Engineered ADAR-recruiting RNAs and methods of use thereof

Abstract

The present application provides a method for editing RNA by introducing a deaminase recruiting RNA into a host cell to deaminate adenosine in a target RNA. The present application also provides a method for reducing off-target editing of RNA. The present application further provides a deaminase recruiting RNA used in the RNA editing method, as well as a composition and a kit comprising the same.

Description

[Technical Field]

[0001] The present application relates to methods and compositions for editing RNA using engineered linear or circular RNAs that can recruit adenosine deaminase to deaminate one or more adenosines in a target RNA. [Background technology]

[0002] Genome editing is a powerful tool for biomedical research and the development of disease treatments. Editing techniques using engineered nucleases, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the Cas proteins of the CRISPR system, have been applied to manipulate the genomes of countless organisms. Recently, new tools for RNA editing have been developed using deaminase proteins, such as adenosine deaminases acting on RNA (ADARs). Mammalian cells contain three ADAR proteins: Adar1 (two isoforms, p110 and p150), Adar2, and Adar3 (catalytically inactive). The catalytic substrate of ADAR proteins is double-stranded RNA, and ADARs can remove the -NH2 group from adenosine (A) nucleobases, converting A to inosine (I). The (I) is then recognized as guanosine (G) and pairs with cytidine (C) during the subsequent cellular transcription and translation processes. To achieve targeted RNA editing, ADAR proteins or their catalytic domains have been fused to lambda peptides, SNAP tags, or Cas proteins (dCas13b), and guide RNAs have been designed to recruit the chimeric ADAR proteins to the target site. Alternatively, targeted RNA editing has been reported to be achieved by overexpressing ADAR1 or ADAR2 proteins and guide RNAs containing R / G motifs.

[0003] However, currently available ADAR-mediated RNA editing technologies have certain limitations. For example, while the most efficient in vivo delivery of gene therapy is via viral vectors, the highly desirable adeno-associated viral (AAV) vector is limited by its cargo size (approximately 4.5 kb), making it difficult to accommodate both protein and guide RNA. Furthermore, it has recently been reported that overexpression of ADAR1 confers oncogenic potential in multiple myeloma through aberrant RNA hyperediting, resulting in extensive global off-target editing. Furthermore, ectopic expression of proteins or their domains of non-human origin carries the potential risk of causing immunogenicity. Furthermore, pre-existing adaptive immunity and the p53-mediated DNA damage response may hinder the efficacy of therapeutic proteins such as Cas9. Summary of the Invention [Means for solving the problem]

[0004] The present application provides methods for RNA editing using ADAR-recruiting RNA ("dRNA" or "arRNA"), including circular ADAR-recruiting RNA ("circ-dRNA" or "circ-arRNA"), which can use endogenous adenosine deaminase ("ADAR") acting on RNA proteins to edit RNA. Also provided herein are engineered dRNAs, or constructs containing nucleic acid sequences encoding engineered dRNAs for use in these methods, as well as compositions and kits containing them. Further provided herein are methods for treating or preventing a disease or condition in an individual, comprising editing a target RNA associated with the disease or condition in a cell of the individual.

[0005] In one aspect, the present disclosure provides a method for editing a target adenosine in a target RNA in a host cell, comprising introducing a deaminase recruiting RNA (dRNA) or a construct comprising a nucleic acid sequence encoding a dRNA into the host cell, wherein (1) the dRNA comprises a targeting RNA sequence capable of hybridizing to the target RNA to form a double-stranded RNA, the double-stranded RNA comprising a bulge containing a non-target adenosine in the target RNA, and (2) the dRNA is capable of recruiting an adenosine deaminase (ADAR) that acts on RNA. In some embodiments, the double-stranded RNA comprises a bulge at each non-target adenosine in the target RNA. In some embodiments, the targeting RNA sequence is complementary to the target RNA, except that it lacks one or more nucleotides opposite the non-target adenosine in the target RNA. In some embodiments, the targeting RNA sequence is complementary to the target RNA, except that it lacks two or more consecutive nucleotides opposite the non-target adenosine in the target RNA. In some embodiments, the methods comprise reducing the level of editing of non-target adenosines in the target RNA.

[0006] In some embodiments of any one of the above methods, dRNA is linear RNA.In some embodiments, dRNA is linear RNA that can form circular RNA.In some embodiments, dRNA is circular RNA.

[0007] In some embodiments according to any one of the above methods, the dRNA comprises a linker nucleic acid sequence adjacent to the end of the target RNA sequence, wherein the linker nucleic acid sequence does not form substantially a secondary structure with any portion of the dRNA.

[0008] In some embodiments according to any one of the above methods, the dRNA comprises a linker nucleic acid sequence that replaces the end of the targeting RNA sequence, and the linker nucleic acid sequence does not form substantially a secondary structure with any portion of the dRNA.

[0009] In another aspect, the present specification provides a method for editing target adenosine in target RNA in host cell, comprising: introducing dRNA or construct comprising the nucleic acid sequence encoding dRNA into said host cell, wherein (1) dRNA comprises target RNA sequence that can hybridize with target RNA, dRNA comprises linker nucleic acid sequence adjacent to the end of target RNA sequence, and said linker nucleic acid sequence does not form substantially secondary structure with any part of dRNA, (2) dRNA can recruit ADAR, and (3) dRNA is circular RNA or linear RNA that can form circular RNA.In some embodiments, dRNA is circular RNA.In some embodiments, dRNA is linear RNA that can form circular RNA.

[0010] In some embodiments of any one of the above methods, the dRNA comprises a linker nucleic acid sequence, and the linker nucleic acid sequence is from about 5 nucleotides (nt) to about 500 nt in length. In some embodiments, the linker nucleic acid sequence is from about 50 nt to about 500 nt in length. In some embodiments, the linker nucleic acid sequence is from about 5 nucleotides (nt) to about 500 nt in length. In some embodiments, the linker nucleic acid sequence is 70 nt or less in length, and optionally, the linker nucleic acid sequence is any integer between 10 nt to 50 nt, 10 nt to 40 nt, 10 nt to 30 nt, 10 nt to 20 nt, 20 nt to 50 nt, 20 nt to 40 nt, 20 nt to 30 nt, 30 nt to 50 nt, 30 nt to 40 nt, or 40 nt to 50 nt in length. In some embodiments, the linker nucleic acid sequence is from about 20 nt to about 60 nt in length, and optionally, the linker nucleic acid sequence is about 30 nt or about 50 nt in length. In some embodiments, at least about 50%, 60%, 70%, 80%, 85%, 90%, or 95% of the linker nucleic acid sequence comprises adenosine or cytidine, and optionally, 100% of the linker nucleic acid sequence comprises adenosine or cytidine. In some embodiments, the linker nucleic acid sequence comprises a polyadenosine (polyA), polyguanosine (polyG), or polycytosine (polyC) sequence. In some embodiments, at least 50% of the linker nucleic acid sequence comprises adenosine. In some embodiments, the linker nucleic acid sequence comprises a dinucleotide repeat sequence. In some embodiments, the linker nucleic acid sequence comprises an (AT) n wherein n is an integer greater than or equal to 3. In some embodiments, the linker nucleic acid sequence comprises SEQ ID NO:22.

[0011] In some embodiments of any one of the above methods, the dRNA comprises a linker nucleic acid sequence, wherein the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeting RNA sequence and a second linker nucleic acid sequence adjacent to the 3' end of the targeting RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeting RNA sequence and a second linker nucleic acid sequence replacing the 3' end of the targeting RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence replacing the 5' end of the targeting RNA sequence and a second linker nucleic acid sequence adjacent to the 3' end of the targeting RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence replacing the 5' end of the targeting RNA sequence and a second linker nucleic acid sequence replacing the 3' end of the targeting RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence replacing the 5' end of the targeting RNA sequence and a second linker nucleic acid sequence replacing the 3' end of the targeting RNA sequence. In some embodiments, the first linker nucleic acid sequence is the same as the second linker nucleic acid sequence. In some embodiments, the first linker nucleic acid sequence is different from the second linker nucleic acid sequence. In some embodiments, the dRNA is a circular RNA, and the linker nucleic acid sequence links the 5' end of the targeting RNA sequence to the 3' end of the targeting RNA sequence.

[0012] In some embodiments according to any one of the above methods, the dRNA is a circular RNA, and the dRNA further comprises a 3' exon sequence recognizable by a 3' catalytic group I intron fragment adjacent to the 5' end of the target RNA sequence, and a 5' exon sequence recognizable by a 5' catalytic group I intron fragment adjacent to the 3' end of the target RNA sequence.

[0013] In some embodiments of any one of the above methods, the dRNA further comprises a 3' linking sequence (ligation sequence) and a 5' linking sequence. In some embodiments, the 3' linking sequence and the 5' linking sequence are at least partially complementary to each other. In some embodiments, the 3' linking sequence and the 5' linking sequence are about 20 to about 75 nucleotides in length. In some embodiments, the linking sequence is about 5 nucleotides (nt) to about 500 nt in length. In some embodiments, the linking sequence is 70 nt or less in length, and optionally, the linking sequence is any integer between 10 nt and 50 nt, 10 nt and 40 nt, 10 nt and 30 nt, 10 nt and 20 nt, 20 nt and 50 nt, 20 nt and 40 nt, 20 nt and 30 nt, 30 nt and 50 nt, 30 nt and 40 nt, or 40 nt and 50 nt. In some embodiments, the linking sequence is about 20 nt to about 60 nt in length, and optionally, the linking sequence is about 30 nt or about 50 nt in length. In some embodiments, at least about any one of 50%, 60%, 70%, 80%, 85%, 90%, or 95% of the linked sequences contain adenosine or cytidine, and optionally, 100% of the linked sequences contain adenosine or cytidine. In some embodiments, the dRNA is circularized by RNA ligase RtcB. In some embodiments, the RNA ligase RtcB is endogenously expressed in the host cell. In some embodiments, the dRNA is circularized by T4 RNA ligase 1 (Rnl1) or RNA ligase 2 (Rnl2).

[0014] In some embodiments according to any one of the above methods, the dRNA or a construct comprising a nucleic acid sequence encoding the dRNA edits the target adenosine in the target RNA in a dose-dependent manner.

[0015] In some embodiments of any one of the methods above, the method comprises introducing into the host cell a construct comprising a nucleic acid sequence encoding a dRNA. In some embodiments, the construct further comprises a promoter operably linked to the nucleic acid sequence encoding the dRNA. In some embodiments, the promoter is a polymerase II promoter ("Pol II promoter"). In some embodiments, the promoter is a polymerase III promoter ("Pol III promoter"). In some embodiments, the construct is a viral vector or a plasmid. In some embodiments, the construct is an adeno-associated virus (AAV) vector. In some embodiments, the construct is a self-complementary AAV (scAAV) vector.

[0016] In some embodiments of any one of the above methods, the ADAR is endogenously expressed by the host cell. In some embodiments, the host cell is a T cell.

[0017] In some embodiments of any one of the above methods, the targeting RNA sequence is about 100 to about 200 nt in length (e.g., about 150 nt or about 170 nt). In some embodiments, the targeting RNA sequence comprises a cytidine, adenosine, or uridine directly opposite the target adenosine in the target RNA. In some embodiments, the targeting RNA sequence comprises a cytidine mismatch directly opposite the target adenosine in the target RNA. In some embodiments, the cytidine mismatch is located at least 20 nucleotides from the 3' end of the targeting RNA sequence and at least 5 nucleotides from the 5' end of the targeting RNA sequence. In some embodiments, the 5'-closest neighbor of the target adenosine in the target RNA is a nucleotide selected from U, C, A, and G, with preference U>C≈A>G, and the 3'-closest neighbor of the target adenosine in the target RNA is a nucleotide selected from G, C, A, and U, with preference G>C>A≈U. In some embodiments, the target adenosine is located in a UAG three-base motif, and the targeting RNA includes an A directly opposite the uridine of the three-base motif, a cytidine directly opposite the target adenosine, and a cytidine, guanosine, or uridine directly opposite the guanosine of the three-base motif.

[0018] In some embodiments of any one of the above methods, the target RNA is RNA selected from the group consisting of pre-messenger RNA, messenger RNA, ribosomal RNA, transfer RNA, long non-coding RNA, and small RNA. In some embodiments, the target RNA is pre-messenger RNA.

[0019] In some embodiments according to any one of the above methods, the method further comprises introducing an ADAR3 inhibitor and / or an interferon stimulating agent into the host cell.

[0020] In some embodiments according to any one of the above methods, the method comprises introducing into the host cell multiple dRNAs or constructs, each targeting a different target RNA.

[0021] In some embodiments of any one of the above methods, the editing efficiency of the target RNA is at least 40%.

[0022] In some embodiments according to any one of the above methods, the method further comprises introducing an ADAR into the host cell.

[0023] In some embodiments of any one of the above methods, deamination of the target adenosine in the target RNA causes a missense mutation, a premature stop codon, aberrant or alternative splicing in the target RNA, or reversal of the missense mutation, premature stop codon, aberrant or alternative splicing in the target RNA. In some embodiments, deamination of the target adenosine in the target RNA causes a point mutation, truncation, elongation, and / or misfolding of the protein encoded by the target RNA, or reversal of the missense mutation, premature stop codon, aberrant or alternative splicing in the target RNA to produce a functional, full-length, correctly folded, and / or wild-type protein.

[0024] In some embodiments according to any one of the above methods, the host cell is a eukaryotic cell. In some embodiments, the host cell is a mammalian cell. In some embodiments, the host cell is a human or mouse cell.

[0025] In another aspect, the description provides an edited RNA produced by any one of the above methods, or a host cell harboring the edited RNA.

[0026] In another aspect, the present disclosure provides a method for treating or preventing a disease or condition in an individual, comprising editing a target RNA associated with the disease or condition in the individual's cells according to any one of the methods described above.In some embodiments, the disease or condition is an inherited genetic disease, or a disease or condition associated with one or more acquired genetic mutations.In some embodiments, the disease or condition is a monogenic or polygenic disease or condition.In some embodiments, the target RNA has a G to A mutation.

[0027] In some embodiments of any one of the above methods, the target RNA is TP53 and the disease or condition is cancer. In some embodiments, the target RNA is IDUA and the disease or condition is mucopolysaccharidosis type I (MPS I). In some embodiments, the target RNA is COL3A1 and the disease or condition is Ehlers-Danlos syndrome. In some embodiments, the target RNA is BMPR2 and the disease or condition is Joubert syndrome. In some embodiments, the target RNA is FANCC and the disease or condition is Fanconi anemia. In some embodiments, the target RNA is MYBPC3 and the disease or condition is primary familial hypertrophic cardiomyopathy. In some embodiments, the target RNA is IL2RG and the disease or condition is X-linked severe combined immunodeficiency. In some embodiments, the target RNA is MALAT1 and the disease or condition is hyperglycemia. In some embodiments, the target RNA is RAB7A and the disease or condition is Charcot-Marie-Tooth syndrome type 2B (CMT2B).

[0028] Compositions, kits, and articles of manufacture for use in any one of the above methods are also provided.

[0029] In another aspect, the present disclosure provides a dRNA for editing target RNA, comprising a targeting RNA sequence that can hybridize to target RNA to form double-stranded RNA, wherein the double-stranded RNA comprises a bulge containing a non-target adenosine in the target RNA.In some embodiments, the double-stranded RNA comprises a bulge at each non-target adenosine in the target RNA.In some embodiments, the targeting RNA sequence is complementary to the target RNA, except for one or more nucleotides opposite the non-target adenosine in the target RNA.In some embodiments, the targeting RNA sequence is complementary to the target RNA, except for two or more consecutive nucleotides opposite the non-target adenosine in the target RNA.In some embodiments, the method comprises reducing the editing level of non-target adenosine in the target RNA.

[0030] In some embodiments according to any one of the above dRNA, dRNA is linear RNA.In some embodiments, dRNA is linear RNA that can form circular RNA.In some embodiments, dRNA is circular RNA.

[0031] In some embodiments of the dRNA of any one of the above, the dRNA comprises a linker nucleic acid sequence adjacent to the end of the targeting RNA sequence, and the linker nucleic acid sequence does not substantially form a secondary structure with any part of the dRNA.In some embodiments, the dRNA comprises a linker nucleic acid sequence that replaces the end of the targeting RNA sequence, and the linker nucleic acid sequence does not substantially form a secondary structure with any part of the dRNA.

[0032] Another aspect provided herein is a dRNA for editing target RNA, comprising targeting RNA sequence that can hybridize with target RNA, wherein dRNA comprises linker nucleic acid sequence adjacent to the end of targeting RNA sequence, and linker nucleic acid sequence does not form substantially secondary structure with any part of dRNA, and dRNA is circular RNA or the linear RNA that can form circular RNA.In some embodiments, dRNA is circular RNA.In some embodiments, dRNA is the linear RNA that can form circular RNA.

[0033] Another aspect provided herein is a dRNA for editing target RNA, comprising a targeting RNA sequence that can hybridize with target RNA, wherein said dRNA comprises a linker nucleic acid sequence that replaces the end of targeting RNA sequence, and said linker nucleic acid sequence does not form substantially secondary structure with any part of dRNA, and said dRNA is circular RNA or the linear RNA that can form circular RNA.In some embodiments, dRNA is circular RNA.In some embodiments, dRNA is the linear RNA that can form circular RNA.

[0034] In some embodiments of the dRNA of any one of the above, the dRNA comprises a linker nucleic acid sequence, and the linker nucleic acid sequence is from about 5 nucleotides (nt) to about 500 nt in length. In some embodiments, the linker nucleic acid sequence is from about 50 nt to about 500 nt in length. In some embodiments, the linker nucleic acid sequence is from about 5 nucleotides (nt) to about 500 nt in length. In some embodiments, the linker nucleic acid sequence is 70 nt or less in length, and optionally, the linker nucleic acid sequence is any integer between 10 nt to 50 nt, 10 nt to 40 nt, 10 nt to 30 nt, 10 nt to 20 nt, 20 nt to 50 nt, 20 nt to 40 nt, 20 nt to 30 nt, 30 nt to 50 nt, 30 nt to 40 nt, or 40 nt to 50 nt. In some embodiments, the linker nucleic acid sequence is from about 20 nt to about 60 nt in length, and optionally, the linker nucleic acid sequence is about 30 nt or about 50 nt in length. In some embodiments, at least about 50%, 60%, 70%, 80%, 85%, 90%, or 95% of the linker nucleic acid sequence comprises adenosine or cytidine, and optionally, 100% of the linker nucleic acid sequence comprises adenosine or cytidine. In some embodiments, the linker nucleic acid sequence comprises a polyadenosine (polyA), polyguanosine (polyG), or polycytosine (polyC) sequence. In some embodiments, at least 50% of the linker nucleic acid sequence comprises adenosine. In some embodiments, the linker nucleic acid sequence comprises a dinucleotide repeat sequence. In some embodiments, the linker nucleic acid sequence comprises an (AT) n where n is an integer greater than or equal to 3.

[0035] In some embodiments of the dRNA of any one of the above, the dRNA comprises a linker nucleic acid sequence, and the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeting RNA sequence and a second linker nucleic acid sequence adjacent to the 3' end of the targeting RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeting RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeting RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence that replaces the 5' end of the targeting RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeting RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence that replaces the 5' end of the targeting RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeting RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence that replaces the 5' end of the targeting RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeting RNA sequence. In some embodiments, the first linker nucleic acid sequence is the same as the second linker nucleic acid sequence. In some embodiments, the first linker nucleic acid sequence is different from the second linker nucleic acid sequence. In some embodiments, the dRNA is a circular RNA, and the linker nucleic acid sequence links the 5' end of the targeting RNA sequence to the 3' end of the targeting RNA sequence.

[0036] In some embodiments according to any one of the above dRNAs, the dRNA is a circular RNA, and the dRNA further comprises a 3' exon sequence recognizable by a 3' catalytic group I intron fragment adjacent to the 5' end of the targeting RNA sequence, and a 5' exon sequence recognizable by a 5' catalytic group I intron fragment adjacent to the 3' end of the targeting RNA sequence.

[0037] In some embodiments of the dRNA of any one of the above, the dRNA further comprises a 3' linking sequence and a 5' linking sequence. In some embodiments, the 3' linking sequence and the 5' linking sequence are at least partially complementary to each other. In some embodiments, the 3' linker sequence and the 5' linker sequence are about 20 to about 75 nucleotides in length. In some embodiments, the dRNA is circularized by RNA ligase RtcB. In some embodiments, the RNA ligase RtcB is endogenously expressed in the host cell. In some embodiments, the dRNA is circularized by T4 RNA ligase 1 (Rnl1) or RNA ligase 2 (Rnl2).

[0038] In some embodiments of the dRNA of any one of the above, the targeting RNA sequence is about 100 to about 200 nt in length (e.g., about 150 nt or about 170 nt). In some embodiments, the targeting RNA sequence comprises a cytidine, adenosine, or uridine directly opposite the target adenosine in the target RNA. In some embodiments, the targeting RNA sequence comprises a cytidine mismatch directly opposite the target adenosine in the target RNA. In some embodiments, the cytidine mismatch is located at least 20 nucleotides from the 3' end of the targeting RNA sequence and at least 5 nucleotides from the 5' end of the targeting RNA sequence. In some embodiments, the 5'-closest neighbor of the target adenosine in the target RNA is a nucleotide selected from U, C, A, and G, with preference being U>C≒A>G, and the 3'-closest neighbor of the target adenosine in the target RNA is a nucleotide selected from G, C, A, and U, with preference being G>C>A≒U. In some embodiments, the target adenosine is located in a UAG three-base motif, and the targeting RNA includes an A directly opposite the uridine of the three-base motif, a cytidine directly opposite the target adenosine, and a cytidine, guanosine, or uridine directly opposite the guanosine of the three-base motif.

[0039] In some embodiments of the dRNA of any one of the above, the target RNA is an RNA selected from the group consisting of pre-messenger RNA, messenger RNA, ribosomal RNA, transfer RNA, long non-coding RNA, and small RNA. In some embodiments, the target RNA is a pre-messenger RNA.

[0040] In some embodiments, a construct is provided, comprising the nucleic acid sequence encoding any one of the above-mentioned dRNAs.In some embodiments, the construct further comprises a promoter operably linked to the nucleic acid sequence encoding the dRNA, wherein the promoter is a Pol III promoter.In some embodiments, the construct is a virus vector or a plasmid.In some embodiments, the construct is an adeno-associated virus (AAV) vector.In some embodiments, the construct is a self-complementary AAV (scAAV) vector.

[0041] In some embodiments, a host cell is provided, comprising any one of the constructs or dRNAs described above. In some embodiments, a kit is provided, comprising any one of the constructs or dRNAs described above, wherein the kit further comprises instructions for editing target RNA in a host cell.

