acid concentrations of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at lactic acid concentrations of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9, similar to typical yeast strains used in fermentation (e.g., Saccharomyces For the strain Y1027), after 48 hours of fermentation, the percentages were approximately 0.1% to 75% (i.e., approximately 0.1% to approximately 75%), 0.2% to 75%, 0.3% to 75%, 0.4% to 75%, 0.5% to 75%, 0.6% to 75%, 0.7% to 75%, 0.8% to 75%, 0.9% to 75%, 1% to 75%, 2% to 75%, 3% to 75%, 4% to 75%, 5% to 75%, 6% to 75%, 7% to 75%, 8% to 75%, 9% to 75%, 10% to 75% %, 15%~75%, 20%~75%, 25%~75%, 30%~75%, 35%~75%, 40%~75%, 45%~75%, 50%~75%, 55%~75%, 60%~75%, 0.1%~70%, 0.2%~70%, 0.3%~70%, 0.4%~70%, 0.5%~70%, 0.6%~70%, 0.7%~70%, 0.8%~70%, 0.9%~70%, 1%~70%, 2%~70%, 3%~70%, 4%~70% %, 5%~70%, 6%~70%, 7%~70%, 8%~70%, 9%~70%, 10%~70%, 15%~70%, 20%~70%, 25%~70%, 30%~70%, 35%~70%, 40%~70%, 45%~70%, 50%~70%, 55%~70%, 60%~70%, 0.1%~60%, 0.2%~60%, 0.3%~60%, 0.4%~60%, 0.5%~60%, 0.6%~60%, 0.7%~60%, 0.8%~60%、0.9%~60%、1%~60%、2%~60%、3%~60%、4%~60%%、5%~60%、6%~60%、7%~60%、8%~60%、9%~60%、10%~60%、15%~60%、20%~60%、25%~60%、30%~60%、35%~60%、40%~60%、45%~60%、50%~60%、0.1%~50%、0.2%~50%、0.3%~50%、0.4%~50%、0.5%~50%、0.6%~50%、0.7%~50%、0.8%~50%、0.9%~50%、1%~50%、2%~50%、3%~50%、4%~50%%、5%~50%、6%~50%、7%~50%、8%~50%、9%~50%、10%~50%、15%~50%、20%~50%、25%~50%、30%~50%、35%~50%、40%~50%、0.1%~40%、0.2%~40%、0.3%~40%、0.4%~40%、0.5%~40%、0.6%~40%、0.7%~40%、0.8%~40%、0.9%~40%、1%~40%、2%~40%、3%~40%、4%~40%%、5%~40%、6%~40%、7%~40%、8%~40%、9%~40%、10%~40%、15%~40%、20%~40%、25%~40%、30%~40%、0.1%~30%、0.2%~30%、0.3%~30%、0.4%~30%、0.5%~30%、0.6%~30%、0.7%~30%、0.8%~30%、0.9%~30%、1%~30%、2%~30%、3%~30%、4%~30%%、5%~30%、6%~30%、7%~30%、8%~30%、9%~30%、10%~30%、15%~30%、20%~30%、0.1%~20%、0.2%~20%、0.3%~20%、0.4%~20%、0.5%~20%、0.6%~20%、0.7%~20%、0.8%~20%、0.9%~20%、1%~20%、2%~20%、3%~20%、4%~20%、5%~20%、6%~20%、7%~20%、8%~20%、9%~20%、10%~20%、0.2%~19%、0.3%~19%、0.4%~19%、0.5%~19%、0.6%~19%、0.7%~19%、0.8%~19%、0.9%~19%、1%~19%、2%~19%、3%~19%、4%~19%、5%~19%、6%~19%、7%~19%、8%~19%、9%~19%、10%~19%、0.2%~18%、0.3%~18%、0.4%~18%、0.5%~18%、0.6%~18%、0.7%~18%、0.8%~18%、0.9%~18%、1%~18%、2%~18%、3%~18%、4%~18%、5%~18%、6%~18%、7%~18%、8%~18%、9%~18%、10%~18%、0.2%~17%、0.3%~17%、0.4%~17%、0.5%~17%、0.6%~17%、0.7%~17%、0.8%~17%、0.9%~17%、1%~17%、2%~17%、3%~17%、4%~17%、5%~17%、6%~17%、7%~17%、8%~17%、9%~17%、10%~17%、0.2%~16%、0.3%~16%、0.4%~16%、0.5%~16%、0.6%~16%、0.7%~16%、0.8%~16%、0.9%~16%、1%~16%、2%~16%、3%~16%、4%~16%、5%~16%、6%~16%、7%~16%、8%~16%、9%~16%、10%~16%、0.2%~15%、0.3%~15%、0.4%~15%、0.5%~15%、0.6%~15%、0.7%~15%、0.8%~15%、0.9%~15%、1%~15%、2%~15%、3%~15%、4%~15%、5%~15%、6%~15%、7%~15%、8%~15%、9%~15%、10%~15%、0.1%~14%、0.2%~14%、0.3%~14%、0.4%~14%、0.5%~14%、0.6%~14%、0.7%~14%、0.8%~14%、0.9%~14%、1%~14%、2%~14%、3%~14%、4%~14%、5%~14%、6%~14%、7%~14%、8%~14%、9%~14%、10%~14%、0.1%~13%、0.2%~13%、0.3%~13%、0.4%~13%、0.5%~13%、0.6%~13%、0.7%~13%、0.8%~13%、0.9%~13%、1%~13%、2%~13%、3%~13%、4%~13%、5%~13%、6%~13%、7%~13%、8%~13%、9%~13%、10%~13%、0.1%~12%、0.2%~12%、0.3%~12%、0.4%~12%、0.5%~12%、0.6%~12%, 0.7%~12%, 0.8%~12%, 0.9%~12%, 1%~12%, 2%~12%, 3%~12%, 4%~12%, 5%~12%, 6%~12%, 7%~12%, 8%~12%, 9%~12%, 10%~12%, 0.1%~11%, 0.2%~11%, 0.3%~11%, 0.4%~11%, 0.5%~11%, 0.6%~11%, 0.7%~11%, 0.8%~11%, 0.9%~11%, 1%~11%, 2%~11%, 3%~11%, 4%~11 %, 5%-11%, 6%-11%, 7%-11%, 8%-11%, 9%-11%, 10%-11%, 0.1%-0.2%, 0.1%-0.3%, 0.1%-0.4%, 0.1%-0.5%, 0.1%-0.6%, 0.1%-0.7%, 0.1%-0.8%, 0.1%-0.9%, 0.1%-1%, 0.1%-2%, 0.1%-3%, 0.1%-4%, 0.1%-5%, 0.1%-6%, 0.1%-7%, 0.1%-8%, or 0.1%-9% higher ethanol yield.

[0066]

[0077] In some embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher fructose utilization than typical yeast strains used in fermentation (e.g., Saccharomyces sp. strain Y1027) at acetic acid concentrations of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at lactic acid concentrations of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. In certain embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher fructose utilization than typical yeast strains used in fermentation (e.g., Saccharomyces sp. strain Y1027) at a temperature of 33° C., at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. In another embodiment, one or more of the yeast strains and derivatives thereof described herein have statistically significantly higher fructose utilization than typical yeast strains used in fermentation (e.g., Saccharomyces sp. strain Y1027) at a temperature of 38° C., at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. The inventors surprisingly find that the yeast strains described herein result in statistically significantly higher fructose utilization at low pH with higher organic acid concentrations compared to Y1027 under the same fermentation conditions. The inventors also surprisingly find that the derivatives described herein result in statistically significantly higher fructose utilization at low pH with higher organic acid concentrations compared to Y1027 under the same conditions.

[0067]

[0078] In some embodiments, one or more of the yeast strains and derivatives thereof described herein exhibit a lactic acid concentration of at least about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 20%, 22%, 23%, 24%, 25%, 26%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 48%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 181%, 190%, 192%, 193%, 194 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% higher fructose utilization. In some embodiments, one or more of the yeast strains and derivatives thereof described herein can be grown at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9, for a typical yeast strain used in fermentation (e.g., Saccharomyces sp. strain Y1027) at 48 hours of fermentation. After a period of time, the fructose utilization rate may be at most about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% higher. In some embodiments, one or more of the yeast strains and derivatives thereof described herein are cultured at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at an acetic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.At a lactic acid concentration of 90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9, for a typical yeast strain used in fermentation (e.g., Saccharomyces sp. strain Y1027), after 48 hours of fermentation, the lactic acid concentration may be about 0.5% to 55% (i.e., about 0.5% to about 55%), 1% to 55%, 2% to 55%, 3% to 55%, 4% to 55%, 5% to 55%, 6% to 55%, 7% to 55%, 8% to 55%, 9% to 55%, 10% to 55%, 11% to 55%, 12% to 55%, 13% to 55%, 14% to 55%, 15% to 55%, 16%~55%, 17%~55%, 18%~55%, 19%~55%, 20%~55%, 21%~55%, 22%~55%, 23%~55%, 24%~55%, 25%~55%, 26%~55%, 27%~55%, 28%~55%, 29%~55%, 30%~55%, 31%~55%, 32%~55%, 33%~55%, 34%~55%, 35%~55%, 36%~55%, 37%~55%, 38%~55%, 39%~55%, 40%~55%, 41%~55%, 42%~55%, 43%~55%, 44%~55%, 45% ~55%, 46%~55%, 47%~55%, 48%~55%, 49%~55%, 50%~55%, 51%~55%, 52%~55%, 53%~55%, 54%~55%, 0.5%~50%, 1%~50%, 2%~50%, 3%~50%, 4%~50%, 5%~50%, 6%~50%, 7%~50%, 8%~50%, 9%~50%, 10%~50%, 11%~50%, 12%~50%, 13%~50%, 14%~50%, 15%~50%, 16%~50%, 17%~50%, 18%~50%, 19%~50%, 20%~50 %, 21%~50%, 22%~50%, 23%~50%, 24%~50%, 25%~50%, 26%~50%, 27%~50%, 28%~50%, 29%~50%, 30%~50%, 31%~50%, 32%~50%, 33%~50%, 34%~50%, 35%~50%, 36%~50%, 37%~50%, 38%~50%, 39%~50%, 40%~50%, 41%~50%, 42%~50%, 43%~50%, 44%~50%, 45%~50%, 46%~50%, 47%~50%, 48%~50%, 49%~50%, 0.5%~45%、1%~45%、2%~45%、3%~45%、4%~45%、5%~45%、6%~45%、7%~45%、8%~45%、9%~45%、10%~45%、11%~45%、12%~45%、13%~45%、14%~45%、15%~45%、16%~45%、17%~45%、18%~45%、19%~45%、20%~45%、21%~45%、22%~45%、23%~45%、24%~45%、25%~45%、26%~45%、27%~45%、28%~45%、29%~45%、30%~45%、31%~45%、32%~45%、33%~45%、34%~45%、35%~45%、36%~45%、37%~45%、38%~45%、39%~45%、40%~45%、41%~45%、42%~45%、43%~45%、44%~45%、0.5%~40%、1%~40%、2%~40%、3%~40%、4%~40%、5%~40%、6%~40%、7%~40%、8%~40%、9%~40%、10%~40%、11%~40%、12%~40%、13%~40%、14%~40%、15%~40%、16%~40%、17%~40%、18%~40%、19%~40%、20%~40%、21%~40%、22%~40%、23%~40%、24%~40%、25%~40%、26%~40%、27%~40%、28%~40%、29%~40%、40%~40%、31%~40%、32%~40%、33%~40%、34%~40%、35%~40%、36%~40%、37%~40%、38%~40%、39%~40%、0.5%~35%、1%~35%、2%~35%、3%~35%、4%~35%、5%~35%、6%~35%、7%~35%、8%~35%、9%~35%、10%~35%、11%~35%、12%~35%、13%~35%、14%~35%、15%~35%、16%~35%、17%~35%、18%~35%、19%~35%、20%~35%、21%~35%、22%~35%、23%~35%、24%~35%、25%~35%、26%~35%、27%~35%、28%~35%、29%~35%、35%~35%、31%~35%、32%~35%、33%~35%、34%~35%、0.5%~30%、1%~30%、2%~30%、3%~30%、4%~30%、5%~30%、6%~30%、7%~30%、8%~30%、9%~30%、10%~30%、11%~30%、12%~30%、13%~30%、14%~30%、15%~30%、16%~30%、17%~30%、18%~30%、19%~30%、20%~30%、21%~30%、22%~30%、23%~30%、24%~30%、25%~30%、26%~30%、27%~30%、28%~30%、29%~30%、0.5%~29%、1%~29%、2%~29%、3%~29%、4%~29%、5%~29%、6%~29%、7%~29%、8%~29%、9%~29%、10%~29%、11%~29%、12%~29%、13%~29%、14%~29%、15%~29%、16%~29%、17%~29%、18%~29%、19%~29%、20%~29%、21%~29%、22%~29%、23%~29%、24%~29%、25%~29%、26%~29%、27%~29%、28%~29%、0.5%~28%、1%~28%、2%~28%、3%~28%、4%~28%、5%~28%、6%~28%、7%~28%、8%~28%、9%~28%、10%~28%、11%~28%、12%~28%、13%~28%、14%~28%、15%~28%、16%~28%、17%~28%、18%~28%、19%~28%、20%~28%、21%~28%、22%~28%、23%~28%、24%~28%、25%~28%、26%~28%、27%~28%、0.5%~27%、1%~27%、2%~27%、3%~27%、4%~27%、5%~27%、6%~27%、7%~27%、8%~27%、9%~27%、10%~27%、11%~27%、12%~27%、13%~27%、14%~27%、15%~27%、16%~27%、17%~27%、18%~27%、19%~27%、20%~27%、21%~27%、22%~27%、23%~27%、24%~27%、25%~27%、26%~27%、0.5%~26%、1%~26%、2%~26%、3%~26%、4%~26%、5%~26%、6%~26%、7%~26%、8%~26%、9%~26%、10%~26%、11%~26%、12%~26%、13%~26%、14%~26%、15%~26%、16%~26%、17%~26%、18%~26%、19%~26%、20%~26%、21%~26%、22%~26%、23%~26%、24%~26%、25%~26%、0.5%~25%、1%~25%、2%~25%、3%~25%、4%~25%、5%~25%、6%~25%、7%~25%、8%~25%、9%~25%、10%~25%、11%~25%、12%~25%、13%~25%、14%~25%、15%~25%、16%~25%、17%~25%、18%~25%、19%~25%、20%~25%、21%~25%、22%~25%、23%~25%、24%~25%、0.5%~24%、1%~24%、2%~24%、3%~24%、4%~24%、5%~24%、6%~24%、7%~24%、8%~24%、9%~24%、10%~24%、11%~24%、12%~24%、13%~24%、14%~24%、15%~24%、16%~24%、17%~24%、18%~24%、19%~24%、20%~24%、21%~24%、22%~24%、23%~24%、0.5%~23%、1%~23%、2%~23%、3%~23%、4%~23%、5%~23%、6%~23%、7%~23%、8%~23%、9%~23%、10%~23%、11%~23%、12%~23%、13%~23%、14%~23%、15%~23%、16%~23%、17%~23%、18%~23%、19%~23%、20%~23%、21%~23%、22%~23%、0.5%~22%、1%~22%、2%~22%、3%~22%、4%~22%、5%~22%、6%~22%、7%~22%、8%~22%、9%~22%、10%~22%、11%~22%、12%~22%、13%~22%、14%~22%、15%~22%、16%~22%、17%~22%、18%~22%、19%~22%、20%~22%、21%~22%、0.5%~21%、1%~21%、2%~21%、3%~21%、4%~21%、5%~21%、6%~21%、7%~21%、8%~21%、9%~21%、10%~21%、11%~21%、12%~21%、13%~21%、14%~21%、15%~21%、16%~21%、17%~21%、18%~21%、19%~21%、20%~21%、0.5%~20%、1%~20%、2%~20%、3%~20%、4%~20%、5%~20%、6%~20%、7%~20%、8%~20%、9%~20%、10%~20%、11%~20%、12%~20%、13%~20%、14%~20%、15%~20%、16%~20%、17%~20%、18%~20%、19%~20%、0.5%~19%、1%~19%、2%~19%、. 3%~19%、4%~19%、5%~19%、6%~19%、7%~19%、8%~19%、9%~19%、10%~19%、11%~19%、12%~19%、13%~19%、14%~19%、15%~19%、16%~19%、17%~19%、18%~19%、0.5%~18%、1%~18%、2%~18%、3%~18%、4%~18%、5%~18%、6%~18%、7%~18%、8%~18%、9%~18%、10%~18%、11%~18%、12%~18%、13%~18%、14%~18%、15%~18%、16%~18%、17%~18%、0.5%~17%、1%~17%、2%~17%、3%~17%、4%~17%、5%~17%、6%~17%、7%~17%、8%~17%、9%~17%、10%~17%、11%~17%、12%~17%、13%~17%、14%~17%、15%~17%、16%~17%、0.5%~16%、1%~16%、2%~16%、3%~16%、4%~16%、5%~16%、6%~16%、7%~16%、8%~16%、9%~16%、10%~16%、11%~16%、12%~16%、13%~16%、14%~16%、15%~16%、0.5%~15%、1%~15%、2%~15%、3%~15%、4%~15%、5%~15%、6%~15%、7%~15%、8%~15%、9%~15%、10%~15%、11%~15%、12%~15%、13%~15%、14%~15%、0.5%~14%、1%~14%、2%~14%、3%~14%、4%~14%、5%~14%、6%~14%、7%~14%、8%~14%、9%~14%、10%~14%、11%~14%、12%~14%、13%~14%、0.5%~13%、1%~13%、2%~13%、3%~13%、4%~13%、5%~13%、6%~13%、7%~13%、8%~13%、9%~13%、10%~13%、11%~13%、12%~13%、0.5%~12%、1%~12%、2%~12%、3%~12%、4%~12%、5%~12%、6%~12%、7%~12%、8%~12%、9%~12%、10%~12%、11%~12%、0.5%~11%、1%~11%、2%~11%、3%~11%、4%~11%、5%~11%、6%~11%、7%~11%、8%~11%、9%~11%、10%~11%、0.5%~10%, 1%~10%, 2%~10%, 3%~10%, 4%~10%, 5%~10%, 6%~10%, 7%~10%, 8%~10%, 9%~10%, 0.5%~9%, 1%~9%, 2%~9%, 3%~9%, 4%~9%, 5%~9%, 6%~9%, 7%~9%, 8%~9%, 0.5%~8%, 1%~8%, 2%~8%, 3%~8%, 4%~8%, 5%~8%, 6%~8%, 7%~8%, 0.5%~7%, 1%~7 %, 2%-7%, 3%-7%, 4%-7%, 5%-7%, 6%-7%, 0.5%-6%, 1%-6%, 2%-6%, 3%-6%, 4%-6%, 5%-6%, 0.5%-5%, 1%-5%, 2%-5%, 3%-5%, 4%-5%, 0.5%-4%, 1%-4%, 2%-4%, 3%-4%, 0.5%-3%, 1%-3%, 2%-3%, 0.5%-2%, 1%-2%, or 0.5%-1% higher fructose utilization.

[0068]

[0079] In some embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher ethanol to glycerol ratio than typical yeast strains used in fermentation (e.g., Saccharomyces sp. strain Y1027) at acetic acid concentrations of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at lactic acid concentrations of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. In certain embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher ethanol to glycerol ratio than typical yeast strains used in fermentation (e.g., Saccharomyces sp. strain Y1027) at a temperature of 33° C., at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. In another embodiment, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher ethanol to glycerol ratio than typical yeast strains used in fermentation (e.g., Saccharomyces sp. strain Y1027) at a temperature of 38° C., at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. The inventors surprisingly find that the yeast strains described herein produce a statistically significantly higher ethanol to glycerol ratio at low pH with higher organic acid concentrations compared to Y1027 under the same fermentation conditions. The inventors also surprisingly find that the derivatives described herein result in higher organic acid concentrations and statistically significantly higher ethanol to glycerol ratios at low pH compared to Y1027 under the same conditions.

[0069]