[0042] It should be understood that one, some, or all of the features of the various embodiments described herein may be combined to form other embodiments of the present application, and these and other embodiments of the present application are further described in the detailed description below. [Brief explanation of the drawings]

[0043] [Figure 1A]Figures 1A-1C show FACS analysis after transfection of a plasmid expressing an arRNA driven by a Pol II promoter (CMV) and a plasmid expressing an arRNA driven by a Pol III promoter (U6). Figure 1A shows a schematic diagram of genetically encoded arRNAs via the U6 or CMV promoter. A 151-nt arRNA targeting fluorescent reporter gene 1 was expressed under the human U6 or CMV promoter. In reporter gene 1, the mCherry and EGFP genes were linked by a sequence containing a 3xGGGGS coding region and an in-frame UAG stop codon. Cells expressing the reporter gene produced only mCherry protein, and targeted editing of the UAG stop codon in the reporter gene transcript converted UAG to UIG, enabling downstream EGFP expression. [Figure 1B] FIG. 1B shows the FACS results of arRNA expression levels normalized to GAPDH. [Figure 1C] Figure 1C shows the FACS results of the EGFP+ percentage and the editing efficiency of various promoter-driven arRNAs targeting reporter gene transcripts in HEK293T cells stably expressing the reporter gene. The percentage of EGFP+ cells is normalized by the transfection efficiency measured by mCherry+. [Figure 2A] Figures 2A-2N show the editing efficacy of circular ADAR-recruiting RNA (circ-arRNA), demonstrating that circ-arRNA is capable of efficient, durable, and programmable RNA editing of endogenous transcripts. Figure 2A shows a schematic diagram of a gene-coding circ-arRNA targeting a fluorescent reporter gene. [Figure 2B] Figure 2B shows the results of quantitative PCR demonstrating the expression levels of linear arRNA and circ-arRNA. Data are expressed as mean ± SEM (n = 3), where n represents the number of independent experiments performed in parallel; unpaired two-tailed Student's t-test, ****P < 0.0001. [Figure 2C]Figure 2C shows the FACS results of the EGFP+ percentage, indicating the editing efficiency of circ-arRNA driven by the U6 and CMV promoters targeting the reporter transcript in HEK293T cells stably expressing the reporter gene. The EGFP+ percentage was normalized by the transfection efficiency determined by mCherry+. Data are presented as mean ± SEM (n = 3), where n represents the number of independent experiments performed in parallel; unpaired two-tailed Student's t-test, ****P < 0.0001. [Figure 2D] Figure 2D shows the FACS results of EGFP+ percentage and the editing efficiency of different arRNA versions targeting reporter gene transcripts in HEK293T cells stably expressing the reporter gene. The EGFP+ percentage was normalized by the transfection efficiency determined by mCherry+. [Figure 2E] Figure 2E shows EGFP expression in HEK293T cells stably expressing a reporter gene on days 2, 9, and 18 after transfection with U6-driven linear arRNA and circ-arRNA. The scale bar is 200 μm. Data are means ± SEM (n = 3), where n represents the number of independent experiments performed in parallel. [Figure 2F] Figure 2F shows the FACS results of EGFP+ percentage, demonstrating the dependence of arRNA and circ-arRNA on endogenous ADAR. The EGFP+ percentage was normalized by transfection efficiency determined by mCherry+. Data are mean ± SEM (n = 3), where n represents the number of independent experiments performed in parallel. [Figure 2G] Figure 2G shows the FACS results of EGFP+ percentages, which indicate the editing efficiency of different versions of arRNA targeting reporter gene transcripts in multiple cell lines. The EGFP+ percentages were normalized by the transfection efficiency determined by mCherry+. [Figure 2H]Figure 2H shows a schematic diagram of the endogenous transcripts of six genes (PPIA, KRAS, RAB7A, FANCC, MALAT1, and TP53) and their corresponding arRNAs / circ-arRNAs. [Figure 2I] Figure 2I shows the results of deep sequencing demonstrating the editing ratios of PPIA, KRAS, RAB7A, FANCC, MALAT1, and TP53 transcripts to their target adenosines by U6-driven linear arRNA and circ-arRNA in HEK293T cells. Data are means ± SEM (n = 3), where n represents the number of independent experiments performed in parallel. [Figure 2J] Figure 2J shows the corresponding fold changes in editing ratios normalized to linear arRNA. Significance was analyzed using an unpaired, two-tailed Student's t-test; P = 1.33124 × 10-10 for circ-arRNA151 and P = 1.20289 × 10-10 for circ-arRNA151_AC50; center line, median; limits, 75% and 25%; whiskers, maximum and minimum values; n = 3, 20 sites per site. [Figure 2K] Figure 2K shows the next-generation sequencing (NGS) results showing the targeted editing rate in HEK293T cells infected with AAV-delivered circ-arRNA, n = 2, mean ± s.d. [Figure 2L] Figure 2L shows next-generation sequencing results showing targeted editing rates in human primary hepatocytes infected with AAV-delivered circ-arRNA, n = 2, mean ± s.d. [Figure 2M] Figure 2M shows the results of next-generation sequencing showing the targeted editing rate in brain organoids PPIA infected with AAV-delivered circ-arRNA (n=2, mean ± SD). [Figure 2N] Figure 2N shows the next-generation sequencing results showing the targeted editing rate in brain organoids FANCC infected with AAV-delivered circ-arRNA, n = 4, mean ± sd. [Figure 3A]Figures 3A-3E show the targeting of endogenous ADAR proteins for RNA editing by in vitro circularized circular ADAR-recruiting RNA (circ-arRNA). Figure 3A shows the results of HPLC chromatography of in vitro transcribed circularized circ-arRNA. Top: precursor without T4 Rnl treatment. Middle: circ-arRNA ligated by T4 Rnl1. Bottom: circ-arRNA ligated by T4 Rnl2. [Figure 3B] Figure 3B shows deep sequencing analysis of the A to I conversion rate of the target site of the reporter gene transcript. Data represent the mean ± SEM. [Figure 3C] Figure 3C shows the results of deep sequencing demonstrating the editing rate for the targeted adenosine of the PPIB transcript by introducing circ-arRNA circularized by T4 Rnl into HEK293T cells. [Figure 3D] Figure 3D shows deep sequencing results demonstrating the targeted adenosine editing rate of Idua transcripts by introducing group I ribozyme-autocatalytically linked circ-arRNA into primary MEF cell lines generated from Hurler syndrome mice. Data represent mean ± SEM. n = 2 or 3, where n represents the number of independent experiments performed in parallel. [Figure 3E] Figure 3E shows electropherograms showing the results of Sanger sequencing of the target region after transfection with precursor (top), circ-arRNA ligated with T4 RNA ligase 1 (middle), and circ-arRNA ligated with T4 RNA ligase 2 (bottom). [Figure 4A]Figures 4A-4J show the transcriptome-wide off-target site analysis of circ-arRNA151-PPIA, demonstrating that the expression level and splicing pattern of PPIA are not affected by circ-arRNA151-PPIA. Figures 4A-4B show the results of the whole transcriptome off-target analysis of the circ-arRNA151 and ADAR2DD overexpression groups. The on-target site of PPIA is shown in Figure 4A. Potential off-target sites identified in the PPIA-targeting RNA group and the ADAR2DD overexpression group are not labeled. [Figure 4B] Figures 4A and 4B show the results of whole-transcriptome off-target analysis of the circ-arRNA151 and ADAR2DD overexpression groups. Potential off-target sites identified in the PPIA-targeting RNA group and the ADAR2DD overexpression group are not labeled. [Figure 4C] Figure 4C shows a whole-transcriptome analysis of the effect of circ-arRNA151-PPIA on native editing sites. Three independent experiments were performed. [Figure 4D] Figure 4D shows the distribution of off-target sites. [Figure 4E] Figure 4E shows the minimum free energy of circ-arRNA151 and the off-target site regions of the RNA hybrid. [Figure 4F] Figure 4F shows differential gene expression analysis of the effects of control RNA151 (Ctrl-RNA151) and circ-arRNA151 (circ-arRNA151) from transcriptome-level RNA-seq data. FPKM values ​​were calculated using the STRINGTIE tool, and global differential gene expression was assessed using Pearson correlation coefficient analysis. [Figure 4G] Figure 4G shows an immunoblot showing PPIA protein expression levels in cells transfected with control RNA151 and circ-arRNA151-PPIA. [Figure 4H]Figure 4H shows quantitative PCR showing the effect of circ-arRNA versus control RNA on the expression levels of targeted PPIA transcripts in HEK293T cells, normalized to GAPDH, n=3, mean±SD. [Figure 4I] Figure 4I shows the FPKM of the two major PPIA splicing isoforms. ns, not significant; n=2, mean ± SD. Unpaired two-tailed Student's t-test, ns, not significant. [Figure 4J] Figure 4J shows the splice junctions of target genes. Top: PPIA splicing isoforms in RNA-seq analysis. Middle: PPIA splicing junctions of control RNA151. Bottom: PPIA splicing junctions of circ-arRNA151. [Figure 5A] Figures 5A-5M show off-target editing of adjacent bases by engineered circ-arRNAs, as well as the relative quantitative expression levels of ADAR and interferon-stimulated genes. Figure 5A shows a schematic diagram of arRNA targeting a fluorescent reporter gene 1 with a nucleotide deletion opposite the targeted adenosine (linear arRNAΔC) (top), and the EGFP+ percentage indicates the editing efficiency of reporter transcripts targeting arRNA and arRNAΔC in HEK293T cells stably expressing the reporter (bottom). [Figure 5B] Figure 5B shows a schematic diagram of circ-arRNA targeting fluorescent reporter 1 and the nucleotide deletion opposite the targeted adenosine (circ-arRNAΔC) (top), and the EGFP+ percentage indicates the editing efficiency of reporter transcripts targeting arRNA and arRNAΔC in HEK293T cells stably expressing the reporter (bottom). [Figure 5C]Figure 5C shows a schematic diagram of the PPIA transcript sequence targeted by circ-arRNA151 (top) and circ-arRNA151-AΔ8 (bottom). The targeted adenosine is at position 76. Circ-arRNA151-AΔ8 has adenosine deletions at positions A18, A25, A33, A41, A42, A47, A59, and A87 to minimize potential off-targeting in editing-prone motifs. [Figure 5D] Figure 5D shows the on-target editing ratios of PPIA transcripts of circ-arRNA151 and circ-arRNA151-AΔ8. [Figure 5E] Figure 5E shows the off-target editing ratios of circ-arRNA151 and circ-arRNA151-AΔ8 at positions A18, A25, A33, A41, A42, A47, A59, and A87. [Figure 5F] Figure 5F shows a schematic of the PPIA transcript sequence covered by the 151-nt arRNA. Black arrows indicate the targeted adenosines, and potential off-target adenosines are marked in red. To maximize off-target editing in easily editable motifs, circ-arRNA151-AΔ14, which targets the PPIA transcript, contains U deletions opposite positions A6, A13, A18, A25, A33, A41, A42, A47, A59, A72, A87, A103, A110, and A129. [Figure 5G] Figure 5G shows the editing ratios of off-target adenosines in the circ-arRNA151_AC50 and circ-arRNA151-AΔ14_AC50 groups; n = 3, mean ± sd. [Figure 5H]Figure 5H shows a heatmap of the editing ratio of adenosines covered by circ-arRNA151_AC50 and circ-arRNA151-AΔ14_AC50 in the PPIA transcript; n = 3. Gray triangles represent the position of the U deletion in circ-arRNA151-AΔ14_AC50, and blue triangles represent the position of an additional U deletion in circ-arRNA151-AΔ8, which is based on circ-arRNA151-AΔ5. The positions of the U deletions in circ-arRNA151-AΔ14_AC50 are indicated by gray, blue, and black triangles. [Figure 5I] Figure 5I shows the IGV results showing the compiled reads of circ-RNA151_AC50. [Figure 5J] Figure 5J shows the IGV results showing the edited reads of circ-arRNA151-AΔ14_AC50. [Figure 5K] Figure 5K shows that in vitro circularized circ-arRNA151-AΔ14 achieves efficient RNA editing at the target site in a dose-dependent manner, n=2, mean ± SD. [Figure 5L] FIG. 5L shows a heatmap showing the relative expression levels of ADAR1p110, ADAR1p150, and ADAR2 normalized to GAPDH. [Figure 5M] FIG. 5M shows a heatmap depicting the relative expression levels of interferon-stimulated genes normalized to GAPDH; n=2, mean±SD. [Figure 6A] Figures 6A to 6G show the transcriptional regulatory activity of the mutant TP53W53X restored by circ-arRNA. Figure 6A shows a schematic diagram of the TP53 transcriptional sequences targeted by circ-arRNA151_AC50 (top) and circ-arRNA151-AΔ4_AC50 (bottom). [Figure 6B]Figure 6B shows deep sequencing results demonstrating targeted editing of TP53W53X transcripts by circ-arRNA151, circ-arRNA151-AG1, circ-arRNA151-AG4, circ-arRNA151-AΔ1, circ-arRNA151-AΔ4, circ-arRNA151_AC50, and circ-arRNA151-AΔ4_AC50. [Figure 6C] Figure 6C shows a Western blot demonstrating the restoration of full-length p53 protein production by circ-arRNA from TP53W53X transcripts in HEK293T TP53− / − cells. [Figure 6D] FIG. 6D shows the use of the p53-firefly luciferase reporter system to detect the transcriptional regulatory activity of restored p53 protein, normalized by a co-transfected aequorea-luciferase vector. [Figure 6E] Figure 6E shows the results of deep sequencing of the off-target editing ratios of circ-arRNA151 and circ-arRNA151-AΔ8 at positions A18, A25, A33, A41, A42, A47, A59, and A87. All data represent the mean ± SEM (n = 3), where n indicates the number of independent experiments performed in parallel. [Figure 6F] Figure 6F shows a schematic diagram of the TP53W53X transcript sequence covered by a 151-nt arRNA containing the clinically relevant c.158G-to-A nonsense mutation (Trp53Ter). The black arrow indicates the targeted adenosine. The circ-arRNA targeting the TP53W53X transcript was designed with U deletions opposite positions A66, A36, A111, and A114 to minimize potential off-target editing in readily editable motifs. [Figure 6G] Figure 6G shows a heatmap of the editing ratio of adenosines covered by the indicated circ-arRNAs in the TP53W53X transcript (highlighted in blue). Δ indicates the U deletion site of the circ-arRNA; n = 3. [Figure 7A] Figures 7A-7C show the restoration of IDUA activity in Hurler syndrome mice by circ-arRNA. Figure 7A shows the results of deep sequencing demonstrating the editing ratio of targeted adenosines in Idua transcripts in mouse hepatocytes. [Figure 7B] FIG. 7B shows the catalytic activity of IDUA on the 4-methylumbelliferone IDUA substrate. [Figure 7C] Figure 7C shows quantitative PCR results showing the expression levels of Idua transcripts in different treatments. Signals were normalized to GAPDH transcripts. All data are expressed as mean ± SEM (n≧3), where n represents the number of independent experiments performed in parallel; unpaired, two-tailed Student's t-test, *P<0.05; **P<0.01. [Figure 8A] FIG. 8A shows a schematic diagram of a circular arRNA (circ-arRNA) with flanking linker sequences flanking the 5′ and 3′ ends of the arRNA sequence. [Figure 8B] Figure 8B shows the locations of flanking linker sequences in various designs of circ-arRNA. [Figure 8C] Figure 8C shows the on-target editing efficiency of various circ-arRNAs targeting mf-PPIA-UTR2 in LLC-MK2 and FRHK-4 cells. [Figure 8D] Figure 8D shows the adenosine (positions are marked on the x-axis) editing (i.e., A to G conversion) rates of each mf-PPIA-UTR2 amplicon using circ-arRNA171, circ-arRNA171-L, circ-arRNA171-R, and circ-arRNA171-LR in LLC-MK2 cells. [Figure 8E] Figure 8E shows the on-target editing efficiency of various circ-arRNAs targeting mf-PPIA-3 in LLC-MK2 cells and FRHK-4 cells. [Figure 8F]Figure 8F shows the editing ratio of each adenosine in the mf-PPIA-3 amplicon using circ-arRNA171, circ-arRNA171-R, and an unrelated arRNA (UT) in FRHK-4 cells. [Figure 8G] Figure 8G shows the on-target editing efficiency of various circ-arRNAs targeting mf-IDUA-1 in LLC-MK2 and FRHK-4 cells. [Figure 8H] Figure 8H shows the editing ratio of each adenosine in the mf-IDUA-1 amplicon using circ-arRNA171, circ-arRNA171+LR, and an unrelated arRNA (UT) in LLC-MK2 cells. [Figure 9A] Figure 9A shows a heat map of editing ratios at positions 127 (4 off-targets), 132 (3 off-targets), 155 (on-target), 160 (2 off-targets), and 168 (1 off-target) of the mf-PPIA-3 amplicon using circ-arRNA171 and circ-arRNA constructs containing U deletions (-1, -2, -3, -4, -43, -432, and -4321) in FRHK and LLC-MK2 cells. [Figure 9B] Figure 9B shows a heat map of editing ratios at positions 62 (4 off-targets), 91 (3 off-targets), 102 (2 off-targets), 118 (1 off-target), and 134 (on-target) of the mf-IDUA-1 amplicon using circ-arRNA171 and circ-arRNA constructs containing U deletions (-1, -2, -3, -4, -43, -432, and -4321) in FRHK and LLC-MK2 cells. DETAILED DESCRIPTION OF THE INVENTION

[0044] The present application provides improved RNA editing methods and specifically designed RNAs (referred to herein as deaminase-recruiting RNAs ("dRNAs") or ADAR-recruiting RNAs ("arRNAs"), or constructs comprising nucleic acids encoding these arRNAs) for editing target RNAs in host cells.

[0045] "LEAPER" (Programmable Editing of RNA Using Endogenous ADARs) was previously developed by the inventors of the present application and utilizes endogenous ADARs to edit target RNAs using dRNA. The LEAPER method is described in WO2021 / 008447 and PCT / CN2021 / 071292, the entire contents of which are incorporated herein by reference. Specifically, targeting RNA partially complementary to the target transcript is used to recruit native ADAR1 or ADAR2, converting adenosine to inosine at specific sites on the on-target RNA. Therefore, RNA editing can be achieved in some systems without abnormal or overexpressing ADAR proteins in host cells.

[0046] The present application provides improved LEAPER methods that enable increased editing efficiency, reduced off-target (also referred to herein as "bystander editing") effects, and / or more precise and durable RNA editing. In some embodiments, the dRNA is linear or circular, and the dRNA contains deletions of one or more uridines that base pair with non-target adenosines in the target RNA. In some embodiments, the dRNA is a circular RNA or a linear RNA capable of forming a circular RNA, and the circular RNA contains one or more linker sequences adjacent to a targeting RNA sequence that is partially complementary to the target RNA. The linker sequences can enhance the on-target editing efficiency of circular dRNAs targeting RNA sequences that are prone to secondary structure formation. The circular dRNAs described herein have improved stability and efficacy compared to linear dRNAs. The methods described herein have been successfully used to correct pathogenic point mutations. The improved LEAPER methods may have broad applicability in therapeutics and biomedical research.

[0047] Accordingly, one aspect of the present application provides a method for editing a target adenosine in a target RNA in a host cell, comprising introducing into the host cell a deaminase-recruiting RNA (dRNA) or a construct comprising a nucleic acid sequence encoding the dRNA, wherein (1) the dRNA comprises a targeting RNA sequence capable of hybridizing to the target RNA to form a double-stranded RNA, the double-stranded RNA comprising a bulge containing a non-target adenosine in the target RNA, and (2) the dRNA is capable of recruiting an adenosine deaminase (ADAR) acting on RNA.

[0048] Another aspect of the present application provides a method for editing a target adenosine in a target RNA in a host cell, comprising introducing into the host cell a dRNA or a construct comprising a nucleic acid sequence encoding the dRNA, wherein: (1) the dRNA comprises a targeting RNA sequence capable of hybridizing to the target RNA, the dRNA comprises a linker nucleic acid sequence adjacent to an end of the targeting RNA sequence, wherein the linker nucleic acid sequence does not form substantially a secondary structure with any portion of the dRNA; (2) the dRNA is capable of recruiting ADAR; and (3) the dRNA is a circular RNA or a linear RNA capable of forming a circular RNA.

[0049] Another aspect of the present application provides a method for editing a target adenosine in a target RNA in a host cell, comprising introducing into the host cell a dRNA or a construct comprising a nucleic acid sequence encoding the dRNA, wherein: (1) the dRNA comprises a targeting RNA sequence capable of hybridizing to the target RNA, the dRNA comprises a linker nucleic acid sequence that replaces the end of the targeting RNA sequence, wherein the linker nucleic acid sequence does not form substantially a secondary structure with any portion of the dRNA, (2) the dRNA is capable of recruiting ADAR, and (3) the dRNA is a circular RNA or a linear RNA that can form a circular RNA.

[0050] I. Definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. All patents, applications, published applications, and other publications mentioned herein are incorporated by reference in their entirety. To the extent that a definition set forth in this section conflicts or is inconsistent with a definition set forth in a patent, application, or other publication incorporated herein by reference, the definition set forth in this section shall take precedence over the definition incorporated herein by reference.

[0051] It will be understood that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination. All combinations of embodiments relating to specific method steps, reagents, or conditions are specifically included in the disclosure and are disclosed herein as if each combination were individually and expressly disclosed.

[0052] As used herein, the term "bulge" refers to an asymmetric bubbling region in a nucleic acid duplex formed by one or more unpaired nucleotides (e.g., a non-target adenosine) in one strand of the nucleic acid duplex. The bulges described herein may have a completely unpaired region in one strand with no corresponding complementary region in the opposite strand. Alternatively, the bulges described herein may be formed from two non-complementary regions (one in each strand) with different numbers of nucleotides, which may further include mismatched nucleotides that do not form Watson-Crick base pairs. The longer of the two non-complementary regions has at least one nucleotide (e.g., a non-target adenosine) that does not pair with any nucleotide in the non-complementary region of the opposite strand. That is, the opposite strand contains a nucleic acid sequence complementary to the nucleic acid sequence adjacent to the bulge, but the opposite strand does not contain at least one nucleotide opposite the nucleotide in the bulge (e.g., a non-target adenosine). As used herein, a "bulge" does not include a completely mismatched region of nucleotides located within one strand of a nucleic acid duplex. That is, the opposite strand contains nucleotides that are not complementary to all nucleotides within the bulge, resulting in symmetric bubbling of the nucleic acid duplex. In some embodiments, the bulge contains 1, 2, 3, 4, 5, or more than 5 nucleotides within the strand with the unpaired nucleotide. For example, the duplex shown in the schematic diagram of Figure 5A has a bulge containing one nucleotide in the mRNA strand (top strand), which is a non-target adenosine that has no corresponding nucleotide in the linear arRNAdC strand (bottom strand).

[0053] When a first nucleic acid strand and a second nucleic acid strand form a double-stranded nucleic acid region, a first nucleoside of the first nucleic acid strand that base pairs with a second nucleoside of the second nucleic acid strand is described herein as "opposite" or "corresponding" to one another, i.e., the first nucleoside is opposite the second nucleoside and the second nucleoside is opposite the first nucleoside.

[0054] The terms "polynucleotide," "nucleic acid," "nucleotide sequence," and "nucleic acid sequence" are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Those of skill in the art will understand that instead of using "u" to represent uracil and "t" to represent thymine, "t" can represent both uracil and thymine. It will also be understood that with respect to ribonucleic acid (RNA), "t" will be used to represent uracil unless otherwise specified.

[0055] The terms "deaminase-recruiting RNA," "dRNA," "ADAR-recruiting RNA," and "arRNA" are used interchangeably herein and refer to engineered RNAs that can recruit ADARs to deaminate target adenosines in RNA.

[0056] The terms "group I intron" and "group I catalytic intron" are used interchangeably and refer to a self-splicing ribozyme that catalyzes its own excision from an RNA precursor. A group I intron contains two fragments, a 5' catalytic group I intron fragment and a 3' catalytic group I intron fragment, and retains folding and catalytic functions (i.e., self-splicing activity). In its natural environment, the 5' end of the 5' catalytic group I intron fragment is flanked by a 5' exon containing a 5' exon sequence recognizable by the 5' catalytic group I intron fragment, and the 3' end of the 3' catalytic group I intron fragment is flanked by a 3' exon containing a 3' exon sequence recognizable by the 3' catalytic group I intron fragment. As used herein, the terms "5' exon sequence" and "3' exon sequence" are labeled according to the order of the exons in their natural environment relative to the group I intron.

[0057] As used herein, the terms "adenine," "guanine," "cytosine," "thymine," "uracil," and "hypoxanthine" refer to the nucleobase itself. The terms "adenosine," "guanosine," "cytidine," "thymidine," "uridine," and "inosine" refer to a nucleobase linked to a ribose or deoxyribose sugar moiety. The term "nucleoside" refers to a nucleobase linked to a ribose or deoxyribose sugar moiety. The term "nucleotide" refers to the respective nucleobase-ribosyl-phosphate or nucleobase-deoxyribosyl-phosphate. Adenosine and adenine (abbreviated "A"), guanosine and guanine (abbreviated "G"), cytosine and cytidine (abbreviated "C"), uracil and uridine (abbreviated "U"), thymine and thymidine (abbreviated "T"), and inosine and hypoxanthine (abbreviated "I") refer to the corresponding nucleobase, nucleoside, or nucleotide, and are used interchangeably. Unless the context clearly requires otherwise, the terms nucleobase, nucleoside and nucleotide may be used interchangeably.

[0058] The term "functional protein" refers to a naturally occurring protein, a functional variant thereof, or an engineered derivative thereof that is functional in the treatment of a genetic disease or condition. The disease or condition may be caused in whole or in part by an alteration, such as a mutation, in the wild-type, naturally occurring protein that corresponds to the functional protein.

[0059] The term "functional variant" of a reference protein refers to a variant polypeptide derived from the reference protein or a portion thereof and having substantially the same activity (e.g., target binding activity or enzymatic activity) as the reference protein. "Substantially the same activity" refers to an activity level that is at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more of the activity of the reference protein.

[0060] The present disclosure provides several types of polynucleotide- or polypeptide-based compositions, including variants and derivatives. These include, for example, substitution, insertion, deletion, and covalent variants and derivatives. The term "derivative" is synonymous with the term "variant" and generally refers to a molecule that has been modified and / or changed in some way relative to a reference or starting molecule.

[0061] As used herein, the term "introducing" or "introduction" refers to the delivery of one or more polynucleotides, such as dRNA, or one or more constructs, including the vectors described herein, or one or more transcripts thereof, into a host cell. The present invention serves as a basic platform for achieving targeted editing of RNA, such as pre-messenger RNA, messenger RNA, ribosomal RNA, transfer RNA, long non-coding RNA, and small RNA (e.g., miRNA). The present method can achieve the introduction of the dRNA or construct described herein into the host cell using a number of delivery systems, including, but not limited to, viruses, liposomes, electroporation, microinjection, and conjugation. Conventional viral and non-viral gene transfer methods can be used to introduce nucleic acids into mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding the present dRNA to cells in culture or a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., transcripts of the constructs described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle (e.g., liposomes). Viral vector delivery systems include DNA and RNA viruses that have episomal or integrated genomes for delivery to host cells.

[0062] In the context of this application, " target RNA " refers to the RNA sequence that deaminase recruiting RNA sequence is designed to have complete or substantial complementarity with it, and the hybridization between target sequence and dRNA forms a double-stranded RNA (dsRNA) region that contains target adenosine, which recruits adenosine deaminase (ADAR) acting on RNA to deaminate target adenosine.In some embodiments, ADAR naturally exists in host cells, such as eukaryotic cells (preferably mammalian cells, more preferably human cells).In some embodiments, ADAR is introduced into host cells.

[0063] As used herein, "operably linked" refers to a situation in which a first nucleic acid sequence is operably linked to a second nucleic acid sequence, where the first nucleic acid sequence is in a functional relationship with the second nucleic acid sequence. For example, if the promoter influences the transcription of the coding sequence, the promoter is operably linked to the coding sequence. Similarly, if the signal peptide influences the extracellular secretion of the polypeptide, the coding sequence of the signal peptide is operably linked to the coding sequence of the polypeptide. Usually, operably linked nucleic acid sequences are contiguous, and the open reading frames are aligned, if necessary, to link two protein coding regions.

[0064] As used herein, "linked" means joining nucleic acid sequences directly or indirectly, for example, via an inserted nucleic acid sequence.

[0065] As used herein, "complementarity" refers to the ability of a nucleic acid to form hydrogen bonds with another nucleic acid through conventional Watson-Crick base pairing. Percent complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (i.e., Watson-Crick base pairing) with a second nucleic acid (e.g., about 5, 6, 7, 8, 9, and 10 out of 10 are about 50%, 60%, 70%, 80%, 90%, and 100% complementary, respectively). "Fully complementary" means that all contiguous residues of a nucleic acid sequence form hydrogen bonds with the same number of contiguous residues in a second nucleic acid sequence. As used herein, "substantially complementary" refers to two nucleic acids that hybridize under stringent conditions or with a degree of complementarity of at least about any one of 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of about 40, 50, 60, 70, 80, 100, 150, 200, 250, or more nucleotides.

[0066] As used herein, "stringent conditions" for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence hybridizes primarily to the target sequence and does not hybridize substantially to non-target sequences. Stringent conditions are generally sequence-dependent and vary depending on many factors. Generally, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology - Hybridization With Nucleic Acid Probes Part I, Second Chapter "Principles of principles of hybridization and the strategy of nucleic acid probe assay", Elsevier, N.Y.

[0067] "Hybridization" refers to a reaction in which one or more polynucleotides react to form a complex stabilized through hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding can occur by Watson-Crick base pairing, Hoogstein binding, or other sequence-specific methods. A sequence that can hybridize to a given sequence is called the "complement" of the given sequence.

[0068] A "subject," "patient," or "individual" includes humans or other animals, typically mammals such as humans. In some embodiments, a subject, such as a patient, to whom the therapeutic agents and compositions are administered is a mammal, typically a primate, such as a human. In some embodiments, the primate is a monkey or ape. The subject may be male or female and of any suitable age, including infant, adolescent, young adult, adult, or elderly. In some embodiments, the subject is a non-primate mammal, such as a rodent, dog, cat, or domestic animal, such as a cow or horse.

[0069] As used herein, the term "treatment" refers to a clinical intervention designed to produce a beneficial and desired effect on the natural processes of the individual or cells being treated during clinical pathology. For purposes of this disclosure, desired therapeutic outcomes include, but are not limited to, slowing the rate of disease progression, ameliorating or alleviating the disease state, and alleviating or improving prognosis. For example, an individual is successfully "treated" if one or more symptoms associated with cancer are reduced or eliminated, including, but not limited to, reducing (or destroying) cancer cell proliferation, increasing cancer cell death, alleviating symptoms caused by the disease, preventing the spread of the disease, preventing the recurrence of the disease, improving the quality of life of a person suffering from the disease, reducing the dosage of other medications required to treat the disease, slowing the progression of the disease, and / or extending the individual's survival.

[0070] As used herein, the term "effective amount" or "therapeutically effective amount" of a substance refers to at least the minimum concentration required to achieve a measurable improvement or prevention of a particular condition. The effective amount herein may vary depending on factors such as the patient's condition, age, sex, and weight, as well as the ability of the substance to elicit a desired response in an individual. An effective amount is also an amount in which any toxic or detrimental effects of the treatment are offset by a therapeutically beneficial effect. In the case of cancer, an effective amount includes an amount sufficient to cause tumor shrinkage and / or reduce the rate of tumor growth (e.g., inhibit tumor growth), or prevent or slow other undesirable cell proliferation in cancer. In some embodiments, an effective amount is an amount sufficient to slow the progression of cancer. In some embodiments, an effective amount is an amount sufficient to prevent or slow recurrence. In some embodiments, an effective amount is an amount sufficient to reduce the recurrence rate in an individual. An effective amount can be administered one or more times. An effective amount of a drug or composition can (i) reduce the number of cancer cells, (ii) reduce tumor size, (iii) inhibit, delay, slow to some extent, and preferably prevent, cancer cell invasion into peripheral organs, (iv) inhibit (i.e., slow to some extent, and preferably stop to some extent) tumor metastasis, (v) inhibit tumor growth, (vi) prevent or delay tumor onset and / or recurrence, (vii) reduce the rate of tumor recurrence, and / or (viii) alleviate to some extent one or more symptoms associated with cancer. An effective amount can be administered one or more times. For purposes of this disclosure, an effective amount of a drug, compound, or pharmaceutical composition is an amount sufficient to directly or indirectly provide prophylactic or therapeutic treatment. As understood in a clinical context, an effective amount of a drug, compound, or pharmaceutical composition can be achieved in combination with or without another drug, compound, or pharmaceutical composition. Thus, an "effective amount" may be considered when one or more therapeutic agents are administered, and may also consider administration of an effective amount of a single agent when, in combination with one or more other agents, a desired result is likely or can be achieved.

[0071] The term "wild-type" as used herein is a term understood by those skilled in the art to refer to the typical form of an organism, strain, gene or characteristic found in nature, as opposed to a mutant or variant.

[0072] "Host cell" as used herein refers to any cell type that can be used as a host cell, as long as it can be modified as described herein.For example, the host cell can be a host cell that endogenously expresses adenosine deaminase (ADAR) that acts on RNA, or a host cell into which adenosine deaminase (ADAR) that acts on RNA is introduced by a method known in the art.For example, the host cell can be a prokaryotic cell, a eukaryotic cell, or a plant cell.In some embodiments, the host cell is derived from a previously established cell line, such as a mammalian cell line, including a human cell line or a non-human cell line.In some embodiments, the host cell is derived from an individual, such as a human individual.

[0073] A "recombinant AAV vector (rAAV vector)" refers to a polynucleotide vector containing one or more heterologous sequences (i.e., nucleic acid sequences of non-AAV origin) flanked by at least one, and in embodiments, two, AAV inverted terminal repeats (ITRs). When such rAAV vectors are present in a host infected with an appropriate helper virus (or a virus expressing appropriate helper functions) and expressing the AAV rep and cap gene products (i.e., AAV Rep and Cap proteins), they can be replicated and packaged into infectious viral particles. When rAAV vectors are integrated into a larger polynucleotide (e.g., a chromosome or another vector such as a plasmid used for cloning or transfection), they can be referred to as "pre-vectors" and can be "rescued" by replicating and encapsulating in the presence of AAV packaging functions and appropriate accessory functions. rAAV vectors can be in any of a variety of forms, including, but not limited to, plasmids, linear artificial chromosomes, lipid-complexed vectors, liposome-encapsulated vectors, and viral particles, particularly AAV particles. The rAAV vector can be packaged into an AAV viral capsid to generate a "recombinant adeno-associated viral particle (rAAV particle)."

[0074] The term "AAV inverted terminal repeat (ITR)" is well known in the art and refers to a sequence of approximately 145 nucleotides present at both ends of a naturally occurring single-stranded AAV genome. The outermost 125 nucleotides of the ITR can be in either of two opposite orientations, resulting in heterogeneity between different AAV genomes and between the ends of a single AAV genome. The outermost 125 nucleotides also contain several short self-complementary regions (called the A, A', B, B', C, C', and D regions) that allow intrastrand base pairing to occur within this portion of the ITR.

[0075] Thus, polynucleotides encoding peptides or polypeptides are included within the scope of the present disclosure, including substitutions, insertions and / or additions, deletions, and covalent modifications of reference sequences, particularly the polypeptide sequences disclosed herein. For example, sequence tags or amino acids, such as one or more lysines, can be added to a peptide sequence (e.g., at the N- or C-terminus). Sequence tags can be used for peptide detection, purification, or localization. Lysines can be used to increase peptide solubility or enable biotinylation. Alternatively, amino acid residues located in the carboxyl- and amino-terminal regions of a peptide or protein amino acid sequence can be optionally deleted to provide a truncated sequence. Depending on the use of the sequence, for example, when expressing the sequence as part of a larger sequence linked to a soluble or solid support, specific amino acids (e.g., C- or N-terminal residues) can alternatively be deleted.

[0076] The terms "non-naturally occurring" and "engineered" are used interchangeably to indicate artificial involvement. When referring to a nucleic acid molecule or polypeptide, these terms mean that the nucleic acid molecule or polypeptide is at least substantially free from at least one other component with which it is naturally associated and found in nature.

[0077] As used herein, "expression" refers to the process by which a polynucleotide is transcribed from a DNA template (e.g., into mRNA or other RNA transcript) and / or the subsequent translation of the transcribed mRNA into a peptide, polypeptide, or protein. The transcript and the encoded polypeptide are sometimes collectively referred to as the "gene product." If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.

[0078] As used herein, "carrier" includes pharmaceutically acceptable carriers, excipients, or stabilizers that are non-toxic to the cells or mammals to which they are exposed at dosages and concentrations used. Typically, physiologically acceptable carriers are pH-buffered aqueous solutions. Non-limiting examples of physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants such as ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, aspartic acid, arginine, or lysine; monosaccharides, disaccharides, and other sugars, including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or non-ionic surfactants such as TWEEN™, polyethylene glycol (PEG), and PLURONICS™.

[0079] The term "protocol" refers to instructions typically included in commercial packaging for a therapeutic product, which contain information such as indications, uses, dosage, administration, concomitant therapy, contraindications, and / or warnings regarding the use of such therapeutic product.

[0080] An "article of manufacture" is any product (e.g., package or container) or kit that includes at least one reagent, e.g., an agent for treating a disease or condition. In some embodiments, the article of manufacture or kit is advertised, distributed, or sold as a unit for performing the methods described herein.

[0081] As used herein, the terms "consisting of," "containing," and "including" are used in an open and non-limiting sense. It will also be understood that aspects and embodiments of the present application described herein can include aspects and embodiments "consisting of" and / or "consisting essentially of."

[0082] Whether or not the term "about" is explicitly used, each quantity given herein will be understood to mean the actual given value and also mean an approximation of such given value that can be reasonably estimated based on the ordinary skill of one of ordinary skill in the art. This approximation includes equivalents and approximations obtained from experimental and / or measurement conditions of such given value. References herein to "about" a value or parameter include (and account for) variations about the value or parameter itself. For example, a statement about "about X" includes a statement about "X."

[0083] As used herein, reference to a value or parameter that is "not" generally means and describes a value or parameter that is "different" from that value or parameter. For example, a method that is not used to treat disease type X means that the method is used to treat diseases other than disease type X.

[0084] As used herein, the term "about X to Y" has the same meaning as "about X to about Y."

[0085] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. It should also be noted that the claims may be drafted to exclude any element. Accordingly, this statement is intended to serve as a prerequisite for using exclusive terminology, such as "only" or "only," when referring to claim elements or using a "negative" limitation.

[0086] As used herein, the term "and / or," e.g., phrases such as "A and / or B," are intended to include both A and B, A or B, A alone, and B alone. Similarly, as used herein, the term "and / or," phrases such as "A, B and / or C," are intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B, or C; A and C; A and B; B and C; A alone; B alone; C alone.

[0087] II. RNA editing methods Provided herein are methods for editing a target RNA in a host cell using a deaminase-recruiting RNA (dRNA) comprising a targeting RNA sequence, where the deaminase-recruiting RNA has a deletion of one or more nucleosides opposite a non-target adenosine-containing region in the target RNA and / or comprises one or more linker nucleic acid sequences adjacent to the 5' and / or 3' end of the targeting RNA sequence, wherein the dRNA is capable of recruiting an adenosine deaminase acting on RNA (ADAR). The dRNA can be any of the dRNAs described in Section III below ("dRNA, Constructs, and Libraries"). In some embodiments, the dRNA is linear. In some embodiments, the dRNA is circular. In some embodiments, the dRNA is a linear RNA capable of forming a circular RNA. In some embodiments, the method uses a construct comprising a nucleic acid sequence encoding the dRNA. The construct can be any of the constructs described in Section III below.

[0088] In some embodiments, a method for editing a target adenosine in a target RNA in a host cell is provided, comprising introducing a dRNA or a construct comprising a nucleic acid sequence encoding the dRNA into the host cell, wherein (1) the dRNA comprises a targeting RNA sequence capable of hybridizing to the target RNA to form a double-stranded RNA, the double-stranded RNA comprising a bulge containing a non-target adenosine in the target RNA, and (2) the dRNA is capable of recruiting an ADAR. In some embodiments, the double-stranded RNA comprises a bulge at each non-target adenosine in the target RNA. In some embodiments, the targeting RNA sequence is complementary to the target RNA except that one or more nucleotides opposite the non-target adenosine in the target RNA are missing. In some embodiments, the dRNA is linear. In some embodiments, the dRNA is circular. In some embodiments, the dRNA is a linear RNA capable of forming a circular RNA. In some embodiments, the method does not comprise introducing a construct comprising a nucleic acid encoding any protein or protein (e.g., Cas, ADAR, or a fusion protein of ADAR and Cas) into the host cell.

[0089] In some embodiments, a method for editing a target adenosine in a target RNA in a host cell is provided, comprising introducing into the host cell a construct comprising a dRNA or a nucleic acid sequence encoding the dRNA, wherein (1) the dRNA comprises a targeting RNA sequence capable of hybridizing to the target RNA, the dRNA comprises a linker nucleic acid sequence adjacent to the end of the targeting RNA sequence, the linker nucleic acid sequence does not form substantially a secondary structure with any portion of the dRNA, (2) the dRNA is capable of recruiting ADAR, and (3) the dRNA is a circular RNA or a linear RNA capable of forming a circular RNA. In some embodiments, the length of the linker nucleic acid sequence is about 5 nt to about 500 nt, e.g., about 50 nt to about 200 nt. In some embodiments, the linker nucleic acid sequence comprises a polyadenosine (polyA), polyguanosine (polyG), or polycytosine (polyC) sequence. In some embodiments, at least 50% of the linker nucleic acid sequence comprises adenosine. In some embodiments, the linker nucleic acid sequence comprises a dinucleotide repeat sequence, e.g., (AT) n wherein n is an integer greater than or equal to 3. In some embodiments, the linker nucleic acid sequence comprises SEQ ID NO: 22. In some embodiments, the method does not include introducing into the host cell a construct comprising a nucleic acid encoding any protein or protein (e.g., Cas, ADAR, or a fusion protein of ADAR and Cas).

[0090] In some embodiments, a method for editing a target adenosine in a target RNA in a host cell is provided, comprising introducing into the host cell a dRNA or a construct comprising a nucleic acid sequence encoding the dRNA, wherein (1) the dRNA comprises a targeting RNA sequence capable of hybridizing to the target RNA, the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeting RNA sequence and a second linker nucleic acid sequence adjacent to the 3' end of the targeting RNA sequence, wherein the linker nucleic acid sequences do not form substantially a secondary structure with any portion of the dRNA, (2) the dRNA is capable of recruiting ADAR, and (3) the dRNA is a circular RNA or a linear RNA capable of forming a circular RNA. In some embodiments, the length of the first linker nucleic acid sequence and / or the second linker nucleic acid sequence is about 5 nt to about 500 nt, e.g., about 50 nt to about 200 nt. In some embodiments, the first linker nucleic acid sequence is the same as the second linker nucleic acid sequence. In some embodiments, the first linker nucleic acid sequence is different from the second linker nucleic acid sequence. In some embodiments, the first linker nucleic acid sequence and / or the second linker nucleic acid sequence comprises a polyadenosine (polyA), polyguanosine (polyG), or polycytosine (polyC) sequence. In some embodiments, the first linker nucleic acid sequence and / or the second linker nucleic acid sequence comprises a dinucleotide repeat sequence, for example, (AT) n wherein n is an integer greater than or equal to 3. In some embodiments, the first linker nucleic acid sequence and / or the second linker nucleic acid sequence comprises SEQ ID NO: 22. In some embodiments, the dRNA is a circular RNA, and the linker nucleic acid sequence links the 5' end of the targeting RNA sequence to the 3' end of the targeting RNA sequence. In some embodiments, the method does not include introducing into the host cell a construct comprising a nucleic acid encoding any protein or protein (e.g., Cas, ADAR, or a fusion protein of ADAR and Cas).

[0091] In some embodiments, provided is a method for editing target adenosines in target RNA in host cells, comprising: introducing dRNA or a construct comprising a nucleic acid sequence encoding dRNA into said host cell, wherein (1) dRNA comprises a targeting RNA sequence that can hybridize with target RNA to form double-stranded RNA, and the double-stranded RNA comprises a bulge that contains non-target adenosines in target RNA; dRNA comprises a linker nucleic acid sequence adjacent to the end of the targeting RNA sequence, and the linker nucleic acid sequence does not substantially form a secondary structure with any part of dRNA; (2) dRNA can recruit ADAR; and (3) dRNA is circular RNA or a linear RNA that can form circular RNA.In some embodiments, the double-stranded RNA comprises a bulge at each non-target adenosines in target RNA.In some embodiments, the targeting RNA sequence is complementary to target RNA, except that it lacks one or more nucleotides opposite non-target adenosines in target RNA. In some embodiments, the length of the linker nucleic acid sequence is about 5 nt to about 500 nt, for example, about 50 nt to about 200 nt. In some embodiments, the linker nucleic acid sequence comprises a polyadenosine (polyA), polyguanosine (polyG), or polycytosine (polyC) sequence. In some embodiments, at least 50% of the linker nucleic acid sequence comprises adenosine. In some embodiments, the linker nucleic acid sequence comprises a dinucleotide repeat sequence, for example, (AT) nwherein n is an integer greater than or equal to 3. In some embodiments, the linker nucleic acid sequence comprises SEQ ID NO: 22. In some embodiments, the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence adjacent to the 3' end of the targeter RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeter RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence that replaces the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeter RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence that replaces the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeter RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence that replaces the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeter RNA sequence. In some embodiments, the first linker nucleic acid sequence is the same as the second linker nucleic acid sequence. In some embodiments, the first linker nucleic acid sequence is different from the second linker nucleic acid sequence. In some embodiments, the dRNA is a circular RNA, and the linker nucleic acid sequence links the 5' end of the targeting RNA sequence to the 3' end of the targeting RNA sequence. In some embodiments, the method does not include introducing a construct containing a nucleic acid encoding any protein or protein (e.g., Cas, ADAR, or a fusion protein of ADAR and Cas) into a host cell.