[0080] In some embodiments, one or more of the yeast strains and derivatives thereof described herein exhibit a lactic acid concentration of at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139 with 0%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90% higher ethanol to glycerol ratios. In some embodiments, one or more of the yeast strains and derivatives thereof described herein can be grown at acetic acid concentrations of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, lactic acid concentrations of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9, for typical yeast strains used in fermentation (e.g., Saccharomyces sp. strain Y1027). ,After 48 hours of fermentation, at most about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%,having a 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90% higher ethanol to glycerol ratio. In some embodiments, one or more of the yeast strains and derivatives thereof described herein can be fermented at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably at a pH of 4.2 to 4.9, for a typical yeast strain used in fermentation (e.g., Saccharomyces sp. strain Y1027). After 2 hours, the rate is approximately 1% to 90% (i.e., approximately 1% to approximately 90%), 2% to 90%, 3% to 90%, 4% to 90%, 5% to 90%, 6% to 90%, 7% to 90%, 8% to 90%, 9% to 90%, 10% to 90%, 11% to 90%, 12% to 90%, 13% to 90%, 14% to 90%, 15% to 90%, 16% to 90%, 17% to 90%, 18% to 90%, 19% to 90%, 20% to 90%, 21% to 90%, 22% to 90%, 23% to 90%, 24% to 90%, 25% to 90% , 26%~90%, 27%~90%, 28%~90%, 29%~90%, 30%~90%, 31%~90%, 32%~90%, 33%~90%, 34%~90%, 35%~90%, 36%~90%, 37%~90%, 38%~90%, 39%~90%, 40%~90%, 41%~90%, 42%~90%, 43%~90%, 44%~90%, 45%~90%, 46%~90%, 47%~90%, 48%~90%, 49%~90%, 50%~90%, 51%~90% , 52%~90%, 53%~90%, 54%~90%, 55%~90%, 56%~90%, 57%~90%, 58%~90%, 59%~90%, 60%~90%, 61%~90%, 62%~90%, 63%~90%, 64%~90%, 65%~90%, 66%~90%, 67%~90%, 68%~90%, 69%~90%, 70%~90%, 71%~90%, 72%~90%, 73%~90%, 74%~90%, 75%~90%, 76%~90%, 77%~90%,78%~90%、79%~90%、80%~90%、81%~90%、82%~90%、83%~90%、84%~90%、85%~90%、86%~90%、87%~90%、88%~90%、89%~90%、1%~80%、2%~80%、3%~80%、4%~80%、5%~80%、6%~80%、7%~80%、8%~80%、9%~80%、10%~80%、11%~80%、12%~80%、13%~80%、14%~80%、15%~80%、16%~80%、17%~80%、18%~80%、19%~80%、20%~80%、21%~80%、22%~80%、23%~80%、24%~80%、25%~80%、26%~80%、27%~80%、28%~80%、29%~80%、30%~80%、31%~80%、32%~80%、33%~80%、34%~80%、35%~80%、36%~80%、37%~80%、38%~80%、39%~80%、40%~80%、41%~80%、42%~80%、43%~80%、44%~80%、45%~80%、46%~80%、47%~80%、48%~80%、49%~80%、50%~80%、51%~80%、52%~80%、53%~80%、54%~80%、55%~80%、56%~80%、57%~80%、58%~80%、59%~80%、60%~80%、61%~80%、62%~80%、63%~80%、64%~80%、65%~80%、66%~80%、67%~80%、68%~80%、69%~80%、70%~80%、71%~80%、72%~80%、73%~80%、74%~80%、75%~80%、76%~80%、77%~80%、78%~80%、79%~80%、1%~70%、2%~70%、3%~70%、4%~70%、5%~70%、6%~70%、7%~70%、8%~70%、9%~70%、10%~70%、11%~70%、12%~70%、13%~70%、14%~70%、15%~70%、16%~70%、17%~70%、18%~70%、19%~70%、20%~70%、21%~70%、22%~70%、23%~70%、24%~70%、25%~70%、26%~70%、27%~70%、28%~70%、29%~70%、30%~70%、31%~70%、32%~70%、33%~70%、34%~70%、35%~70%、36%~70%、37%~70%、38%~70%、39%~70%、40%~70%、41%~70%、42%~70%、43%~70%、44%~70%、45%~70%、46%~70%、47%~70%、48%~70%、49%~70%、50%~70%、51%~70%、52%~70%、53%~70%、54%~70%、55%~70%、56%~70%、57%~70%、58%~70%、59%~70%、60%~70%、61%~70%、62%~70%、63%~70%、64%~70%、65%~70%、66%~70%、67%~70%、68%~70%、69%~70%、1%~60%、2%~60%、3%~60%、4%~60%、5%~60%、6%~60%、7%~60%、8%~60%、9%~60%、10%~60%、11%~60%、12%~60%、13%~60%、14%~60%、15%~60%、16%~60%、17%~60%、18%~60%、19%~60%、20%~60%、21%~60%、22%~60%、23%~60%、24%~60%、25%~60%、26%~60%、27%~60%、28%~60%、29%~60%、30%~60%、31%~60%、32%~60%、33%~60%、34%~60%、35%~60%、36%~60%、37%~60%、38%~60%、39%~60%、40%~60%、41%~60%、42%~60%、43%~60%、44%~60%、45%~60%、46%~60%、47%~60%、48%~60%、49%~60%、50%~60%、51%~60%、52%~60%、53%~60%、54%~60%、55%~60%、56%~60%、57%~60%、58%~60%、59%~60%、1%~50%、2%~50%、3%~50%、4%~50%、5%~50%、6%~50%、7%~50%、8%~50%、9%~50%、10%~50%、11%~50%、12%~50%、13%~50%、14%~50%、15%~50%、16%~50%、17%~50%、18%~50%、19%~50%、20%~50%、21%~50%、22%~50%、23%~50%、24%~50%、25%~50%、26%~50%、27%~50%、28%~50%、29%~50%、30%~50%、31%~50%、32%~50%、33%~50%、34%~50%、35%~50%、36%~50%、37%~50%、38%~50%、39%~50%、40%~50%、41%~50%、42%~50%、43%~50%、44%~50%、45%~50%、46%~50%、47%~50%、48%~50%、49%~50%、1%~40%、2%~40%、3%~40%、4%~40%、5%~40%、6%~40%、7%~40%、8%~40%、9%~40%、10%~40%、11%~40%、12%~40%、13%~40%、14%~40%、15%~40%、16%~40%、17%~40%、18%~40%、19%~40%、20%~40%、21%~40%、22%~40%、23%~40%、24%~40%、25%~40%、26%~40%、27%~40%、28%~40%、29%~40%、30%~40%、31%~40%、32%~40%、33%~40%、34%~40%、35%~40%、36%~40%、37%~40%、38%~40%、39%~40%、1%~30%、2%~30%、3%~30%、4%~30%、5%~30%、6%~30%、7%~30%、8%~30%、9%~30%、10%~30%、11%~30%、12%~30%、13%~30%、14%~30%、15%~30%、16%~30%、17%~30%、18%~30%、19%~30%、20%~30%、21%~30%、22%~30%、23%~30%、24%~30%、25%~30%、26%~30%、27%~30%、28%~30%、29%~30%、1%~29%、2%~29%、3%~29%、4%~29%、5%~29%、6%~29%、7%~29%、8%~29%、9%~29%、10%~29%、11%~29%、12%~29%、13%~29%、14%~29%、15%~29%、16%~29%、17%~29%、18%~29%、19%~29%、20%~29%、21%~29%、22%~29%、23%~29%、24%~29%、25%~29%、26%~29%、27%~29%、28%~29%、1%~28%、2%~28%、3%~28%、4%~28%、5%~28%、6%~28%、7%~28%、8%~28%、9%~28%、10%~28%、11%~28%、12%~28%、13%~28%、14%~28%、15%~28%、16%~28%、17%~28%、18%~28%、19%~28%、20%~28%、21%~28%、22%~28%、23%~28%、24%~28%、25%~28%、26%~28%、27%~28%、1%~27%、2%~27%、3%~27%、4%~27%、5%~27%、6%~27%、7%~27%、8%~27%、9%~27%、 10%~27%、11%~27%、12%~27%、13%~27%、14%~27%、15%~27%、16%~27%、17%~27%、18%~27%、19%~27%、20%~27%、21%~27%、22%~27%、23%~27%、24%~27%、25%~27%、26%~27%、1%~26%、2%~26%、3%~26%、4%~26%、5%~26%、6%~26%、7%~26%、8%~26%、9%~26%、10%~26%、11%~26%、12%~26%、13%~26%、14%~26%、15%~26%、16%~26%、17%~26%、18%~26%、19%~26%、20%~26%、21%~26%、22%~26%、23%~26%、24%~26%、25%~26%、1%~25%、2%~25%、3%~25%、4%~25%、5%~25%、6%~25%、7%~25%、8%~25%、9%~25%、10%~25%、11%~25%、12%~25%、13%~25%、14%~25%、15%~25%、16%~25%、17%~25%、18%~25%、19%~25%、20%~25%、21%~25%、22%~25%、23%~25%、24%~25%、1%~24%、2%~24%、3%~24%、4%~24%、5%~24%、6%~24%、7%~24%、8%~24%、9%~24%、10%~24%、11%~24%、12%~24%、13%~24%、14%~24%、15%~24%、16%~24%、17%~24%、18%~24%、19%~24%、20%~24%、21%~24%、22%~24%、23%~24%、1%~23%、2%~23%、3%~23%、4%~23%、5%~23%、6%~23%、7%~23%、8%~23%、9%~23%、10%~23%、11%~23%、12%~23%、13%~23%、14%~23%、15%~23%、16%~23%、17%~23%、18%~23%、19%~23%、20%~23%、21%~23%、22%~23%、1%~22%、2%~22%、3%~22%、4%~22%、5%~22%、6%~22%、7%~22%、8%~22%、9%~22%、10%~22%、11%~22%、12%~22%、13%~22%、14%~22%、15%~22%、16%~22%、17%~22%、18%~22%、19%~22%、20%~22%、21%~22%、1%~21%、2%~21%、3%~21%、4%~21%、5%~21%、6%~21%、7%~21%、8%~21%、9%~21%、10%~21%、11%~21%、12%~21%、13%~21%、14%~21%、15%~21%、16%~21%、17%~21%、18%~21%、19%~21%、20%~21%、1%~20%、2%~20%、3%~20%、4%~20%、5%~20%、6%~20%、7%~20%、8%~20%、9%~20%、10%~20%、11%~20%、12%~20%、13%~20%、14%~20%、15%~20%、16%~20%、17%~20%、18%~20%、19%~20%、1%~19%、2%~19%、3%~19%、4%~19%、5%~19%、6%~19%、7%~19%、8%~19%、9%~19%、10%~19%、11%~19%、12%~19%、13%~19%、14%~19%、15%~19%、16%~19%、17%~19%、18%~19%、1%~18%、2%~18%、3%~18%、4%~18%、5%~18%、6%~18%、7%~18%、8%~18%、9%~18%、10%~18%、11%~18%、12%~18%、13%~18%、14%~18%、15%~18%、16%~18%、17%~18%、1%~17%、2%~17%、3%~17%、4%~17%、5%~17%、6%~17%、7%~17%、8%~17%、9%~17%、10%~17%、11%~17%、12%~17%、13%~17%、14%~17%、15%~17%、16%~17%、1%~16%、2%~16%、3%~16%、4%~16%、5%~16%、6%~16%、7%~16%、8%~16%、9%~16%、10%~16%、11%~16%、12%~16%、13%~16%、14%~16%、15%~16%、1%~15%、2%~15%、3%~15%、4%~15%、5%~15%、6%~15%、7%~15%、8%~15%、9%~15%、10%~15%、11%~15%、12%~15%、13%~15%、14%~15%、1%~14%、2%~14%、3%~14%、4%~14%、5%~14%、6%~14%、7%~14%、8%~14%、9%~14%、10%~14%、11%~14%、12%~14%、13%~14%、1%~13%, 2%~13%, 3%~13%, 4%~13%, 5%~13%, 6%~13%, 7%~13%, 8%~13%, 9%~13%, 10%~13%, 11%~13%, 12%~13%, 1%~12%, 2%~12%, 3%~12%, 4%~12%, 5%~12%, 6%~12%, 7%~12% , 8%~12%, 9%~12%, 10%~12%, 11%~12%, 1%~11%, 2%~11%, 3%~11%, 4%~11%, 5%~11%, 6%~11%, 7%~11%, 8%~11%, 9%~11%, 10%~11%, 1%~10%, 2%~10%, 3%~10%, 4%~10%, 5%~10% , 6%~10%, 7%~10%, 8%~10%, 9%~10%, 1%~9%, 2%~9%, 3%~9%, 4%~9%, 5%~9%, 6%~9%, 7%~9%, 8%~9%, 1%~8%, 2%~8%, 3%~8%, 4%~8%, 5%~8%, 6%~8%, 7%~8%, 1%~7%, 2%~7%, 3%~7 %, 4%-7%, 5%-7%, 6%-7%, 1%-6%, 2%-6%, 3%-6%, 4%-6%, 5%-6%, 1%-5%, 2%-5%, 3%-5%, 4%-5%, 1%-4%, 2%-4%, 3%-4%, 1%-3%, 2%-3%, or 1%-2% higher ethanol to glycerol ratios.

[0070]

[0081] In some embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly faster fermentation rate than typical yeast strains used in fermentation (e.g., Saccharomyces sp. strain Y1027) at acetic acid concentrations of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at lactic acid concentrations of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. In certain embodiments, one or more of the yeast strains and derivatives thereof described herein have a fermentation rate that is statistically significantly faster than typical yeast strains used in fermentation (e.g., Saccharomyces sp. strain Y1027) at a temperature of 33° C., at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. In another embodiment, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly faster fermentation rate than typical yeast strains used in fermentation (e.g., Saccharomyces sp. strain Y1027) at a temperature of 38°C, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. The inventors surprisingly find that the yeast strains described herein produce statistically significantly faster fermentation rates at low pH with higher organic acid concentrations than Y1027 under the same fermentation conditions. The inventors surprisingly find that the derivatives described herein produce statistically significantly faster fermentation rates at low pH with higher organic acid concentrations than Y1027 under the same conditions.

[0071]

[0082] In some embodiments, one or more of the yeast strains and derivatives thereof described herein exhibit at least about 0%, 1%, 10% or more of the following lactic acid concentrations after 24 hours of fermentation at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9, at least about 0%, 1%, 10% or more of the following lactic acid concentrations after 24 hours of fermentation: a) a yeast strain used in fermentation (e.g., Saccharomyces sp. strain Y1027) , 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, or 450% faster fermentation rate. In some embodiments, one or more of the yeast strains and derivatives thereof described herein exhibit at most about 10%, 20% or more lactic acid content greater than that of a typical yeast strain used in fermentation (e.g., Saccharomyces sp. strain Y1027) after 24 hours of fermentation at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. , 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, or 450% faster fermentation rate. In some embodiments, one or more of the yeast strains and derivatives thereof described herein are cultured at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at an acetic acid concentration of 0.50% w / v to 1.0% w / v,At a lactic acid concentration of preferably 0.36% w / v to 0.90% w / v, and at a pH in the range of pH 3.5 to pH 5.0, preferably pH 4.2 to pH 4.9, after 24 hours of fermentation, the yield of the lactic acid obtained is about 0% to 450% (i.e., about 0% to about 450%), 1% to 450%, 10% to 450%, 20% to 450%, 30% to 450%, 40% to 450%, 50% to 450%, 60% to 450%, 70% to 450%, 80% to 450%, 90% to 450%, 100% to 450%, 110% to 450%, 120% to 450%, 130% to 450%, 140% to 450%, 150% to 450%, 160% to 450%, 170% to 450%, 180% to 450%, 190% to 450%, 200% to 450%, 210% to 450%, 220% to 450%, 230% to 450%, 240% to 450%, 250% to 450%, 260% to 450%, 270% to 450%, 280% to 450%, 290% to 450%, 300% to 450%, 310% to 450%, 320% to 450%, 330% to 450%, 340% to 450%, 350% to 450%, 360% to 450%, 370% to 0%, 120%~450%, 130%~450%, 140%~450%, 150%~450%, 160%~450%, 170%~450%, 180%~450%, 190%~450%, 200%~450%, 210%~450%, 220%~450%, 230%~450%, 2 40%~450%, 250%~450%, 260%~450%, 270%~450%, 280%~450%, 290%~450%, 300%~450%, 310%~450%, 320%~450%, 330%~450%, 340%~450%, 350%~450%, 360%~450% 50%, 370%~450%, 380%~450%, 390%~450%, 400%~450%, 410%~450%, 420%~450%, 430%~450%, 440%~450%, 0%~400%, 1%~400%, 10%~400%, 20%~400%, 30%~40 0%, 40%~400%, 50%~400%, 60%~400%, 70%~400%, 80%~400%, 90%~400%, 100%~400%, 110%~400%, 120%~400%, 130%~400%, 140%~400%, 150%~400%, 160%~40 0%, 170%~400%, 180%~400%, 190%~400%, 200%~400%, 210%~400%, 220%~400%, 230%~400%, 240%~400%, 250%~400%, 260%~400%, 270%~400%, 280%~400%, 2 90%~400%, 300%~400%, 310%~400%, 320%~400%, 330%~400%, 340%~400%, 350%~400%, 360%~400%, 370%~400%, 380%~400%, 390%~400%, 0%~300%, 1%~300%,10%~300%, 20%~300%, 30%~300%, 40%~300%, 50%~300%, 60%~300%, 70%~300%, 80%~300%, 90%~300%, 100%~300%, 110%~300%, 120%~300%, 130%~300%, 140%~300%, 150%~300%, 160%~300%, 170%~300%, 1 80%~300%, 190%~300%, 200%~300%, 210%~300%, 220%~300%, 230%~300%, 240%~300%, 250%~300%, 260%~300%, 270%~300%, 280%~300%, 290%~300%, 0%~200%, 1%~200%, 10%~200%, 20%~200%, 30%~200%, 40%~200%, 50%~200%, 60%~200%, 70%~200%, 80%~200%, 90%~200%, 100%~200%, 110%~200%, 120%~200%, 130%~200%, 140%~200%, 150%~200%, 160%~200%, 170%~200%, 180%~200%, 190%~200%, 0%~100%, 1% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 0% to 50%, 1% to 50%, 10% to 50%, 20% to 50%, 30% to 50%, 40% to 50%, 0% to 10%, or 1% to 10% faster fermentation rate.

[0072]

[0083] In some embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher organic acid tolerance at low pH than typical yeast strains used in fermentation (e.g., Saccharomyces sp. strain Y1027). Organic acid tolerance at low pH may be exhibited by one or more of high ethanol yield, high fructose utilization, high ethanol to glycerol ratio, and fast fermentation rate. In certain embodiments, one or more of the yeast strains and derivatives thereof described herein are administered at a pH of about 3.0-5.5, 3.5-5.5, 4.0-5.5, 4.5-5.5, 5.0-5.5, 3.0-5.0, 3.5-5.0, 4.0-5.0, 4.5-5.0, 3.0-4.5, 3.5-4.5, 4.0-4.5, 3.0-4.0, 3.5-4.0, or 3.0-3.5 at a concentration of about 0.1%-1.5%, 0.2%-1.5%, 0.3%-1.5%, 0.4%-1.5%, 0.5%-1.5%, 0.6%-1.5%, 0.7%-1.5%, 0.8%-1.5%, 0.9%-1.5%, 10%-1.5%, 11%-1.5%, 12%-1.5%, 13%-1.5%, 14%-1.5%, 15%-1.5%, 16%-1.5%, 17%-17%. 5%, 0.5%~1.5%, 0.6%~1.5%, 0.7%~1.5%, 0.8%~1.5%, 0.9%~1.5%, 1.0%~1.5%, 1.1%~1.5%, 1.2%~1.5%, 1.3%~1.5%, 1.4%~1.5%, 0.1%~1.4%, 0.2%~1.4%, 0.3%~1.4%, 0.4%~1.4%, 0.5%~1.4%, 0.6%~1.4%, 0.7%~1.4%, 0.8%~1.4%, 0.9%~1.4%, 1.0%~1.4%, 1. 1%~1.4%, 1.2%~1.4%, 1.3%~1.4%, 0.1%~1.3%, 0.2%~1.3%, 0.3%~1.3%, 0.4%~1.3%, 0.5%~1.3%, 0.6%~1.3%, 0.7%~1.3%, 0.8%~1.3%, 0.9%~1.3%, 1.0%~1.3%, 1.1%~1.3%, 1.2%~1.3%, 0.1%~1.2%, 0.2%~1.2%, 0.3%~1.2%, 0.4%~1.2%, 0.5%~1.2%, 0.6%~1. 2%, 0.7%~1.2%, 0.8%~1.2%, 0.9%~1.2%, 1.0%~1.2%, 1.1%~1.2%, 0.1%~1.1%, 0.2%~1.1%, 0.3%~1.1%, 0.4%~1.1%, 0.5%~1.1%, 0.6%~1.1%, 0.7%~1.1%, 0.8%~1.1%, 0.9%~1.1%, 1.0%~1.1%, 0.1%~1.0%, 0.2%~1.0%, 0.3%~1.0%, 0.4%~1.0%, 0.5%~1.0%, 0.6%~1.0%, 0.7%~1.0%, 0.8%~1.0%, 0.9%~1.0%, 0.1%~0.9%, 0.2%~0.9%, 0.3%~0.9%, 0.4%~0.9%, 0.5%~0.9%, 0.6%~0.9%, 0.7%~0.9%, 0.8%~0.9%, 0.1%~0.8%, 0.2%~0.8%, 0.3%~0.8%, 0.4%~0.8%, 0.5%~0.8%, 0.6%~0.8%, 0.7%~0.8%, 0.1%~0.7%, 0.2%~0.7%, 0.3%~0. The yeast strains described herein can tolerate organic acid concentrations (e.g., acetic acid and lactic acid) of 7%, 0.4%-0.7%, 0.5%-0.7%, 0.6%-0.7%, 0.1%-0.6%, 0.2%-0.6%, 0.3%-0.6%, 0.4%-0.6%, 0.5%-0.6%, 0.1%-0.5%, 0.2%-0.5%, 0.3%-0.5%, 0.4%-0.5%, 0.1%-0.4%, 0.2%-0.4%, 0.3%-0.4%, 0.1%-0.3%, 0.2%-0.3%, or 0.1%-0.2%. The inventors surprisingly found that the yeast strains and their derivatives described herein have statistically significantly higher organic acid tolerance at low pH compared to Y1027 under the same fermentation conditions. .

[0073]

[0084] In some embodiments, one or more of the yeast strains and derivatives thereof described herein have one or more of the defining characteristics described herein. In some embodiments, one or more of the yeast strains and derivatives thereof described herein have one or more of the defining characteristics described herein at temperatures between 20° C. and 40° C., preferably between 33° C. and 38° C., at acetic acid concentrations of 0.1% w / v and 0.5% w / v, preferably at acetic acid concentrations of 0.25% w / v, at lactic acid concentrations of 0.50% w / v and 1.0% w / v, preferably at lactic acid concentrations of 0.36% w / v and 0.90% w / v, and at a pH between 3.5 and 5.0, preferably between 4.2 and 4.9. For example, in some embodiments, one or more of the yeast strains and derivatives thereof described herein have a statistically significantly higher ethanol yield, a statistically significantly higher fructose utilization, a statistically significant higher ethanol to glycerol ratio, a statistically significantly faster fermentation rate, a statistically significantly higher temperature tolerance, and a statistically significantly higher organic acid tolerance than typical yeast strains used in fermentation (e.g., Saccharomyces strain Y1027).

[0074]

[0085] The yeast strains and derivatives thereof described herein can be in any feasible form, including friable, dry (including active dry and instant), pressed, cream form, yeast culture, etc. In certain embodiments, the Saccharomyces cerevisiae yeast strain or derivative thereof is a dry yeast, such as an active dry yeast. In another embodiment, the Saccharomyces cerevisiae yeast strain or derivative thereof is a pressed yeast. In another embodiment, the Saccharomyces cerevisiae yeast strain or derivative thereof is a cream yeast.

[0075] A yeast strain

[0086] One embodiment described herein is a yeast strain of the genus Saccharomyces deposited under NRRL Patent Deposit Designation No. Y-68182; Y2084 (deposited under NRRL Patent Deposit Designation No. Y-68183); Y2086 (deposited under NRRL Patent Deposit Designation No. Y-68184); or Y2087 (deposited under NRRL Patent Deposit Designation No. Y-68185). These yeast strains are referred to herein as "yeast strains," "yeast strains of the genus Saccharomyces," or by these designations (i.e., "Y2083" or "Y-68182"; "Y2084" or "Y-68183"; "Y2086" or "Y-68184"; "Y2087" or "Y-68185"). The yeast strains (i.e., Y2083, Y2084, Y2086, and Y2087) were generated from one or more different yeast strains of the genus Saccharomyces by one or more of the methods shown in Figure 1. In one aspect, the yeast strains described herein comprise one or more distinct characteristics including higher ethanol yield, higher fructose utilization, higher ethanol to glycerol ratio, higher temperature tolerance, higher organic acid tolerance, and faster fermentation rate than other yeast strains and typical yeast strains used in fermentation, particularly compared to yeast strain Y1027, the yeast strain used in the product Fali® M. Representative samples of the yeast strains are deposited under the above-listed accession numbers at the Agricultural Research Service Patent Culture Collection (NRRL), Northern Regional Research Center, 1815 University Street, Peoria, IL, USA.

[0076] b. Yeast strain derivative

[0087] Another embodiment described herein is a derivative of a yeast strain of the genus Saccharomyces selected from the yeast strains of the genus Saccharomyces deposited under NRRL Patent Deposit Designation No. Y-68182; Y2084 (NRRL Patent Deposit Designation No. Y-68183); Y2086 (NRRL Patent Deposit Designation No. Y-68184); and Y2087 (NRRL Patent Deposit Designation No. Y-68185). In one aspect, the derivative comprises one or more distinct characteristics including higher ethanol yield, higher fructose utilization, higher ethanol to glycerol ratio, higher temperature tolerance, higher organic acid tolerance, and faster fermentation rate than other yeast strains and typical yeast strains used in fermentation, particularly compared to yeast strain Y1027, the yeast strain used in the product Fali® M. In another aspect, the derivative can be a parent strain and can be used to generate other derivatives.

[0077] c. Mutant yeast and derivatives

[0088] Another embodiment described herein is a mutant of a Saccharomyces yeast strain selected from the Saccharomyces yeast strains deposited at Y2083 (deposited under NRRL Patent Deposit Designation No. Y-68182); Y2084 (deposited under NRRL Patent Deposit Designation No. Y-68183); Y2086 (deposited under NRRL Patent Deposit Designation No. Y-68184); Y2087 (deposited under NRRL Patent Deposit Designation No. Y-68185); or a derivative thereof. In one embodiment, the Saccharomyces yeast strains deposited at Y2083, Y2084, Y2086, and Y2087 can be derived from one or more different Saccharomyces yeast strains by the process shown in FIG. 1D, such that one or more of Y2083, Y2084, Y2086, or Y2087 can be a mutant yeast strain. In one aspect, the mutant yeast strains and mutant derivatives comprise one or more distinct characteristics, including higher ethanol yields than other yeast strains and typical yeast strains used in fermentation, higher fructose utilization, higher ethanol to glycerol ratios, higher temperature tolerance, higher organic acid tolerance, and faster fermentation rates, particularly compared to yeast strain Y1027, the yeast strain used in the product Fali® M. In another aspect, the mutant yeast strains and mutant derivatives can be parent strains and used to generate other derivatives. An example of mutagenesis is shown in FIG. 1D. In one embodiment, the mutant yeast strains and mutant derivatives described herein were derived from the method shown in FIG. 1D.

[0078]

[0089] Mutant yeast strains and mutant derivatives can be generated by contacting any of the yeast strains described herein with a mutagen. The mutagen can be any mutagen known in the art. For example, the mutagen can be ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methyl methanesulfonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3-(ethyl-2-chloroethyl)aminopropylamino]acridine 2 (ICR-170), nitrogen mustard, etc.

[0079] d. Evolved yeast and derivatives

[0090] Another embodiment described herein is an evolved yeast strain or derivative of a Saccharomyces yeast strain selected from the Saccharomyces yeast strains deposited under NRRL Patent Deposit Designation No. Y-68182; Y2084 (deposited under NRRL Patent Deposit Designation No. Y-68183); Y2086 (deposited under NRRL Patent Deposit Designation No. Y-68184); and Y2087 (deposited under NRRL Patent Deposit Designation No. Y-68185). In one embodiment, the Saccharomyces yeast strains deposited under Y2083, Y2084, Y2086, and Y2087 can be derived from one or more different Saccharomyces yeast strains by the process shown in FIG. 1C, such that one or more of Y2083, Y2084, Y2086, or Y2087 can be evolved yeast strains. In one aspect, the evolved yeast strains and evolved derivatives comprise one or more distinct characteristics, including higher ethanol yields than other yeast strains used in fermentation and typical yeast strains, higher fructose utilization, higher ethanol to glycerol ratios, higher temperature tolerance, higher organic acid tolerance, and faster fermentation rates, particularly compared to yeast strain Y1027, the yeast strain used in the product Fali® M. In another aspect, the evolved yeast strains and evolved derivatives can be parent strains and used to generate other derivatives. An example of evolution is shown in FIG. 1C. In one embodiment, the evolved yeast strains and evolved derivatives described herein were derived from the method shown in FIG. 1C.