[0092] In some embodiments, a method for editing a target adenosine in a target RNA in a host cell is provided, comprising introducing a construct comprising a circular dRNA or a nucleic acid sequence encoding a circular dRNA into the host cell, wherein (1) the circular dRNA comprises a targeting RNA sequence that can hybridize to the target RNA to form a double-stranded RNA, and the double-stranded RNA comprises a bulge that contains a non-target adenosine in the target RNA; and (2) the circular dRNA can recruit ADAR. In some embodiments, the double-stranded RNA comprises a bulge at each non-target adenosine in the target RNA. In some embodiments, the targeting RNA sequence is complementary to the target RNA, except that one or more nucleotides opposite the non-target adenosine in the target RNA are missing. In some embodiments, the circular dRNA further comprises a linker nucleic acid sequence adjacent to the end of the targeting RNA sequence, and the linker nucleic acid sequence does not substantially form a secondary structure with any part of the dRNA. In some embodiments, the circular dRNA further comprises a linker nucleic acid sequence that replaces the end of the targeting RNA sequence, and the linker nucleic acid sequence does not form substantially a secondary structure with any portion of the dRNA. In some embodiments, the length of the linker nucleic acid sequence is about 5 nt to about 500 nt, for example, about 50 nt to about 200 nt. In some embodiments, the linker nucleic acid sequence comprises SEQ ID NO: 22. In some embodiments, the linker nucleic acid sequence connects the 5' end of the targeting RNA sequence to the 3' end of the targeting RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeting RNA sequence and a second linker nucleic acid sequence adjacent to the 3' end of the targeting RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeting RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeting RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence that replaces the 5' end of the targeting RNA sequence and a second linker nucleic acid sequence adjacent to the 3' end of the targeting RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence that replaces the 5' end of the targeting RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeting RNA sequence.In some embodiments, the dRNA further comprises a 3' exon sequence recognizable by a 3' catalytic group I intron fragment adjacent to the 5' end of the targeting RNA sequence, and a 5' exon sequence recognizable by a 5' catalytic group I intron fragment adjacent to the 3' end of the targeting RNA sequence. In some embodiments, the dRNA further comprises a 3' linking sequence and a 5' linking sequence. In some embodiments, the method does not include introducing a construct comprising a nucleic acid encoding any protein or protein (e.g., Cas, ADAR, or an ADAR and Cas fusion protein) into a host cell.

[0093] In some embodiments, a method for editing a target adenosine in a target RNA in a host cell is provided, comprising: (a) introducing a dRNA or a construct comprising a nucleic acid sequence encoding a dRNA, and (b) an ADAR or a construct comprising a nucleic acid encoding an ADAR into the host cell, wherein (1) the dRNA comprises a targeting RNA sequence that can hybridize to the target RNA to form a double-stranded RNA, and the double-stranded RNA comprises a bulge containing a non-target adenosine in the target RNA; and (2) the dRNA can recruit an ADAR. In some embodiments, the double-stranded RNA comprises a bulge at each non-target adenosine in the target RNA. In some embodiments, the targeting RNA sequence is complementary to the target RNA, except that it lacks one or more nucleotides opposite the non-target adenosine in the target RNA. In some embodiments, the ADAR is an ADAR endogenously encoded in the host cell, and introducing the ADAR comprises overexpressing the ADAR in the host cell. In some embodiments, the ADAR is exogenous to the host cell. In some embodiments, the construct comprising the nucleic acid encoding the ADAR is a vector, such as a plasmid or a viral vector (e.g., AAV, such as scAAV).

[0094] In some embodiments, a method for editing a target adenosine in a target RNA in a host cell is provided, comprising introducing into the host cell (a) a dRNA or a construct comprising a nucleic acid sequence encoding the dRNA, and (b) an ADAR or a construct comprising a nucleic acid encoding the ADAR, wherein (1) the dRNA comprises a targeting RNA sequence capable of hybridizing to the target RNA, the dRNA comprises a linker nucleic acid sequence adjacent to the end of the targeting RNA sequence, the linker nucleic acid sequence not forming substantially a secondary structure with any portion of the dRNA, (2) the dRNA is capable of recruiting an ADAR, and (3) the dRNA is a circular RNA or a linear RNA capable of forming a circular RNA. In some embodiments, the length of the linker nucleic acid sequence is about 5 nt to about 500 nt, e.g., about 50 nt to about 200 nt. In some embodiments, the linker nucleic acid sequence comprises a polyadenosine (polyA), polyguanosine (polyG), or polycytosine (polyC) sequence. In some embodiments, at least 50% of the linker nucleic acid sequence comprises adenosine. In some embodiments, the linker nucleic acid sequence comprises a dinucleotide repeat sequence, for example, (AT) nwherein n is an integer greater than or equal to 3. In some embodiments, the linker nucleic acid sequence comprises SEQ ID NO: 22. In some embodiments, the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence adjacent to the 3' end of the targeter RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeter RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence that replaces the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeter RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence that replaces the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeter RNA sequence. In some embodiments, ADAR is the ADAR that is endogenously encoded in host cell, and introducing ADAR comprises overexpressing ADAR in host cell.In some embodiments, ADAR is exogenous to host cell.In some embodiments, the construct that comprises the nucleic acid encoding ADAR is a vector such as plasmid or virus vector (for example, AAV, such as scAAV).

[0095] In some embodiments, a method for editing a target adenosine in a target RNA in a host cell is provided, the method comprising: (a) introducing a dRNA or a construct comprising a nucleic acid sequence encoding a dRNA, and (b) an ADAR or a construct comprising a nucleic acid encoding an ADAR into the host cell, wherein (1) the dRNA comprises a targeting RNA sequence that can hybridize to the target RNA to form a double-stranded RNA, the double-stranded RNA comprises a bulge that contains a non-target adenosine in the target RNA, the dRNA comprises a linker nucleic acid sequence adjacent to the end of the targeting RNA sequence, and the linker nucleic acid sequence does not form a substantial secondary structure with any part of the dRNA; (2) the dRNA can recruit ADAR; and (3) the dRNA is a circular RNA or a linear RNA that can form a circular RNA. In some embodiments, the double-stranded RNA comprises a bulge at each non-target adenosine in the target RNA. In some embodiments, the targeting RNA sequence is complementary to the target RNA, except that it lacks one or more nucleotides opposite the non-target adenosine in the target RNA. In some embodiments, the length of the linker nucleic acid sequence is about 5 nt to about 500 nt, for example, about 50 nt to about 200 nt. In some embodiments, the linker nucleic acid sequence comprises a polyadenosine (polyA), polyguanosine (polyG), or polycytosine (polyC) sequence. In some embodiments, at least 50% of the linker nucleic acid sequence comprises adenosine. In some embodiments, the linker nucleic acid sequence comprises a dinucleotide repeat sequence, for example, (AT) nwherein n is an integer greater than or equal to 3. In some embodiments, the linker nucleic acid sequence comprises SEQ ID NO: 22. In some embodiments, the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence adjacent to the 3' end of the targeter RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeter RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence that replaces the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeter RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence that replaces the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeter RNA sequence. In some embodiments, dRNA is circular RNA, and linker nucleic acid sequence connects the 5' end of targeting RNA sequence and the 3' end of targeting RNA sequence.In some embodiments, ADAR is the ADAR that is endogenously encoded in host cell, and introducing ADAR comprises overexpressing ADAR in host cell.In some embodiments, ADAR is exogenous to host cell.In some embodiments, the construct comprising the nucleic acid encoding ADAR is a vector such as plasmid or virus vector (for example, AAV, such as scAAV).

[0096] In some embodiments, the present invention provides a method of editing a target adenosine in a target RNA disclosed herein, wherein a dRNA, or a construct comprising a nucleic acid sequence encoding the dRNA, edits the target adenosine in the target RNA in a dose-dependent manner.

[0097] In some embodiments, a method for reducing non-target adenosine editing (also referred to herein as "bystander editing") in target RNA in a host cell is provided, comprising introducing a dRNA or a construct comprising a nucleic acid sequence encoding a dRNA into the host cell, wherein (1) the dRNA comprises a targeting RNA sequence that can hybridize to the target RNA to form a double-stranded RNA, and the double-stranded RNA comprises a bulge that contains the non-target adenosine in the target RNA; and (2) the dRNA can recruit ADAR, wherein the editing rate of non-target adenosines is reduced compared to a method using a dRNA comprising a targeting RNA sequence that is complementary to the target RNA. In some embodiments, the double-stranded RNA comprises a bulge at each non-target adenosine in the target RNA. In some embodiments, the targeting RNA sequence is complementary to the target RNA, except that it lacks one or more nucleotides opposite the non-target adenosine in the target RNA. In some embodiments, the targeting RNA sequence is complementary to the targeting RNA except that it lacks two or more consecutive nucleotides opposite a non-targeting adenosine in the targeting RNA. In some embodiments, the dRNA comprises a linker nucleic acid sequence adjacent to the end of the targeting RNA sequence, wherein the linker nucleic acid sequence does not substantially form a secondary structure with any portion of the dRNA. In some embodiments, the dRNA comprises a linker nucleic acid sequence that replaces the end of the targeting RNA sequence, wherein the linker nucleic acid sequence does not substantially form a secondary structure with any portion of the dRNA. In some embodiments, the length of the linker nucleic acid sequence is from about 5 nt to about 500 nt, e.g., from about 50 nt to about 200 nt. In some embodiments, the linker nucleic acid sequence comprises a polyadenosine (polyA), polyguanosine (polyG), or polycytosine (polyC) sequence. In some embodiments, at least 50% of the linker nucleic acid sequence comprises an adenosine. In some embodiments, the linker nucleic acid sequence comprises a dinucleotide repeat sequence, e.g., (AT) nwherein n is an integer greater than or equal to 3. In some embodiments, the linker nucleic acid sequence comprises SEQ ID NO: 22. In some embodiments, the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeting RNA sequence and a second linker nucleic acid sequence adjacent to the 3' end of the targeting RNA sequence. In some embodiments, the dRNA is a circular RNA, and the linker nucleic acid sequence connects the 5' end of the targeting RNA sequence to the 3' end of the targeting RNA sequence. In some embodiments, the rate of editing of non-targeted adenosines is reduced by at least about 20%, 30%, 50%, 60%, 70%, 80%, 90%, 95% or more compared to a method using a dRNA comprising a targeting RNA sequence complementary to the target RNA.

[0098] In some embodiments, a method for enhancing the editing efficiency of a target adenosine in a target RNA in a host cell is provided, comprising introducing into the host cell a dRNA or a construct comprising a nucleic acid sequence encoding the dRNA, wherein (1) the dRNA comprises a targeting RNA sequence capable of hybridizing to the target RNA, the dRNA comprises a linker nucleic acid sequence adjacent to the end of the targeting RNA sequence, the linker nucleic acid sequence does not substantially form a secondary structure with any portion of the dRNA, and (2) the dRNA is capable of recruiting ADAR, wherein the editing efficiency of the target adenosine is enhanced compared to a method using a dRNA that does not comprise a linker nucleic acid sequence. In some embodiments, the length of the linker nucleic acid sequence is about 5 nt to about 500 nt, for example, about 50 nt to about 200 nt. In some embodiments, the linker nucleic acid sequence comprises a polyadenosine (polyA), polyguanosine (polyG), or polycytosine (polyC) sequence. In some embodiments, the linker nucleic acid sequence comprises a dinucleotide repeat sequence, for example, (AT) nwherein n is an integer greater than or equal to 3. In some embodiments, the linker nucleic acid sequence comprises SEQ ID NO: 22. In some embodiments, the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeting RNA sequence and a second linker nucleic acid sequence adjacent to the 3' end of the targeting RNA sequence. In some embodiments, the dRNA is a circular RNA, and the linker nucleic acid sequence connects the 5' end of the targeting RNA sequence to the 3' end of the targeting RNA sequence. In some embodiments, the dRNA comprises a targeting RNA sequence that can hybridize to the target RNA to form a double-stranded RNA, and the double-stranded RNA comprises a bulge containing a non-target adenosine in the target RNA. In some embodiments, the double-stranded RNA comprises a bulge at each non-target adenosine in the target RNA. In some embodiments, the targeting RNA sequence is complementary to the target RNA except that it lacks one or more nucleotides opposite the non-target adenosines in the target RNA. In some embodiments, the editing efficiency of the target adenosine is increased by at least about 50%, 2-fold, 3-fold, 4-fold, 2-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold or more compared to methods using dRNAs that do not contain linker nucleic acid sequences.

[0099] In one aspect, the present application provides a method for editing multiple (e.g., at least about 2, 3, 4, 5, 10, 20, 50, 100, 1000 or more) target RNAs in a host cell by introducing multiple dRNAs, or one or more constructs encoding the dRNAs, into the host cell.

[0100] In some embodiments, the host cell is a prokaryotic cell. In some embodiments, the host cell is a eukaryotic cell. In some embodiments, the host cell is a mammalian cell. In some embodiments, the host cell is a human cell. In some embodiments, the host cell is a murine cell. In some embodiments, the host cell is a plant cell or a fungal cell.

[0101] In some embodiments, the host cell is a cell line such as HEK293T, HT29, A549, HepG2, RD, SF268, SW13, and HeLa cells. In some embodiments, the host cell is a primary cell such as a fibroblast, epithelial cell, or immune cell. In some embodiments, the host cell is a T cell. In some embodiments, the host cell is a post-mitotic cell. In some embodiments, the host cell is a cell of the central nervous system (CNS), such as a brain cell, e.g., a cerebellar cell.

[0102] In some embodiments, the ADAR is endogenous to the host cell. In some embodiments, the adenosine deaminase acting on RNA (ADAR) is naturally or endogenously present in the host cell, for example, naturally or endogenously present in a eukaryotic cell. In some embodiments, the ADAR is endogenously expressed by the host cell. In some embodiments, the ADAR is exogenously introduced into the host cell. In some embodiments, the ADAR is ADAR1 and / or ADAR2. In some embodiments, the ADAR is one or more ADARs selected from the group consisting of hADAR1, hADAR2, mouse ADAR1, and ADAR2. In some embodiments, the ADAR is the p110 isoform of ADAR1 ("ADAR1"). p110 " ) and / or the p150 isoform of ADAR1 (" ADAR1 p150 "). In some embodiments, the ADAR is ADAR2. In some embodiments, the ADAR is ADAR2 expressed by a host cell, for example, ADAR2 expressed by a cerebellar cell.

[0103] In some embodiments, ADAR is an exogenous ADAR to host cells.In some embodiments, ADAR is a hyperactive mutant of naturally occurring ADAR.In some embodiments, ADAR is ADAR1 comprising E1008Q mutation.In some embodiments, ADAR is not a fusion protein comprising binding domain.In some embodiments, ADAR does not comprise engineered double-stranded nucleic acid binding domain.In some embodiments, ADAR does not comprise the MCP domain that binds to the MS2 hairpin that is fused to the complementary RNA sequence of dRNA.

[0104] In some embodiments, the host cell expresses high levels of ADAR1 (ADAR1 p110 and / or ADAR1 p150 In some embodiments, the host cell has a high expression level of ADAR2, e.g., at least about 10%, 20%, 50%, 100%, 2-fold, 3-fold, 5-fold, or more than the protein expression level of β-tubulin. In some embodiments, the host cell has a low expression level of ADAR3, e.g., at least about 5-fold, 3-fold, 2-fold, 100%, 50%, 20% or less than the protein expression level of β-tubulin.

[0105] In certain embodiments, the method further comprises introducing an inhibitor of ADAR3 into the host cell. In some embodiments, the inhibitor of ADAR3 is an RNAi against ADAR3, for example, an shRNA against ADAR3 or an siRNA against ADAR3. In some embodiments, the method further comprises introducing an interferon stimulator into the host cell. In some embodiments, the ADAR is inducible by interferon, for example, the ADAR is an ADAR p150In some embodiments, the interferon stimulating agent is IFNα. In some embodiments, the inhibitor of ADAR3 and / or the interferon stimulating agent are encoded by the same construct (e.g., vector) that encodes the dRNA.

[0106] In certain embodiments, the method does not induce an immune response, such as an innate immune response. In some embodiments, the method does not induce expression of interferon and / or interleukin in the host cell. In some embodiments, the method does not induce expression of IFN-β and / or IL-6 in the host cell.

[0107] Nucleic acids, including dRNAs, constructs thereof, and nucleic acids encoding ADARs, can be delivered using any method known in the art, including viral or non-viral delivery.

[0108] Methods for non-viral delivery of nucleic acids include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, electroporation, nanoparticles, exosomes, microvesicles, or gene guns, naked DNA, and artificial virions.

[0109] The use of RNA or DNA virus-based systems for nucleic acid delivery has high efficiency in targeting viruses to specific cells and transporting viral payloads to the cell nucleus. In certain embodiments, this method involves introducing a viral vector (such as an AAV, such as scAAV, or a lentiviral vector) encoding dRNA into a host cell. For example, the constructs described herein may be any of the viral vectors described in Section III, "dRNA, Constructs, and Libraries," below.

[0110] In some embodiments, the method comprises introducing a plasmid encoding the dRNA into the host cell. In some embodiments, the method comprises electroporating the dRNA (e.g., synthetic dRNA) into the host cell. In some embodiments, the method comprises transfecting the dRNA into the host cell.

[0111] In certain embodiments, the editing efficiency of the target RNA is at least about 10%, e.g., at least about any one of 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or more. In some embodiments, the editing efficiency of the target RNA is at least about 40%. In some embodiments, the editing efficiency is determined by Sanger sequencing. In some embodiments, the editing efficiency is determined by next-generation sequencing. In some embodiments, the editing efficiency is determined by assessing the expression of a reporter gene, such as a fluorescent reporter gene such as EGFP.

[0112] In certain embodiments, this method has a low off-target editing rate. In some embodiments, this method has an editing efficiency of less than about 1% (e.g., less than about 0.5%, 0.1%, 0.05%, 0.01%, 0.001%, or less than 1%) for non-target A in the target RNA. In some embodiments, this method does not edit non-target A in the target RNA. In some embodiments, this method has an editing efficiency of less than about 0.1% (e.g., less than about 0.05%, 0.01%, 0.005%, 0.001%, 0.0001%, or less than 1%) for A in the non-target RNA.

[0113] After deamination, modifications of the target RNA and / or the protein encoded by the target RNA can be determined using different methods depending on the location of the target adenosine in the target RNA. For example, to determine whether an "A" has been edited to an "I" in the target RNA, RNA sequencing methods known in the art can be used to detect the modification of the RNA sequence. If the target adenosine is in the coding region of an mRNA, RNA editing can change the amino acid sequence encoded by the mRNA. For example, a point mutation can be introduced into the mRNA, converting the "A" to an "I," thereby reverting a congenital or acquired point mutation in the mRNA to a wild-type gene product. Amino acid sequencing by methods known in the art can be used to detect changes in amino acid residues in the encoded protein. Modification of a stop codon can be determined by assessing the presence of functional, extended, truncated, full-length, and / or wild-type proteins. For example, if the target adenosine is located at a UGA, UAG, or UAA stop codon, modification of the target A (UGA or UAG) or multiple A's (UAA) can create a read-through mutation and / or an extended protein. Alternatively, a truncated protein encoded by the target RNA can be restored to create a functional full-length and / or wild-type protein. Editing the target RNA can also generate aberrant splicing sites and / or alternative splicing sites in the target RNA, thus creating a functional, correctly folded full-length and / or wild-type protein by restoring an extended, truncated, or misfolded protein, or an aberrant splicing or alternative splicing site encoded by the target RNA. In some embodiments, the present application contemplates both congenital and acquired genetic alterations, such as missense mutations, premature stop codons, aberrant splicing, or editing of an alternative splicing site encoded by the target RNA. The function of the protein encoded by the target RNA can be assessed using known methods to confirm whether RNA editing achieved the desired effect.Because adenosine (A) to inosine (I) deamination can correct the mutated A at the target position in mutant protein-coding RNA, identifying deamination to inosine can provide an indication of whether a functional protein exists or whether disease- or drug-resistance-related RNA caused by the presence of the mutated adenosine is reverted or partially reverted. Similarly, because adenosine (A) to inosine (I) deamination can introduce point mutations into the resulting protein, identifying deamination to inosine can provide a functional indicator for identifying disease causes or disease-related factors.

[0114] If the presence of the target adenosine causes aberrant splicing, the readout may be an assessment of the occurrence and frequency of aberrant splicing. On the other hand, if deamination of the target adenosine is required to introduce a splice site, a similar method can be used to check whether the required type of splicing occurs. Exemplary suitable methods for identifying the presence of inosine after deamination of the target adenosine are RT-PCR and sequencing using methods well known to those skilled in the art.

[0115] The effects of targeted adenosine deamination include, for example, point mutations, premature stop codons, aberrant splice sites, alternative splice sites, and resulting protein misfolding. These effects can induce structural and functional changes in RNA and / or proteins associated with disease, whether inherited or caused by acquired genetic mutations, or associated with the development of drug resistance. Thus, the present dRNAs, dRNA-encoding constructs, and RNA-editing methods can be used to prevent or treat inherited diseases or conditions, or diseases or conditions associated with acquired genetic mutations, by altering the structure and / or function of disease-associated RNA and / or proteins.

[0116] In some embodiments, the target RNA is a pre-messenger RNA. In some embodiments, the target RNA is a messenger RNA. In some embodiments, the target RNA is a regulatory RNA. In some embodiments, the target RNA is a ribosomal RNA, transfer RNA, long non-coding RNA, or small RNA (e.g., miRNA, pri-miRNA, pre-miRNA, piRNA, siRNA, snoRNA, snRNA, exRNA, or scaRNA). The effect of deamination of the target adenosine includes, for example, a change in the structure and function of the ribosomal RNA, transfer RNA, long non-coding RNA, or small RNA (e.g., miRNA), including a change in the three-dimensional structure of the target RNA and / or a loss or gain of function. In some embodiments, deamination of the target A in the target RNA alters the expression level of one or more downstream molecules (e.g., proteins, RNAs, and / or metabolites) of the target RNA. The change in the expression level of the downstream molecule may be an increase or decrease in expression level.

[0117] Some embodiments of the present application relate to multiplex editing of target RNAs in a host cell, which can be used to screen for different variants of a target gene or different genes in a host cell. The method includes introducing multiple dRNAs into the host cell, where at least two dRNAs of the multiple dRNAs have different sequences and / or different target RNAs. In some embodiments, each dRNA has a different sequence and / or a different target RNA. In some embodiments, the method generates multiple (e.g., at least 2, 3, 5, 10, 50, 100, 1000, or more) modifications to a single target RNA in a host cell. In some embodiments, the method generates modifications to multiple (e.g., at least 2, 3, 5, 10, 50, 100, 1000, or more) target RNAs in a host cell. In some embodiments, the method includes editing multiple target RNAs in multiple populations of host cells. In some embodiments, each population of host cells receives a different dRNA or a dRNA with a different target RNA than the other populations of host cells.

[0118] Also provided is an edited RNA or a host cell having an edited RNA produced by any one of the methods described herein. In some embodiments, the edited RNA includes an inosine. In some embodiments, the host cell includes a target RNA having a missense mutation, a premature stop codon, an alternative splicing site, or an aberrant splicing site. In some embodiments, the host cell includes a mutated, truncated, or misfolded protein. In some embodiments, the method restores the function of the target RNA.

[0119] III. dRNA, Constructs and Libraries The present application further provides dRNAs, constructs encoding the dRNAs, and libraries comprising multiple dRNAs or constructs thereof, which may be used in any of the RNA editing or therapeutic methods described herein. It is contemplated that any of the features and parameters of the dRNAs or constructs described herein may be combined with each other as if all combinations were described individually.

[0120] In one aspect, the present application provides a dRNA for editing a target RNA, comprising a targeting RNA sequence that can hybridize to the target RNA to form a double-stranded RNA, wherein the double-stranded RNA comprises a bulge containing a non-target adenosine in the target RNA. In some embodiments, the double-stranded RNA comprises a bulge at each non-target adenosine in the target RNA. In some embodiments, the targeting RNA sequence is complementary to the target RNA, except that it lacks one or more nucleotides opposite the non-target adenosine in the target RNA. In some embodiments, the targeting RNA sequence lacks one or more uridine residues opposite one or more non-target adenosines in the sequence complementary to the target RNA. In some embodiments, the dRNA is a linear RNA. In some embodiments, the dRNA is a circular RNA. In some embodiments, the dRNA is a linear RNA that can form a circular RNA.

[0121] In one aspect, the present application provides a dRNA for editing a target RNA, the dRNA comprising a targeting RNA sequence capable of hybridizing to the target RNA, wherein the dRNA comprises a linker nucleic acid sequence adjacent to the end of the targeting RNA sequence, the linker nucleic acid sequence does not form substantially a secondary structure with any portion of the dRNA, and the dRNA is a circular RNA or a linear RNA capable of forming a circular RNA. In some embodiments, the length of the linker nucleic acid sequence is about 5 nt to about 500 nt, e.g., about 50 nt to about 200 nt. In some embodiments, the linker nucleic acid sequence comprises a polyadenosine (polyA), polyguanosine (polyG), or polycytosine (polyC) sequence. In some embodiments, at least 50% of the linker nucleic acid sequence comprises adenosine. In some embodiments, the linker nucleic acid sequence comprises a dinucleotide repeat sequence, e.g., (AT) n wherein n is an integer greater than or equal to 3. In some embodiments, the linker nucleic acid sequence comprises SEQ ID NO: 22. In some embodiments, the dRNA is a circular RNA. In some embodiments, the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence adjacent to the 3' end of the targeter RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeter RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence that replaces the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeter RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence that replaces the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeter RNA sequence.

[0122] In one aspect, the present application provides a dRNA for editing a target RNA, the dRNA comprising a targeting RNA sequence capable of hybridizing to the target RNA, wherein the double-stranded RNA comprises a bulge containing a non-target adenosine in the target RNA, the dRNA comprises a linker nucleic acid sequence adjacent to the end of the targeting RNA sequence, the linker nucleic acid sequence does not form substantially a secondary structure with any portion of the dRNA, and the dRNA is a circular RNA or a linear RNA capable of forming a circular RNA. In some embodiments, the dRNA is a circular RNA. In some embodiments, the targeting RNA sequence is complementary to the target RNA except that it lacks one or more nucleotides opposite the non-target adenosine in the target RNA. In some embodiments, the length of the linker nucleic acid sequence is about 5 nt to about 500 nt, e.g., about 50 nt to about 200 nt. In some embodiments, the linker nucleic acid sequence comprises a polyadenosine (polyA), polyguanosine (polyG), or polycytosine (polyC) sequence. In some embodiments, the linker nucleic acid sequence comprises a dinucleotide repeat sequence, e.g., (AT) n wherein n is an integer greater than or equal to 3. In some embodiments, the linker nucleic acid sequence comprises SEQ ID NO: 22. In some embodiments, the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence adjacent to the 3' end of the targeter RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeter RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence that replaces the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeter RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence that replaces the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeter RNA sequence.

[0123] In one aspect, the present application provides a construct comprising a nucleic acid sequence encoding any one of the dRNAs described herein. In certain embodiments, the construct is a viral vector or a plasmid. In some embodiments, the construct is an adeno-associated virus (AAV) vector. In some embodiments, the construct is a self-complementary AAV (scAAV) vector. In some embodiments, the construct encodes a single dRNA. In some embodiments, the construct encodes multiple (e.g., about 1, 2, 3, 4, 5, 10, 20, or more) dRNAs.

[0124] In one aspect, the present application provides a library comprising a plurality of dRNAs or a plurality of constructs described herein.

[0125] In one aspect, the present application provides a composition or host cell comprising a deaminase recruiting RNA or a construct described herein. In certain embodiments, the host cell is a prokaryotic or eukaryotic cell. In some embodiments, the host cell is a mammalian cell. In some embodiments, the host cell is a human cell.

[0126] dRNA The dRNA of the present application comprises a targeting RNA sequence that hybridizes to the target RNA. The targeting RNA sequence is fully complementary or substantially complementary to the target RNA, allowing the targeting RNA sequence to hybridize to the target RNA. In some embodiments, the targeting RNA sequence has 100% sequence complementarity with the target RNA. In some embodiments, the targeting RNA sequence has at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more complementarity with a continuous stretch of at least about 20, 40, 60, 80, 100, 150, 200, or more nucleotides in the target RNA. In some embodiments, the dsRNA formed by hybridization between the targeter RNA sequence and the target RNA has one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) non-Watson-Crick base pairs (i.e., mismatches).

[0127] In some embodiments, the dsRNA (also referred to herein as "double-stranded RNA") formed by hybridization between the targeter RNA sequence and the target RNA has one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) unpaired nucleotides. In some embodiments, the dsRNA formed by hybridization between the targeter RNA sequence and the target RNA has one or more unpaired non-target adenosines within the target RNA. In some embodiments, the dRNA lacks one or more nucleotides opposite one or more non-target adenosines in the target RNA. In some embodiments, the targeter RNA sequence in the dRNA lacks a nucleotide opposite each non-target adenosine in the target RNA. In some embodiments, the targeter RNA sequence in the dRNA lacks two or more (e.g., 2, 3, 4 or more) consecutive nucleotides opposite the region containing the non-target adenosines in the target RNA. In some embodiments, the targeting RNA sequence in the dRNA is complementary to the target RNA, except that one or more nucleotides opposite one or more non-target adenosines in the target RNA are missing.In some embodiments, the targeting RNA sequence in the dRNA is complementary to the target RNA, except that the nucleotide opposite each non-target adenosine in the target RNA is missing.

[0128] An unpaired nucleotide in a dsRNA causes a bulge. In some embodiments, a target RNA hybridizes to a dRNA to form a dsRNA containing a bulge that includes a non-target adenosine in the target RNA. The bulge of the dsRNA formed by hybridization of the dRNA and the target RNA includes the non-target adenosine in the target RNA. The bulge can be a mononucleotide bulge, i.e., one that includes an unpaired non-target adenosine, or a polynucleotide bulge, i.e., one that includes additional unpaired or mismatched nucleotides adjacent to the unpaired non-target adenosine. In some embodiments, the bulge can include more than one (e.g., 2, 3, 4, 5, or more) unpaired nucleotide in the target RNA, i.e., the bulge is composed of unpaired nucleotides immediately adjacent to the 5' and / or 3' side of the non-target adenosine residue. In some embodiments, the bulge can include one or more (e.g., 2, 3, 4, 5, or more) mismatched nucleotides immediately adjacent to the 5' and / or 3' side of the non-target adenosine residue. In some embodiments, the bulge comprises an unpaired non-target adenosine, one or more unpaired nucleotides adjacent to the 5' and / or 3' side of the non-target adenosine residue, and one or more mismatched nucleotides adjacent to the 5' and / or 3' side of the non-target adenosine residue, hi some embodiments, the length of the bulge is 1 nt, 2 nt, 3 nt, or more.

[0129] In some embodiments, the double-stranded RNA comprises two or more bulges, e.g., 2, 3, 4, 5, 6, or more bulges, each bulge comprising a non-target adenosine in the target RNA. In some embodiments, the double-stranded RNA comprises a bulge at each non-target adenosine in the target RNA.

[0130] In some embodiments, the dsRNA formed by hybridization between dRNA and target RNA does not contain mismatch.In some embodiments, the dsRNA formed by hybridization between dRNA and target RNA contains one or more mismatches, for example, 1, 2, 3, 4, 5, 6, 7 or more mismatches (for example, the same type or different types of mismatches).In some embodiments, the dsRNA formed by hybridization between dRNA and target RNA contains one or more types of mismatches, for example, 1, 2, 3, 4, 5, 6, 7 types of mismatches selected from the group consisting of GA, CA, UC, AA, GG, CC and UU.

[0131] In some embodiments, the mismatch is located upstream (5') or downstream (3') of the target adenosine, which can enhance editing efficiency of the target adenosine in the target RNA. In some embodiments, the double-stranded RNA has additional mismatches upstream and / or downstream of the target adenosine.

[0132] In some embodiments, the targeting RNA sequence further comprises one or more guanosines, e.g., 1, 2, 3, 4, 5, 6, or more Gs, each directly opposite a non-target adenosine in the target RNA. In some embodiments, the targeting RNA sequence comprises two or more consecutive mismatched nucleotides (e.g., 2, 3, 4, 5, or more mismatched nucleosides) opposite a non-target adenosine in the target RNA.

[0133] In some embodiments, the dRNA comprises a targeting RNA sequence that comprises a G opposite one or more non-target adenosines in the target RNA and lacks the nucleotide opposite one or more non-target adenosines in the target RNA.The double-stranded RNA can have one or more bulges that include one or more non-target adenosines, and the dRNA can comprise a G opposite other non-target adenosines in the target RNA.

[0134] In some embodiments, the target RNA contains about 20 or fewer non-target A's, such as about 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 or fewer non-target A's. Deletion of U's and / or G's opposite the non-target A's, along with adjacent mismatched or unpaired nucleotides in the dRNA, may reduce off-target editing effects by ADARs.

[0135] In some embodiments, the dRNA comprises one or more linker nucleic acid sequences (also referred to herein as "flanking linker sequences") adjacent to the ends of the target RNA sequence, and the linker nucleic acid sequences do not substantially form secondary structures with any part of the dRNA. The inventors of the present application have discovered that the inclusion of flanking linker sequences can improve the editing efficiency of the target adenosine in the target RNA. Without being bound by any theory, it is hypothesized that the linker nucleic acid sequence can increase the flexibility of the circular dRNA, thereby facilitating the hybridization of the target RNA sequence to the target RNA.

[0136] In some embodiments, the dRNA comprises a single linker nucleic acid sequence. In some embodiments, the dRNA comprises a linker nucleic acid sequence at the 5' end of the targeting RNA sequence. In some embodiments, the dRNA comprises a linker nucleic acid sequence at the 3' end of the targeting RNA sequence. In some embodiments, the dRNA comprises a first linker nucleic acid sequence at the 5' end of the targeting sequence and a second linker nucleic acid sequence at the 3' end of the targeting RNA sequence. In some embodiments, the dRNA is a circular RNA comprising a linker nucleic acid sequence that directly or indirectly connects the 5' end and 3' end of the targeting RNA sequence. The first linker nucleic acid sequence and the second linker nucleic acid sequence may be the same sequence or different sequences.

[0137] In some embodiments, the length of the linker nucleic acid sequence (including the first linker nucleic acid sequence and the second linker nucleic acid sequence) is at least about any of 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nt. In some embodiments, the length of the linker nucleic acid sequence (including the first linker nucleic acid sequence and the second linker nucleic acid sequence) is no more than any of about 500, 450, 400, 350, 300, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, or 5 nt. In some embodiments, the length of the linker nucleic acid sequence (including the first linker nucleic acid sequence and the second linker nucleic acid sequence) is about 5 to 10, 10 to 20, 20 to 50, 5 to 50, 10 to 100, 5 to 50, 50 to 100, 100 to 200, 200 to 300, 300 to 400, 400 to 500, 5 to 100, 5 to 200, 5 to 300, 5 to 400, 5 to 500, 50 to 200, 50 to 300, 50 to 400, or 50 to 500 nt. In some embodiments, the linker nucleic acid sequence (including the first linker nucleic acid sequence and the second linker nucleic acid sequence) is about 50 nt in length. In some embodiments, the first linker nucleic acid sequence and the second linker nucleic acid sequence are the same length. In some embodiments, the first linker nucleic acid sequence and the second linker nucleic acid sequence are different lengths.

[0138] The linker nucleic acid sequence (including the first linker nucleic acid sequence and the second linker nucleic acid sequence) does not substantially form a secondary structure with any portion of the dRNA. For example, computational tools for predicting RNA secondary structure, including RNA folding, are known in the art. In some embodiments, the linker nucleic acid sequence does not form a duplex region with a portion of the target RNA sequence that is longer than about any one of 3, 4, 5, 6, or more base pairs in length. In some embodiments, the linker nucleic acid sequence does not contain a complementary region that is longer than 3, 4, 5, or 6 nucleotides in length. In some embodiments, the first linker nucleic acid sequence does not have a complementary region that is longer than 3, 4, 5, or 6 nucleotides in length with the second linker nucleic acid sequence.

[0139] The linker nucleic acid sequence (including the first linker nucleic acid sequence and the second linker nucleic acid sequence) may be a mononucleotide or dinucleotide repeat sequence, or a random sequence. In some embodiments, the linker nucleic acid sequence comprises a polyadenosine (polyA), polyguanosine (polyG), or polycytosine (polyC) sequence. In some embodiments, at least 50% of the linker nucleic acid sequence comprises adenosine. In some embodiments, the linker nucleic acid sequence comprises a dinucleotide repeat sequence, for example, an AT or TA repeat sequence. In some embodiments, the linker nucleic acid sequence comprises an (AT) n wherein n is an integer greater than or equal to 3. In some embodiments, the linker nucleic acid sequence comprises SEQ ID NO:22.

[0140] In some embodiments, a linker nucleic acid sequence is used as a linker sequence connecting the 5' and 3' ends of the targeting RNA sequence of the circular dRNA.

[0141] ADARs, such as human ADAR enzymes, edit double-stranded RNA (dsRNA) structures with different specificities depending on many factors. One important factor is the degree of complementarity between the two strands that make up the dsRNA sequence. Perfect complementarity between the dRNA and the target RNA typically allows the catalytic domain of the ADAR to indiscriminately deaminate adenosines. The specificity and efficiency of ADARs can be modified by introducing mismatches into the dsRNA region. For example, an AC mismatch is preferably recommended to increase the specificity and efficiency of deamination of the edited adenosines. Perfect complementarity between the dRNA and the target RNA is not necessarily required for dsRNA formation, as long as there is sufficient complementarity between the dRNA and the target RNA for dsRNA hybridization and dsRNA generation. In some embodiments, when optimally aligned, the dRNA sequence or its single-stranded RNA region has at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence complementarity with the target RNA. Optimal alignment can be determined using any suitable algorithm for aligning sequences, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wimsch algorithm, and algorithms based on the Burrows-Wheeler transformation (e.g., Burrows Wheeler Aligner).

[0142] The nucleotides adjacent to the target adenosine also affect the specificity and efficiency of deamination. For example, in terms of the specificity and efficiency of adenosine deamination, the 5'-most neighbor of the target adenosine edited in the target RNA sequence has a preference of U>C≒A>G, and the 3'-most neighbor of the target adenosine edited in the target RNA sequence has a preference of G>C>A≒U. In some embodiments, when the target adenosine in the target RNA can be a three-base motif selected from the group consisting of UAG, UAC, UAA, UAU, CAG, CAC, CAA, CAU, AAG, AAC, AAA, AAU, GAG, GAC, GAA, and GAU, the specificity and efficiency of adenosine deamination are higher than adenosines of other three-base motifs. In some embodiments, when the target adenosine to be edited is in the three-base motif UAG, UAC, UAA, UAU, CAG, CAC, AAG, AAC, or AAA, the efficiency of adenosine deamination is higher than that of adenosines in other motifs.For the same three-base motif, different dRNA designs may also lead to different deamination efficiencies.Taking the three-base motif UAG as an example, in some embodiments, when the dRNA contains a cytidine (C) directly opposite the target adenosine to be edited, an adenosine (A) directly opposite a uridine, or a cytidine (C), guanosine (G), or uridine (U) directly opposite a guanosine, the efficiency of target adenosine deamination is higher than that when other dRNA sequences are used. In some embodiments, when the dRNA contains ACC, ACG, or ACU opposite UAG in the target RNA, the editing efficiency of the A in UAG in the target RNA can reach about 25% to 90% (e.g., about 25% to 80%, 25% to 70%, 25% to 60%, 25% to 50%, 25% to 40%, or 25% to 30%).

[0143] In addition to the target adenosine, the target RNA may contain one or more adenosines (referred to herein as "non-target A") that are undesirable for editing. It is preferable to reduce the editing efficiency of these adenosines as much as possible. The inventors have found that deleting the U opposite the non-target A results in the formation of a bulge with the unpaired non-target A in the duplex between the dRNA and the target RNA, significantly reducing off-target editing of the non-target A. The dRNA may further contain one or more unpaired nucleotides and / or one or more mismatched nucleotides directly adjacent to the 5' or 3' side of the non-target adenosine. As used herein, the term "unpaired" means that a nucleotide in the first strand of a double-stranded nucleic acid does not base pair with any nucleotide in the second strand of the double-stranded nucleic acid. In some embodiments, when a guanosine is located directly opposite an adenosine in the target RNA, the deamination efficiency is significantly reduced. Thus, to reduce off-target deamination, the dRNA can be designed to delete one or more nucleotides (e.g., U) opposite the first non-target adenosine and / or to have a nucleotide directly opposite the second non-target adenosine that is edited in the target RNA.

[0144] The desired level of specificity and efficiency in editing a target RNA sequence varies depending on the application. Following the instructions in this patent application, those skilled in the art can design a dRNA with a sequence complementary or substantially complementary to the target RNA sequence as needed, and achieve the desired results through trial and error. As used herein, the term "mismatch" refers to opposite nucleotides in a double-stranded RNA (dsRNA) that do not form a perfect base pair according to the Watson-Crick base-pairing rules. Mismatched base pairs include, for example, GA, CA, UC, AA, GG, CC, and UU base pairs. Taking an AC match as an example, if a single target adenosine residue is to be edited in the target RNA, the dRNA is designed to contain a C opposite the edited A, generating an AC mismatch in the dsRNA formed by hybridization between the target RNA and the dRNA.

[0145] The targeting RNA sequence of the dRNA is single-stranded. The dRNA can be completely single-stranded or can have one or more (e.g., one, two, three, or more) double-stranded regions and / or one or more stem-loop regions.

[0146] The dRNA described herein comprises the targeting RNA sequence that is at least partially complementary to targeting RNA.In certain embodiments, the length of the targeting RNA sequence in dRNA comprises at least about 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240 or 250 nucleotides (nt). In certain embodiments, the length of the targeting RNA sequence in the dRNA comprises no more than about any of 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 nucleotides. In certain embodiments, the length of the target RNA sequence in the dRNA is about 40 to 260, 45 to 250, 50 to 240, 60 to 230, 65 to 220, 70 to 220, 70 to 210, 70 to 200, 70 to 190, 70 to 180, 70 to 170, 70 to 160, 70 to 150, 70 to 140, 70 to 130, 70 to 120, 70 to 110, 70 to 150, 70 to 160, 70 to 170, 70 to 180, 70 to 190, 70 to 210, 70 to 220, 70 to 230, 70 to 240, 70 to 250, 70 to 26 ...70, 70 to 280, 70 to 290, 70 to 300, 70 to 310, 70 to 320, 70 to 330, 70 to 340, 70 to 350, 70 to 360, 70 to 370, 70 to 380, 70 to 390, 70 to 400, 70 to 410, 70 to 420, 70 to 430, 70 to 440, 70 to 450, 70 to 460, 70 to 47 The targeting RNA sequence in the dRNA has a length of any of the following: -100, 70-90, 70-80, 75-200, 80-190, 85-180, 90-170, 95-160, 100-200, 100-150, 100-175, 110-200, 110-160, 110-175, 110-150, 140-160, 105-140, or 105-155 nucleotides. In some embodiments, the length of the targeting RNA sequence in the dRNA is about 100-200 nt. In some embodiments, the length of the targeting RNA sequence in the dRNA is about 70 nt (e.g., 71 nt). In some embodiments, the length of the targeting RNA sequence in the dRNA is about 120 nt (e.g., 121 nt). In some embodiments, the length of the targeting RNA sequence in the dRNA is about 150 nt (e.g., 151 nt). In some embodiments, the length of the targeting RNA sequence in the dRNA is about 170 nt (e.g., 171 nt). In some embodiments, the length of the targeting RNA sequence in the dRNA is about 200 nt (e.g., 201 nt). In some embodiments, the length of the targeting RNA sequence in the dRNA is about 220 nt (e.g., 221 nt).

[0147] In some embodiments, the targeting RNA sequence comprises a cytidine, adenosine, or uridine directly opposite the target adenosine residue of the target RNA. In some embodiments, the targeting RNA sequence comprises a cytidine mismatch directly opposite the target adenosine residue of the target RNA. In some embodiments, the cytidine mismatch is located at least 5 nucleotides, for example, at least 10, 15, 20, 25, 30, or more nucleotides, from the 5' end of the targeting RNA sequence. In some embodiments, the cytidine mismatch is located at least 20 nucleotides, for example, at least 25, 30, 35, or more nucleotides, from the 3' end of the complementary RNA sequence. In some embodiments, the cytidine mismatch is not located within 20 (for example, 15, 10, 5, or less) nucleotides from the 3' end of the targeting RNA sequence. In some embodiments, the cytidine mismatch is located at least 20 nucleotides (e.g., at least 25, 30, 35, or more nucleotides) from the 3' end and at least 5 nucleotides (e.g., at least 10, 15, 20, 25, 30, or more nucleotides) from the 5' end of the targeting RNA sequence. In some embodiments, the cytidine mismatch is located in the center of the targeting RNA sequence. In some embodiments, the cytidine mismatch is located within 20 nucleotides (e.g., 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide) from the center of the targeting sequence of the dRNA.