[0080]

[0091] Evolved yeast strains and evolved derivatives can be generated by applying selective pressure to any of the yeast strains described herein. The selective pressure can be negative (reducing the occurrence of a trait) or positive (increasing the rate of a trait). The selective pressure can be constant or intermittent. Selective pressure can be applied by altering the presence of resources (e.g., starch and sugars) and / or by altering environmental conditions (e.g., temperature, presence of organic acids, pH, and length of fermentation).

[0081] e. Recombinant yeast and derivatives

[0092] Additional embodiments described herein are recombinant yeast strains and recombinant derivatives. Recombinant yeast strains and derivatives can be derived from the Saccharomyces cerevisiae yeast strains described herein or their derivatives. The recombinant yeast can include modifications that silence gene expression, enhance gene expression, introduce genes, delete genes, or manipulate the sequence of genes. An aspect described herein is a method for producing a recombinant yeast strain or its derivative. The method can include using recombinant DNA technology to introduce a nucleic acid into a Saccharomyces yeast cell described herein. Methods for introducing nucleic acids into Saccharomyces yeast cells, and particularly Saccharomyces strains, are known in the art and are described, for example, in Ausubel et al. (1997), Current Protocols in Molecular Biology, 2:13.7.1-13.7.7 and Yang and Blenner (2020), Curr Opin Biotechnol., 66:255-266, both of which are incorporated herein by reference. The method may include altering a nucleic acid sequence of a Saccharomyces yeast or derivative described herein using gene editing or similar techniques.

[0082] 3. Composition

[0093] Additionally, compositions comprising the aforementioned yeast strains or derivatives thereof are provided herein. In one embodiment, the composition may comprise a yeast strain described herein, a derivative described herein, or a combination thereof, and at least one naturally occurring and / or non-naturally occurring component. For example, the composition may comprise one or more components selected from surfactants, emulsifiers, gums, sweeteners, antioxidants, starch, metabolites, and other processing aids. In one embodiment, the composition may comprise a dried yeast strain and / or any of its derivatives, starch, and an emulsifier. In another embodiment, the composition may comprise a cream yeast strain and / or any of its derivatives, glycerol, and xanthan gum. In one embodiment, an enriched culture of any of the yeast strains described herein is provided, enriched to 90%-99% purity. In another embodiment, a pure culture of any of the yeast strains described herein is provided, and is 100% pure, so that no additional yeast is present.

[0083]

[0094] The composition can include a Saccharomyces yeast as described herein and any suitable surfactant. In one embodiment, the surfactant is an anionic surfactant, a cationic surfactant, and / or a nonionic surfactant.

[0084]

[0095] The composition may include a yeast of the genus Saccharomyces described herein and any suitable emulsifier. In one embodiment, the emulsifier is a fatty acid ester of sorbitan. In one embodiment, the emulsifier is selected from the group consisting of sorbitan monostearate (SMS), citric acid esters of monoglycerides or diglycerides, polyglycerol esters, and fatty acid esters of propylene glycol.

[0085]

[0096] The composition may include Olindronal SMS, Olindronal SK, or Olindronal SPL, which include the Saccharomyces yeast described herein and compositions related to European Patent No. 1,724,336. These products are commercially available from Bussetti of Austria for active dry yeast.

[0086]

[0097] The compositions may include a yeast of the genus Saccharomyces as described herein and any suitable gum. In one embodiment, the gum is gum acacia, particularly for cream, pressed, and dry yeast.

[0087]

[0098] The composition may include a Saccharomyces yeast as described herein and any suitable sweetening agent. In one embodiment, the sweetening agent is methylcellulose or carboxymethylcellulose.

[0088]

[0099] The compositions may include a Saccharomyces yeast as described herein and any suitable antioxidant. In one embodiment, the antioxidant is butylated hydroxyanisole (BHA) and / or butylated hydroxytoluene (BHT), or ascorbic acid (vitamin C), particularly for active dry yeast.

[0089] [000100] The composition may include a Saccharomyces yeast as described herein and any suitable starch. In one embodiment, the starch is potato starch, corn starch, or pea starch.

[0090] [000101] The composition can include a yeast of the genus Saccharomyces as described herein and any suitable yeast protectant. In one embodiment, the protectant is glycerol. a. Composition characteristics [000102] In one aspect, the compositions comprise one or more distinct characteristics, including higher ethanol production, higher fructose utilization, higher ethanol to glycerol ratio, higher temperature tolerance, higher organic acid tolerance, and faster fermentation rate than other yeast products and typical yeast products used in fermentation, particularly compared to the yeast product Fali® M. Additionally, the compositions described herein can be readily distinguished from other yeast products used in the ethanol industry that do not possess the ethanol production capabilities and distinct characteristics of the compositions described herein.

[0091] [000103] In some embodiments, the compositions described herein have a higher ethanol yield than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). In some embodiments, the compositions described herein have a higher ethanol yield than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at temperatures ranging from 20°C to 40°C, preferably from 33°C to 38°C. In certain embodiments, the compositions described herein have a higher ethanol yield than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at a temperature of 33° C. In another embodiment, the compositions described herein have a higher ethanol yield than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at a temperature of 38° C.

[0092] [000104] In some embodiments, the compositions described herein contain typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super After 48 hours of fermentation, the concentration of at least about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0% of the fermented cereals containing EDV, Superstart™, DistilaMax™ CN, PE-2, and CAT-1 was at least about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0% of the cereals containing EDV, Superstart™, DistilaMax™ CN, PE-2, and CAT-1 was at least about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 1 %, 21.0%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75% higher ethanol yield. In some embodiments, the compositions described herein provide a fermentation product that exhibits at most about 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0%, 21.0%, 22.0%, 23.0%, 24.0%, 25.0%, 26.0%, 27.0%, 28.0%, 29.0%, 30.0%, 31.0%, 32.0%, 33.0%, 34.0%, 35.0%, 36.0%, 37.0%, 38.0%, 39.0%, 40.0%, 41.0%, 42.0%, 43.0%, 44.0%, 45.0%, 46.0%, 47.0%, 48.0%, 49.0%, 50.0%, 51.0%, 52.0%, 53.0%, 54.0%, 55.0%, 56.0%, 57.0%, 58.0%, 59.0%, 60.0%, 61.0%, 62.0%, 63.0%, 64.0%, 65.0%, 66.0%, 67.0%, 68.0%, 69.0%, 70.0%, 71.0%, 72.0%, 73.0%, 74.0%, 75.0%, 76.0%, 77.0%, 78.0%, 79.0%, 80.0%, 81.0%, 82.0%, 83.0%,0%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75% higher ethanol yield. In some embodiments, the compositions described herein provide a concentration of about 0.1% to 75% (i.e., about 0.1% to about 75%), 0.2% to 75%, 0.3% to 75%, 0.4% to 75%, 0.5% to 75%, 0.6% to 75%, 0.7% to 75%, or 100% of a typical yeast product used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) after 48 hours of fermentation. 0.8%~75%, 0.9%~75%, 1%~75%, 2%~75%, 3%~75%, 4%~75%, 5%~75%, 6%~75%, 7%~75%, 8%~75%, 9%~75%, 10%~75%, 15%~75%, 20%~75%, 25%~75%, 30%~75%, 35%~75%, 40%~75%, 45%~75%, 50%~75%, 55%~75% 5%, 60%~75%, 0.1%~70%, 0.2%~70%, 0.3%~70%, 0.4%~70%, 0.5%~70%, 0.6%~70%, 0.7%~70%, 0.8%~70%, 0.9%~70%, 1%~70%, 2%~70%, 3%~70%, 4%~70%, 5%~70%, 6%~70%, 7%~70%, 8%~70%, 9%~70%, 10% ~70%, 15%~70%, 20%~70%, 25%~70%, 30%~70%, 35%~70%, 40%~70%, 45%~70%, 50%~70%, 55%~70%, 60%~70%, 0.1%~60%, 0.2%~60%, 0.3%~60%, 0.4%~60%, 0.5%~60%, 0.6%~60%, 0.7%~60%, 0.8%~60%, 0.9%~60%、1%~60%、2%~60%、3%~60%、4%~60%%、5%~60%、6%~60%、7%~60%、8%~60%、9%~60%、10%~60%、15%~60%、20%~60%、25%~60%、30%~60%、35%~60%、40%~60%、45%~60%、50%~60%、0.1%~50%、0.2%~50%、0.3%~50%、0.4%~50%、0.5%~50%、0.6%~50%、0.7%~50%、0.8%~50%、0.9%~50%、1%~50%、2%~50%、3%~50%、4%~50%%、5%~50%、6%~50%、7%~50%、8%~50%、9%~50%、10%~50%、15%~50%、20%~50%、25%~50%、30%~50%、35%~50%、40%~50%、0.1%~40%、0.2%~40%、0.3%~40%、0.4%~40%、0.5%~40%、0.6%~40%、0.7%~40%、0.8%~40%、0.9%~40%、1%~40%、2%~40%、3%~40%、4%~40%%、5%~40%、6%~40%、7%~40%、8%~40%、9%~40%、10%~40%、15%~40%、20%~40%、25%~40%、30%~40%、0.1%~30%、0.2%~30%、0.3%~30%、0.4%~30%、0.5%~30%、0.6%~30%、0.7%~30%、0.8%~30%、0.9%~30%、1%~30%、2%~30%、3%~30%、4%~30%%、5%~30%、6%~30%、7%~30%、8%~30%、9%~30%、10%~30%、15%~30%、20%~30%、0.1%~20%、0.2%~20%、0.3%~20%、0.4%~20%、0.5%~20%、0.6%~20%、0.7%~20%、0.8%~20%、0.9%~20%、1%~20%、2%~20%、3%~20%、4%~20%、5%~20%、6%~20%、7%~20%、8%~20%、9%~20%、10%~20%、0.2%~19%、0.3%~19%、0.4%~19%、0.5%~19%、0.6%~19%、0.7%~19%、0.8%~19%、0.9%~19%、1%~19%、2%~19%、3%~19%、4%~19%、5%~19%、6%~19%、7%~19%、8%~19%、9%~19%、10%~19%、0.2%~18%、0.3%~18%、0.4%~18%、0.5%~18%、0.6%~18%、0.7%~18%、0.8%~18%、0.9%~18%、1%~18%、2%~18%、3%~18%、4%~18%、5%~18%、6%~18%、7%~18%、8%~18%、9%~18%、10%~18%、0.2%~17%、0.3%~17%、0.4%~17%、0.5%~17%、0.6%~17%、0.7%~17%、0.8%~17%、0.9%~17%、1%~17%、2%~17%、3%~17%、4%~17%、5%~17%、6%~17%、7%~17%、8%~17%、9%~17%、10%~17%、0.2%~16%、0.3%~16%、0.4%~16%、0.5%~16%、0.6%~16%、0.7%~16%、0.8%~16%、0.9%~16%、1%~16%、2%~16%、3%~16%、4%~16%、5%~16%、6%~16%、7%~16%、8%~16%、9%~16%、10%~16%、0.2%~15%、0.3%~15%、0.4%~15%、0.5%~15%、0.6%~15%、0.7%~15%、0.8%~15%、0.9%~15%、1%~15%、2%~15%、3%~15%、4%~15%、5%~15%、6%~15%、7%~15%、8%~15%、9%~15%、10%~15%、0.1%~14%、0.2%~14%、0.3%~14%、0.4%~14%、0.5%~14%、0.6%~14%、0.7%~14%、0.8%~14%、0.9%~14%、1%~14%、2%~14%、3%~14%、4%~14%、5%~14%、6%~14%、7%~14%、8%~14%、9%~14%、10%~14%、0.1%~13%、0.2%~13%、0.3%~13%、0.4%~13%、0.5%~13%、0.6%~13%、0.7%~13%、0.8%~13%、0.9%~13%、1%~13%、2%~13%、3%~13%、4%~13%、5%~13%、6%~13%、7%~13%、8%~13%、9%~13%、10%~13%、0.1%~12%、0.2%~12%、0.3%~12%、0.4%~12%、0.5%~12%、0.6%~12%、0.7%~12%、0.8%~12%、0.9%~12%, 1%~12%, 2%~12%, 3%~12%, 4%~12%, 5%~12%, 6%~12%, 7%~12%, 8%~12%, 9%~12%, 10%~12%, 0.1%~11%, 0.2%~11%, 0.3%~11%, 0.4%~11%, 0.5%~11%, 0.6%~11%, 0.7%~11%, 0.8%~11%, 0.9%~11%, 1%~11%, 2%~11%, 3%~11%, 4%~11%, 5%~11%, 6%~11 %, 7%-11%, 8%-11%, 9%-11%, 10%-11%, 0.1%-0.2%, 0.1%-0.3%, 0.1%-0.4%, 0.1%-0.5%, 0.1%-0.6%, 0.1%-0.7%, 0.1%-0.8%, 0.1%-0.9%, 0.1%-1%, 0.1%-2%, 0.1%-3%, 0.1%-4%, 0.1%-5%, 0.1%-6%, 0.1%-7%, 0.1%-8%, or 0.1%-9% higher ethanol yield.

[0093] In some embodiments, the compositions described herein have a higher fructose utilization than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). In some embodiments, the compositions described herein have a higher fructose utilization than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at temperatures ranging from 20°C to 40°C, preferably from 33°C to 38°C. In certain embodiments, the compositions described herein have a higher fructose utilization at a temperature of 33° C. than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). In another embodiment, the compositions described herein have a higher fructose utilization at a temperature of 38° C. than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1).

[0094] [000106] In some embodiments, the compositions described herein exhibit a yield of at least about 0.01g after 48 hours of fermentation for typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1).5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% higher fructose utilization. In some embodiments, the compositions described herein may be used in combination with typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super After 48 hours of fermentation, the fructose utilization of the fermented soybeans is at most about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% higher than that of the fermented soybeans (Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). In some embodiments, one or more of the yeast strains and derivatives thereof described herein exhibit a yield of about 0.5% to 55% (i.e., about 0.5%) after 48 hours of fermentation relative to a typical yeast product used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1).5%~approximately 55%), 1%~55%, 2%~55%, 3%~55%, 4%~55%, 5%~55%, 6%~55%, 7%~55%, 8%~55%, 9%~55%, 10%~55%, 11%~55%, 12%~55%, 13%~55%, 14%~55%, 15%~55%, 16%~55%, 17%~55%, 18%~55%, 19%~55%, 20%~55%, 21%~55%, 22%~55%, 23%~55%, 24%~55%, 25%~55%, 26%~55% %, 27%~55%, 28%~55%, 29%~55%, 30%~55%, 31%~55%, 32%~55%, 33%~55%, 34%~55%, 35%~55%, 36%~55%, 37%~55%, 38%~55%, 39%~55%, 40%~55%, 41%~55%, 42%~55%, 43%~55%, 44%~55%, 45%~55%, 46%~55%, 47%~55%, 48%~55%, 49%~55%, 50%~55%, 51%~55%, 52%~5 5%, 53%~55%, 54%~55%, 0.5%~50%, 1%~50%, 2%~50%, 3%~50%, 4%~50%, 5%~50%, 6%~50%, 7%~50%, 8%~50%, 9%~50%, 10%~50%, 11%~50%, 12%~50%, 13%~50%, 14%~50%, 15%~50%, 16%~50%, 17%~50%, 18%~50%, 19%~50%, 20%~50%, 21%~50%, 22%~50%, 23%~50%, 24% ~50%, 25%~50%, 26%~50%, 27%~50%, 28%~50%, 29%~50%, 30%~50%, 31%~50%, 32%~50%, 33%~50%, 34%~50%, 35%~50%, 36%~50%, 37%~50%, 38%~50%, 39%~50%, 40%~50%, 41%~50%, 42%~50%, 43%~50%, 44%~50%, 45%~50%, 46%~50%, 47%~50%, 48%~50%, 49%~50%, 0.5%~45%、1%~45%、2%~45%、3%~45%、4%~45%、5%~45%、6%~45%、7%~45%、8%~45%、9%~45%、10%~45%、11%~45%、12%~45%、13%~45%、14%~45%、15%~45%、16%~45%、17%~45%、18%~45%、19%~45%、20%~45%、21%~45%、22%~45%、23%~45%、24%~45%、25%~45%、26%~45%、27%~45%、28%~45%、29%~45%、30%~45%、31%~45%、32%~45%、33%~45%、34%~45%、35%~45%、36%~45%、37%~45%、38%~45%、39%~45%、40%~45%、41%~45%、42%~45%、43%~45%、44%~45%、0.5%~40%、1%~40%、2%~40%、3%~40%、4%~40%、5%~40%、6%~40%、7%~40%、8%~40%、9%~40%、10%~40%、11%~40%、12%~40%、13%~40%、14%~40%、15%~40%、16%~40%、17%~40%、18%~40%、19%~40%、20%~40%、21%~40%、22%~40%、23%~40%、24%~40%、25%~40%、26%~40%、27%~40%、28%~40%、29%~40%、40%~40%、31%~40%、32%~40%、33%~40%、34%~40%、35%~40%、36%~40%、37%~40%、38%~40%、39%~40%、0.5%~35%、1%~35%、2%~35%、3%~35%、4%~35%、5%~35%、6%~35%、7%~35%、8%~35%、9%~35%、10%~35%、11%~35%、12%~35%、13%~35%、14%~35%、15%~35%、16%~35%、17%~35%、18%~35%、19%~35%、20%~35%、21%~35%、22%~35%、23%~35%、24%~35%、25%~35%、26%~35%、27%~35%、28%~35%、29%~35%、35%~35%、31%~35%、32%~35%、33%~35%、34%~35%、0.5%~30%、1%~30%、2%~30%、3%~30%、4%~30%、5%~30%、6%~30%、7%~30%、8%~30%、9%~30%、10%~30%、11%~30%、12%~30%、13%~30%、14%~30%、15%~30%、16%~30%、17%~30%、18%~30%、19%~30%、20%~30%、21%~30%、22%~30%、23%~30%、24%~30%、25%~30%、26%~30%、27%~30%、28%~30%、29%~30%、0.5%~29%、1%~29%、2%~29%、3%~29%、4%~29%、5%~29%、6%~29%、7%~29%、8%~29%、9%~29%、10%~29%、11%~29%、12%~29%、13%~29%、14%~29%、15%~29%、16%~29%、17%~29%、18%~29%、19%~29%、20%~29%、21%~29%、22%~29%、23%~29%、24%~29%、25%~29%、26%~29%、27%~29%、28%~29%、0.5%~28%、1%~28%、2%~28%、3%~28%、4%~28%、5%~28%、6%~28%、7%~28%、8%~28%、9%~28%、10%~28%、11%~28%、12%~28%、13%~28%、14%~28%、15%~28%、16%~28%、17%~28%、18%~28%、19%~28%、20%~28%、21%~28%、22%~28%、23%~28%、24%~28%、25%~28%、26%~28%、27%~28%、0.5%~27%、1%~27%、2%~27%、3%~27%、4%~27%、5%~27%、6%~27%、7%~27%、8%~27%、9%~27%、10%~27%、11%~27%、12%~27%、13%~27%、14%~27%、15%~27%、16%~27%、17%~27%、18%~27%、19%~27%、20%~27%、21%~27%、22%~27%、23%~27%、24%~27%、25%~27%、26%~27%、0.5%~26%、1%~26%、2%~26%、3%~26%、4%~26%、5%~26%、6%~26%、7%~26%、8%~26%、9%~26%、10%~26%、11%~26%、12%~26%、13%~26%、14%~26%、15%~26%、16%~26%、17%~26%、18%~26%、19%~26%、20%~26%、21%~26%、22%~26%、23%~26%、24%~26%、25%~26%、0.5%~25%、1%~25%、2%~25%、3%~25%、4%~25%、5%~25%、6%~25%、7%~25%、8%~25%、9%~25%、10%~25%、11%~25%、12%~25%、13%~25%、14%~25%、15%~25%、16%~25%、17%~25%、18%~25%、19%~25%、20%~25%、21%~25%、22%~25%、23%~25%、24%~25%、0.5%~24%、1%~24%、2%~24%、3%~24%、4%~24%、5%~24%、6%~24%、7%~24%、8%~24%、9%~24%、10%~24%、11%~24%、12%~24%、13%~24%、14%~24%、15%~24%、16%~24%、17%~24%、18%~24%、19%~24%、20%~24%、21%~24%、22%~24%、23%~24%、0.5%~23%、1%~23%、2%~23%、3%~23%、4%~23%、5%~23%、6%~23%、7%~23%、8%~23%、9%~23%、10%~23%、11%~23%、12%~23%、13%~23%、14%~23%、15%~23%、16%~23%、17%~23%、18%~23%、19%~23%、20%~23%、21%~23%、22%~23%、0.5%~22%、1%~22%、2%~22%、3%~22%、4%~22%、5%~22%、6%~22%、7%~22%、8%~22%、9%~22%、10%~22%、11%~22%、12%~22%、13%~22%、14%~22%、15%~22%、16%~22%、17%~22%、18%~22%、19%~22%、20%~22%、21%~22%、0.5%~21%、1%~21%、2%~21%、3%~21%、4%~21%、5%~21%、6%~21%、7%~21%、8%~21%、9%~21%、10%~21%、11%~21%、12%~21%、13%~21%、14%~21%、15%~21%、16%~21%、17%~21%、18%~21%、19%~21%、20%~21%、0.5%~20%、1%~20%、2%~20%、3%~20%、4%~20%、5%~20%、6%~20%、7%~20%、8%~20%、9%~20%、10%~20%、11%~20%、12%~20%、13%~20%、14%~20%、15%~20%、16%~20%、17%~20%、18%~20%、19%~20%、0.5%~19%、1%~19%、2%~19%、3%~19%、4%~19%、5%~19%、6%~19%、7%~19%、8%~19%、9%~19%、10%~19%、11%~19%、12%~19%、13%~19%、14%~19%、15%~19%、16%~19%、17%~19%、18%~19%、0.5%~18%、1%~18%、2%~18%、3%~18%、. 4%~18%、5%~18%、6%~18%、7%~18%、8%~18%、9%~18%、10%~18%、11%~18%、12%~18%、13%~18%、14%~18%、15%~18%、16%~18%、17%~18%、0.5%~17%、1%~17%、2%~17%、3%~17%、4%~17%、5%~17%、6%~17%、7%~17%、8%~17%、9%~17%、10%~17%、11%~17%、12%~17%、13%~17%、14%~17%、15%~17%、16%~17%、0.5%~16%、1%~16%、2%~16%、3%~16%、4%~16%、5%~16%、6%~16%、7%~16%、8%~16%、9%~16%、10%~16%、11%~16%、12%~16%、13%~16%、14%~16%、15%~16%、0.5%~15%、1%~15%、2%~15%、3%~15%、4%~15%、5%~15%、6%~15%、7%~15%、8%~15%、9%~15%、10%~15%、11%~15%、12%~15%、13%~15%、14%~15%、0.5%~14%、1%~14%、2%~14%、3%~14%、4%~14%、5%~14%、6%~14%、7%~14%、8%~14%、9%~14%、10%~14%、11%~14%、12%~14%、13%~14%、0.5%~13%、1%~13%、2%~13%、3%~13%、4%~13%、5%~13%、6%~13%、7%~13%、8%~13%、9%~13%、10%~13%、11%~13%、12%~13%、0.5%~12%、1%~12%、2%~12%、3%~12%、4%~12%、5%~12%、6%~12%、7%~12%、8%~12%、9%~12%、10%~12%、11%~12%、0.5%~11%、1%~11%、2%~11%、3%~11%、4%~11%、5%~11%、6%~11%、7%~11%、8%~11%、9%~11%、10%~11%、0.5%~10%、1%~10%、2%~10%、3%~10%、4%~10%、5%~10%、6%~10%、7%~10%、8%~10%、9%~10%、0.5%~9%、1%~9%、2%~9%、3%~9%、4%~9%、5%~9%、6%~9%、7%~9%、8%~9%、0.5%-8%, 1%-8%, 2%-8%, 3%-8%, 4%-8%, 5%-8%, 6%-8%, 7%-8%, 0.5%-7%, 1%-7%, 2%-7%, 3%-7%, 4%-7%, 5%-7%, 6%-7%, 0.5%-6%, 1%-6%, 2%-6%, 3%-6%, 4%-6%, 5%-6%, 0.5%-5%, 1%-5%, 2%-5%, 3%-5%, 4%-5%, 0.5%-4%, 1%-4%, 2%-4%, 3%-4%, 0.5%-3%, 1%-3%, 2%-3%, 0.5%-2%, 1%-2%, or 0.5%-1% higher fructose utilization.

[0095] [000107] In some embodiments, the compositions described herein have a higher ethanol to glycerol ratio than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). In some embodiments, the compositions described herein have a higher ethanol to glycerol ratio than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at temperatures ranging from 20°C to 40°C, preferably from 33°C to 38°C. In certain embodiments, the compositions described herein have a higher ethanol to glycerol ratio at a temperature of 33° C. than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). In another embodiment, the compositions described herein have a higher ethanol to glycerol ratio at a temperature of 38° C. than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1).

[0096] [000108] In some embodiments, the compositions described herein exhibit at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120 , 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90% higher ethanol to glycerol ratios. In some embodiments, the compositions described herein provide at most about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%,In some embodiments, the compositions described herein have an ethanol to glycerol ratio greater than 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90%. In some embodiments, the compositions described herein are used in combination with typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super®). After 48 hours of fermentation, the following concentrations were observed: about 1% to 90% (i.e., about 1% to about 90%), 2% to 90%, 3% to 90%, 4% to 90%, 5% to 90%, 6% to 90%, 7% to 90%, 8% to 90%, 9% to 90%, 10% to 90%, 11% to 90%, 12% to 90%, 13% to 90%, 14% to 90%, 15% to 90%, 16% to 90%, 17% to 90%, 18% to 90%, 19% to 90%, 20% to 90%, 21% to 90%, 22% to 90%, 23% to 90%, 24% to 90%, 25% to 90%, 26% to 90%, 27% to 90%, 28% to 90%, 29% to 90%, 30% to 90%, 31% to 90%, 32% to 90%, 33% to 90%, 34% to 90%, 35% to 90%, 36% to 90%, 37% to 90%, 38% to 90%, 39% to 90%, 40% to 90%, 41% to 90%, 42% to 90%, 43% to 90%, 44% to 90%, 45% to 90%, 46% to 90%, 47% to 90%, 48% to 90%, 49% to 90%, 50% to 50%, 51% to 51%, 52% to 52%, 53% to 53%, 54% to 54 %, 15%~90%, 16%~90%, 17%~90%, 18%~90%, 19%~90%, 20%~90%, 21%~90%, 22%~90%, 23%~90%, 24%~90%, 25%~90%, 26%~90%, 27%~90%, 28%~90%, 29%~90%, 30%~90%, 31%~90%, 32%~90%, 33%~90%, 34%~90%, 35%~90%, 36%~90%, 37%~90%, 38%~90%, 3 9%~90%, 40%~90%, 41%~90%, 42%~90%, 43%~90%, 44%~90%, 45%~90%, 46%~90%, 47%~90%, 48%~90%, 49%~90%, 50%~90%, 51%~90%, 52%~90%, 53%~90%, 54%~90%, 55%~90%, 56%~90%, 57%~90%, 58%~90%, 59%~90%, 60%~90%, 61%~90%, 62%~90%, 63%~ 90%, 64%~90%, 65%~90%, 66%~90%, 67%~90%, 68%~90%, 69%~90%, 70%~90%, 71%~90%, 72%~90%, 73%~90%, 74%~90%, 75%~90%, 76%~90%, 77%~90%, 78%~90%, 79%~90%, 80%~90%, 81%~90%, 82%~90%, 83%~90%, 84%~90%, 85%~90%, 86%~90%, 87%~90%,88%~90%、89%~90%、1%~80%、2%~80%、3%~80%、4%~80%、5%~80%、6%~80%、7%~80%、8%~80%、9%~80%、10%~80%、11%~80%、12%~80%、13%~80%、14%~80%、15%~80%、16%~80%、17%~80%、18%~80%、19%~80%、20%~80%、21%~80%、22%~80%、23%~80%、24%~80%、25%~80%、26%~80%、27%~80%、28%~80%、29%~80%、30%~80%、31%~80%、32%~80%、33%~80%、34%~80%、35%~80%、36%~80%、37%~80%、38%~80%、39%~80%、40%~80%、41%~80%、42%~80%、43%~80%、44%~80%、45%~80%、46%~80%、47%~80%、48%~80%、49%~80%、50%~80%、51%~80%、52%~80%、53%~80%、54%~80%、55%~80%、56%~80%、57%~80%、58%~80%、59%~80%、60%~80%、61%~80%、62%~80%、63%~80%、64%~80%、65%~80%、66%~80%、67%~80%、68%~80%、69%~80%、70%~80%、71%~80%、72%~80%、73%~80%、74%~80%、75%~80%、76%~80%、77%~80%、78%~80%、79%~80%、1%~70%、2%~70%、3%~70%、4%~70%、5%~70%、6%~70%、7%~70%、8%~70%、9%~70%、10%~70%、11%~70%、12%~70%、13%~70%、14%~70%、15%~70%、16%~70%、17%~70%、18%~70%、19%~70%、20%~70%、21%~70%、22%~70%、23%~70%、24%~70%、25%~70%、26%~70%、27%~70%、28%~70%、29%~70%、30%~70%、31%~70%、32%~70%、33%~70%、34%~70%、35%~70%、36%~70%、37%~70%、38%~70%、39%~70%、40%~70%、41%~70%、42%~70%、43%~70%、44%~70%、45%~70%、46%~70%、47%~70%、48%~70%、49%~70%、50%~70%、51%~70%、52%~70%、53%~70%、54%~70%、55%~70%、56%~70%、57%~70%、58%~70%、59%~70%、60%~70%、61%~70%、62%~70%、63%~70%、64%~70%、65%~70%、66%~70%、67%~70%、68%~70%、69%~70%、1%~60%、2%~60%、3%~60%、4%~60%、5%~60%、6%~60%、7%~60%、8%~60%、9%~60%、10%~60%、11%~60%、12%~60%、13%~60%、14%~60%、15%~60%、16%~60%、17%~60%、18%~60%、19%~60%、20%~60%、21%~60%、22%~60%、23%~60%、24%~60%、25%~60%、26%~60%、27%~60%、28%~60%、29%~60%、30%~60%、31%~60%、32%~60%、33%~60%、34%~60%、35%~60%、36%~60%、37%~60%、38%~60%、39%~60%、40%~60%、41%~60%、42%~60%、43%~60%、44%~60%、45%~60%、46%~60%、47%~60%、48%~60%、49%~60%、50%~60%、51%~60%、52%~60%、53%~60%、54%~60%、55%~60%、56%~60%、57%~60%、58%~60%、59%~60%、1%~50%、2%~50%、3%~50%、4%~50%、5%~50%、6%~50%、7%~50%、8%~50%、9%~50%、10%~50%、11%~50%、12%~50%、13%~50%、14%~50%、15%~50%、16%~50%、17%~50%、18%~50%、19%~50%、20%~50%、21%~50%、22%~50%、23%~50%、24%~50%、25%~50%、26%~50%、27%~50%、28%~50%、29%~50%、30%~50%、31%~50%、32%~50%、33%~50%、34%~50%、35%~50%、36%~50%、37%~50%、38%~50%、39%~50%、40%~50%、41%~50%、42%~50%、43%~50%、44%~50%、45%~50%、46%~50%、47%~50%、48%~50%、49%~50%、1%~40%、2%~40%、3%~40%、4%~40%、5%~40%、6%~40%、7%~40%、8%~40%、9%~40%、10%~40%、11%~40%、12%~40%、13%~40%、14%~40%、15%~40%、16%~40%、17%~40%、18%~40%、19%~40%、20%~40%、21%~40%、22%~40%、23%~40%、24%~40%、25%~40%、26%~40%、27%~40%、28%~40%、29%~40%、30%~40%、31%~40%、32%~40%、33%~40%、34%~40%、35%~40%、36%~40%、37%~40%、38%~40%、39%~40%、1%~30%、2%~30%、3%~30%、4%~30%、5%~30%、6%~30%、7%~30%、8%~30%、9%~30%、10%~30%、11%~30%、12%~30%、13%~30%、14%~30%、15%~30%、16%~30%、17%~30%、18%~30%、19%~30%、20%~30%、21%~30%、22%~30%、23%~30%、24%~30%、25%~30%、26%~30%、27%~30%、28%~30%、29%~30%、1%~29%、2%~29%、3%~29%、4%~29%、5%~29%、6%~29%、7%~29%、8%~29%、9%~29%、10%~29%、11%~29%、12%~29%、13%~29%、14%~29%、15%~29%、16%~29%、17%~29%、18%~29%、19%~29%、20%~29%、21%~29%、22%~29%、23%~29%、24%~29%、25%~29%、26%~29%、27%~29%、28%~29%、1%~28%、2%~28%、3%~28%、4%~28%、5%~28%、6%~28%、7%~28%、8%~28%、9%~28%、10%~28%、11%~28%、12%~28%、13%~28%、14%~28%、15%~28%、16%~28%、17%~28%、18%~28%、19%~28%、20%~28%、21%~28%、22%~28%、23%~28%、24%~28%、25%~28%、26%~28%、27%~28%、1%~27%、2%~27%、3%~27%、4%~27%、5%~27%、6%~27%、7%~27%、8%~27%、9%~27%、10%~27%、11%~27%、12%~27%、13%~27%、14%~27%、15%~27%、16%~27%、17%~27%、18%~27%、19%~27%、20%~27%、 、21%~27%、22%~27%、23%~27%、24%~27%、25%~27%、26%~27%、1%~26%、2%~26%、3%~26%、4%~26%、5%~26%、6%~26%、7%~26%、8%~26%、9%~26%、10%~26%、11%~26%、12%~26%、13%~26%、14%~26%、15%~26%、16%~26%、17%~26%、18%~26%、19%~26%、20%~26%、21%~26%、22%~26%、23%~26%、24%~26%、25%~26%、1%~25%、2%~25%、3%~25%、4%~25%、5%~25%、6%~25%、7%~25%、8%~25%、9%~25%、10%~25%、11%~25%、12%~25%、13%~25%、14%~25%、15%~25%、16%~25%、17%~25%、18%~25%、19%~25%、20%~25%、21%~25%、22%~25%、23%~25%、24%~25%、1%~24%、2%~24%、3%~24%、4%~24%、5%~24%、6%~24%、7%~24%、8%~24%、9%~24%、10%~24%、11%~24%、12%~24%、13%~24%、14%~24%、15%~24%、16%~24%、17%~24%、18%~24%、19%~24%、20%~24%、21%~24%、22%~24%、23%~24%、1%~23%、2%~23%、3%~23%、4%~23%、5%~23%、6%~23%、7%~23%、8%~23%、9%~23%、10%~23%、11%~23%、12%~23%、13%~23%、14%~23%、15%~23%、16%~23%、17%~23%、18%~23%、19%~23%、20%~23%、21%~23%、22%~23%、1%~22%、2%~22%、3%~22%、4%~22%、5%~22%、6%~22%、7%~22%、8%~22%、9%~22%、10%~22%、11%~22%、12%~22%、13%~22%、14%~22%、15%~22%、16%~22%、17%~22%、18%~22%、19%~22%、20%~22%、21%~22%、1%~21%、2%~21%、3%~21%、4%~21%、5%~21%、6%~21%、7%~21%、8%~21%、9%~21%、10%~21%、11%~21%、12%~21%、13%~21%、14%~21%、15%~21%、16%~21%、17%~21%、18%~21%、19%~21%、20%~21%、1%~20%、2%~20%、3%~20%、4%~20%、5%~20%、6%~20%、7%~20%、8%~20%、9%~20%、10%~20%、11%~20%、12%~20%、13%~20%、14%~20%、15%~20%、16%~20%、17%~20%、18%~20%、19%~20%、1%~19%、2%~19%、3%~19%、4%~19%、5%~19%、6%~19%、7%~19%、8%~19%、9%~19%、10%~19%、11%~19%、12%~19%、13%~19%、14%~19%、15%~19%、16%~19%、17%~19%、18%~19%、1%~18%、2%~18%、3%~18%、4%~18%、5%~18%、6%~18%、7%~18%、8%~18%、9%~18%、10%~18%、11%~18%、12%~18%、13%~18%、14%~18%、15%~18%、16%~18%、17%~18%、1%~17%、2%~17%、3%~17%、4%~17%、5%~17%、6%~17%、7%~17%、8%~17%、9%~17%、10%~17%、11%~17%、12%~17%、13%~17%、14%~17%、15%~17%、16%~17%、1%~16%、2%~16%、3%~16%、4%~16%、5%~16%、6%~16%、7%~16%、8%~16%、9%~16%、10%~16%、11%~16%、12%~16%、13%~16%、14%~16%、15%~16%、1%~15%、2%~15%、3%~15%、4%~15%、5%~15%、6%~15%、7%~15%、8%~15%、9%~15%、10%~15%、11%~15%、12%~15%、13%~15%、14%~15%、1%~14%、2%~14%、3%~14%、4%~14%、5%~14%、6%~14%、7%~14%、8%~14%、9%~14%、10%~14%、11%~14%、12%~14%、13%~14%、1%~13%、2%~13%、3%~13%、4%~13%、5%~13%、6%~13%、7%~13%、8%~13%、9%~13%、10%~13%、11%~13%、12%~13%、1%~12%, 2%~12%, 3%~12%, 4%~12%, 5%~12%, 6%~12%, 7%~12%, 8%~12%, 9%~12%, 10%~12%, 11%~12%, 1%~11%, 2%~11%, 3%~11%, 4%~11%, 5%~11%, 6%~11%, 7%~11%, 8%~11%, 9%~11%, 10%~11%, 1%~10%, 2%~10%, 3%~10%, 4%~10%, 5%~10%, 6%~10%, 7%~10%, 8%~10%, 9%~10%, 1%~9%, 2%~9%, 3% ~9%, 4%-9%, 5%-9%, 6%-9%, 7%-9%, 8%-9%, 1%-8%, 2%-8%, 3%-8%, 4%-8%, 5%-8%, 6%-8%, 7%-8%, 1%-7%, 2%-7%, 3%-7%, 4%-7%, 5%-7%, 6%-7%, 1%-6%, 2%-6%, 3%-6%, 4%-6%, 5%-6%, 1%-5%, 2%-5%, 3%-5%, 4%-5%, 1%-4%, 2%-4%, 3%-4%, 1%-3%, 2%-3%, or 1%-2% higher ethanol to glycerol ratios.

[0097] [000109] In some embodiments, the compositions described herein have a faster fermentation rate than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). In some embodiments, the compositions described herein have a faster fermentation rate than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at temperatures ranging from 20°C to 40°C, preferably from 33°C to 38°C. In certain embodiments, the compositions described herein have a faster fermentation rate at a temperature of 33° C. than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). In another embodiment, the compositions described herein have a faster fermentation rate at a temperature of 38° C. than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1).

[0098] [000110] In some embodiments, the compositions described herein, after 24 hours of fermentation, have a fermentation yield of at least about 0%, 1%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170% or higher than a typical yeast product used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). , 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, or 450% faster fermentation rates. In some embodiments, after 24 hours of fermentation, the compositions described herein have a fermentation rate that is 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, or 450% faster than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super®, etc.). 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 410%, 420%, 430%, 440%, 450%, 460%, 470%, 480%, 490%, 500%, 510%, 520%, 530%, 540%, 550 In some embodiments, the compositions described herein have a fermentation rate that is 0%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, or 450% faster after 24 hours of fermentation. In some embodiments, the compositions described herein have a fermentation rate that is 0%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, or 450% faster than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™,DistilaMax® CN, PE-2, CAT-1) from about 0% to 450% (i.e., about 0% to about 450%), 1% to 450%, 10% to 450%, 20% to 450%, 30% to 450%, 40% to 450%, 50% to 450%, 60% to 450%, 70% to 450%, 80% to 450%, 90% to 450%, 100% to 450%, 110% to 450%, 120% to 450%, 130% to 450%, 140% to 450%, 150% to 450%, 160% to 450%, 170% to 450%, 180% to 450%, 190% to 450%, 200% ~450%, 210%~450%, 220%~450%, 230%~450%, 240%~450%, 250%~450%, 260%~450%, 270%~450%, 280%~450%, 290%~450%, 300%~450%, 310%~450%, 320%~450% , 330%~450%, 340%~450%, 350%~450%, 360%~450%, 370%~450%, 380%~450%, 390%~450%, 400%~450%, 410%~450%, 420%~450%, 430%~450%, 440%~450%, 0%~4 00%, 1%~400%, 10%~400%, 20%~400%, 30%~400%, 40%~400%, 50%~400%, 60%~400%, 70%~400%, 80%~400%, 90%~400%, 100%~400%, 110%~400%, 120%~400%, 13 0%~400%, 140%~400%, 150%~400%, 160%~400%, 170%~400%, 180%~400%, 190%~400%, 200%~400%, 210%~400%, 220%~400%, 230%~400%, 240%~400%, 250%~40 0%, 260%~400%, 270%~400%, 280%~400%, 290%~400%, 300%~400%, 310%~400%, 320%~400%, 330%~400%, 340%~400%, 350%~400%, 360%~400%, 370%~400%, 38 0%~400%, 390%~400%, 0%~300%, 1%~300%, 10%~300%, 20%~300%, 30%~300%, 40%~300%, 50%~300%, 60%~300%, 70%~300%, 80%~300%, 90%~300%, 100%~300%,110%~300%, 120%~300%, 130%~300%, 140%~300%, 150%~300%, 160%~300%, 170%~300%, 180%~300%, 190%~300%, 200%~300%, 210%~300%, 220%~300%, 230%~300%, 240%~300% , 250%~300%, 260%~300%, 270%~300%, 280%~300%, 290%~300%, 0%~200%, 1%~200%, 10%~200%, 20%~200%, 30%~200%, 40%~200%, 50%~200%, 60%~200%, 70%~200%, 80%~200%, 90%~200%, 100%~200%, 110%~200%, 120%~200%, 130%~200%, 140%~200%, 150%~200%, 160%~200%, 170%~200%, 180%~200%, 190%~200%, 0%~100%, 1%~100%, 10%~100%, 20%~1 00%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 0% to 50%, 1% to 50%, 10% to 50%, 20% to 50%, 30% to 50%, 40% to 50%, 0% to 10%, or 1% to 10% faster fermentation rate.

[0099] [000111] In some embodiments, the compositions described herein have higher temperature tolerance than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). Temperature tolerance may be exhibited by one or more of higher ethanol yield, higher fructose utilization, higher ethanol to glycerol ratio, and faster fermentation rate. In certain embodiments, the compositions described herein can withstand temperatures of about 20°C, about 21°C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, about 30°C, about 31°C, about 33°C, about 33°C, about 34°C, about 35°C, about 38°C, about 37°C, about 38°C, about 39°C, and / or about 40°C.

[0100] [000112] In some embodiments, the compositions described herein have higher organic acid tolerance at low pH than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). Organic acid tolerance at low pH can be exhibited by one or more of high ethanol yield, high fructose utilization, high ethanol to glycerol ratio, and fast fermentation rate. In some embodiments, the compositions described herein have higher organic acid tolerance than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at acetic acid concentrations of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at lactic acid concentrations of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. In certain embodiments, the compositions described herein have a higher tolerance to lactic acid and acetic acid at low pH than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at a temperature of 33° C. In another embodiment, the compositions described herein have a higher tolerance to lactic acid and acetic acid at low pH than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at a temperature of 38° C.Examples of organic acids include, but are not limited to, lactic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, other carboxylic acids, or combinations thereof.

[0101] [000113] In some embodiments, the compositions described herein have higher ethanol yields than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at acetic acid concentrations of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at lactic acid concentrations of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. In certain embodiments, the compositions described herein have a higher ethanol yield than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at a temperature of 33° C., at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. In another embodiment, the compositions described herein have a higher ethanol yield than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at a temperature of 38° C., at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9.

[0102] [000114] In some embodiments, the compositions described herein are prepared using typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super®) at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. After 48 hours of fermentation, the concentration of at least about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0% of the fermented cereals containing EDV, Superstart™, DistilaMax™ CN, PE-2, and CAT-1 was at least about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0% of the cereals containing EDV, Superstart™, DistilaMax™ CN, PE-2, and CAT-1 was at least about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 1 %, 21.0%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75% higher ethanol yield. In some embodiments, the compositions described herein have an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, an acetic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and a pH of 3.5 to 5.0, preferably 4.2 to 4.At a pH of 9, for typical yeast products used in fermentations (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1), after 48 hours of fermentation, the yield was at most about 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0%, 21.0% having a 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75% higher ethanol yield. In some embodiments, the compositions described herein are prepared using typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super®) at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. After 48 hours of fermentation, the concentrations of ethanol (Alcohol®, 46EDV, Superstart®, DistilaMax® CN, PE-2, CAT-1) were approximately 0.1% to 75% (i.e., approximately 0.1% to approximately 75%), 0.2% to 75%, 0.3% to 75%, 0.4% to 75%, 0.5% to 75%, 0.6% to 75%, 0.7% to 75%, 0.8% to 75%, and 0.9%~75%、1%~75%、2%~75%、3%~75%、4%~75%%、5%~75%、6%~75%、7%~75%、8%~75%、9%~75%、10%~75%、15%~75%、20%~75%、25%~75%、30%~75%、35%~75%、40%~75%、45%~75%、50%~75%、55%~75%、60%~75%、0.1%~70%、0.2%~70%、0.3%~70%、0.4%~70%、0.5%~70%、0.6%~70%、0.7%~70%、0.8%~70%、0.9%~70%、1%~70%、2%~70%、3%~70%、4%~70%%、5%~70%、6%~70%、7%~70%、8%~70%、9%~70%、10%~70%、15%~70%、20%~70%、25%~70%、30%~70%、35%~70%、40%~70%、45%~70%、50%~70%、55%~70%、60%~70%、0.1%~60%、0.2%~60%、0.3%~60%、0.4%~60%、0.5%~60%、0.6%~60%、0.7%~60%、0.8%~60%、0.9%~60%、1%~60%、2%~60%、3%~60%、4%~60%%、5%~60%、6%~60%、7%~60%、8%~60%、9%~60%、10%~60%、15%~60%、20%~60%、25%~60%、30%~60%、35%~60%、40%~60%、45%~60%、50%~60%、0.1%~50%、0.2%~50%、0.3%~50%、0.4%~50%、0.5%~50%、0.6%~50%、0.7%~50%、0.8%~50%、0.9%~50%、1%~50%、2%~50%、3%~50%、4%~50%%、5%~50%、6%~50%、7%~50%、8%~50%、9%~50%、10%~50%、15%~50%、20%~50%、25%~50%、30%~50%、35%~50%、40%~50%、0.1%~40%、0.2%~40%、0.3%~40%、0.4%~40%、0.5%~40%、0.6%~40%、0.7%~40%、0.8%~40%、0.9%~40%、1%~40%、2%~40%、3%~40%、4%~40%%、5%~40%、6%~40%、7%~40%、8%~40%、9%~40%、10%~40%、15%~40%、20%~40%、25%~40%、30%~40%、0.1%~30%、0.2%~30%、0.3%~30%、0.4%~30%、0.5%~30%、0.6%~30%、0.7%~30%、0.8%~30%、0.9%~30%、1%~30%、2%~30%、3%~30%、4%~30%%、5%~30%、6%~30%、7%~30%、8%~30%、9%~30%、10%~30%、15%~30%、20%~30%、0.1%~20%、0.2%~20%、0.3%~20%、0.4%~20%、0.5%~20%、0.6%~20%、0.7%~20%、0.8%~20%、0.9%~20%、1%~20%、2%~20%、3%~20%、4%~20%、5%~20%、6%~20%、7%~20%、8%~20%、9%~20%、10%~20%、0.2%~19%、0.3%~19%、0.4%~19%、0.5%~19%、0.6%~19%、0.7%~19%、0.8%~19%、0.9%~19%、1%~19%、2%~19%、3%~19%、4%~19%、5%~19%、6%~19%、7%~19%、8%~19%、9%~19%、10%~19%、0.2%~18%、0.3%~18%、0.4%~18%、0.5%~18%、0.6%~18%、0.7%~18%、0.8%~18%、0.9%~18%、1%~18%、2%~18%、3%~18%、4%~18%、5%~18%、6%~18%、7%~18%、8%~18%、9%~18%、10%~18%、0.2%~17%、0.3%~17%、0.4%~17%、0.5%~17%、0.6%~17%、0.7%~17%、0.8%~17%、0.9%~17%、1%~17%、2%~17%、3%~17%、4%~17%、5%~17%、6%~17%、7%~17%、8%~17%、9%~17%、10%~17%、0.2%~16%、0.3%~16%、0.4%~16%、0.5%~16%、0.6%~16%、0.7%~16%、0.8%~16%、0.9%~16%、1%~16%、2%~16%、3%~16%、4%~16%、5%~16%、6%~16%、7%~16%、8%~16%、9%~16%、10%~16%、0.2%~15%、0.3%~15%、0.4%~15%、0.5%~15%、0.6%~15%、0.7%~15%、0.8%~15%、0.9%~15%, 1%~15%, 2%~15%, 3%~15%, 4%~15%, 5%~15%, 6%~15%, 7%~15%, 8%~15%, 9%~15%, 10%~15%, 0.1%~14%, 0.2%~14%, 0.3%~14%, 0.4%~14%, 0.5%~14%, 0.6%~14%, 0.7%~14%, 0.8%~14%, 0.9%~14%, 1%~14%, 2%~14%, 3%~14%, 4%~14%, 5%~14%, 6%~14%, 7%~14%, 8%~14 %, 9%~14%, 10%~14%, 0.1%~13%, 0.2%~13%, 0.3%~13%, 0.4%~13%, 0.5%~13%, 0.6%~13%, 0.7%~13%, 0.8%~13%, 0.9%~13%, 1%~13%, 2%~13%, 3%~13%, 4%~13%, 5%~13%, 6%~13%, 7%~13%, 8%~13%, 9%~13%, 10%~13%, 0.1%~12%, 0.2%~12%, 0.3%~12%, 0.4%~12%, 0.5%~12%, 0.6%~12%, 0.7%~12%, 0.8%~12%, 0.9%~12%, 1%~12%, 2%~12%, 3%~12%, 4%~12%, 5%~12%, 6%~12%, 7%~12%, 8%~12%, 9%~12%, 10%~12%, 0.1%~11%, 0.2%~11%, 0.3%~11%, 0.4%~11%, 0.5%~11%, 0.6%~11%, 0.7%~11%, 0.8%~11%, 0.9%~11%, 1%~11%, 2%~11%, 3%~11%, 4%~11% with a 1%, 5%-11%, 6%-11%, 7%-11%, 8%-11%, 9%-11%, 10%-11%, 0.1%-0.2%, 0.1%-0.3%, 0.1%-0.4%, 0.1%-0.5%, 0.1%-0.6%, 0.1%-0.7%, 0.1%-0.8%, 0.1%-0.9%, 0.1%-1%, 0.1%-2%, 0.1%-3%, 0.1%-4%, 0.1%-5%, 0.1%-6%, 0.1%-7%, 0.1%-8%, or 0.1%-9% higher ethanol yield.