[0148] In certain embodiments, the 5'-closest neighbor of the target adenosine residue is a nucleotide selected from U, C, A, and G, with a preference of U>C≈A>G, and the 3'-closest neighbor of the target adenosine residue is a nucleotide selected from G, C, A, and U, with a preference of G>C>A≈U. In some embodiments, the 5'-closest neighbor of the target adenosine residue is C or A. In some embodiments, the 3'-closest neighbor of the target adenosine residue is G. In some embodiments, the 3'-closest neighbor of the target adenosine residue is C.

[0149] In some embodiments, the target adenosine residue is located in a three-base motif in the target RNA selected from the group consisting of UAG, UAC, UAA, UAU, CAG, CAC, CAA, CAU, AAG, AAC, AAA, AAU, GAG, GAC, GAA, and GAU. In some embodiments, the three-base motif is UAG, and the dRNA includes an A directly opposite the U in the three-base motif, a C directly opposite the target A, and a C, G, or U directly opposite the G in the three-base motif. In certain embodiments, the three-base motif is UAG in the target RNA, and the dRNA includes ACC, ACG, or ACU opposite UAG in the target RNA. In certain embodiments, the three-base motif is UAG in the target RNA, and the dRNA includes ACC opposite UAG in the target RNA.

[0150] In some embodiments, dRNA can further comprise, in addition to targeting RNA sequence, a region for stabilizing dRNA, for example, one or more double-stranded regions and / or stem-loop regions.In some embodiments, the double-stranded region or stem-loop region of dRNA can comprise one of about 200, 150, 100, 50, 40, 30, 20, 10 or less base pairs.In some embodiments, dRNA does not comprise stem-loop or double-stranded region.In some embodiments, dRNA comprises ADAR recruitment domain.In some embodiments, dRNA does not comprise ADAR recruitment domain.

[0151] dRNA can comprise one or more modifications.In some embodiments, dRNA has one or more modified nucleotides, including nucleobase modification and / or backbone modification.Exemplary modifications of RNA include, but are not limited to, phosphorothioate backbone modification, 2'-substitution in ribose (for example, 2'-O-methyl and 2'-fluoro substitution), LNA, and L-RNA.

[0152] In some embodiments, the dRNA does not contain chemical modifications. In some embodiments, the dRNA does not contain chemically modified nucleotides, such as 2'-O-methyl nucleotides or nucleotides with phosphorothioate linkages. In some embodiments, the dRNA contains 2'-O-methylation and phosphorothioate linkage modifications only in the first three and last three residues. In some embodiments, the dRNA is not an antisense oligonucleotide (ASO).

[0153] The dRNA may further comprise one or more additional expression elements that facilitate expression and / or circularization of the dRNA.

[0154] In some embodiments, the dRNA further comprises a 3' exon sequence recognizable by a 3' catalytic group I intron fragment adjacent to the 5' end of the targeting RNA sequence, and a 5' exon sequence recognizable by a 5' catalytic group I intron fragment adjacent to the 3' end of the targeting RNA sequence. In some embodiments, the group I catalytic intron of the T4 phage Td gene is bisected to preserve structural elements important for ribozyme folding. Exon fragment 2 is then ligated upstream of exon fragment 1, and the targeting RNA sequence (which may include linker nucleic acid sequences adjacent to the 5' and / or 3' ends) is inserted between the exon-exon junction.

[0155] In some embodiments, the dRNA is a linear RNA capable of forming a circular RNA. In some embodiments, circularization is performed using the Tornado expression system ("Twister-optimized RNA for durable overexpression"), as described, for example, in Litke, JL & Jaffrey, SR. Highly efficient expression of circular RNA aptamers in cells using autocatalytic transcripts. Nat Biotechnol 37, 667-675 (2019), the entire contents of which are incorporated by reference. Briefly, the transcript expressed by Tornado contains a target RNA flanked by twister ribozymes. A twister ribozyme is any catalytic RNA sequence capable of self-cleavage. The ribozyme undergoes rapid autocatalytic cleavage, leaving ends joined by an RNA ligase.

[0156] In some embodiments, the dRNA comprises a targeting RNA sequence flanked (directly or indirectly) by a 5' and / or 3' linking sequence. In some embodiments, the dRNA comprises a 3' linking sequence. In some embodiments, the dRNA comprises a 5' linking sequence. In some embodiments, the dRNA comprises a 3' linking sequence and a 5' linking sequence. In some embodiments, the 3' linking sequence and the 5' linking sequence are at least partially complementary to each other. In some embodiments, the 3' linking sequence and the 5' linking sequence are at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% complementary to each other. In some embodiments, the 3' linking sequence and the 5' linking sequence are fully complementary to each other. In some embodiments, the 5' and / or 3' linking sequences are further flanked by 5'-twisted ribozymes and / or 3'-twisted ribozymes.

[0157] In some embodiments, the dRNA is a linear RNA capable of forming a circular RNA, wherein the dRNA comprises, from 5' to 3', a 5' linking sequence, a first linker nucleic acid sequence, a targeting RNA sequence, a second linker nucleic acid sequence, and a 3' linking sequence. In some embodiments, the dRNA is a linear RNA capable of forming a circular RNA, wherein the dRNA comprises, from 5' to 3', a 5' linking sequence, a linker nucleic acid sequence, a targeting RNA sequence, and a 3' linking sequence. In some embodiments, the dRNA is a linear RNA capable of forming a circular RNA, wherein the dRNA comprises, from 5' to 3', a 5' linking sequence, a targeting RNA sequence, a linker nucleic acid sequence, and a 3' linking sequence. In some embodiments, the dRNA is a linear RNA capable of forming a circular RNA, wherein the dRNA comprises, from 5' to 3', a 5' linking sequence, a targeting RNA sequence, and a 3' linking sequence. In some embodiments, the 3' linking sequence comprises SEQ ID NO: 11. In some embodiments, the 5' linking sequence comprises SEQ ID NO: 12.

[0158] In some embodiments, the dRNA is a circular RNA comprising a linking sequence that directly or indirectly links the 5' and 3' ends of the targeting RNA sequence. In some embodiments, the linking sequence comprises a 5' linking sequence and a 3' linking sequence that are ligated together by a ligase such as T4 RNA ligase (e.g., Rnl1 or Rnl2). In some embodiments, the linking sequence comprises SEQ ID NO: 10.

[0159] In some embodiments, the dRNA is a circular RNA comprising, in a clockwise direction, a linking sequence, a first linker nucleic acid sequence, a targeting RNA sequence, and a second linker nucleic acid sequence, wherein the linking sequence directly links the 5' end of the first linker nucleic acid sequence to the 3' end of the second linker nucleic acid sequence. In some embodiments, the dRNA is a circular RNA comprising, in a clockwise direction, a linking sequence, a linker nucleic acid sequence, and a targeting RNA sequence, wherein the linking sequence directly links the 5' end of the linker nucleic acid sequence to the 3' end of the targeting RNA sequence. In some embodiments, the dRNA is a circular RNA comprising, in a clockwise direction, a linking sequence, a targeting RNA sequence, and a linker nucleic acid sequence, wherein the linking sequence directly links the 5' end of the targeting RNA sequence to the 3' end of the linker nucleic acid ... a linking sequence and a targeting RNA sequence, wherein the linking sequence directly links the 5' end of the targeting RNA sequence to the 3' end of the targeting RNA sequence.

[0160] In some embodiments, the 3' linking sequence and the 5' linking sequence are independently at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleosides, at least about 40 nucleotides, at least about 45 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, or at least about 100 nucleotides in length. In some embodiments, the 3' linking sequence and the 5' linking sequence are independently about 20-30 nucleotides, about 30-40 nucleotides, about 40-50 nucleotides, about 50-60 nucleotides, about 60-70 nucleotides, about 70-80 nucleotides, about 80-90 nucleotides, about 90-100 nucleotides, about 100-125 nucleotides, about 125-150 nucleotides, about 20-50 nucleotides, about 50-100 nucleotides, or about 100-150 nucleotides in length.

[0161] In some embodiments, the dRNA is circularized by an RNA ligase. Non-limiting examples of RNA ligases include RtcB, T4 RNA ligase 1 (Rnl1), T4 RNA ligase 2 (Rnl2), Rnl3, and Tr11. In some embodiments, the RNA ligase is endogenously expressed in the host cell. In some embodiments, the RNA ligase is RNA ligase RtcB. In some embodiments, the method further comprises introducing an RNA ligase (e.g., RtcB) into the host cell.

[0162] In some embodiments, the dRNA is circularized before being introduced into the host cell. In some embodiments, the dRNA is chemically synthesized. In some embodiments, the dRNA is circularized by in vitro enzymatic ligation (e.g., using RNA or DNA ligase) or chemical ligation (e.g., using cyanogen bromide or a similar condensing agent).

[0163] The dRNA described herein does not include tracrRNA, crRNA, or gRNA used in CRISPR / Cas systems. In some embodiments, the dRNA does not include an ADAR recruitment domain. An "ADAR recruitment domain" can be a nucleotide sequence or structure that binds to an ADAR with high affinity, or a nucleotide sequence that binds to a binding partner fused to an ADAR in an engineered ADAR construct. Exemplary ADAR recruitment regions include, but are not limited to, GluR-2, GluR-B(R / G), GluR-B(Q / R), GluR-6(R / G), 5HT2C, and FlnA(Q / R) domains; see, for example, Wahlstedt, Helene, and Marie, "Site-selective versus promiscuous A-to-I editing," Wiley Interdisciplinary Reviews: RNA 2.6 (2011):761-771, which is incorporated herein by reference in its entirety. In some embodiments, the dRNA does not include a double-stranded portion. In some embodiments, the dRNA does not contain a hairpin, such as an MS2 stem loop. In some embodiments, the dRNA is single-stranded.

[0164] In some embodiments, the dRNA comprises a snoRNA sequence linked to the 5' end of the targeting RNA sequence ("5' snoRNA sequence"). In some embodiments, the dRNA comprises a snoRNA sequence linked to the 3' end of the targeting RNA sequence ("3' snoRNA sequence"). In some embodiments, the dRNA comprises a snoRNA sequence linked to the 5' end of the targeting RNA sequence ("5' snoRNA sequence") and a snoRNA sequence linked to the 3' end of the targeting RNA sequence ("3' snoRNA sequence"). In some embodiments, the snoRNA sequence is at least about 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides in length. In some embodiments, the snoRNA sequence is about 50-75, 75-100, 100-125, 125-150, 150-175, 175-200, 50-100, 100-150, 150-200, 125-175, or 100-200 nucleotides in length. In some embodiments the snoRNA sequence is a C / D Box snoRNA sequence. In some embodiments the snoRNA sequence is an H / ACA Box snoRNA sequence. In some embodiments the snoRNA sequence is a composite C / D Box and H / ACA Box snoRNA sequence. In some embodiments the snoRNA sequence is an orphan snoRNA sequence.

[0165] Small nucleolar RNAs (snoRNAs) are small, non-coding RNA molecules known to guide the chemical modification of other RNAs, such as ribosomal RNAs, transfer RNAs, and small nuclear RNAs. Depending on specific secondary structure features, snoRNAs fall into two major categories: Box C / D and Box H / ACA. Both structural features of snoRNAs enable them to bind to corresponding RNA-binding proteins (RBPs) and accessory proteins to form functional small nucleolar ribonucleoprotein (snoRNP) complexes. Box C / D snoRNAs are thought to be involved in methylation, while H / ACA box snoRNAs are thought to be involved in pseudouridylation. Other snoRNA families include, for example, complex H / ACA and C / D box snoRNAs, as well as orphan snoRNAs. The snoRNA sequences described herein may include naturally occurring snoRNAs, portions thereof, or variants thereof.

[0166] construct The present application provides constructs encoding dRNA and / or ADAR. In some embodiments, a construct (e.g., a vector such as a viral vector) is provided that includes a nucleotide sequence encoding a dRNA. In some embodiments, a construct (e.g., a vector such as a viral vector) is provided that includes a nucleotide sequence encoding an ADAR. In some embodiments, a construct is provided that includes a first nucleotide sequence encoding a dRNA and a second nucleotide sequence encoding an ADAR. In some embodiments, the first nucleotide sequence and the second nucleotide sequence are operably linked to the same promoter. In some embodiments, the first nucleotide sequence and the second nucleotide sequence are operably linked to different promoters. In some embodiments, the promoters are inducible. In some embodiments, the construct does not encode an ADAR. In some embodiments, the vector further includes a nucleic acid sequence encoding an ADAR3 inhibitor (e.g., an ADAR3 shRNA or siRNA) and / or an interferon stimulator (e.g., IFN-α).

[0167] As used herein, the term "construct" refers to a DNA or RNA molecule that contains a coding nucleic acid sequence that can be transcribed into RNA or expressed into a protein. In some embodiments, the construct contains one or more regulatory elements operably linked to the nucleic acid sequence that encodes the RNA or protein. When the construct is introduced into a host cell, the coding nucleic acid sequence in the construct can be transcribed or expressed under appropriate conditions.

[0168] The constructs described herein can include a promoter operably linked to a nucleic acid sequence encoding a dRNA so as to control the transcription or expression of the coding nucleotide sequence. The promoter can be positioned 5' (upstream) of the coding nucleotide sequence under its control. The distance between the promoter and the coding sequence can be approximately the same as the distance between the promoter and the gene it controls in the gene from which it is derived. As is known in the art, variations in this distance can be accommodated without loss of promoter function. In some embodiments, the constructs include a 5' UTR and / or a 3' UTR that regulate the transcription or expression of the coding nucleotide sequence. In some embodiments, the promoter drives the expression of two or more dRNAs.

[0169] The promoter can be a polymerase II promoter ("Pol II promoter") or a polymerase III promoter ("Pol III promoter"). The dRNA is linear RNA. In some embodiments, the construct comprises a Pol II promoter operably linked to a nucleic acid sequence encoding the dRNA. Non-limiting examples of Pol II promoters include CMV, SV40, EF-1a, CAG, and RSV. In some embodiments, the Pol II promoter is a CMV promoter. In some embodiments, the CMV promoter comprises the nucleic acid sequence of SEQ ID NO:5.

[0170] In some embodiments, the dRNA is a circular RNA or a linear RNA capable of forming a circular RNA, and the construct comprises a Pol III promoter. In some embodiments, the promoter is a U6 promoter. In some embodiments, the U6 promoter comprises the nucleic acid sequence of SEQ ID NO: 6.

[0171] In some embodiments, the construct is a vector encoding any one of the dRNAs disclosed in this application. The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it is linked. Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that contain one or more free ends but no free ends (e.g., circular); nucleic acid molecules comprising DNA, RNA, or both; and other types of polynucleotides known in the art. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell after introduction into the host cell, thereby replicating along with the host genome. Furthermore, certain vectors are capable of directing the transcription or expression of coding nucleotide sequences to which they are operably linked. Such vectors are referred to herein as "expression vectors."

[0172] In some embodiments, the construct is a viral vector. In some embodiments, the construct is a lentiviral vector. In some embodiments, the vector is a recombinant adeno-associated virus (rAAV) vector. The use of any AAV serotype is considered within the scope of this disclosure. In some embodiments, the rAAV vector is a vector derived from an AAV serotype, including, but not limited to, AAV ITRs from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, caprine AAV, bovine AAV, or murine AAV capsid serotypes. In some embodiments, the construct is flanked by one or more AAV inverted terminal repeat (ITR) sequences. In some embodiments, the construct is flanked by two AAV ITRs. In some embodiments, the AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, caprine AAV, bovine AAV, or murine AAV serotype ITRs. In some embodiments, the AAV ITRs are AAV2 ITRs.

[0173] In some embodiments, the vector further comprises a stuffer nucleic acid. In some embodiments, the stuffer nucleic acid is located upstream or downstream of the nucleic acid encoding the dRNA. In some embodiments, the vector is a self-complementary rAAV vector. In some embodiments, the vector comprises a first nucleic acid sequence encoding the dRNA and a second nucleic acid sequence encoding a sequence complementary to the dRNA, wherein the first nucleic acid sequence is capable of intrastrand base pairing with the second nucleic acid sequence along most or all of its length. In some embodiments, the first and second nucleic acid sequences are linked by a mutated AAV ITR, which comprises a deletion of the D region and a mutation in the terminal resolution sequence. In some embodiments, the vector is encapsulated into rAAV particles. In some embodiments, the AAV viral particle comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV2 V708K, AAV2-HBKO, AAVDJ8, AAVPHP.B, AAVPHP.eB, AAVBR1, AAVHSC15, AAVHSC17, caprine AAV, AAV1 / AAV2 chimera, bovine AAV, murine AAV, or rAAV2 / HBoV1 serotype capsid.

[0174] In some embodiments, the construct further comprises a 3' twist ribozyme sequence linked to the 3' end of the nucleic acid encoding the dRNA. In some embodiments, the construct further comprises a 5' twist ribozyme sequence linked to the 5' end of the nucleic acid sequence encoding the dRNA. In some embodiments, the construct further comprises a 3' twist ribozyme sequence linked to the 3' end of the nucleic acid sequence encoding the dRNA and a 5' twist ribozyme sequence linked to the 5' end of the nucleic acid sequence encoding the dRNA. In some embodiments, the 3' twist ribozyme sequence is twister P3 U2A and the 5' twist ribozyme sequence is twister P1. In some embodiments, the 5' twist ribozyme sequence is twister P3 U2A and the 3' twist ribozyme sequence is twister P1. In some embodiments, the dRNA undergoes autocatalytic cleavage. In some embodiments, the catalyzed dRNA product comprises a 5'-hydroxyl group and a 2',3'-cyclic phosphate at the 3' end.

[0175] Preparation method The dRNA described herein can be prepared using any method known in the art, including chemical synthesis and in vitro transcription. Circular dRNA can be prepared by chemical ligation of linear RNA, enzymatic ligation, or ribozyme autocatalysis. In some embodiments, circular dRNA is prepared by circularizing linear RNA in vitro.

[0176] In some embodiments, the present application provides a linear RNA capable of forming the circular dRNA of any of the above embodiments. In some embodiments, the linear RNA can be circularized by a chemical cyclization method using cyanogen bromide or a similar condensing agent. In some embodiments, the linear RNA can be circularized by the autocatalytic action of a group I intron containing a 5' catalytic group I intron fragment and a 3' catalytic group I intron fragment. In some embodiments, the linear RNA can be circularized by a ligase. In some embodiments, the linear RNA can be circularized by T4 RNA ligase. In some embodiments, the linear RNA can be circularized by a DNA ligase. Suitable ligases include, but are not limited to, T4 DNA ligase (T4 Dnl), T4 RNA ligase 1 (T4 Rnl1), and T4 RNA ligase 2 (T4 Rnl2). The circular dRNA can be purified using methods known in the art, such as gel purification or high-performance liquid chromatography (HPLC).

[0177] In some embodiments, linear RNA can be chemically circularized to provide circular dRNA. In some chemical methods, the 5' and 3' ends of a nucleic acid (such as a linear or circular polyribonucleotide) contain chemically reactive groups that, when brought into close proximity, can form a new covalent bond between the 5' and 3' ends of the molecule. The 5' end can contain an NHS ester reactive group, and the 3' end can contain a 3' amino-terminal nucleotide, such that in organic solvents, the 3' amino-terminal nucleotide at the 3' end of the linear RNA molecule undergoes nucleophilic attack on the 5'-NHS ester moiety, forming a new 5'- / 3'-amide bond.

[0178] In some embodiments, the circular dRNA can be obtained by ribozyme autocatalytic circularization of a linear RNA. In some embodiments, the linear RNA is circularized in vitro. In some embodiments, the ribozyme autocatalytic circularization includes (a) subjecting the linear RNA to conditions that activate the autocatalysis of a group I intron (or 5' and 3' catalytic group I intron fragments thereof) to provide a circularized RNA product; and (b) isolating the circularized RNA product to provide a circular dRNA.

[0179] In some embodiments, the method includes first cloning a sequence encoding the linear RNA into a plasmid vector and then obtaining the linear RNA by linearizing the recombinant plasmid. In some embodiments, the recombinant plasmid is linearized by restriction enzyme digestion. In some embodiments, the recombinant plasmid is linearized by PCR amplification. In some embodiments, the method further includes in vitro transcription using a linearized plasmid template. In some embodiments, the in vitro transcription is driven by a T7 promoter. In some embodiments, the method further includes purifying the linear RNA transcript. In some embodiments, the linear RNA is purified by gel purification.

[0180] In some embodiments, the present application provides a method for circularizing a linear RNA (e.g., purified linear RNA) by ribozyme autocatalysis of a group I intron. During the splicing process, the 3' hydroxyl group of a guanosine nucleotide undergoes transesterification at the 5' splice site. Half of the 5' intron is excised, and the free hydroxyl group at the end of the intermediate undergoes a second transesterification at the 3' splice site, resulting in cyclization of the intermediate region and excision of the 3' intron. In some embodiments, the conditions for activating the autocatalysis of a group I intron or 5' and 3' catalytic group I intron fragments include GTP and Mg. 2+ In some embodiments, GTP and Mg 2+In some embodiments, the method further comprises treating the linear RNA transcript with RNase R to digest the linear RNA transcript. In some embodiments, the method further comprises isolating the circular dRNA. In some embodiments, the step of isolating the circular dRNA comprises gel-purifying the circular dRNA.

[0181] In some embodiments, circular dRNA can be obtained by circularizing linear RNA using a ligase such as RNA ligase. In some embodiments, the linear RNA is circularized in vitro. In some embodiments, the linear RNA can be circularized using T4 RNA ligase. In some embodiments, the linear RNA includes a 5' linking sequence located at the 5' end of the targeting RNA sequence and a 3' linking sequence located at the 3' end of the targeting RNA sequence, and the 5' linking sequence and the 3' linking sequence are passed through the RNA ligase to join together. In a non-limiting example, the linear RNA can be circularized using a ligase such as T4 DNA ligase (T4 Dnl), T4 RNA ligase 1 (T4 Rnl1), and T4 RNA ligase 2 (T4 Rnl2). The linear RNA can be circularized in the presence or absence of a single-stranded nucleic acid linker (such as splint DNA).

[0182] In some embodiments, DNA or RNA ligase can be used to enzymatically ligate a 5'-phosphorylated nucleic acid molecule (e.g., linear RNA) to the 3'-hydroxyl group of a nucleic acid (e.g., linear nucleic acid) to form a new phosphodiester bond. In an example reaction, linear circular RNA was incubated with 1-10 units of T4 RNA ligase (New England Biolabs, Ipswich, MA) at 37°C for 1 hour according to the manufacturer's protocol. The ligation reaction occurs in the presence of a linear nucleic acid capable of base-pairing with juxtaposed 5' and 3' regions to facilitate the enzymatic ligation reaction. In some embodiments, the ligation is splint ligation. For example, a splint ligase such as SPLINTR® ligase can be used for splint ligation. In splint ligation, a single-stranded polynucleotide (splint), such as a single-stranded RNA, can be designed to hybridize to both ends of a linear polyribonucleotide, thereby juxtaposing the two ends when hybridized to the single-stranded splint. Thus, splint ligases can catalyze the ligation of two ends of juxtaposed linear polyribonucleotides to generate circular polyribonucleotides. In some embodiments, DNA or RNA ligases can be used to synthesize circular dRNAs. As a non-limiting example, the ligase can be a circular ligase or a circular ligase.