[0103] [000115] In some embodiments, the compositions described herein have higher fructose utilization than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at acetic acid concentrations of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at lactic acid concentrations of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. In certain embodiments, the compositions described herein have a higher fructose utilization than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at a temperature of 33° C., at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. In another embodiment, the compositions described herein have a higher fructose utilization than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at a temperature of 38°C, at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9.

[0104] [000116] In some embodiments, the compositions described herein are prepared using typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super®) at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. After 48 hours of fermentation, at least about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, %, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% higher fructose utilization. In some embodiments, the compositions described herein have an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, an acetic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and a pH of 3.5 to 5.0, preferably 4.2 to 4.At a pH of 9, typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super After 48 hours of fermentation, the fructose utilization of the fermented soybeans is at most about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% higher than that of the fermented soybeans (Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). In some embodiments, the compositions described herein provide a yield of about 0.5% to 55% (i.e., about 0.5%) of a typical yeast product used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) after 48 hours of fermentation, at an acetic acid concentration of 0.1% to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% to 1.0% w / v, preferably 0.36% to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9.5%~approximately 55%), 1%~55%, 2%~55%, 3%~55%, 4%~55%, 5%~55%, 6%~55%, 7%~55%, 8%~55%, 9%~55%, 10%~55%, 11%~55%, 12%~55%, 13%~55%, 14%~55%, 15%~55%, 16%~55%, 17%~55%, 18%~55%, 19%~55%, 20%~55%, 21%~55%, 22%~55%, 23%~55%, 24%~55%, 25%~55%, 26%~55% %, 27%~55%, 28%~55%, 29%~55%, 30%~55%, 31%~55%, 32%~55%, 33%~55%, 34%~55%, 35%~55%, 36%~55%, 37%~55%, 38%~55%, 39%~55%, 40%~55%, 41%~55%, 42%~55%, 43%~55%, 44%~55%, 45%~55%, 46%~55%, 47%~55%, 48%~55%, 49%~55%, 50%~55%, 51%~55%, 52%~5 5%, 53%~55%, 54%~55%, 0.5%~50%, 1%~50%, 2%~50%, 3%~50%, 4%~50%, 5%~50%, 6%~50%, 7%~50%, 8%~50%, 9%~50%, 10%~50%, 11%~50%, 12%~50%, 13%~50%, 14%~50%, 15%~50%, 16%~50%, 17%~50%, 18%~50%, 19%~50%, 20%~50%, 21%~50%, 22%~50%, 23%~50%, 24% ~50%, 25%~50%, 26%~50%, 27%~50%, 28%~50%, 29%~50%, 30%~50%, 31%~50%, 32%~50%, 33%~50%, 34%~50%, 35%~50%, 36%~50%, 37%~50%, 38%~50%, 39%~50%, 40%~50%, 41%~50%, 42%~50%, 43%~50%, 44%~50%, 45%~50%, 46%~50%, 47%~50%, 48%~50%, 49%~50%, 0.5%~45%、1%~45%、2%~45%、3%~45%、4%~45%、5%~45%、6%~45%、7%~45%、8%~45%、9%~45%、10%~45%、11%~45%、12%~45%、13%~45%、14%~45%、15%~45%、16%~45%、17%~45%、18%~45%、19%~45%、20%~45%、21%~45%、22%~45%、23%~45%、24%~45%、25%~45%、26%~45%、27%~45%、28%~45%、29%~45%、30%~45%、31%~45%、32%~45%、33%~45%、34%~45%、35%~45%、36%~45%、37%~45%、38%~45%、39%~45%、40%~45%、41%~45%、42%~45%、43%~45%、44%~45%、0.5%~40%、1%~40%、2%~40%、3%~40%、4%~40%、5%~40%、6%~40%、7%~40%、8%~40%、9%~40%、10%~40%、11%~40%、12%~40%、13%~40%、14%~40%、15%~40%、16%~40%、17%~40%、18%~40%、19%~40%、20%~40%、21%~40%、22%~40%、23%~40%、24%~40%、25%~40%、26%~40%、27%~40%、28%~40%、29%~40%、40%~40%、31%~40%、32%~40%、33%~40%、34%~40%、35%~40%、36%~40%、37%~40%、38%~40%、39%~40%、0.5%~35%、1%~35%、2%~35%、3%~35%、4%~35%、5%~35%、6%~35%、7%~35%、8%~35%、9%~35%、10%~35%、11%~35%、12%~35%、13%~35%、14%~35%、15%~35%、16%~35%、17%~35%、18%~35%、19%~35%、20%~35%、21%~35%、22%~35%、23%~35%、24%~35%、25%~35%、26%~35%、27%~35%、28%~35%、29%~35%、35%~35%、31%~35%、32%~35%、33%~35%、34%~35%、0.5%~30%、1%~30%、2%~30%、3%~30%、4%~30%、5%~30%、6%~30%、7%~30%、8%~30%、9%~30%、10%~30%、11%~30%、12%~30%、13%~30%、14%~30%、15%~30%、16%~30%、17%~30%、18%~30%、19%~30%、20%~30%、21%~30%、22%~30%、23%~30%、24%~30%、25%~30%、26%~30%、27%~30%、28%~30%、29%~30%、0.5%~29%、1%~29%、2%~29%、3%~29%、4%~29%、5%~29%、6%~29%、7%~29%、8%~29%、9%~29%、10%~29%、11%~29%、12%~29%、13%~29%、14%~29%、15%~29%、16%~29%、17%~29%、18%~29%、19%~29%、20%~29%、21%~29%、22%~29%、23%~29%、24%~29%、25%~29%、26%~29%、27%~29%、28%~29%、0.5%~28%、1%~28%、2%~28%、3%~28%、4%~28%、5%~28%、6%~28%、7%~28%、8%~28%、9%~28%、10%~28%、11%~28%、12%~28%、13%~28%、14%~28%、15%~28%、16%~28%、17%~28%、18%~28%、19%~28%、20%~28%、21%~28%、22%~28%、23%~28%、24%~28%、25%~28%、26%~28%、27%~28%、0.5%~27%、1%~27%、2%~27%、3%~27%、4%~27%、5%~27%、6%~27%、7%~27%、8%~27%、9%~27%、10%~27%、11%~27%、12%~27%、13%~27%、14%~27%、15%~27%、16%~27%、17%~27%、18%~27%、19%~27%、20%~27%、21%~27%、22%~27%、23%~27%、24%~27%、25%~27%、26%~27%、0.5%~26%、1%~26%、2%~26%、3%~26%、4%~26%、5%~26%、6%~26%、7%~26%、8%~26%、9%~26%、10%~26%、11%~26%、12%~26%、13%~26%、14%~26%、15%~26%、16%~26%、17%~26%、18%~26%、19%~26%、20%~26%、21%~26%、22%~26%、23%~26%、24%~26%、25%~26%、0.5%~25%、1%~25%、2%~25%、3%~25%、4%~25%、5%~25%、6%~25%、7%~25%、8%~25%、9%~25%、10%~25%、11%~25%、12%~25%、13%~25%、14%~25%、15%~25%、16%~25%、17%~25%、18%~25%、19%~25%、20%~25%、21%~25%、22%~25%、23%~25%、24%~25%、0.5%~24%、1%~24%、2%~24%、3%~24%、4%~24%、5%~24%、6%~24%、7%~24%、8%~24%、9%~24%、10%~24%、11%~24%、12%~24%、13%~24%、14%~24%、15%~24%、16%~24%、17%~24%、18%~24%、19%~24%、20%~24%、21%~24%、22%~24%、23%~24%、0.5%~23%、1%~23%、2%~23%、3%~23%、4%~23%、5%~23%、6%~23%、7%~23%、8%~23%、9%~23%、10%~23%、11%~23%、12%~23%、13%~23%、14%~23%、15%~23%、16%~23%、17%~23%、18%~23%、19%~23%、20%~23%、21%~23%、22%~23%、0.5%~22%、1%~22%、2%~22%、3%~22%、4%~22%、5%~22%、6%~22%、7%~22%、. 8%~22%、9%~22%、10%~22%、11%~22%、12%~22%、13%~22%、14%~22%、15%~22%、16%~22%、17%~22%、18%~22%、19%~22%、20%~22%、21%~22%、0.5%~21%、1%~21%、2%~21%、3%~21%、4%~21%、5%~21%、6%~21%、7%~21%、8%~21%、9%~21%、10%~21%、11%~21%、12%~21%、13%~21%、14%~21%、15%~21%、16%~21%、17%~21%、18%~21%、19%~21%、20%~21%、0.5%~20%、1%~20%、2%~20%、3%~20%、4%~20%、5%~20%、6%~20%、7%~20%、8%~20%、9%~20%、10%~20%、11%~20%、12%~20%、13%~20%、14%~20%、15%~20%、16%~20%、17%~20%、18%~20%、19%~20%、0.5%~19%、1%~19%、2%~19%、3%~19%、4%~19%、5%~19%、6%~19%、7%~19%、8%~19%、9%~19%、10%~19%、11%~19%、12%~19%、13%~19%、14%~19%、15%~19%、16%~19%、17%~19%、18%~19%、0.5%~18%、1%~18%、2%~18%、3%~18%、4%~18%、5%~18%、6%~18%、7%~18%、8%~18%、9%~18%、10%~18%、11%~18%、12%~18%、13%~18%、14%~18%、15%~18%、16%~18%、17%~18%、0.5%~17%、1%~17%、2%~17%、3%~17%、4%~17%、5%~17%、6%~17%、7%~17%、8%~17%、9%~17%、10%~17%、11%~17%、12%~17%、13%~17%、14%~17%、15%~17%、16%~17%、0.5%~16%、1%~16%、2%~16%、3%~16%、4%~16%、5%~16%、6%~16%、7%~16%、8%~16%、9%~16%、10%~16%、11%~16%、12%~16%、13%~16%、14%~16%、15%~16%、0.5%~15%, 1%~15%, 2%~15%, 3%~15%, 4%~15%, 5%~15%, 6%~15%, 7%~15%, 8%~15%, 9%~15%, 10%~15%, 11%~15%, 12%~15%, 13%~15%, 14%~15%, 0.5%~14%, 1%~14%, 2%~14%, 3%~14%, 4%~14%, 5%~14%, 6%~14%, 7%~14%, 8%~14%, 9%~14%, 10%~14%, 11%~14%, 12%~14%, 13%~14%, 0.5%~13%, 1%~13%, 2%~13%, 3%~13%, 4%~13%, 5%~13%, 6%~13%, 7%~13%, 8%~13%, 9%~13%, 10%~13%, 11%~13%, 12%~13%, 0.5%~12%, 1%~12%, 2%~12%, 3%~12%, 4%~12%, 5%~12%, 6%~12%, 7%~12%, 8%~12%, 9%~12%, 10%~12%, 11%~12%, 0.5%~11%, 1%~11%, 2%~11%, 3%~11%, 4%~11%, 5%~11%, 6%~11%, 7%~11%, 8%~11%, 9%~11%, 10%~11%, 0.5%~10%, 1%~10%, 2%~10%, 3%~10%, 4%~10%, 5%~10%, 6%~10%, 7%~10%, 8%~10%, 9%~10%, 0.5%~9%, 1%~9%, 2%~9%, 3%~9%, 4%~9%, 5%~9%, 6%~9%, 7%~9%, 8%~9%, 0.5%~8%, 1%~8%, 2%~8%, 3%~8%, 4%~8%, 5%~8 %, 6%-8%, 7%-8%, 0.5%-7%, 1%-7%, 2%-7%, 3%-7%, 4%-7%, 5%-7%, 6%-7%, 0.5%-6%, 1%-6%, 2%-6%, 3%-6%, 4%-6%, 5%-6%, 0.5%-5%, 1%-5%, 2%-5%, 3%-5%, 4%-5%, 0.5%-4%, 1%-4%, 2%-4%, 3%-4%, 0.5%-3%, 1%-3%, 2%-3%, 0.5%-2%, 1%-2%, or 0.5%-1% higher fructose utilization.

[0105] [000117] In some embodiments, the compositions described herein have a higher ethanol to glycerol ratio than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at acetic acid concentrations of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at lactic acid concentrations of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. In certain embodiments, the compositions described herein have a higher ethanol to glycerol ratio than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at a temperature of 33° C., at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. In another embodiment, the compositions described herein have a higher ethanol to glycerol ratio than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at a temperature of 38° C., at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9.

[0106] [000118] In some embodiments, the compositions described herein are prepared using typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super®) at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. After 48 hours of fermentation, at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, , 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90% higher ethanol to glycerol ratios. In some embodiments, the compositions described herein are prepared using a yeast culture medium containing acetic acid at a concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, lactic acid at a concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9, for typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1).After 48 hours of fermentation, at most about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 1 having a 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90% higher ethanol to glycerol ratio. In some embodiments, the compositions described herein are prepared using typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super®) at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. After 48 hours of fermentation, the following concentrations were observed for Alcohol®, 46EDV, Superstart®, DistilaMax® CN, PE-2, and CAT-1: about 1% to 90% (i.e., about 1% to about 90%), 2% to 90%, 3% to 90%, 4% to 90%, 5% to 90%, 6% to 90%, 7% to 90%, 8% to 90%, 9% to 90%, 10% to 90%, 11% to 90%, 12% to 90%, 13% to 90%, 14% to 90%, 15% to 90%, and 16% to 90%. 0%, 16%~90%, 17%~90%, 18%~90%, 19%~90%, 20%~90%, 21%~90%, 22%~90%, 23%~90%, 24%~90%, 25%~90%, 26%~90%, 27%~90%, 28%~90%, 29%~90%, 30%~90%, 31%~90%, 32%~90%, 33%~90%, 34%~90%, 35%~90%, 36%~90%, 37%~90%, 38%~90%, 39%~90%, 40%~90%,41%~90%、42%~90%、43%~90%、44%~90%、45%~90%、46%~90%、47%~90%、48%~90%、49%~90%、50%~90%、51%~90%、52%~90%、53%~90%、54%~90%、55%~90%、56%~90%、57%~90%、58%~90%、59%~90%、60%~90%、61%~90%、62%~90%、63%~90%、64%~90%、65%~90%、66%~90%、67%~90%、68%~90%、69%~90%、70%~90%、71%~90%、72%~90%、73%~90%、74%~90%、75%~90%、76%~90%、77%~90%、78%~90%、79%~90%、80%~90%、81%~90%、82%~90%、83%~90%、84%~90%、85%~90%、86%~90%、87%~90%、88%~90%、89%~90%、1%~80%、2%~80%、3%~80%、4%~80%、5%~80%、6%~80%、7%~80%、8%~80%、9%~80%、10%~80%、11%~80%、12%~80%、13%~80%、14%~80%、15%~80%、16%~80%、17%~80%、18%~80%、19%~80%、20%~80%、21%~80%、22%~80%、23%~80%、24%~80%、25%~80%、26%~80%、27%~80%、28%~80%、29%~80%、30%~80%、31%~80%、32%~80%、33%~80%、34%~80%、35%~80%、36%~80%、37%~80%、38%~80%、39%~80%、40%~80%、41%~80%、42%~80%、43%~80%、44%~80%、45%~80%、46%~80%、47%~80%、48%~80%、49%~80%、50%~80%、51%~80%、52%~80%、53%~80%、54%~80%、55%~80%、56%~80%、57%~80%、58%~80%、59%~80%、60%~80%、61%~80%、62%~80%、63%~80%、64%~80%、65%~80%、66%~80%、67%~80%、68%~80%、69%~80%、70%~80%、71%~80%、72%~80%、73%~80%、74%~80%、75%~80%、76%~80%、77%~80%、78%~80%、79%~80%、1%~70%、2%~70%、3%~70%、4%~70%、5%~70%、6%~70%、7%~70%、8%~70%、9%~70%、10%~70%、11%~70%、12%~70%、13%~70%、14%~70%、15%~70%、16%~70%、17%~70%、18%~70%、19%~70%、20%~70%、21%~70%、22%~70%、23%~70%、24%~70%、25%~70%、26%~70%、27%~70%、28%~70%、29%~70%、30%~70%、31%~70%、32%~70%、33%~70%、34%~70%、35%~70%、36%~70%、37%~70%、38%~70%、39%~70%、40%~70%、41%~70%、42%~70%、43%~70%、44%~70%、45%~70%、46%~70%、47%~70%、48%~70%、49%~70%、50%~70%、51%~70%、52%~70%、53%~70%、54%~70%、55%~70%、56%~70%、57%~70%、58%~70%、59%~70%、60%~70%、61%~70%、62%~70%、63%~70%、64%~70%、65%~70%、66%~70%、67%~70%、68%~70%、69%~70%、1%~60%、2%~60%、3%~60%、4%~60%、5%~60%、6%~60%、7%~60%、8%~60%、9%~60%、10%~60%、11%~60%、12%~60%、13%~60%、14%~60%、15%~60%、16%~60%、17%~60%、18%~60%、19%~60%、20%~60%、21%~60%、22%~60%、23%~60%、24%~60%、25%~60%、26%~60%、27%~60%、28%~60%、29%~60%、30%~60%、31%~60%、32%~60%、33%~60%、34%~60%、35%~60%、36%~60%、37%~60%、38%~60%、39%~60%、40%~60%、41%~60%、42%~60%、43%~60%、44%~60%、45%~60%、46%~60%、47%~60%、48%~60%、49%~60%、50%~60%、51%~60%、52%~60%、53%~60%、54%~60%、55%~60%、56%~60%、57%~60%、58%~60%、59%~60%、1%~50%、2%~50%、3%~50%、4%~50%、5%~50%、6%~50%、7%~50%、8%~50%、9%~50%、10%~50%、11%~50%、12%~50%、13%~50%、14%~50%、15%~50%、16%~50%、17%~50%、18%~50%、19%~50%、20%~50%、21%~50%、22%~50%、23%~50%、24%~50%、25%~50%、26%~50%、27%~50%、28%~50%、29%~50%、30%~50%、31%~50%、32%~50%、33%~50%、34%~50%、35%~50%、36%~50%、37%~50%、38%~50%、39%~50%、40%~50%、41%~50%、42%~50%、43%~50%、44%~50%、45%~50%、46%~50%、47%~50%、48%~50%、49%~50%、1%~40%、2%~40%、3%~40%、4%~40%、5%~40%、6%~40%、7%~40%、8%~40%、9%~40%、10%~40%、11%~40%、12%~40%、13%~40%、14%~40%、15%~40%、16%~40%、17%~40%、18%~40%、19%~40%、20%~40%、21%~40%、22%~40%、23%~40%、24%~40%、25%~40%、26%~40%、27%~40%、28%~40%、29%~40%、30%~40%、31%~40%、32%~40%、33%~40%、34%~40%、35%~40%、36%~40%、37%~40%、38%~40%、39%~40%、1%~30%、2%~30%、3%~30%、4%~30%、5%~30%、6%~30%、7%~30%、8%~30%、9%~30%、10%~30%、11%~30%、12%~30%、13%~30%、14%~30%、15%~30%、16%~30%、17%~30%、18%~30%、19%~30%、20%~30%、21%~30%、22%~30%、23%~30%、24%~30%、25%~30%、26%~30%、27%~30%、28%~30%、29%~30%、 1%~29%、2%~29%、3%~29%、4%~29%、5%~29%、6%~29%、7%~29%、8%~29%、9%~29%、10%~29%、11%~29%、12%~29%、13%~29%、14%~29%、15%~29%、16%~29%、17%~29%、18%~29%、19%~29%、20%~29%、21%~29%、22%~29%、23%~29%、24%~29%、25%~29%、26%~29%、27%~29%、28%~29%、1%~28%、2%~28%、3%~28%、4%~28%、5%~28%、6%~28%、7%~28%、8%~28%、9%~28%、10%~28%、11%~28%、12%~28%、13%~28%、14%~28%、15%~28%、16%~28%、17%~28%、18%~28%、19%~28%、20%~28%、21%~28%、22%~28%、23%~28%、24%~28%、25%~28%、26%~28%、27%~28%、1%~27%、2%~27%、3%~27%、4%~27%、5%~27%、6%~27%、7%~27%、8%~27%、9%~27%、10%~27%、11%~27%、12%~27%、13%~27%、14%~27%、15%~27%、16%~27%、17%~27%、18%~27%、19%~27%、20%~27%、21%~27%、22%~27%、23%~27%、24%~27%、25%~27%、26%~27%、1%~26%、2%~26%、3%~26%、4%~26%、5%~26%、6%~26%、7%~26%、8%~26%、9%~26%、10%~26%、11%~26%、12%~26%、13%~26%、14%~26%、15%~26%、16%~26%、17%~26%、18%~26%、19%~26%、20%~26%、21%~26%、22%~26%、23%~26%、24%~26%、25%~26%、1%~25%、2%~25%、3%~25%、4%~25%、5%~25%、6%~25%、7%~25%、8%~25%、9%~25%、10%~25%、11%~25%、12%~25%、13%~25%、14%~25%、15%~25%、16%~25%、17%~25%、18%~25%、19%~25%、20%~25%、21%~25%、22%~25%、23%~25%、24%~25%、1%~24%、2%~24%、3%~24%、4%~24%、5%~24%、6%~24%、7%~24%、8%~24%、9%~24%、10%~24%、11%~24%、12%~24%、13%~24%、14%~24%、15%~24%、16%~24%、17%~24%、18%~24%、19%~24%、20%~24%、21%~24%、22%~24%、23%~24%、1%~23%、2%~23%、3%~23%、4%~23%、5%~23%、6%~23%、7%~23%、8%~23%、9%~23%、10%~23%、11%~23%、12%~23%、13%~23%、14%~23%、15%~23%、16%~23%、17%~23%、18%~23%、19%~23%、20%~23%、21%~23%、22%~23%、1%~22%、2%~22%、3%~22%、4%~22%、5%~22%、6%~22%、7%~22%、8%~22%、9%~22%、10%~22%、11%~22%、12%~22%、13%~22%、14%~22%、15%~22%、16%~22%、17%~22%、18%~22%、19%~22%、20%~22%、21%~22%、1%~21%、2%~21%、3%~21%、4%~21%、5%~21%、6%~21%、7%~21%、8%~21%、9%~21%、10%~21%、11%~21%、12%~21%、13%~21%、14%~21%、15%~21%、16%~21%、17%~21%、18%~21%、19%~21%、20%~21%、1%~20%、2%~20%、3%~20%、4%~20%、5%~20%、6%~20%、7%~20%、8%~20%、9%~20%、10%~20%、11%~20%、12%~20%、13%~20%、14%~20%、15%~20%、16%~20%、17%~20%、18%~20%、19%~20%、1%~19%、2%~19%、3%~19%、4%~19%、5%~19%、6%~19%、7%~19%、8%~19%、9%~19%、10%~19%、11%~19%、12%~19%、13%~19%、14%~19%、15%~19%、16%~19%、17%~19%、18%~19%、1%~18%、2%~18%、3%~18%、4%~18%、5%~18%、6%~18%、7%~18%、8%~18%、9%~18%、10%~18%、11%~18%、12%~18%、13%~18%、14%~18%、15%~18%、16%~18%、17%~18%、1%~17%、2%~17%、3%~17%、4%~17%、5%~17%、6%~17%、7%~17%、8%~17%、9%~17%、10%~17%、11%~17%、12%~17%、13%~17%、14%~17%、15%~17%、16%~17%、1%~16%、2%~16%、3%~16%、4%~16%、5%~16%、6%~16%、7%~16%、8%~16%、9%~16%、10%~16%、11%~16%、12%~16%、13%~16%、14%~16%、15%~16%、1%~15%、2%~15%、3%~15%、4%~15%、5%~15%、6%~15%、7%~15%、8%~15%、9%~15%、10%~15%、11%~15%、12%~15%、13%~15%、14%~15%、1%~14%、2%~14%、3%~14%、4%~14%、5%~14%、6%~14%、7%~14%、8%~14%、9%~14%、10%~14%、11%~14%、12%~14%、13%~14%、1%~13%、2%~13%、3%~13%、4%~13%、5%~13%、6%~13%、7%~13%、8%~13%、9%~13%、10%~13%、11%~13%、12%~13%、1%~12%、2%~12%、3%~12%、4%~12%、5%~12%、6%~12%、7%~12%、8%~12%、9%~12%、10%~12%、11%~12%、1%~11%、2%~11%、3%~11%、4%~11%、5%~11%、6%~11%、7%~11%、8%~11%、9%~11%、10%~11%、1%~10%、2%~10%、3%~10%、4%~10%、5%~10%、6%~10%、7%~10%、8%~10%、9%~10%、1%~9%、2%~9%、3%~9%、4%~9%、5%~9%、6%~9%、7%~9%、8%~9%、1%~8%、2%~8%、3%~8%、4%~8%、5%~8%、6%~8%、7%~8%、1%~7%、2%~7%、3%~7%、4%~7%、5%~7%、6%~7%、1%~6%、2%~6%、3%~6%、4%~6%、5%~6%、1%~5%、2%~5%、3%~5%、4%~5%、1%~4%、2%~4%、3%~4%、1%~3%、2%~3%、Or 1% to 2% higher ethanol to glycerol ratio.

[0107] [000119] In some embodiments, the compositions described herein have faster fermentation rates than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at acetic acid concentrations of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at lactic acid concentrations of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. In certain embodiments, the compositions described herein have a faster fermentation rate than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at a temperature of 33° C., at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9. In another embodiment, the compositions described herein have a faster fermentation rate than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at a temperature of 38° C., at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9.

[0108] [000120] In some embodiments, the compositions described herein are fermented at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably 4.2 to 4.9, after 24 hours of fermentation with a typical yeast product used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super At least about 0%, 1%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170% of the following: Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1 , 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, or 450% faster fermentation rate. In some embodiments, the compositions described herein are fermented at an acetic acid concentration of 0.1% w / v to 0.5% w / v, preferably at an acetic acid concentration of 0.25% w / v, at a lactic acid concentration of 0.50% w / v to 1.0% w / v, preferably at a lactic acid concentration of 0.36% w / v to 0.90% w / v, and at a pH of 3.5 to 5.0, preferably at a pH of 4.2 to 4.9, after 24 hours of fermentation, with a typical yeast product used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1) at most about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%,In some embodiments, the compositions described herein have a fermentation rate that is 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, or 450% faster. ...400%, 410%, 420%, 430%, 440%, or 450% faster. In some embodiments, the compositions described herein have a fermentation rate that is 300%, 310%, 320%, 330%, 340%, 350%, 400%, 410%, 420%, 430%, 440%, or 450% faster. In some embodiments, the compositions described herein have a fermentation rate that is 300%, 310%, 320%, 330%, 340%, 350%, 400 Alcohol®, 46EDV, Superstart®, DistilaMax® CN, PE-2, CAT-1) from about 0% to 450% (i.e., about 0% to about 450%), 1% to 450%, 10% to 450%, 20% to 450%, 30% to 450%, 40% to 450%, 50% to 450%, 60% to 450%, 70% to 450%, 80% to 450%, 90%~450%, 100%~450%, 110%~450%, 120%~450%, 130%~450%, 140%~450%, 150%~450%, 160%~450%, 170%~450%, 180%~450%, 190%~450%, 200%~450%, 210%~450%, 220%~450%, 230%~450%, 240%~450%, 250 %~450%, 260%~450%, 270%~450%, 280%~450%, 290%~450%, 300%~450%, 310%~450%, 320%~450%, 330%~450%, 340%~450%, 350%~450%, 360%~450%, 370%~450%, 380%~450%, 390%~450%, 400%~450%, 410%~450%, 420%~450%, 430%~450%, 440%~450%, 0%~400%, 1%~400%, 10%~400%, 20%~400%, 30%~400%, 40%~400%, 50%~400%, 60%~400%, 70%~400%, 80%~400%, 90%~400%, 100%~400%, 110%~400%, 120%~400%, 130%~400%,140%~400%, 150%~400%, 160%~400%, 170%~400%, 180%~400%, 190%~400%, 200%~400%, 210%~400%, 220%~400%, 230%~400%, 240%~400%, 250%~400%, 260%~400%, 270%~400%, 280%~400%, 290%~400%, 300%~400%, 310%~400%, 320%~400%, 330%~400%, 340%~400%, 350%~400%, 360%~400%, 3 70%~400%, 380%~400%, 390%~400%, 0%~300%, 1%~300%, 10%~300%, 20%~300%, 30%~300%, 40%~300%, 50%~300%, 60%~300%, 70%~300%, 80%~300%, 90%~300%, 100%~300%, 110%~300%, 120%~300%, 130%~300%, 140%~300%, 150%~300%, 160%~300%, 170%~300%, 180%~300%, 190%~300%, 200%~ 300%, 210%~300%, 220%~300%, 230%~300%, 240%~300%, 250%~300%, 260%~300%, 270%~300%, 280%~300%, 290%~300%, 0%~200%, 1%~200%, 10%~200%, 20%~200%, 30%~200%, 40%~200%, 50%~200%, 60%~200%, 70%~200%, 80%~200%, 90%~200%, 100%~200%, 110%~200%, 120%~200%, 130%~200% , 140% to 200%, 150% to 200%, 160% to 200%, 170% to 200%, 180% to 200%, 190% to 200%, 0% to 100%, 1% to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 0% to 50%, 1% to 50%, 10% to 50%, 20% to 50%, 30% to 50%, 40% to 50%, 0% to 10%, or 1% to 10% faster fermentation rate.

[0109] [000121] In some embodiments, the compositions described herein have one or more of the defining characteristics described herein. In some embodiments, the compositions described herein have one or more of the defining characteristics described herein at temperatures between 20°C and 40°C, preferably between 33°C and 38°C, at acetic acid concentrations between 0.1% w / v and 0.5% w / v, preferably between 0.25% w / v, at lactic acid concentrations between 0.50% w / v and 1.0% w / v, preferably between 0.36% w / v and 0.90% w / v, and at a pH between 3.5 and 5.0, preferably between 4.2 and 4.9. For example, in some embodiments, the compositions described herein have higher ethanol yields, higher fructose utilization, higher ethanol to glycerol ratios, faster fermentation rates, higher temperature tolerance, and higher organic acid tolerance than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1).

[0110] [000122] In some embodiments, one or more of the compositions described herein have a statistically significantly higher organic acid tolerance at low pH than typical yeast products used in fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46EDV, Superstart™, DistilaMax® CN, PE-2, CAT-1). Organic acid tolerance at low pH may be exhibited by one or more of high ethanol yield, high fructose utilization, high ethanol to glycerol ratio, and fast fermentation rate. In certain embodiments, one or more of the yeast strains and derivatives thereof described herein are provided at a pH of about 3.0-5.5, 3.5-5.5, 4.0-5.5, 4.5-5.5, 5.0-5.5, 3.0-5.0, 3.5-5.0, 4.0-5.0, 4.5-5.0, 3.0-4.5, 3.5-4.5, 4.0-4.5, 3.0-4.0, 3.5-4.0, or 3.0-3.5, at a concentration of about 0.1% to 1.5%. , 0.2%~1.5%, 0.3%~1.5%, 0.4%~1.5%, 0.5%~1.5%, 0.6%~1.5%, 0.7%~1.5%, 0.8%~1.5%, 0.9%~1.5%, 1.0%~1.5%, 1.1%~1.5%, 1.2%~1.5%, 1.3%~1.5%, 1.4%~1.5%, 0.1%~1.4%, 0.2%~1.4%, 0.3%~1.4%, 0.4%~1.4%, 0.5%~1. 4%, 0.6%~1.4%, 0.7%~1.4%, 0.8%~1.4%, 0.9%~1.4%, 1.0%~1.4%, 1.1%~1.4%, 1.2%~1.4%, 1.3%~1.4%, 0.1%~1.3%, 0.2%~1.3%, 0.3%~1.3%, 0.4%~1.3%, 0.5%~1.3%, 0.6%~1.3%, 0.7%~1.3%, 0.8%~1.3%, 0.9%~1.3%, 1.0% ~1.3%, 1.1%~1.3%, 1.2%~1.3%, 0.1%~1.2%, 0.2%~1.2%, 0.3%~1.2%, 0.4%~1.2%, 0.5%~1.2%, 0.6%~1.2%, 0.7%~1.2%, 0.8%~1.2%, 0.9%~1.2%, 1.0%~1.2%, 1.1%~1.2%, 0.1%~1.1%, 0.2%~1.1%, 0.3%~1.1%, 0.4%~1.1%, 0.5%~1.1%, 0.6%~1.1%, 0.7%~1.1%, 0.8%~1.1%, 0.9%~1.1%, 1.0%~1.1%, 0.1%~1.0%, 0.2%~1.0%, 0.3%~1.0%, 0.4%~1.0%, 0.5%~1.0%, 0.6%~1.0%, 0.7%~1.0%, 0.8%~1. 0%, 0.9%~1.0%, 0.1%~0.9%, 0.2%~0.9%, 0.3%~0.9%, 0.4%~0.9%, 0.5%~0.9%, 0.6%~0.9%, 0.7%~0.9%, 0.8%~0.9%, 0.1%~0.8%, 0.2%~0.8%, 0.3%~0.8%, 0.4%~0.8%, 0. 5%~0.8%, 0.6%~0.8%, 0.7%~0.8%, 0.1%~0.7%, 0.2%~0.7%, 0.3%~0.7%, 0.4%~0.7%, 0.5%~0.7%, 0.6%~0.7%, 0.1%~0.6%, 0.2%~0.6%, 0.3%~0.6%, 0.4%~0.6%, 0.5%~0. Able to tolerate organic acid concentrations (e.g., acetic acid and lactic acid) of 6%, 0.1%-0.5%, 0.2%-0.5%, 0.3%-0.5%, 0.4%-0.5%, 0.1%-0.4%, 0.2%-0.4%, 0.3%-0.4%, 0.1%-0.3%, 0.2%-0.3%, or 0.1%-0.2%.

[0111] 4. Ethanol Production [000123] Described herein are processes for producing ethanol from a substrate by contacting the substrate with a fermenting organism or a composition comprising a fermenting organism. The fermenting organism is selected from the yeast strains and derivatives thereof described herein. Fermenting organisms having characteristics substantially similar to those of Saccharomyces cerevisiae Y2083, Y2084, Y2086, Y2087, or the distinctly characterized yeast strains described herein or derivatives of the yeast strains described herein can be used in the processes described herein. Also described herein are fermentation products comprising any of the yeasts described herein. Further described herein are fermentation products obtained by the methods described herein. Fermentation products can include, but are not limited to, fuel ethanol, industrial ethanol, potable ethanol, bioethanol, fermented foods such as alcoholic beverages, cultured milk and yogurt, wine, beer, cider, tempeh, miso, kimchi, sauerkraut, and fermented sausages.

[0112] [000124] Fermentation is carried out in a fermentation medium. The fermentation medium includes a fermentation substrate, i.e., a carbohydrate source that is metabolized by the fermenting organism, such as biomass. The fermentation medium may include nutrients for the fermenting organism. Nutrients are widely used in the field of fermentation and include nitrogen sources, vitamins, minerals, or combinations thereof.

[0113] [000125] In one embodiment, the strain or derivative, or composition described herein is incubated with a substrate containing fermentable sugars from biomass, such as plant biomass from forests and / or agricultural or food processing products and / or co-products, which constitute a significant carbon source for the production of the molecule of interest. The strain or derivative is incubated with the substrate under conditions that allow for the fermentation of the fermentable sugars. The fermentable sugars can be glucose, galactose, maltose, fructose, sucrose, mannose, or combinations thereof. Typically, the fermentable sugars are glucose, fructose, and sucrose. The source of the fermentable sugars in the substrate can be any source containing fermentable sugars. The fermentable sugars in the substrate can be derived from, for example, any one or more of the following sources: hydrolyzed starch, hydrolyzed cellulose, molasses from sugarcane, sugar beet, or sweet sorghum, sugarcane juice, agave, sugar beet juice, grape juice, fruit juice, glucose, fructose, hydrolyzed maltodextrin, raw sugar juice, galactose, sucrose, any other form of fermentable sugar, or combinations thereof. The starch can be obtained from any starch-rich crop. Examples of starch-rich crops include, but are not limited to, corn, wheat, barley, cassava, sorghum, sweet potato, millet, rice, or any other starch-rich crop. In preparing the substrate, the crop is typically ground and mixed with water and hydrolytic enzymes under conditions that result in the hydrolysis of starch and the release of fermentable sugars such as glucose. Typical enzymes for starch hydrolysis include α-amylase, amyloglucosidase, pullulanase, β-amylase, glucoamylase, or mixtures thereof.

[0114] [000126] Generally, fermenting organisms such as yeast, including Saccharomyces cerevisiae yeast, require a suitable nitrogen source for propagation and fermentation. Many nitrogen sources can be used, and such nitrogen sources are well known in the art. The nitrogen source can be organic, such as urea or corn mash, or inorganic, such as ammonia, ammonium hydroxide, or ammonium salts.

[0115] [000127] In certain embodiments, the biomass may include or be derived from sugarcane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or combinations thereof. In certain embodiments, the substrate is provided in the form of molasses. Methods for producing molasses are known in the art and are described, for example, in Olbrich, (2006) Biotechnologie-Kempe GmbH, 128, and Clarke and Godshall, (2013) Chemistry and processing of sugarbeet and sugarcane: proceedings of the Symposium on the Chemistry and Processing of Sugarbeet, Denver, Colorado, April 6, 1987, and the Symposium on the Chemistry and Processing of Sugarcane, New Orleans, Louisiana, September 3-4, 1987, Elsevier. In certain embodiments, the substrate is provided in the form of a syrup. In certain embodiments, the substrate is provided in the form of corn mash or synthetic corn medium (SCM). Methods for preparing corn mash are known in the art and are described, for example, in Thomas et al. (2001) Journal of Applied Microbiology, 90, 819-828. Methods for preparing substrates similar in function to SCM are known in the art and are described, for example, in U.S. Patent No. 10,106,823, the entire contents of which are incorporated herein by reference. Methods for preparing starch-based substrates are also described, for example, in PCT Publication No. 2006 / 113683 and U.S. Patent Publication No. 2007 / 0014905.

[0116] [000128] The sugar content of the fermentation medium can be adjusted to be as high as possible while ensuring that the sugars are converted to ethanol as quickly and completely as possible. It is preferred that the yeast convert all of the sugars in the medium to ethanol and that the overall yield of conversion of consumed sugars to ethanol is as high as possible, so that little co-products, such as glycerol, are produced during fermentation.

[0117] [000129] Fermentation is carried out at a temperature that allows for the fermentation of fermentable sugars. Generally, the higher the temperature at which fermentation can be carried out, the more economical the industrial process. Typically, the temperature at which fermentation is carried out is about 25-42°C (i.e., about 25°C to about 42°C). Suitable temperature ranges are 25-41°C, 26-40°C, 27-40°C, 28-40°C, 29-40°C, 30-40°C, 25-39°C, 26-39°C, 27-39°C, 28-39°C, 29-39°C, 30-39°C, 31-39°C, 32-39°C, 33-39°C, 25-38°C, 26-38°C, 27-38°C, 28-38°C, 29-38°C, 30-38°C, 31-38°C, 32-38°C, 33-38°C, 25-27°C, 26 Includes up to 37°C, 27-37°C, 28-37°C, 29-37°C, 30-37°C, 31-37°C, 32-37°C, 33-37°C, 25-36°C, 26-36°C, 27-36°C, 28-36°C, 29-36°C, 30-36°C, 31-36°C, 32-36°C, 33-36°C, 25-35°C, 26-35°C, 27-35°C, 28-35°C, 29-35°C, 30-35°C, 31-35°C, 32-35°C, or 33-35°C.

[0118] [000130] Methods for fermentation and distillation are known in the art and are described, for example, in PCT Publication No. 2006 / 113683 and U.S. Patent Publication No. 2007 / 0014905. In particular, the ethanol production described herein can be carried out using simultaneous saccharification and fermentation ("SSF"), batch fermentation, fed-batch fermentation, or continuous fermentation.

[0119] a. Fermentation from sucrose-based substrates [000131] The use of refined molasses and other sugar products as feedstocks is a common method for industrial-scale production of bioethanol and distilled spirits. The ethanol fermentation process can utilize sugars obtained during refining, which occurs at any of the refining steps. The fermentation process is usually a fed-batch fermentation. Yeast can be propagated before fermentation, or the propagation step can be omitted by directly pitching the active dry yeast product. Fermentation can be carried out at a temperature of about 25°C to about 40°C, e.g., about 25°C to about 33°C, about 30°C to about 34°C, or 32°C to about 36°C. For bioethanol applications, a temperature of approximately 33°C is preferred. In one embodiment, fermentation is continued for about 6 hours to about 120 hours, particularly about 18 hours to about 72 hours, and preferably about 24 hours to about 48 hours. In one embodiment, the pH is about 3.0 to about 6.0, preferably about 4.0 to about 5.0.

[0120] b. Simultaneous Saccharification and Fermentation (“SSF”) SSF is widely used in industrial-scale fermentation processes, particularly ethanol production processes. When SSF is performed, the saccharification and fermentation steps occur simultaneously. There is no holding stage for saccharification, meaning that the fermentation organism, such as yeast, and enzymes can be added together. However, separate addition of the fermentation organism and enzymes (i.e., separate hydrolysis and fermentation (SHF)) is also contemplated. SSF can be performed at a temperature of about 25°C to about 40°C, e.g., about 28°C to about 35°C, e.g., about 30°C to about 34°C, preferably about 33°C. In one embodiment, fermentation is continued for about 6 hours to about 120 hours, particularly about 24 hours to about 96 hours, and preferably about 48 hours. In one embodiment, the pH is about 3.0 to 6.0, preferably about 4.0 to 5.0.

[0121] c. Ethanol recovery [000133] Following fermentation, e.g., SSF, ethanol can be separated from the spent fermentation medium or beer. The beer can be rectified or distilled to recover / extract the desired fermentation products (i.e., ethanol and higher alcohols). Alternatively, the desired fermentation product (i.e., ethanol) can be extracted from the fermentation medium by microfiltration or membrane filtration techniques known in the art. The fermentation product (i.e., ethanol) can also be recovered by stripping methods or other methods known in the art.

[0122] [000134] In some embodiments, ethanol is not recovered / extracted from the fermentation medium or beer, for example, in the production of alcoholic beverages. d. Batch fermentation [000135] Batch fermentation is when fermentation is carried out in separate batches. Batch fermentation is a process in which a fermentation medium is prepared in a fermenter from the start, the fermenter is inoculated with the intended microorganism (i.e., yeast, yeast product), and the fermentation process is run until predetermined conditions are reached, typically exhaustion of the substrate in the fermentation medium and cessation of ethanol production caused by exhaustion. Once the process is complete, the product is removed from the fermenter, and the fermenter is sterilized until the next fermentation. The contents can then be used as a final product (e.g., wine) or rectified / distilled (e.g., fuel ethanol and whiskey).

[0123] e. Fed-batch fermentation [000136] A fed-batch process can also be used. A fed-batch process is a fermentation in which a portion of the fermentation medium is prepared from the beginning of the fermentation process, an inoculum is added, and at a certain point after the additional fermentation substrate is started, a feed is fed to the fermenter at a rate that can be predetermined or determined by the conditions in the fermenter, until a maximum volume is reached. The feed may or may not have the same composition as the initial fermentation medium. The contents can then be the final product (e.g., wine) or rectified / distilled (e.g., fuel ethanol and whiskey).

[0124] f. Continuous fermentation [000137] Continuous fermentation allows for fermentation to occur over an extended period of time without fermenting in separate batches. A continuous fermentation process is one in which new growth medium is continuously fed to a fermenter and fermentate is simultaneously removed from the fermenter at the same rate to keep the volume in the fermenter constant. The contents can then be either a final product (e.g., wine) or rectified / distilled (e.g., fuel ethanol and whiskey).

[0125] 5. Ethanol [000138] The ethanol produced by the yeast and derivatives thereof described herein can be fuel ethanol, industrial ethanol, and / or potable ethanol. Fuel ethanol, industrial ethanol, and potable alcohol can be produced from starch-containing biomass, including starch found in cereal grains (e.g., corn, wheat, rice, sorghum / milo, barley, etc.), and from starch in tubers and root vegetables (e.g., potato, cassava, etc.); from plant vegetation containing the sugars sucrose, glucose, and fructose (e.g., sugarcane, sweet sorghum, sugar beet, agave, etc.); and from plant fruits and berries containing sucrose, glucose, and fructose (e.g., grapes, oranges, peaches, cherries, etc.).

[0126] [000139] Fuel and industrial ethanol can also be produced from plant biomass containing cellulose and hemicellulose, such as crop residues of cereal grains (e.g., wheat and rice straw, corn stover, corn cobs, etc.), from corn fiber, from so-called energy crops such as American sugarcane and poplar, from woody waste materials including residues from sawmills (e.g., sawdust and wood chips), from residues from pulp and paper manufacturing, and from waste paper and cardboard.

[0127] a. Fuel ethanol [000140] Fuel ethanol is produced for use in internal combustion engines and can be produced as anhydrous or hydrous fuel ethanol. Anhydrous fuel ethanol can be blended with gasoline to form an ethanol / gasoline mixture or with diesel to form an ethanol / diesel mixture. Hydrous fuel ethanol can be used directly as a fuel in internal combustion engines.

[0128] b. Industrial ethanol [000141] Industrial ethanol is produced for use in a variety of applications, including as a solvent in pharmaceuticals, cosmetics, surfactants, household cleaners and disinfectants, and coatings and inks, and as a chemical intermediate in the production of ethyl acetate, ethyl acrylate, polyethylene, acetic acid, and other organic molecules of industrial importance.

[0129] c. Potable ethanol [000142] Potable ethanol is produced for human consumption and includes ethanol found in wine, beer, cider, sake, mead, kombucha, and distilled spirits including whiskey, bourbon, cachaça, paical, paichu, etc.

[0130] 6. Yeast strain generation A. Directed mating [000143] Provided herein are methods for producing derivatives of the Saccharomyces yeast strain Y2083 described herein. The method may include providing a first yeast strain selected from Saccharomyces strains Y2083, Y2084, Y2086, and Y2087, and a second yeast strain, which may be any yeast strain in the Saccharomyces sensu stricto clade, such as a Saccharomyces cerevisiae strain. The second strain may also be any of the yeast strains described herein. The method may further include inducing sporulation of the first and second yeast strains. The method may also include screening and selecting spores from the first yeast strain and the second yeast strain. Additionally, the method may include crossing spores of the selected first yeast strain with spores of the selected second yeast strain; and screening or selecting the derivative strain. The method may include screening or selecting spores that exhibit one or more defining characteristics of the Saccharomyces strains described herein. The method may further include screening or selecting hybrids that exhibit one or more defining characteristics of the Saccharomyces strains described herein. An example of a directed cross is shown in FIG. 1A. Thus, the parents (i.e., the "a" and "alpha" haploid donors) that produce the hybrids are known. In one embodiment, the yeast strains described herein and their derivatives are produced from the process shown in FIGS. 1A-D. In one embodiment, the Saccharomyces yeast strains deposited at Y2083, Y2084, Y2086, and Y2087 are derived from one or more different Saccharomyces yeast strains by the process shown in FIGS. 1A-D, e.g., the process shown in FIG. 1A, such that one or more of Y2083, Y2084, Y2086, or Y2087 are the product of a directed cross. Methods of directed breeding are known in the art and are described in US Pat. Nos. 10,308,963 and 10,106,823, which are incorporated herein by reference.