[0183] IV. Treatment method The RNA editing methods and compositions described herein can be used to treat or prevent diseases or conditions in an individual, including, but not limited to, inherited genetic diseases and drug resistance.

[0184] In some embodiments, provided are methods of editing a target RNA in a cell of an individual (e.g., a human individual) ex vivo, comprising editing the target RNA using any one of the RNA editing methods described herein.

[0185] In some embodiments, methods are provided for treating or preventing a disease or condition in an individual (e.g., a human individual) using any of the RNA editing methods described herein, comprising editing a target RNA associated with the disease or condition in the individual's cells, wherein the dRNA comprises a targeting RNA sequence that hybridizes to the target RNA associated with the disease or condition. In some embodiments, the method comprises introducing the dRNA, or a construct comprising a nucleic acid encoding the dRNA, into isolated cells of the individual ex vivo. In some embodiments, the method comprises administering to the individual an effective amount of the dRNA, or a construct comprising a nucleic acid encoding the dRNA.

[0186] In some embodiments, the target RNA is associated with a disease or condition in an individual. In some embodiments, the disease or condition is an inherited genetic disease or a disease or condition associated with one or more acquired genetic mutations (e.g., drug resistance). In some embodiments, the method further comprises obtaining cells from the individual. In some embodiments, the ADAR is an ADAR that is endogenously expressed in the isolated cell. In some embodiments, the method comprises introducing a construct comprising an ADAR or a nucleic acid encoding an ADAR into the isolated cell. In some embodiments, the method further comprises culturing the cells having the edited RNA. In some embodiments, the method further comprises administering the cells having the edited RNA to an individual. In some embodiments, the disease or condition is an inherited genetic disease or a disease or condition associated with one or more acquired genetic mutations (e.g., drug resistance).

[0187] Diseases and conditions suitable for treatment using the methods of the present application include diseases associated with mutations in RNA transcripts, such as missense mutations, premature stop codons, aberrant splicing, or G to A mutations that cause alternative splicing. Examples of disease-associated mutations that can be ameliorated by the methods of the present application include TP53 mutations associated with cancer. W53X (e.g., 158G>A), IDUA associated with mucopolysaccharidosis type I (MPS I) W402X(e.g., TGG>TAG mutation in exon 9), COL3A1 associated with Ehlers-Danlos syndrome W1278X (e.g., 3833G>A mutation), BMPR2 associated with primary pulmonary hypertension W298X (e.g., 893G>A), AHI1 associated with Joubert syndrome W725X (e.g., 2174G>A) syndrome, FANCC associated with Fanconi anemia W506X (e.g., 1517G>A), MYBPC3 associated with primary familial hypertrophic cardiomyopathy W1098X (e.g., 3293G>A), and IL2RG associated with X-linked severe combined immunodeficiency W237X (e.g., 710G>A). In some embodiments, the disease or condition is cancer. In some embodiments, the disease or condition is a monogenic disease. In some embodiments, the disease or condition is a polygenic disease.

[0188] In some embodiments, methods are provided for treating cancer associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising editing the target RNA in the cells of the individual using any of the RNA editing methods described herein. In some embodiments, the target RNA is TP53 W53X (For example, 158G>A).

[0189] In some embodiments, provided are methods of treating MPS I (e.g., Hurler syndrome or Scheie syndrome) associated with a target RNA that has a mutation (e.g., a G>A mutation) in an individual, comprising editing the target RNA in a cell of the individual using any of the RNA editing methods described herein. In some embodiments, the target RNA is W402X (e.g., TGG>TAG mutation in exon 9).

[0190] In some embodiments, methods are provided for treating or preventing Ehlers-Danlos syndrome associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising editing the target RNA in cells of the individual using any of the RNA editing methods described herein. In some embodiments, the target RNA is COL3A1 W1278X (e.g., the 3833G>A mutation).

[0191] In some embodiments, methods are provided for treating primary pulmonary hypertension associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising editing the target RNA in the cells of the individual using any of the RNA editing methods described herein. In some embodiments, the target RNA is BMPR2 W298X (e.g., 893G>A).

[0192] In some embodiments, provided are methods of treating Joubert syndrome associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising editing the target RNA in a cell of the individual using any of the RNA editing methods described herein. In some embodiments, the target RNA is AH11 W725X (For example, 2174G>A).

[0193] In some embodiments, methods are provided for treating Fanconi anemia associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising editing the target RNA in cells of the individual using any of the RNA editing methods described herein. In some embodiments, the target RNA is W506X (For example, 1517G>A).

[0194] In some embodiments, methods are provided for treating primary familial hypertrophic cardiomyopathy associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising editing the target RNA in cells of the individual using any of the RNA editing methods described herein. In some embodiments, the target RNA is MYBPC3 W1098X (For example, 3293G>A).

[0195] In some embodiments, methods are provided for treating X-linked severe combined immunodeficiency associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising editing the target RNA in cells of the individual using any of the RNA editing methods described herein. In some embodiments, the target RNA is IL2RG W237X (For example, 710G>A).

[0196] In some embodiments, a method is provided for treating hyperglycemia associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising editing the target RNA in a cell of the individual using any of the RNA editing methods described herein. In some embodiments, the target RNA is MALAT1.

[0197] In some embodiments, provided are methods for treating Charcot-Marie-Tooth disease type 2B (CMT2B) associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising editing the target RNA in cells of the individual using any of the RNA editing methods described herein. In some embodiments, the target RNA is RAB7A.

[0198] Generally, the dosage, schedule, and route of administration of a composition (e.g., a dRNA or a construct encoding a dRNA) can be determined according to the size and condition of the individual and in accordance with standard pharmaceutical practice. Exemplary routes of administration include intravenous, intraarterial, intraperitoneal, intrapulmonary, intravesicular, intramuscular, intratracheal, subcutaneous, intraocular, intrathecal, or transdermal.

[0199] The RNA editing methods of the present application can be used not only in animal cells, e.g., mammalian cells, but also to modify the RNA of plants or fungi, e.g., plants or fungi that have endogenously expressed ADARs. The methods described herein can be used to generate genetically engineered plants and fungi with improved properties.

[0200] Further provided are cells and compositions comprising any of the dRNAs, constructs, edited RNAs described herein for use in any of the methods of treatment described herein, and any of the dRNAs, constructs, edited cells and compositions described herein in the manufacture of a medicament for treating a disease or condition.

[0201] V. Compositions, Kits and Articles of Manufacture The present specification further provides compositions (such as pharmaceutical compositions) comprising any one of the dRNAs, constructs, libraries, or host cells harboring edited RNA described herein.

[0202] In some embodiments, pharmaceutical compositions are provided comprising any one of the dRNAs or dRNA-encoding constructs described herein and a pharmaceutically acceptable carrier, excipient, or stabilizer (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)). Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (e.g., octadecyldimethylbenzylammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl alcohol, or benzyl alcohol; alkyl p-hydroxybenzoates such as methyl p-hydroxybenzoate or propyl p-hydroxybenzoate; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight compounds such as PEG-1, PEG-2, PEG-3, PEG-4, PEG-5, PEG-6, PEG-7, PEG-8, PEG-9, PEG-10, PEG-11, PEG-12, PEG-13, PEG-14, PEG-15, PEG-16, PEG-17, PEG-18, PEG-19, PEG-21, PEG-22, PEG-23, PEG-24, PEG-25, PEG-26, PEG-27, PEG-28, PEG-29, PEG-30, PEG-31, PEG-32, PEG-33, PEG-34, PEG-35, PEG-46, PEG-47, PEG-48, PEG-49, PEG-49, PEG-49, PEG-48, PEG-49, PEG-49, PEG-49, PEG-49, PEG-49 The pharmaceutical composition may comprise a polypeptide of low molecular weight (less than about 10 residues); a protein such as serum albumin, gelatin, or immunoglobulin; a hydrophilic polymer such as polyvinylpyrrolidone; an amino acid such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other sugars including glucose, mannose, or dextrin; a chelating agent such as EDTA; a sugar such as sucrose, mannitol, trehalose, or sorbitol; a salt-forming counterion such as sodium; a metal complex (e.g., a Zn-protein complex); and / or a non-ionic surfactant such as TWEEN™, PLURONICS™, or polyethylene glycol (PEG). In some embodiments, a lyophilized formulation is provided. Pharmaceutical compositions used for in vivo administration must be sterile. This can be readily accomplished, for example, by filtration through sterile filtration membranes.

[0203] Further provided are kits or articles of manufacture that can be used in any one of the RNA editing methods or therapeutic methods described herein, comprising any one of the dRNAs, constructs, compositions, libraries, or edited host cells described herein.

[0204] In some embodiments, a kit for editing target RNA in host cell is provided, the kit comprises dRNA or a construct comprising the nucleic acid sequence encoding dRNA, wherein dRNA comprises targeting RNA sequence that hybridizes with target RNA to form double-stranded RNA, the target RNA is associated with disease or symptoms, the double-stranded RNA comprises a bulge that contains non-target adenosine in the target RNA, and the dRNA can recruit ADAR to deaminate the target adenosine residue in the target RNA.In some embodiments, the dRNA is circular.In some embodiments, the dRNA comprises a linker nucleic acid sequence adjacent to the end of targeting RNA sequence.

[0205] In some embodiments, a kit for editing a target RNA in a host cell is provided, comprising a dRNA or a construct comprising a nucleic acid sequence encoding the dRNA, wherein the dRNA comprises a targeting RNA sequence that hybridizes to the target RNA, wherein the target RNA is associated with a disease or condition, wherein the dRNA comprises a linker nucleic acid sequence adjacent to an end of the targeting RNA sequence, wherein the linker nucleic acid sequence does not form substantially a secondary structure with any portion of the dRNA, wherein the dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA, and wherein the dRNA is a circular RNA or a linear RNA capable of forming a circular RNA.

[0206] In some embodiments, the kit further comprises an ADAR or a construct comprising a nucleic acid encoding an ADAR. In some embodiments, the kit further comprises an ADAR3 inhibitor or a construct thereof. In some embodiments, the kit further comprises an interferon stimulator or a construct thereof. In some embodiments, the kit further comprises instructions for performing any one of the RNA editing methods or treatment methods described herein.

[0207] The kits of the present application are in suitable packaging, including, but not limited to, vials, bottles, jars, flexible packaging (e.g., sealed polyester film or plastic bags), etc. Kits may optionally provide additional components, such as transfection or transduction reagents, cell culture media, buffers, and interpretive information.

[0208] Accordingly, the present application also provides a product. The product may include a container and a label or protocol on or associated with the container. Suitable containers include vials (e.g., sealed vials), bottles, jars, flexible packaging, etc. In some embodiments, the container holds the pharmaceutical composition and may have a sterile access port (e.g., the container may be an intravenous solution bag or a vial with a stopper pierceable by a hypodermic injection needle). The container holding the pharmaceutical composition may be a multi-use vial that allows for multiple administrations (e.g., 2-6 administrations) of the reconstituted formulation. A protocol refers to instructions typically included in commercial packaging of therapeutic products and includes information such as indications, directions for use, dosage, administration, contraindications, and / or warnings regarding the use of such products. The product may also further include a second container containing a pharmaceutically acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution, and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.

[0209] The kit or article of manufacture may include a plurality of unit doses of the pharmaceutical composition packaged in an amount sufficient for storage and use in a pharmacy (e.g., hospital pharmacy and compounding pharmacy) and instructions for use.

[0210] Example The following examples are merely illustrative of the present application and should not be construed as limiting the present invention in any way. The following exemplary embodiments and examples, as well as the detailed description, are offered by way of illustration and not by way of limitation.

[0211] Materials and Methods (Plasmid construction) For constructs expressing linear arRNA, the arRNA sequence was synthesized and cloned into the pLenti-sgRNA-lib 2.0 (Addgene #89638) backbone by Golden Gate cloning, and arRNA transcription was driven by the hU6 or CMV promoter, respectively. For gene-encoded circ-arRNA expression constructs, first, Twister P3 U2A, 5' linking sequence, 3' linking sequence, and Twister P1 48 A cloning vector was constructed based on the pLenti-sgRNA-lib 2.0 vector containing the sgRNA. The arRNA sequence was then synthesized and cloned into an autocatalytic circular RNA expression vector by Golden Gate cloning.

[0212] To further improve editing efficiency, we 151 was flanked by a 20-nt spacer and a 30-nt polyAC sequence and then cloned into a genetically encoded circ-arRNA expression vector by Golden Gate cloning.

[0213] To reduce off-target editing, the nucleotide opposite the potential off-target adenosine was deleted and cloned into a genetically encoded circ-arRNA expression vector.

[0214] For the dual fluorescent reporter, the mCherry and EGFP (with the ATG start codon of EGFP deleted) coding sequences were amplified by PCR, digested with BsmBI (ThermoFisher Scientific, ER0452), and subsequently ligated with a 3xGGGGS linker using T4 DNA ligase (NEB, M0202L). The ligation product was then inserted into the pLenti-CMV-MCS-PURO backbone.

[0215] For constructs expressing genes with pathogenic mutations, the full-length coding sequence of TP53 (ordered from Vigenebio, a gift from J. Wang's laboratory at the Institute of Pathogen Biology, Chinese Academy of Medical Sciences) was amplified from constructs encoding the corresponding genes, and a G>A mutation was introduced by PCR. The amplified product was cloned into the pLenti-CMV-MCS-mCherry backbone by the Gibson cloning method.

[0216] In vitro generation and purification of circular RNA Circular RNA (circRNA) was generated according to the method described in Abe, N. et al., "Preparation of Circular RNA In Vitro," Circular RNAs. Humana Press, New York, NY, 2018, pp. 181-192, and Chen, H. et al., "Preferential production of RNA rings by T4 RNA ligase 2 without any splint through rational design of precursor strand," Nucleic Acids Research 48, e54-e54 (2020). Briefly, circular RNA precursors were synthesized by in vitro transcription (IVT) from linearized circular RNA plasmid templates using the HISCRIBE™ T7 High Yield RNA Synthesis Kit (New England Biolabs, #E2040S). After IVT, the IVT product was treated with DNase I (New England Biolabs, #M0303S) for 30 minutes to digest the DNA template. For T4 Rnl circularization, T4 Rnl 1 (New England Biolabs, #M0239L) or T4 Rnl 2 (New England Biolabs, #M0204L) was added to the linear circular RNA precursor, followed by DNase I digestion and incubation at 37°C overnight. For group 1 autocatalytic circularization, after DNase I digestion, GTP was added to the reaction at a final concentration of 2 mM, and the reaction was incubated at 55°C for 15 minutes to catalyze circularization of the circular RNA. The circularized circ-arRNA was then column-purified using the Monarch RNA Cleanup Kit (New England Biolabs, #T2040L). The column-purified RNA was then heated at 65°C for 3 minutes and cooled on ice. The reaction was treated with RNase R (Epicenter, #RNR07250) for 15 minutes at 37°C to enrich for circRNA. The RNase R-treated RNA was column-purified.

[0217] To further enrich circ-arRNA, the purified RNase R-treated circ-arRNA was analyzed in RNase-free TE buffer using a high-performance liquid chromatography (Agilent HPLC1260) equipped with a 4.6 x 300 mm size-exclusion column (Sepax Technologies, #215980P-4630) with a 5 μm particle size and 2000 Å pore size. The circ-arRNA-enriched fraction was collected and subjected to column purification (New England Biolabs, #T2040L). To further reduce the immunogenicity of the purified circ-arRNA, the circ-arRNA was heated at 65°C for 3 min, cooled on ice, and then treated with Quick CIP Phosphatase (New England Biolabs, #M0525S). Finally, the circ-arRNA was column-purified and concentrated using the RNA Clean & Concentrator Kit (ZYMO, #R1018).

[0218] (Cell culture and transfection) The HeLa cell line was obtained from Z. Jiang's laboratory (Peking University), and the HEK293T cell line was obtained from C. Zhang's laboratory (Peking University). The A549 cell line was from EdiGene. The C2C12 cell line was purchased from Procell. MEF cells were generated from Idua-W392X mice. The Hep G2 / RPE1 / SF268 / Cos7 / NIH3T3 cell lines were maintained in our laboratory at Peking University. These mammalian cell lines were cultured at 37°C and 5% CO2 in Dulbecco's modified Eagle's medium (Corning, 10-013-CV) containing 10% fetal bovine serum (BI) supplemented with 1% penicillin-streptomycin.

[0219] Plasmids were transfected into cells using X-tremeGENE HP DNA transfection reagent (Roche, 06366546001) or PEI (Proteintech, B600070) according to the manufacturer's protocol, and in vitro circularized RNA was transfected into cells using Lipofectamine MessengerMax (Invitrogen, LRNA003).

[0220] (Cell line construction) For stable reporter cell lines, the reporter construct (pLenti-CMV-MCS-PURO backbone) was co-transfected into HEK293T cells with two viral packaging plasmids, pR8.74 and pVSVG. After 72 hours, the supernatant virus was collected and stored at -80°C. After HEK293T cells were infected with lentivirus, mCherry-positive cells were sorted by fluorescence-activated cell sorting (FACS) and cultured to select a single clonal cell line stably expressing the dual fluorescent reporter without detectable EGFP background. HEK293T ADAR1 - / - and TP53 - / - Cell lines were generated according to the method described in Zhou, Y., Zhang, H., & Wei, W., "Simultaneous generation of multi-gene knockouts in human cells," FEBS Letters 11 (2016). HEK293T cells were co-transfected with a single guide RNA targeting ADAR1 and PCR-amplified donor DNA containing a CMV-driven puromycin resistance gene. Cells were then treated with puromycin 7 days after transfection. Single clones were isolated from puromycin-resistant cells and subsequently verified by sequencing and Western blot.

[0221] (RNA editing of endogenously or exogenously expressed transcripts) To assess RNA editing with the dual fluorescent reporter, HEK293T reporter cells were plated in 12-well plates (1–3 × 105 After 24 hours, cells were transfected with 2 μg of linear arRNA or circ-arRNA plasmid. 48 hours after transfection, editing efficiency was assessed by EGFP expression. + As with dual fluorescent reporter cells, ADAR1 - / - HEK293T cells were transfected with a reporter gene and linear arRNA or circ-arRNA plasmids.

[0222] To evaluate RNA editing efficiency in multiple cell lines, 1 x 10 5 (HeLa, Hep G2, A549, RPE1, SF268, C2C12, NIH3T3) or 4 × 10 5 HEK293T cells were seeded in 12-well plates. After 24 hours, reporter gene and arRNA plasmids were co-transfected into these cells. Editing efficiency was assessed by EGFP expression. + Measured by ratio.

[0223] EGFP + To evaluate the ratio, cells were sorted and collected by flow cytometry (FACS analysis) 48 hours after transfection. The mCherry signal served as a fluorescent selection marker for reporter gene / circ-arRNA-expressing cells, while the EGFP signal served as a fluorescent selection marker for reporter gene / circ-arRNA-expressing cells. + / mCherry + The percentage of cells was calculated as a readout of editing efficiency.

[0224] To assess RNA editing of endogenous mRNA transcripts, HEK293T cells were seeded in 6-well plates (8 × 10 5 (cells / well). 24 hours later, cells were transfected with 3 μg of linear or circular arRNA plasmid. 48 hours after transfection, cells were sorted and collected by FACS analysis. Editing efficiency was measured by deep sequencing.

[0225] For next-generation sequencing (NGS) quantification of the A-to-I editing ratio, 48 hours after transfection, cells were sorted and collected by FACS assay for RNA isolation (Zymo, R1055). Total RNA was then reverse-transcribed into cDNA via reverse transcription PCR (RT-PCR) (TIANGEN, KR118), and the target site was PCR-amplified using the corresponding primers mCherry-SpeI-F (SEQ ID NO: 1), mCherry-BsmBI-R1 (SEQ ID NO: 2), and EGFP-BsmBI-F1 (SEQ ID NO: 3). PCR products were purified for Sanger sequencing or next-generation sequencing (NGS) (Illumina HiSeq X Ten).

[0226] (Target site RNA editing analysis) For deep sequencing analysis, an index was generated using the target site sequence (upstream and downstream 20-nt) of the arRNA coverage sequence. Reads were aligned and quantified using BWA (v.0.7.10-r789). BAMs were then sorted by Samtools alignment and analyzed for RNA editing sites using REDitools (v.1.0.4). The parameters were: -U[AG or TC]-t8-n0.0-T6-6-edu. All significant A-to-G conversions within the arRNA-targeted region, calculated by Fisher's exact test (p-value <0.05), were considered to be arRNA-mediated editing. Conversions excluding the target adenosine were considered off-target editing. Mutations that appeared simultaneously in both the control and experimental groups were considered to be due to single nucleotide polymorphisms.

[0227] (Whole transcriptome RNA sequencing analysis) Control RNA carrying a blue fluorescent protein (BFP) expression cassette 151 or circ-arRNA 151 The BFP-PPIA expression plasmid was transfected into HEK293T cells. +Cells were enriched by FACS 48 hours after transfection, and RNA was purified using the RNAprep Pure Micro Kit (TIANGEN, DP420). Next, mRNA was purified using the NEBNext Poly(A) mRNA Magnetic Separation Module (New England Biolabs, E7490) and processed with Illumina's NEBNext Ultra II RNA Library Prep Kit (New England Biolabs, E7770). Deep sequencing was then performed using the Illumina HiSeq X Ten platform (2 x 150 base pair paired-end; 30 µg per sample). To eliminate nonspecific effects due to transfection, a mock group was included in which cells were treated only with the transfection reagent. Each group contained four replicates.

[0228] The bioinformatics analysis pipeline followed the work of Vogel et al. Quality control of the analysis was performed using FastQC, and quality trimming was based on Cutadapt (the first 6 bp of each read was trimmed, with a maximum of 20 bp quality trimmed). An AWK script was used to filter introduced circ-arRNAs. After trimming, reads shorter than 90 nt in length were filtered. The filtered reads were then mapped to the reference genome (GRCh38-hg38) using STAR software. Variants were called using the GATK Haplotypcaller. The raw VCF (Variant Call Format) files generated by GATK were filtered and annotated using GATK VariantFiltration, bcftools, and ANNOVAR. Variants from dbSNP, 1000 Genome, and EVS were filtered. Shared variants from six replicates of each group were then selected as RNA editing sites. The mock RNA editing level is displayed as background, and the mock variants are subtracted to obtain the control RNA. 151 and circ-arRNA 151-The Company has acquired the global target for PPIA.