[0131] B mass mating [000144] Provided herein are methods for producing derivatives of the Saccharomyces yeast strain Y2083 described herein. The methods may include providing a first yeast strain selected from Saccharomyces strains Y2083, Y2084, Y2086, and Y2087, and one or more additional yeast strains, such as any yeast strain in the Saccharomyces sensu stricto clade, such as a Saccharomyces cerevisiae strain. The one or more additional yeast strains may also be any of the yeast strains described herein. The methods may further include inducing sporulation of the first yeast strain and the one or more additional yeast strains. The methods may also include mixing all of the spores to allow for spore crossing, and screening or selecting derivative strains. The methods may include screening or selecting hybrids that exhibit one or more characteristic characteristics of the Saccharomyces strains described herein. An example of mass mating is shown in Figure 1B. Thus, the parents (i.e., the "a" and "alpha" haploid donors) that generate the hybrid are unknown. In one embodiment, the yeast strains described herein, and derivatives thereof, are derived from the process depicted in Figures 1A-D. In one embodiment, the Saccharomyces yeast strains deposited at Y2083, Y2084, Y2086, and Y2087 are derived from one or more different Saccharomyces yeast strains by the process depicted in Figures 1A-D, e.g., the process depicted in Figure 1B, such that one or more of Y2083, Y2084, Y2086, or Y2087 are the product of a population mating.

[0132] 7. Working Example [000145] The foregoing may be better understood with reference to the following examples, which are presented for illustrative purposes and are not intended to limit the scope of the invention. The present disclosure has numerous aspects and embodiments, which are illustrated by the accompanying non-limiting examples.

[0133] Example 1 material and method [000146] Diluted sugarcane molasses medium (DM) is used in the following examples. Molasses (79° Brix, United States Standards for Grades of Sugarcane Molasses, USDA, 1956) is commonly used in industrial bioethanol production. DM is prepared by dilution of commercially available molasses and adjusted to reflect the chemical composition of the sugarcane molasses used at production scale in terms of sugar and nutrient availability. DM reflects medium-gravity model sugarcane molasses with 22-25% fermentable sugars and should yield a final ethanol content of 7-11% w / v. Molasses quality and composition can vary depending on geography and refinery procedures.

[0134] [000147] This medium is used to monitor yeast performance during a batch fermentation process, where fermentable sugars are added once before the start of fermentation. [000148] Preparation of Standard DM (SDM). 1 kg of SDM medium was made by adding 1 L of water to 615 g of molasses and 1.6 g of urea. The medium was autoclaved at 120°C for 20 minutes and cooled to room temperature. The pH was adjusted to 4.87 with hydrochloric acid and / or potassium hydroxide while mixing at 24–25°C. To minimize contaminant growth during fermentation, virginiamycin was added to 1.0 ppm and penicillin G was added to 100 ppm. The broth was adjusted to 22–25% w / v fermentable sugars with water. The resulting medium contains 0.36% w / v lactic acid and 0.25% w / v acetic acid. A representative sample of the solution was collected for specific gravity measurement and HPLC analysis.

[0135] [000149] Preparation of high organic acid DM (ALM). 1 kg of ALM was prepared in the same manner as SDM except that lactic acid was added and the pH was adjusted to 4.2. The resulting medium contains 22-25% w / v fermentable sugars, 0.9% w / v lactic acid, and 0.25% acetic acid.

[0136] [000150] Yeast Product Rehydration. The yeast dry product was resuspended in 0.9% sodium chloride (0.07 g / g) and allowed to hydrate at room temperature for 30 minutes before inoculation. [000151] Batch fermentation. 95.00 ± 0.02 mL of SDM or ALM was added to each test sample container for each yeast strain. 5 g of yeast culture or rehydrated yeast product was inoculated into the sample container containing SDM or ALM. The sample container was closed with an airlock cap filled with water. The sample containers were incubated at 33°C or 38°C, 150 rpm, and 80% humidity for 48 hours. The weight of each sample container was measured before incubation and at 24 and 48 hours of incubation. After 48 hours of incubation, the fermentation was terminated, and the sample containers were removed from the incubator and sampled for HPLC analysis.

[0137] [000152] End of Fermentation HPLC Analysis. The composition of samples at the end of fermentation was analyzed for residual sugars, lactic acid, acetic acid, glycerol and ethanol using art methods. [000153] Ethanol yield. The ratio of glucose equivalents of ethanol present at the end of fermentation to glucose equivalents at the end of all fermentations was used to determine ethanol yield. The relative difference in ethanol yield was determined as the percentage ratio of ethanol yield to the average ethanol yield of Y1027 minus 100 percent.

[0138] [000154] Ethanol to glycerol ratio. Net glycerol produced during fermentation was determined as the difference between the total glycerol at the end of fermentation and the initial glycerol present in the medium. The ethanol to glycerol ratio (ethanol:glycerol) was determined as the ratio of ethanol to net glycerol. The relative percent change in ethanol:glycerol for Y1027 was determined as the difference between the percent ethanol:glycerol ratio of the average ethanol:glycerol for Y1027 minus 100 percent.

[0139]

number

[0140] [000155] Fructose Utilization. The concentration of residual fructose at the end of fermentation was used as an indicator of fructose utilization, e.g., less residual fructose indicates higher fructose utilization. The relative percent change in fructose utilization for Y1027 was determined as the difference between the percent ratio of residual fructose to the average residual fructose of Y1027 minus 100 percent.

[0141]

number

[0142] [000156] Fermentation Rate. The amount of CO produced in grams during ethanol fermentation is proportional to the amount of ethanol produced in grams during the same reaction. Therefore, mass loss in grams can be used to assess the progress of the fermentation reaction without breaking the anaerobic seal. Mass loss in grams over 24 hours of fermentation was used as an indicator of the mean fermentation rate. The relative change in fermentation rate of a given strain relative to Y1027 was determined as the percent ratio of that strain's fermentation rate to the average fermentation rate of Y1027 minus 100 percent.

[0143]

number

[0144] [000157] Statistical Analysis. Student's T-tests were performed for ethanol, ethanol yield, ethanol, glycerol, ethanol to glycerol ratio, glucose and fructose values, and velocity. 95% confidence intervals (95% CI) and standard errors for each analyte were calculated.

[0145] Example 2 Mutants derived from Y1027 [000158] Genetic diversity can be generated in yeast populations by artificially introducing mutations. Artificial mutagenesis can be obtained by exposure to radiant energy (e.g., ultraviolet light), chemical mutagens (e.g., ethyl methanesulfonate, EMS), or a combination of both. The following paragraphs demonstrate the use of artificial mutagenesis to generate a genetically diverse population starting with Y1027.

[0146] [000159] A fresh colony of Y1027 was inoculated into 50 mL of YPS medium (1% w / v yeast extract, 2% w / v Bacto-peptone, 2% w / v sucrose) and incubated at 33°C with agitation at 250 rpm for 24 hours. The culture was grown to 2.2 x 10 8 The cells were diluted to 0–4 kJ / cm 2 The cultures were exposed to UV radiation and 3% w / v EMS for 90–240 min. The cultures were washed with phosphate-buffered saline buffer at pH 7.4 and stored at 4°C. Aliquots of the cultures before and after treatment were plated on YPS agar plates, and the colony ratio relative to the untreated culture was used to determine survival (Table 1).

[0147] [Table 1]

[0148] Example 3 Selection of strains with improved acid tolerance [000160] A pool of mutants derived from Y1027 was inoculated into 1% w / v yeast extract, 2% w / v Bacto-peptone, 10.8% w / v fermentable sugars (2.8% glucose, 8% fructose), 9.6% w / v ethanol, 1.2% w / v lactic acid at pH 3.8 and incubated for 24 hours at 38°C. Surviving cells were plated onto YPS agar plates and incubated at 32°C to obtain isolated colonies.

[0149] Example 4 Guided evolution [000161] Directed evolution applies selective pressure to genetically diverse populations to obtain fitness advantages that are otherwise difficult to obtain through traditional breeding and selection. Directed evolution can be carried out under the continuous culture conditions described herein, as sequential batch or fed-batch passages, or a combination of both. Selection conditions can be applied simultaneously, sequentially, or in an alternating pattern to improve specific traits throughout the course of strain development. Those skilled in the art will recognize the need for protocol modification steps throughout the conduct of directed evolution experiments. For example, those skilled in the art can adjust the feed rate of certain nutrients.

[0150] [000162] Genetically diverse populations can be generated through natural mutations and / or by artificial mutagenesis (e.g., chemical mutagenesis). Genetically diverse populations can also be generated by breeding genetically diverse strains as described in the previous examples.

[0151] [000163] Directed evolution of temperature tolerance. In one example, directed evolution was performed by continuously culturing an acid-tolerant strain as the starting strain in sugarcane molasses medium for 100 days at 37°C to 38°C. Cells were maintained in suspension with continuous agitation at 150 rpm. The culture was continuously fed with standard diluted molasses medium (SDM). Fermentable sugar concentrations were maintained at 4-6% w / v throughout the experiment, and ethanol was maintained at 3.6-7.7% w / v. Initial organic acid concentrations were 0.326 ± 0.015% w / v acetic acid and 0.5-0.6% w / v lactic acid. The initial pH was adjusted to 4.8-4.9. After 650 h of continuous cultivation, the feed medium was acidified to pH 4.4 with hydrochloric acid, and the lactate concentration in the feed was increased to 1% w / v, reaching 0.77% w / v and pH 4.4 at the end of induced evolution in the culture vessel. Growth was stimulated by the addition of Tween-80 (420 mg / L) and ergosterol (10 mg / L).

[0152] Example 5 Sporulation of yeast cultures [000164] Meiotic yeast spore formation can be induced according to methods well known in the art (e.g., as described in "Methods in Yeast Genetics, A Cold Spring Harbor Laboratory Course Manual, 2000 Edition" by D. Burke, D. Dawson, and T. Stearns, Cold Spring Harbor Laboratory Press (ISBN 0-87969-588-9)). Meiotic yeast spore formation was promoted by resuspending fresh yeast cultures grown in acetate medium (1% w / v yeast extract, 2% w / v bactopeptone, 2% w / v potassium acetate) in sporulation medium and incubating at 30°C for 5 days with agitation at 250 rpm. In some cases, the spore suspension was treated with an equal volume of ethyl ether, incubated at room temperature (e.g., 25°C) for 2 hours, and washed with sterile sporulation medium to remove vegetative cells. The spore suspension was stored at 4°C until use.

[0153] [000165] Spore germination. Spore suspensions from strains with the desired traits were treated with 5 units / mL zymolyase for 15 minutes to disrupt the ascus wall and promote spore separation. Spore germination was induced by incubation in YPS medium.

[0154] Example 6 Isolation of haploid strains [000166] To isolate individual haploid strains, germinating meiotic spores were immediately excised from the asci with the aid of a micromanipulator and incubated on YPS agar plates at 32°C until growth was observed. Haploid mating types were confirmed by PCR amplification of the MAT locus (Huxley et al., TIG, 1990;6(8):236).

[0155] Example 7 Induced mating [000167] Breeding occurs when physical contact between two haploid cells or meiotic spores germinating from opposite mating types (MAT alpha and MA Ta) results in cell fusion and the formation of a diploid cell. Direct breeding is the result of manually induced breeding, in which a skilled artisan facilitates physical contact between the two cells. The use of a micromanipulation device (e.g., Singer Model No. 1377 A3) can be used to facilitate physical contact between the two cells.

[0156] [000168] In some cases, two individual stable haploid cells of opposite mating types are brought into physical contact. As an example, individual MAT alpha haploid cells were obtained from the passage of the Y1027 mutant. The MAT alpha haploid cells were brought into physical contact with individual MA Ta haploid cells inherited from the hybrid strain. The pairs were placed on YPS agar plates with the aid of a micromanipulator and incubated at 32°C until growth was observed.

[0157] [000169] In other cases, following treatment with 5 units / mL of zymolyase, random meiotic spores from a first strain with the desired characteristics were physically removed, separated from other meiotic spores in the same ascites, and placed on a YPS agar plate using a micromanipulator. Random meiotic spores from a second strain with the desired characteristics were removed in the same manner and physically placed next to the first spores, bringing them into physical contact with the YPS agar plate. The spore pairs were allowed to germinate and fuse by incubation at 32°C until growth was observed. For example, hybrid diploid passages were obtained by physically contacting individual spores from an acid-tolerant mutant strain and a high fructose-producing strain, Fermichamp.

[0158] [000170] In other cases, single zymolyase-treated random spores from a first strain with the desired characteristics were physically contacted with individual cells from a stable haploid strain exhibiting the desired characteristics on a micromanipulator-assisted YPS agar plate and incubated at 32°C until growth was observed. For example, random spores from an intermediate hybrid were contacted with individual MAT alpha haploid cells from the CAT-1 strain to generate a new hybrid strain.

[0159] [000171] Colonies obtained from induced matings were reisolated on fresh YPS agar plates and the diploid state was confirmed by PCR amplification of the MAT locus (Huxley et al., TIG, 1990;6(8):236).

[0160] Example 8 Mass mating [000172] Breeding by mass mating is the result of random cell fusion between two haploid cells of opposite mating types in a mixed haploid cell suspension. The haploid cell suspension can be obtained from one or more stable haploid populations, provided that both mating types are present. Alternatively, a haploid cell suspension can be obtained by treating a spore suspension with zymolyase to digest the ascus wall and promote mechanical separation of meiotic spores. The zymolyase-treated spore suspension is diluted in a medium containing sucrose or glucose to promote spore germination in the haploid cells. The suspension is mixed and allowed to settle for a short period to promote cell fusion events.

[0161] [000173] In the context of the present invention, ethyl ether-treated meiotic spores from at least two different strains possessing the desired characteristics were treated with 5 units / mL of zymolyase for 30 minutes, mixed with 10 mL of YPS broth (1% yeast extract, 1% peptone, 2% sucrose), and resuspended. The mixture was incubated without stirring for 1.5 hours to allow random contact between germinating individual spores. The mixture was further incubated at 33°C for an additional 18-20 hours with gentle stirring at 70 rpm.

[0162] [000174] Colonies obtained by direct mating were reisolated on fresh YPS agar plates and the diploid state was confirmed by PCR amplification of the MAT locus (Huxley et al., TIG, 1990;6(8):236).

[0163] Example 9 Breeding and selection for tolerance to multiple stresses and fermentation rates [000175] A combination of breeding and guided evolution was used to improve tolerance to multiple stresses and improve fermentation rates. Tolerance to multiple stresses was achieved by applying several rounds of mass mating and selection to a population of intermediate strains obtained through breeding and selection for improved acid and temperature tolerance in sugarcane molasses medium. A portion of the strains was first inoculated into continuous cultures in SDM medium at 33°C. A second portion of the strains was first selected in YP (1% yeast extract, 2% bacto-peptone) for tolerance to different concentrations of organic acids and ethanol at various temperatures and pH levels from 36°C to 40°C. Isolates meeting each selection criterion were combined for sporulation and mass mating. At different time points throughout the experiment, aliquots from the continuous cultures were obtained and subjected to the mass mating and selection protocol. Conversely, a portion of the strains surviving each round of temperature and acid selection were inoculated into continuous cultures in SDM medium at 33°C for rate selection.

[0164] Example 10 Strain Description [000176] Representative samples of the yeast strains of the genus Saccharomyces described herein, as well as the strains deposited under NRRL Patent Deposit Designation Nos. Y-68182 (Y2083), Y-68183 (Y2084), Y-68184 (Y2086), and Y-68185 (Y2087), were observed to have the following characteristics based on experiments conducted at normal pH without organic acids or at low pH with added organic acids at 33°C or 38°C. Y1027 is shown for comparison and was analyzed under similar conditions.

[0165] [000177] Notable advantageous characteristics of the yeast strains described herein include higher ethanol yields, higher fructose utilization, higher ethanol to glycerol ratios, and faster initial fermentation rates compared to controls. The advantageous fermentation characteristics of the yeast strains described herein and their corresponding products are demonstrated in the Examples below.

[0166] Example 11 Ethanol production, glycerol production, and fermentation rate [000178] Active dry yeast products from the yeast strains described herein were evaluated for ethanol production, fructose utilization, glycerol production, and fermentation rate in standard diluted molasses medium (SDM) initially containing 22.5-24.5% w / v fermentable sugars, 0.36% w / v lactic acid, and 0.25% w / v acetic acid at 33°C and pH 4.9 (Table 2 and Figures 2A-E). A control (Y1027) is shown for comparison.

[0167] [Table 2]

[0168] [000179] Active dry yeast products from the yeast strains described herein were evaluated for ethanol production, fructose utilization, glycerol production, and fermentation rate at 33°C and pH 4.2 in ALM initially containing 22.5-24.5% w / v fermentable sugars, 0.9% w / v lactic acid, and 0.25% w / v acetic acid (Table 3 and Figures 3A-E). A control (Y1027) is shown for comparison.

[0169] [Table 3]

[0170] [000180] Active dry yeast products from the yeast strains described herein were evaluated for ethanol production, fructose utilization, glycerol production, and fermentation rate at 38°C and pH 4.9 in SDM initially containing 22.5-24.5% w / v fermentable sugars, 0.36% w / v lactic acid, and 0.25% w / v acetic acid (Table 4 and Figures 4A-E). A control (Y1027) is shown for comparison.

[0171] [Table 4]

[0172] [000181] Active dry yeast products from the yeast strains described herein were evaluated for ethanol production, fructose utilization, glycerol production, and fermentation rate at 38°C and pH 4.2 in ALM initially containing 22.5-24.5% w / v fermentable sugars, 0.9% w / v lactic acid, and 0.25% w / v acetic acid (Table 5 and Figures 5A-E). A control (Y1027) is shown for comparison.

[0173] [Table 5]

[0174] [000182] Table 6 summarizes the results. Percentages indicate the percent change from the control for the yeast strains described herein.

[0175] [Table 6]

[0176] Example 12 Differentiation of strains Y2083, Y2084, Y2086, and Y2087 from each other and from other commercial bioethanol yeast strains by microsatellite PCR [000183] A comparison of genotypes utilized for PCR amplification of microsatellite loci was performed to demonstrate that strains Y2083, Y2084, Y2086, and Y2087 (NRRL Patent Deposit Designation Nos. Y-68182, Y-68183, Y-68184, and Y-68185, respectively) have unique genotypes and can be differentiated from other strains isolated from commercial yeast production used in bioethanol production (Table 7).

[0177] [Table 7]

[0178] [000184] In this example, microsatellite DNA amplification products were generated through multiplex PCR of the YPL009C and YOR267C loci. The primers used were YPL009C_F1: GGTTTTGGATTTTTATGGAAAG (SEQ ID NO: 1), YPL009C_R1: TTTCGTGCTATCGTTTGAATC (SEQ ID NO: 2), YOR267C_F1: CGATGCTAATGGTGACTCTAAC (SEQ ID NO: 3), and YOR267C_R1: CTGTTGACTCGATTTATTATCG (SEQ ID NO: 4). Each primer was used at a concentration of 0.4 μM. Reactions were performed in a final volume of 20 μl using 10 μl of OneTaq Hot Start 2x Master Mix containing standard buffer (New England Biolabs, catalog number: M0484S). PCR amplification was performed using a Mastercycler Nexus Gradient Instrument (Eppendorf) with the following thermocycling conditions: 94°C for 2 minutes, followed by 35 cycles of an initial denaturation step at 94°C for 30 seconds, 53.5°C for 20 seconds, and 68°C for 30 seconds, followed by a final extension step at 68°C for 5 minutes. PCR products were analyzed by capillary electrophoresis using a QIAxcel Advanced Instrument (Qiagen) with the following operating settings: rise time: 0.3 seconds; applied injection time: 20 seconds; applied separation time: 425 seconds; method injection time: 10 seconds; method separation time: 420 seconds; method injection voltage: 5.0 kV; and method separation voltage: 5.0 kV. Fragment sizes were compared to a reference marker table generated using QX DNA size markers 100 bp-2.5 kb (Qiagen catalog number: 929559) prepared in 1× PCR buffer to a final concentration of 20 ng / μl. The alignment marker used was the QX alignment marker 15 bp / 5 kb (Qiagen catalog number: 929524).

[0179] [000185] Through the results of this analysis, it is observed that strains Y2083, Y2084, Y2086, and Y2087 are novel yeast strains that can be differentiated from prior art strains based on their microsatellite DNA patterns (Figure 6).

[0180] Example 13 How to analyze strain uniqueness using bioinformatics analysis [000186] To further demonstrate that strains Y2083, Y2084, Y2086, and Y2087 are genetically unique and distinct from each other and from Y1027, PacBio whole-genome sequencing was performed. The coding ORFs from the reference strain S288C were used as query sequences for blastn analysis against the whole-genome assemblies from each strain to identify the corresponding ORFs in the strains.

[0181] [000187] Further bioinformatic sequence analysis was performed in which a subset of ORF sequences were compared between strains. [000188] The sequence comparison results are presented as a heat map showing the percentage of identical nucleotide matches in each strain relative to Y1027 for the 56 ORF sequences (Figure 7A). The intensity legend on the heat map corresponds to the percentage of exact matches generated through blastn analysis using the Y1027 ORF sequence as the query sequence. Shaded rectangles represent percent identity less than 100% compared to the Y1027 sequence and therefore indicate sequence variation. In Figure 7A, strains Y2083, Y2084, Y2086, and Y2087 each have a unique shading pattern, indicating, in line with the microsatellite PCR results, that the strains claimed in this invention have a new and unique genotype.

[0182] [000189] Additional bioinformatics analysis was performed to verify the unique genotypes of strains Y2083 and Y2084, with the microsatellite PCR profiles being most similar. An additional subset of predicted ORF sequences was used to compare strain Y2083 versus strain Y2084 using blastn. The heatmap in Figure 7B shows the percentage of perfect matches for strain Y2083 versus Y2084 for 16 ORFs. Percent identities less than 100% for Y2083 versus Y2084 indicate that the two strains have different genotypes.

[0183] [000190] The foregoing description of specific embodiments makes fully apparent the general nature of the present invention, such that, other than as described, those skilled in the art can readily modify and / or adapt such specific embodiments for various uses without undue experimentation by applying their knowledge without departing from the general gist of the present disclosure. Accordingly, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein. It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, and therefore should be interpreted by one of ordinary skill in the art in light of the teaching and guidance.

[0184] [000191] The breadth and scope of the present disclosure should not be limited by any of the above-described exemplary embodiments, but should be defined only in accordance with the following claims and their equivalents. [000192] All publications, patents, patent applications, and / or other documents mentioned herein are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, and / or other document was individually intended to be incorporated by reference for all purposes.

[0185] [000193] For reasons of completeness, various aspects of the invention are set out in the following numbered clauses. [000194] Clause 1. A non-naturally occurring yeast strain of Saccharomyces selected from: (a) Saccharomyces strain Y2083, which is a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68182; (b) Saccharomyces strain Y2084, which is a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68183; (c) Saccharomyces strain Y2086, which is a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68184; or (d) Saccharomyces strain Y2087, which is a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68185.

[0186] [000195] Clause 2. A non-naturally occurring derivative of a yeast strain of the genus Saccharomyces selected from: (a) Saccharomyces sp. strain Y2083, which is a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68182; (b) Saccharomyces sp. strain Y2084, which is a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68183; (c) Saccharomyces sp. strain Y2086, which is a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68184; or (d) Saccharomyces sp. strain Y2087, which is a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68185.

[0187] [000196] Clause 3. The yeast strain of clause 1 or the derivative of clause 2, comprising one or more distinct characteristics selected from: (a) a higher ethanol yield than Saccharomyces strain Y1027 under the same fermentation conditions; (b) a higher temperature tolerance compared to Saccharomyces strain Y1027; (c) a higher fructose utilization than Saccharomyces strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio than Saccharomyces strain Y1027 under the same fermentation conditions; (e) a higher organic acid tolerance compared to Saccharomyces strain Y1027 under the same fermentation conditions; and (f) a faster fermentation rate compared to Saccharomyces strain Y1027 under the same fermentation conditions.

[0188] [000197] Clause 4. The yeast strain or derivative of any one of clauses 1 to 3, having an ethanol yield after 48 hours of fermentation that is at least about 3.3% higher than Saccharomyces cerevisiae strain Y1027.

[0189] [000198] Clause 5. The yeast strain or derivative of any one of clauses 1 to 3, having at least about 5% higher fructose utilization than Saccharomyces cerevisiae strain Y1027 after 48 hours of fermentation.

[0190] [000199] Clause 6. The yeast strain or derivative of any one of clauses 1 to 3, having an ethanol to glycerol ratio that is at least about 11% higher than Saccharomyces cerevisiae strain Y1027 after 48 hours of fermentation.

[0191] [000200] Clause 7. The yeast strain or derivative of any one of clauses 1 to 3, having a fermentation rate that is at least about 1.5% faster than Saccharomyces cerevisiae strain Y1027 after 24 hours of fermentation.

[0192] [000201] Clause 8. The yeast strain or derivative of any one of clauses 1 to 7, having a higher temperature tolerance during fermentation than Saccharomyces cerevisiae strain Y1027 at a fermentation temperature in the range of 33°C to 38°C.

[0193] [000202] Clause 9. The yeast strain or derivative of clause 8, wherein the fermentation temperature is 33°C. [000203] Clause 10. The yeast strain or derivative of clause 8, wherein the fermentation temperature is 38°C. [000204] Clause 11. The yeast strain or derivative of any one of clauses 1 to 10, which has a higher organic acid tolerance compared to Saccharomyces cerevisiae strain Y1027 when increasing the amount of organic acid in the fermentation medium reduces the fermentation pH from about 4.9 to about 4.0.

[0194] [000205] Clause 12. The yeast strain or derivative of clause 11, wherein the organic acids in the fermentation medium comprise 0.36% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.9. [000206] Clause 13. The yeast strain or derivative of any one of clauses 3 to 11, wherein the organic acid comprises lactic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, or a combination thereof.

[0195] [000207] Clause 14. A method for producing a derivative of a yeast strain of the genus Saccharomyces of any one of clauses 2 to 13, comprising: (1) (a) (i) a first yeast strain selected from Saccharomyces sensu Y2083, Y2084, Y2086, Y2087, and derivatives thereof; and (ii) a Saccharomyces sensu (b) inducing sporulation of the first yeast strain and the second yeast strain; (c) screening and selecting spores from the first yeast strain and spores from the second yeast strain; (d) crossing spores of the selected first yeast strain with spores of the selected second yeast strain; and (e) screening or selecting derivative strains; or (2)(a)(i) a first yeast strain selected from Saccharomyces sensu Y2083, Y2084, Y2086, Y2087, and derivatives thereof; and (ii) Saccharomyces sensu (b) providing one or more additional yeast strains of the stricto clade; (b) inducing sporulation of the first yeast strain and the one or more additional yeast strains to produce spores; (c) mixing all of the spores of step (b) to allow cross-pollination of the spores; and (d) screening or selecting derivative strains.

[0196] [000208] Clause 15. The method of clause 14, wherein step (1)(c) comprises screening or selecting spores that exhibit one or more distinctive characteristics of Saccharomyces strain Y2083, Y2084, Y2086, Y2087, or derivatives thereof, and wherein step (1)(e) comprises screening or selecting hybrids that exhibit one or more distinctive characteristics of Saccharomyces strain Y2083, Y2084, Y2086, Y2087, or derivatives thereof.

[0197] [000209] Clause 16. The method of Clause 14, wherein step (2)(d) comprises screening or selecting hybrids that exhibit one or more distinctive characteristics of Saccharomyces strain Y2083, Y2084, Y2086, or Y2087.

[0198] [000210] Clause 17. A mutant yeast of the yeast strain described in Clause 1 or a derivative described in Clause 2. [000211] Clause 18. A method of producing a mutant yeast according to clause 17, wherein the mutant yeast is mutated by contacting the yeast strain with a mutagen.

[0199] [000212] Clause 19. The method of clause 18, wherein the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methyl methanesulfonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3-(ethyl-2-chloroethyl)aminopropylamino]acridine 2 (ICR-170), or nitrogen mustard.

[0200] [000213] Clause 20. A method of producing a mutant yeast according to clause 17, wherein the mutant yeast is mutated by contacting the derivative with a mutagen. [000214] Clause 21. The method of clause 20, wherein the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methyl methanesulfonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3-(ethyl-2-chloroethyl)aminopropylamino]acridine 2 (ICR-170), or nitrogen mustard.

[0201] [000215] Clause 22. An evolved yeast of the yeast strain described in Clause 1 or a derivative described in Clause 2. [000216] Clause 23. A method of generating an evolved yeast according to clause 22, wherein the evolution is induced by applying selective pressure to the yeast strain.

[0202] [000217] Clause 24. A method of generating an evolved yeast according to clause 22, wherein the evolution is induced by applying selective pressure to the derivative. [000218] Clause 25. A genetically modified yeast of the yeast strain described in Clause 1 or a derivative described in Clause 2.

[0203] [000219] Clause 26. The genetically modified yeast of Clause 25, wherein the nucleic acid sequence of the genetically modified yeast is altered using gene editing. [000220] Clause 27. A recombinant yeast of the yeast strain described in Clause 1 or a derivative described in Clause 2.

[0204] [000221] Clause 28. The recombinant yeast of Clause 27, comprising a modification that silences expression of a gene, enhances expression of a gene, introduces a gene, or deletes a gene. [000222] Clause 29. A process for producing ethanol from a substrate by contacting the substrate with a fermenting organism, wherein the fermenting organism is selected from (a) Saccharomyces sp. strain Y2083, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68182, or a derivative thereof; (b) Saccharomyces sp. strain Y2084, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68183, or a derivative thereof; (c) Saccharomyces sp. strain Y2086, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68184, or a derivative thereof; or (d) Saccharomyces sp. strain Y2087, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68185, or a derivative thereof.

[0205] [000223] Clause 30. The process of clause 29, wherein the substrate comprises or is derived from sugarcane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof.

[0206] [000224] Clause 31. The process of Clause 29, wherein the yeast comprises one or more defining characteristics selected from: (a) a higher ethanol yield than Saccharomyces strain Y1027 under the same fermentation conditions; (b) a higher temperature tolerance compared to Saccharomyces strain Y1027; (c) a higher fructose utilization than Saccharomyces strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio than Saccharomyces strain Y1027 under the same fermentation conditions; (e) a higher organic acid tolerance compared to Saccharomyces strain Y1027 under the same fermentation conditions; and (f) a faster fermentation rate compared to Saccharomyces strain Y1027 under the same fermentation conditions.

[0207] [000225] Clause 32. The process of any one of clauses 29 to 31, wherein the yeast has a higher temperature tolerance during fermentation than Saccharomyces cerevisiae strain Y1027 at fermentation temperatures ranging from 33°C to 38°C.

[0208] [000226] Clause 33. The process of clause 32, wherein the fermentation temperature is 33°C. [000227] Clause 34. The process of clause 32, wherein the fermentation temperature is 38°C. [000228] Clause 35. The process of any one of clauses 29 to 34, wherein the yeast has a higher organic acid tolerance in a fermentation medium at a pH decreasing from about 4.9 to about 4.0 in the presence of increasing organic acids compared to Saccharomyces cerevisiae strain Y1027.

[0209] [000229] Clause 36. The process of clause 35, wherein the organic acids in the fermentation medium comprise 0.36% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.9. [000230] Clause 37. The process of clause 35, wherein the organic acids in the fermentation medium comprise 0.9% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.2.

[0210] [000231] Clause 38. The process of any one of clauses 29 to 37, wherein the ethanol is used as fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.

[0211] [000232] Clause 39. The process of any one of clauses 29 to 37, wherein ethanol is produced using starch. [000233] Clause 40. The process of clause 39, wherein simultaneous saccharification and fermentation (SSF) or continuous fermentation is used to produce ethanol.

[0212] [000234] Clause 41. The process of any one of clauses 29 to 37, wherein ethanol is produced using sugar. [000235] Clause 42. The process of clause 41, wherein batch fermentation or continuous fermentation is used to produce ethanol.

[0213] [000236] Clause 43. The process of any one of clauses 29 to 37, wherein ethanol is produced using lignocellulosic sugars. [000237] Clause 44. The process of clause 43, wherein simultaneous saccharification and fermentation (SSF) or separate hydrolysis and fermentation (SHF) is used to produce ethanol.

[0214] [000238] Clause 45. A composition comprising the yeast strain of clause 1 or the derivative of clause 2 and one or more components selected from surfactants, emulsifiers, gums, sweeteners, protectants, and antioxidants.

[0215] [000239] Clause 46. The composition of clause 45, comprising one or more distinct characteristics selected from: (a) a higher ethanol yield than Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (b) a higher temperature tolerance compared to Saccharomyces cerevisiae strain Y1027; (c) a higher fructose utilization than Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (e) a higher organic acid tolerance compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; and (f) a faster fermentation rate compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions.

[0216] [000240] Clause 47. The composition of clause 45 or clause 46, wherein the yeast has a higher temperature tolerance at 33°C to 38°C than Saccharomyces cerevisiae strain Y1027. [000241] Clause 48. The composition of any one of clauses 45 to 47, wherein the temperature is 33°C.

[0217] [000242] Clause 49. The composition of any one of clauses 45 to 47, wherein the temperature is 38°C. [000243] Clause 50. The composition of any one of clauses 45 to 49, wherein the yeast has higher organic acid tolerance compared to Saccharomyces cerevisiae strain Y1027 at a pH decreasing from about 4.9 to about 4.0 in the presence of increasing organic acids.

[0218] [000244] Clause 51. The composition of any one of clauses 45 to 50, wherein the organic acid comprises 0.36% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.9. [000245] Clause 52. The composition of any one of clauses 45 to 50, wherein the organic acid comprises 0.9% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.2.

[0219] [000246] Clause 53. A process for producing ethanol from biomass by contacting the biomass with the composition of clause 45. [000247] Clause 54. The process of clause 53, wherein the ethanol is used as fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.

[0220] [000248] Clause 55. The process of clause 53, wherein the ethanol is produced using starch. [000249] Clause 56. The process of clause 53, wherein simultaneous saccharification and fermentation (SSF) or continuous fermentation is used to produce ethanol.

[0221] [000250] Clause 57. The process of clause 53, wherein ethanol is produced using sugar. [000251] Clause 58. The process of clause 53, wherein batch fermentation or continuous fermentation is used to produce ethanol.

[0222] [000252] Clause 59. The process of clause 53, wherein ethanol is produced using lignocellulosic sugars. [000253] Clause 60. The process of clause 53, wherein simultaneous saccharification and fermentation (SSF) or separate hydrolysis and fermentation (SHF) is used to produce ethanol.

[0223] [000254] Clause 61. A method for producing a fermentation product from a substrate by contacting the substrate with a fermenting organism, wherein the fermenting organism is (a) Saccharomyces sp. strain Y2083, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68182, or a derivative thereof; (b) Saccharomyces sp. strain Y2084, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68183, or a derivative thereof; (c) Saccharomyces sp. strain Y2086, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68184, or a derivative thereof; or (d) Saccharomyces sp. strain Y2087, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68185, or a derivative thereof. A method selected from the following.

[0224] [000255] Clause 62. The method of clause 61, wherein the substrate comprises or is derived from sugarcane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof.

[0225] [000256] Clause 63. The method of Clause 61, wherein the fermentation product is ethanol. [000257] Clause 64. The method of clause 63, wherein the ethanol is used as fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.

[0226] [000258] Clause 65. The method of clause 61, wherein batch fermentation, continuous fermentation, simultaneous saccharification and fermentation (SSF), or separate hydrolysis and fermentation (SHF) is used to produce the fermentation product.

[0227] 8. Biological deposit [000259] Representative samples of the yeast strains of the genus Saccharomyces described herein were deposited at the Agricultural Research Service Patent Culture Collection Northern Regional Research Center (NRRL), 1815 University Street, Peoria, IL, USA, on July 26, 2022, and assigned NRRL Patent Deposit Designation No. Y-68182 (Y2083), NRRL Patent Deposit Designation No. Y-68183 (Y2084), NRRL Patent Deposit Designation No. Y-68184 (Y2086), and NRRL Patent Deposit Designation No. Y-68185 (Y2087) on July 26, 2022. The deposit was maintained at the NRRL depositor under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure for a period of at least 30 years, and for at least 5 years after the depositor's acceptance of the latest requirements for replenishment of samples of the deposit. Applicants will fulfill all requirements of 37 CFR §§ 1.801-1.809 (37 CFR §§ 1.801-1.809), including providing an indication of sample viability. Additional deposits will be made at the NRRL as necessary to ensure availability under the conditions described herein. Applicants will impose no restrictions on the availability of deposited material from the NRRL after the issuance of a patent from this application. Applicants have no authority to override any restrictions imposed by law on the transmission of commercially available biological materials or their transport worldwide. Applicants do not waive any of their rights granted under any patent issuing from this application in any country.

[0228] array SEQ ID NO: 1 YPL009C_F1 primer GGTTTTGGATTTTTATGGAAAG SEQ ID NO: 2 YPL009C_R1 primer TTTCGTGCTATCGTTTGAATC SEQ ID NO: 3 YOR267C_F1 primer CGATGCTAATGGTGACTCTAAC SEQ ID NO:4 YOR267C_R1 primer CTGTTGACTCGATTTATTATCG

Claims

1. (a) Saccharomyces sp. strain Y2083, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68182; (b) Saccharomyces sp. strain Y2084, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68183; (c) Saccharomyces sp. strain Y2086, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68184; (d) Saccharomyces sp. strain Y2087, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68185. A non-naturally occurring Saccharomyces yeast strain selected from:

2. (a) Saccharomyces sp. strain Y2083, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68182; (b) Saccharomyces sp. strain Y2084, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68183; (c) Saccharomyces sp. strain Y2086, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68184; (d) Saccharomyces sp. strain Y2087, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68185. A non-naturally occurring derivative of a yeast strain of the genus Saccharomyces selected from:

3. (a) Higher ethanol yield than Saccharomyces strain Y1027 under the same fermentation conditions; (b) increased temperature tolerance compared to Saccharomyces strain Y1027; (c) higher fructose utilization than Saccharomyces strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio than Saccharomyces strain Y1027 under the same fermentation conditions; (e) increased organic acid tolerance compared to Saccharomyces strain Y1027 under the same fermentation conditions; and (f) Faster fermentation rate compared to Saccharomyces strain Y1027 under the same fermentation conditions.

3. The yeast strain of claim 1 or a derivative of claim 2, comprising one or more defining characteristics selected from:

4. 4. The yeast strain or derivative according to claim 1, having an ethanol yield that is at least about 3.3% higher than that of Saccharomyces cerevisiae strain Y1027 after 48 hours of fermentation.

5. 4. A yeast strain or derivative according to any one of claims 1 to 3, having at least about 5% higher fructose utilization than Saccharomyces cerevisiae strain Y1027 after 48 hours of fermentation.

6. 4. A yeast strain or derivative according to any one of claims 1 to 3, having an ethanol to glycerol ratio at least about 11% higher than Saccharomyces cerevisiae strain Y1027 after 48 hours of fermentation.

7. 4. A yeast strain or derivative according to any one of claims 1 to 3, having a fermentation rate at least about 1.5% faster than Saccharomyces cerevisiae strain Y1027 after 24 hours of fermentation.

8. 8. A yeast strain or derivative according to any one of claims 1 to 7, which has a higher temperature tolerance during fermentation compared to Saccharomyces cerevisiae strain Y1027 at fermentation temperatures in the range of 33°C to 38°C.

9. 9. The yeast strain or derivative according to claim 8, wherein the fermentation temperature is 33°C.

10. 9. The yeast strain or derivative according to claim 8, wherein the fermentation temperature is 38°C.

11. 11. The yeast strain or derivative of claim 1, which has higher organic acid tolerance compared to Saccharomyces cerevisiae strain Y1027 when increasing the amount of organic acid in the fermentation medium reduces the fermentation pH from about 4.9 to about 4.

0.

12. 12. The yeast strain or derivative of claim 11, wherein the organic acids in the fermentation medium comprise 0.36% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.

9.

13. 12. The yeast strain or derivative of any one of claims 3 to 11, wherein the organic acid comprises lactic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, or a combination thereof.

14. 14. A method for producing a derivative of a yeast strain of the genus Saccharomyces according to any one of claims 2 to 13, comprising the steps of: (1)(a) (i) a first yeast strain selected from Saccharomyces sp. strains Y2083, Y2084, Y2086, Y2087, and derivatives thereof; and (ii) a second yeast strain in the Saccharomyces sensu stricto clade; preparing a (b) inducing sporulation of the first yeast strain and the second yeast strain; (c) screening and selecting spores from the first yeast strain and spores from the second yeast strain; (d) crossing spores of the selected first yeast strain with spores of the selected second yeast strain; and (e) screening or selecting derivative strains; or (2)(a) (i) a first yeast strain selected from Saccharomyces sp. strains Y2083, Y2084, Y2086, Y2087, and derivatives thereof; and (ii) one or more additional yeast strains in the Saccharomyces sensu stricto clade preparing a (b) inducing sporulation of the first yeast strain and one or more additional yeast strains to produce spores; (c) mixing all of the spores of step (b) to allow for cross-pollination of the spores; and (d) Screening or selecting derivative strains A method comprising any one of the following:

15. 15. The method of claim 14, wherein step (1)(c) comprises screening or selecting spores that exhibit one or more distinctive characteristics of Saccharomyces strain Y2083, Y2084, Y2086, Y2087, or derivatives thereof, and wherein step (1)(e) comprises screening or selecting hybrids that exhibit one or more distinctive characteristics of Saccharomyces strain Y2083, Y2084, Y2086, Y2087, or derivatives thereof.

16. 15. The method of claim 14, wherein step (2)(d) comprises screening or selecting hybrids that exhibit one or more distinctive characteristics of Saccharomyces strain Y2083, Y2084, Y2086, or Y2087.

17. A mutant yeast of the yeast strain of claim 1 or a derivative of claim 2.

18. 20. A method for producing the mutant yeast of claim 17, wherein the mutant yeast is mutated by contacting the yeast strain with a mutagen.

19. 19. The method of claim 18, wherein the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methyl methanesulfonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3-(ethyl-2-chloroethyl)aminopropylamino]acridine 2 (ICR-170), or nitrogen mustard.

20. 20. A method for producing the mutant yeast of claim 17, wherein the mutant yeast is mutated by contacting the derivative with a mutagen.

21. 21. The method of claim 20, wherein the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methyl methanesulfonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3-(ethyl-2-chloroethyl)aminopropylamino]acridine 2 (ICR-170), or nitrogen mustard.

22. 3. An evolved yeast of the yeast strain of claim 1 or a derivative of claim 2.

23. 23. A method for producing an evolved yeast according to claim 22, wherein evolution is induced by applying selective pressure to a yeast strain.

24. 23. A method for producing an evolved yeast according to claim 22, wherein evolution is induced by applying selective pressure to the derivative.

25. A genetically modified yeast of the yeast strain of claim 1 or a derivative of claim 2.

26. 26. The genetically modified yeast of claim 25, wherein a nucleic acid sequence of the genetically modified yeast is altered using gene editing.

27. A recombinant yeast of the yeast strain of claim 1 or a derivative of claim 2.

28. 28. The recombinant yeast of claim 27, comprising a modification that silences gene expression, enhances gene expression, introduces gene, or deletes gene.

29. 1. A process for producing ethanol from a substrate by contacting the substrate with a fermentation organism, the fermentation organism comprising: (a) Saccharomyces sp. strain Y2083, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68182, or a derivative thereof; (b) Saccharomyces sp. strain Y2084, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68183, or a derivative thereof; (c) Saccharomyces sp. strain Y2086, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68184, or a derivative thereof; (d) Saccharomyces sp. strain Y2087, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68185, or a derivative thereof. A process selected from:

30. 30. The process of claim 29, wherein the substrate comprises or is derived from sugarcane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or combinations thereof.

31. The yeast, (a) Higher ethanol yield than Saccharomyces strain Y1027 under the same fermentation conditions; (b) increased temperature tolerance compared to Saccharomyces strain Y1027; (c) higher fructose utilization than Saccharomyces strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio than Saccharomyces strain Y1027 under the same fermentation conditions; (e) increased organic acid tolerance compared to Saccharomyces strain Y1027 under the same fermentation conditions; and (f) Faster fermentation rate compared to Saccharomyces strain Y1027 under the same fermentation conditions.

30. The process of claim 29, comprising one or more defining features selected from:

32. 32. The process of any one of claims 29 to 31, wherein the yeast has a higher temperature tolerance during fermentation than Saccharomyces cerevisiae strain Y1027 at fermentation temperatures ranging from 33°C to 38°C.

33. 33. The process of claim 32, wherein the fermentation temperature is 33°C.

34. 33. The process of claim 32, wherein the fermentation temperature is 38°C.

35. 35. The process of any one of claims 29 to 34, wherein the yeast has higher organic acid tolerance in a fermentation medium at a pH that decreases from about 4.9 to about 4.0 in the presence of increasing organic acids compared to Saccharomyces cerevisiae strain Y1027.

36. 36. The process of claim 35, wherein the organic acids in the fermentation medium comprise 0.36% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.

9.

37. 36. The process of claim 35, wherein the organic acids in the fermentation medium comprise 0.9% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.

2.

38. 38. The process of any one of claims 29 to 37, wherein the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.

39. 38. The process of any one of claims 29 to 37, wherein ethanol is produced using starch.

40. 40. The process of claim 39, wherein simultaneous saccharification and fermentation (SSF) or sequential fermentation is used to produce ethanol.

41. 38. The process of any one of claims 29 to 37, wherein ethanol is produced using sugars.

42. 42. The process of claim 41, wherein batch or continuous fermentation is used to produce ethanol.

43. 38. The process of any one of claims 29 to 37, wherein ethanol is produced using lignocellulosic sugars.

44. 44. The process of claim 43, wherein simultaneous saccharification and fermentation (SSF) or separate hydrolysis and fermentation (SHF) is used to produce ethanol.

45. A composition comprising the yeast strain of claim 1 or the derivative of claim 2 and one or more components selected from surfactants, emulsifiers, gums, sweeteners, protectants, and antioxidants.

46. (a) Higher ethanol yield than Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (b) increased temperature tolerance compared to Saccharomyces cerevisiae strain Y1027; (c) higher fructose utilization than Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (e) increased organic acid tolerance compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; and (f) Faster fermentation rate compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions.

46. ​​The composition of claim 45, comprising one or more defining characteristics selected from:

47. 47. The composition of claim 45 or claim 46, wherein the yeast has a higher temperature tolerance between 33°C and 38°C than Saccharomyces cerevisiae strain Y1027.

48. 48. The composition of any one of claims 45 to 47, wherein the temperature is 33°C.

49. 48. The composition of any one of claims 45 to 47, wherein the temperature is 38°C.

50. 50. The composition of any one of claims 45 to 49, wherein the yeast has higher organic acid tolerance compared to Saccharomyces cerevisiae strain Y1027 at a pH decreasing from about 4.9 to about 4.0 in the presence of increasing organic acids.

51. 51. A composition according to any one of claims 45 to 50, wherein the organic acid comprises 0.36% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.

9.

52. 51. A composition according to any one of claims 45 to 50, wherein the organic acid comprises 0.9% w / v lactic acid and 0.25% w / v acetic acid, and the pH is 4.

2.

53. 46. ​​A process for producing ethanol from biomass by contacting the biomass with the composition of claim 45.

54. 54. The process of claim 53, wherein the ethanol is used as fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.

55. 54. The process of claim 53, wherein ethanol is produced using starch.

56. 54. The process of claim 53, wherein simultaneous saccharification and fermentation (SSF) or sequential fermentation is used to produce ethanol.

57. 54. The process of claim 53, wherein ethanol is produced using sugars.

58. 54. The process of claim 53, wherein batch or continuous fermentation is used to produce ethanol.

59. 54. The process of claim 53, wherein ethanol is produced using lignocellulosic sugars.

60. 54. The process of claim 53, wherein simultaneous saccharification and fermentation (SSF) or separate hydrolysis and fermentation (SHF) is used to produce ethanol.

61. 1. A method for producing a fermentation product from a substrate by contacting the substrate with a fermentation organism, the fermentation organism comprising: (a) Saccharomyces sp. strain Y2083, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68182, or a derivative thereof; (b) Saccharomyces sp. strain Y2084, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68183, or a derivative thereof; (c) Saccharomyces sp. strain Y2086, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68184, or a derivative thereof; (d) Saccharomyces sp. strain Y2087, a representative sample of the strain deposited under NRRL Patent Deposit Designation No. Y-68185, or a derivative thereof. A method selected from the following.

62. 62. The method of claim 61, wherein the substrate comprises or is derived from sugarcane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or combinations thereof.

63. 62. The method of claim 61 , wherein the fermentation product is ethanol.

64. 64. The method of claim 63, wherein the ethanol is used as fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.

65. 62. The method of claim 61, wherein batch fermentation, continuous fermentation, simultaneous saccharification and fermentation (SSF), or separate hydrolysis and fermentation (SHF) is used to produce the fermentation product.

Images