[0229] To assess whether circ-arRNA disrupts natural editing homeostasis, we used control RNA 151 and circ-arRNA 151 The global editing sites shared by -PPIA were analyzed. Differences in RNA editing ratios at native A-to-I editing sites were assessed by Pearson correlation coefficient analysis.

[0230] (p53 transcriptional regulatory activity assay) TP53 W53X The cDNA expression plasmid and circ-arRNA expression plasmid were used together with a p53-firefly luciferase cis-reporting plasmid (YRGene, VXS0446) and a Renilla luciferase plasmid (from Z. Jiang's laboratory at Peking University) to detect the transcriptional regulatory activity of p53. Forty-eight hours after transfection, cells were harvested and assayed using the Promega Dual-Glo Luciferase Assay System (Promega, E2940) according to the manufacturer's protocol. Luminescence was measured using an Infinite M200 reader (TECAN). The fold change in p53-induced luciferase activity was calculated as the ratio of firefly luminescence to Renilla luminescence.

[0231] Western blot Mouse monoclonal primary antibodies against p53 (Santa Cruz, sc-126) and β-tubulin (CWBiotech, CW0098) were used. HRP-conjugated goat anti-mouse IgG (H+L, 115-035-003) secondary antibody was purchased from Jackson ImmunoResearch. 2 × 10 6Cells were sorted and lysed, and equal amounts of protein from each lysate were loaded onto SDS-PAGE. Sample proteins were then transferred to polyvinylidene difluoride membranes (Bio-Rad Laboratories) and immunoblotted with primary antibodies (p53, 1:300; anti-tubulin, 1:2000). This was followed by secondary antibody incubation (1:3,000) and exposure. Experiments were repeated three times. Semiquantitative analysis was performed using Image Lab software.

[0232] (Animal experiments) Idua-W392X mice were purchased from Jackson Laboratory. All mice were bred and housed under specific pathogen-free (SPF) conditions at the Peking University Laboratory Animal Center. Animal experiments were approved by the Peking University Laboratory Animal Center and conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

[0233] circ-arRNA AAV8 was packaged by PackGene Biotech. At 6–8 weeks of age, AAV was injected at a dose of 1 × 10 per mouse. 13 The vector genome was injected into IDUA-W392X mice (B6.129S-Iduatml.1Kmke / J) via the tail vein at a dose of 100 mg / kg / day. Mice were monitored four times a week for the duration of the experiment (4-5 weeks).

[0234] The collected mouse tissues were homogenized in 1 mL of Trizol and RNA was extracted using chloroform extraction. The reverse-transcribed RNA was then subjected to PCR and analyzed by Sanger sequencing or next-generation sequencing.

[0235] (IDUA catalytic activity assay) The collected cell pellet was resuspended and lysed in 28 μL of 0.5% Triton X-100 in 1x PBS buffer and kept on ice for 30 min. Next, 25 μL of the cell lysate was added to 25 μL of 190 μM 4-methylumbelliferyl-α-L-iduronidase substrate (Cayman, 2A-19543-500) dissolved in 0.4 M sodium formate buffer (pH 3.5) containing 0.2% Triton X-100 and incubated at 37°C for 90 min in the dark. The catalytic reaction was quenched by adding 200 μL of 0.5 M NaOH / glycine buffer (pH 10.3) and centrifuged at 4°C for 2 min. The supernatant was transferred to a 96-well plate, and fluorescence was measured at emission wavelengths of 365 nm and 450 nm using an Infinite M200 reader (TECAN).

[0236] (statistics) For group comparisons, unpaired two-tailed Student's t-tests were performed. For whole-transcriptome RNA-seq data, statistical significance was analyzed using DESeq2 (v.1.18.1). Statistical analyses were performed using R and Prism8 (GraphPad Software, Inc.).

[0237] Example 1. High RNA editing efficiency can be achieved by arRNA generated from a Pol II promoter To test whether RNA polymerase II (Pol II) can improve editing efficiency, we constructed a plasmid expressing arRNA driven by the Pol II promoter (CMV). Using a reporter system containing an in-frame stop codon between mCherry and EGFP (reporter 1, Figure 1A), we investigated the RNA editing efficiency between arRNA driven by the CMV and U6 (Pol III) promoters (arRNA). 151 ) were compared. Untreated cells were used as mock (untreated).

[0238] The sequences used were: arRNA 151has the sequence of SEQ ID NO: 4. The CMV promoter has the nucleic acid sequence of SEQ ID NO: 5. The U6 promoter has the nucleic acid sequence of SEQ ID NO: 6. Dual fluorescent reporter gene 1 contains the sequence of mCherry (SEQ ID NO: 7), a sequence containing a 3xGS linker and a targeted A (SEQ ID NO: 8), and the sequence of eGFP (SEQ ID NO: 9).

[0239] We found that CMV-arRNA outperformed U6-arRNA in RNA editing (Figures 1B-1C). These results indicate that the abundance of arRNA is important for LEAPER efficiency and that 5'-Cap and 3'-poly(A) do not interfere with arRNA during targeted editing.

[0240] Example 2. circ-arRNA enables efficient, durable, and programmable RNA editing To test whether circularization of arRNA can improve RNA stability and half-life, HEK293T cells stably expressing reporter gene 1, which contains an in-frame stop codon between mCherry and EGFP (Figure 2A), were transfected with circ-arRNA targeting reporter 1, as described in Example 1. 151 The cells were transfected with a plasmid expressing EGFP, which indicates the efficiency of targeted editing of the RNA.

[0241] The circularization efficiency of arRNA (circ-arRNA) was determined by PCR amplification of the target locus using the corresponding primer pair, and the PCR product was purified for Sanger sequencing. Sanger sequencing showed that circ-arRNA was successfully generated. Reporter 1 was used to generate 151-nt arRNA (arRNA) driven by the CMV (Pol II) or U6 (Pol III) promoter. 151 ;SEQ ID NO: 4) and circ-arRNA (circ-arRNA 151 We compared the RNA editing efficiency between U6-circ-arRNA and U6-circ-arRNA. 151 has been implicated in CMV-arRNA in RNA editing. 151It was found to be superior to circ-arRNA (Figure 2B). 151 has a linker sequence of SEQ ID NO: 10 connecting the 5' and 3' ends of SEQ ID NO: 4. The 3' linker sequence is SEQ ID NO: 11, and the 5' linker sequence is SEQ ID NO: 12. To further increase the amount of RNA produced, circ-arRNA driven by a Pol II promoter (CMV) was used. 151 A plasmid expressing U6-circ-arRNA was constructed. U6-circ-arRNA was expressed as a surrogate reporter assay, as indicated by EGFP expression. 151 CMV-circ-arRNA in RNA editing 151 Based on the above results, the editing efficiency of circ-arRNA driven by the U6 promoter was proven to be superior to that of the CMV promoter in RNA editing. Therefore, the U6 promoter was used in all subsequent experiments.

[0242] Reporter 1 was used to express arRNA (arRNA) driven by the U6 promoter. 151 ) and circ-arRNA (circ-arRNA 151 ) were used as a control. 151 ) EGFP in transfected HEK293T cells + Circ-arRNA was found to be superior to arRNA, as indicated by a significant increase in the percentage of circ-arRNA (Figure 2D). Furthermore, this RNA editing was persistent, lasting for at least approximately 18 days (Figure 2E).

[0243] To test whether circ-arRNA-mediated RNA editing also depends on the endogenous ADAR1 protein, we analyzed reporter 1 and the circ-arRNA targeting reporter 1. 151 Plasmids expressing ADAR1 were transfected into HEK293T cells with and without ADAR1 knockout (HEK293T ADAR - / - ). EGFP +Percentages are mCherry + The transfection efficiency was normalized by the transfection efficiency determined by HEK293T ADAR - / - We found that RNA editing of both arRNA and circ-arRNA was dependent on endogenous ADARs, as indicated by the complete disappearance of the editing-generated EGFP signal in cells ( Figure 2F ).

[0244] The RNA editing efficiencies of arRNA and circ-arRNA were further compared in multiple cell types, including HeLa, HepG2, A549, RPE1, SF268, C2C12, NIH3T3, and Cos7 (Figure 2G). circ-arRNA was found to perform better than arRNA in all cell types. To test whether circ-arRNA can perform efficient RNA editing on endogenous transcripts, we used circ-arRNAs targeting six endogenous transcripts: PPIA (SEQ ID NO: 13), KRAS (SEQ ID NO: 44), RAB7A (SEQ ID NO: 45), FANCC (SEQ ID NO: 46), MALAT1 (SEQ ID NO: 47), and TP53 (SEQ ID NO: 16). 151 We designed a circ-arRNA (Figure 2H). The reverse-transcribed RNA was PCR-amplified and purified by next-generation sequencing (NGS; Illumina HiSeq X Ten). Next-generation sequencing results showed that among all six transcripts, circ-arRNA performed better than its linear counterpart in targeted RNA editing (Figure 2I). Furthermore, as indicated by similar relative RNA expression determined by quantitative PCR, circ-arRNA did not exhibit any RNAi effect on the expression of PPIA and FANCC gene transcripts (data not shown).

[0245] Next, to test whether circ-arRNAs can also achieve efficient RNA editing at multiple target sites in endogenous transcripts, we designed 151-nt circ-arRNAs to target 20 distinct RNA sites in nine endogenous genes: PPIB, GUSB, KRAS, MALAT1, TUBB, RAB7A, PPIA, SMYD5, and CTNNB1 (Table 2). Next-generation sequencing showed that circ-arRNAs performed better in targeted RNA editing than their linear counterparts at 17 of the 20 sites. However, circ-arRNAs showed comparable editing rates at MALAT1 (site 1) and further reduced editing rates at KRAS (sites 1 and 2). It is possible that circ-arRNAs targeting these three sites possess structures that hinder target recognition and their ability to mediate target editing activity. To test whether the addition of flexible RNA linkers flanking circ-arRNAs could further optimize their ability to mediate editing activity, we inserted a 50-nucleotide flexible polyAC RNA linker (termed AC50) into the flanking circ-arRNAs. 151 circ-arRNA 151 Compared with the original circ-arRNA_AC50 linker, these circ-arRNA_AC50 linkers showed improved editing rates at 14 sites. Indeed, circ-arRNA_AC50 targeting KRAS (sites 1 and 2) improved the editing efficiency of the original circ-arRNA to a level comparable to that of the corresponding linear arRNA. On average, the editing efficiencies of circ-arRNA and circ-arRNA_AC50 were 2.3- and 3.1-fold higher than those of their linear counterparts, respectively (Figure 2J).

[0246] Adeno-associated virus (AAV) was used to deliver circ-arRNA to HEK293T cells, human primary hepatocytes, and human brain organoids. Next-generation sequencing results showed that AAV-delivered circ-arRNA produced higher levels of targeted editing in a long-lasting manner in all of these cells and organoids compared to their linear counterparts (Figure 2K-N).

[0247]

Table 1

[0248]

Table 2

[0249]

Table 3

[0250]

Table 4

[0251]

Table 5

[0252]

Table 6

[0253]

Table 7

[0254]

Table 8

[0255]

Table 9

[0256]

Table 10

[0257]

Table 11

[0258] [Table 12]

[0259] Example 3. Generation of circ-arRNA for LEAPER using an in vitro circularization strategy To test the in vitro strategy for generating circ-arRNA (Figure 2A), we ligated linear arRNA created by in vitro transcription with two T4 RNA ligases, T4 Rnl1 and Rnl2. 50 The EGFP reporter was circularized by HPLC and purified by high-performance liquid chromatography (HPLC) (Figure 3A). 42 After transfection into HEK293T cells containing the circ-arRNA, EGFP expression was observed on days 1, 3, and 7. These purified circ-arRNAs were found to produce higher and longer-lasting EGFP signal levels than the linearized versions. Furthermore, Sanger sequencing (Figure 3E) and next-generation sequencing (Figure 3B) demonstrated that the adenosine-to-inosine (A to I) conversion rate at target sites in the circ-arRNA reporter transcripts was more than five-fold higher than that of the linearized arRNA. Furthermore, the editing ratio of the in vitro delivered circ-arRNA on endogenous PPIB transcripts could also reach more than 50% (Figure 3C).

[0260] Group I ribozyme-mediated autocatalytic activity 51,52 To study the pathogenic point mutation (IDUA), a group I ribozyme-autocatalytically linked circ-arRNA was introduced into a primary MEF cell line generated from Hurler syndrome mice. W392X The editing ratio of Idua transcripts bearing the circ-arRNA (A) to the targeted adenosine was measured. Untreated cells were used as a mock control (untreated). Cells transfected with non-targeting RNA were also used as a control (control RNA). Next-generation sequencing results demonstrated that circ-arRNA generated by group I ribozyme autocatalysis regulates Idua in MEF cells. W392XWe demonstrated that pathogenic point mutations in the transcripts could be corrected with an editing ratio of approximately 25% (Figure 3D). These results demonstrate that circ-arRNAs generated in vivo or in vitro can achieve efficient and sustained targeted RNA editing in endogenous transcripts.

[0261] Example 4. RNA editing specificity of circ-arRNA To evaluate the RNA editing specificity of circ-arRNA, we performed whole-transcriptome RNA sequencing analysis. HEK293T cells were transfected with circ-arRNA. 151 Cells were transfected with a circ-arRNA expression plasmid. Cells transfected with non-targeting RNA were used as a control (control RNA). Whole-transcriptome RNA sequencing revealed that circ-arRNA 151 The -PPIA transfection group showed 17 potential off-target edits (Figure 4A) and one PPIA on-target site. In contrast, the ADAR2 deaminase domain (ADAR2), which is used in many reported RNA editing tools, was not detected. DD ) Overexpression groups experienced nearly 16,588 off-target edits in the RNA transcriptome compared to controls (Figure 4B). DD Off-target editing in the overexpression group (16,588 off-targets) was much higher than in the circ-arRNA group (17 off-targets). 151 Most of the 17 off-target sites identified in the circ-PPIA transfection group were located in introns and pseudogene regions (Figure 4D). Minimum free energy analysis confirmed that all of these off-target hits were located in the circ-arRNA. 151 -PPIA failed to form a stable duplex (Fig. 4E), thus indicating that it is unlikely to be a true sequence-dependent off-target.

[0262] circ-arRNA 151To test whether circ-arRNA in PPIA affects the expression levels of targeted PPIA transcripts, we performed further analysis using the whole-transcriptome RNA-seq data described above. 151 PPIA-mediated editing did not affect the expression or splicing pattern of PPIA transcripts (Figures 4F and 4H-J), nor did it affect the protein level of PPIA (Figure 4G). 151 -PPIA group and control RNA 151 Comparison of the A-to-I RNA editing sites shared by the groups showed that they were highly similar to each other, indicating that circ-arRNAs have little effect on the native A-to-I editing function of endogenous ADAR deaminases ( Figure 4C ).

[0263] Example 5. Reduction of adjacent base off-targets by engineered circ-arRNA To test for off-targeting of adjacent bases in the arRNA-covered region of the targeted transcript, HEK293T cells stably expressing reporter 1, which contains an in-frame stop codon between mCherry and EGFP, were transfected with either linear or circular arRNA targeting reporter 1 (Figure 5A-5B, upper panel). 54-56 , deleting the nucleotide opposite the targeted adenosine in linear arRNA (Figure 5A, bottom panel) or circ-arRNA (Figure 5B, bottom panel) (arRNA ΔC and circ-arRNA ΔC ), and was found to completely eliminate the targeted RNA editing.

[0264] To reduce bystander off-targets, the nucleotide opposite the unnecessary adenosine in the region covered by circ-arRNA was deleted (Figure 5C). Different versions of circ-arRNA were designed to target the endogenous PPIA transcript (target sequence of SEQ ID NO: 13), including the circ-arRNA151 -PPIA (having the target RNA sequence of SEQ ID NO: 14), circ-arRNA 151-AΔ5 -PPIA (targeted RNA sequence of SEQ ID NO: 139), circ-arRNA 151-AΔ8 -PPIA (having the target RNA sequence of SEQ ID NO: 15), circ-arRNA 151 -AC50-PPIA (having the target RNA sequence of SEQ ID NO: 115), and circ-arRNA 151-AΔ14 _AC50-PPIA (having the targeting RNA sequence of SEQ ID NO: 141), and the uridine on the circ-arRNA opposite the potential off-target site was either retained or deleted (Figures 5C and 5F, and Table 2). 151-AΔ8 In this study, uridines at positions 18, 25, 33, 41, 42, 47, 59, and 87 of SEQ ID NO: 14 were deleted, corresponding to eight potential off-target sites within the target RNA. The 5' and 3' ends of the target RNA sequence were linked to each other via the linker sequence of SEQ ID NO: 10. Next-generation sequencing results showed that the circ-arRNA 151 (Figure 5D), compared with circ-arRNA 151-AΔ8 Higher on-target editing rates were achieved using the circ-arRNA, indicating that the on-target editing rate was not affected by the U deletion in the circ-arRNA. 151-AΔ8 significantly reduced off-target editing at all eight sites tested (Figure 5E). These results confirm that adenosines in mismatched or bulged incomplete double-stranded RNA (dsRNA) can be effectively edited by ADARs with high specificity and efficiency in mammalian cells. 57,58 Furthermore, circ-arRNA 151-AΔ14 We found that _AC50 nearly eliminated all bystander off-targets while still maintaining 60% editing efficiency at the target site (Figures 5G and 5H). NGS reads around the target site were significantly higher than those of circ-arRNA. 151-AΔ14We demonstrated that _AC50 can generate targeted edits without bystander off-targets in >90% of edited transcripts (Figures 5I and 5J).

[0265] Next, in vitro synthesized circ-arRNA 151-AΔ14 We tested circ-arRNAs and found that they also enabled efficient editing in a dose-dependent manner (Figure 5K).Regardless of whether they were deleted, circ-arRNAs did not affect ADAR expression levels or induce innate immune responses (Figures 5L and 5M).

[0266] Example 6. Restoration of p53 transcriptional activity by circ-arRNA with high efficiency and specificity To explore the potential therapeutic applications of circ-arRNA, the TP53 tumor suppressor gene, which is frequently mutated in over 50% of human cancers, was targeted. 59 The c.158G to A variant of TP53 is a clinically relevant nonsense mutation (Trp53Ter) that generates a nonfunctional truncated protein (Figure 6F). TP53, flanked by flexible RNA linkers and / or with a U deletion, W53X We designed different versions of circ-arRNAs targeting TP53 (Figure 6A). W53X The target sequence of the transcript is SEQ ID NO: 16. The targeting RNA sequence is: circ-arRNA 151 (SEQ ID NO: 17), circ-arRNA 151-AG1 (SEQ ID NO: 18), circ-arRNA 151-AG4 (SEQ ID NO: 19), circ-arRNA 151-AΔ1 (SEQ ID NO: 20), circ-arRNA 151-AΔ4 (SEQ ID NO: 21), circ-arRNA 151_AC50 (SEQ ID NO: 17), and circ-arRNA 151-AΔ4 _AC50 (SEQ ID NO: 21). circ-arRNA 151 , circ-arRNA151-AG1, circ-arRNA 151-AG4 and circ-arRNA 151-AΔ1 , circ-arRNA 151-AΔ4has a linker sequence of SEQ ID NO: 10. 151-AG1 In the targeting RNA sequence of SEQ ID NO: 17, the uridine at position 66 is substituted with G. 151-AG4 In the target RNA sequence of SEQ ID NO: 17, the uridines at positions 36, 66, 111, and 114 were substituted with G. 151-AΔ1 In the targeting RNA sequence of SEQ ID NO: 17, the uridine at position 66 is deleted. 151-AΔ4 In the targeting RNA sequence of SEQ ID NO: 17, the uridines at positions 36, 66, 111, and 114 of SEQ ID NO: 17 are deleted.

[0267] Next-generation sequencing analysis revealed that the editing ratio of targeted adenosines varied, and circ-arRNA 151 In circ-arRNA, it is about 30%. 151-AG1 , circ-arRNA 151-AG4 , and circ-arRNA 151-AΔ1 40% of the arRNAs had an A-G mismatch or a U deletion at one undesired off-target site (Figure 6B and Table 2), all of which were higher than the corresponding linear arRNA versions. 42 Furthermore, circ-arRNAs with U deletions at four potential off-target sites 151-AΔ4 resulted in a higher editing ratio of approximately 50% ( Figure 6B ).

[0268] To test whether adding flexible RNA linkers flanking the arRNA sequence to circ-arRNA could improve its ability to bind to target RNA and enhance editing efficiency, a 50-nt polyAC RNA linker, designated AC50 (SEQ ID NO: 22), was added to circ-arRNA. 151 and circ-arRNA 151-AΔ4 circ-arRNA 151 _AC50 and circ-arRNA 151-AΔ4 Next-generation sequencing analysis revealed that this optimization using flexible linkers enabled the identification of circ-arRNA sequences, particularly circ-arRNA sequences.151-AΔ4 For _AC50, the targeted RNA editing efficiency was improved, with approximately 70% editing (Figure 6B).

[0269] In addition to transcript editing, all circ-arRNA versions were also expressed in HEK293T TP53 - / - We were able to effectively rescue the production of full-length p53 protein in cells (Figure 6C). 60,61 Using this method, we found that all versions of circ-arRNA could restore the transcriptional regulatory function of p53 (Figure 6D). 42 Compared with circ-arRNA 151-AΔ4 _AC50 showed the highest editing ratio and restored the highest transcriptional regulatory activity (Figure 6D).

[0270] We also investigated potential off-targets within the region covered by circ-arRNA. When the U nucleotide opposite the potential off-target A nucleotide in circ-arRNA was deleted, bystander off-targets at the four predicted sites were nearly eliminated (Figures 6E and 6G), and the on-target editing ratio was further increased (Figure 6B). 151 The editing efficiency of _AC50 is circ-arRNA 151-AΔ4 Although it was higher than that of circ-arRNA (Figure 6B), its low rate of bystander off-target effects made it difficult to distinguish between circ-arRNA and circ-arRNA. 151-AΔ4 The functional recovery level of circ-arRNA 151 The on-target editing rate was significantly higher than that of _AC50 (Figures 6D and 6G). Collectively, these results demonstrate that the upgraded LEAPER version, called LEAPER2.0, can significantly improve on-target editing rates while eliminating off-target effects.

[0271] Example 7. Restoration of α-L-iduronidase (IDUA) activity in Hurler syndrome mice by circ-arRNA Hurler syndrome is the most severe subtype of mucopolysaccharidosis type I, caused by a deficiency of α-L-iduronidase (IDUA), a lysosomal enzyme responsible for the metabolism of mucopolysaccharides. To explore the therapeutic potential of circ-arRNA, we used a mouse model of Hurler syndrome. This mouse model harbors a homozygous W392X (TGG to TAG) point mutation in exon 9 of Idua, which is similar to the W402X mutation found in clinical Hurler syndrome patients.

[0272] We designed two versions of circ-arRNA that target either the mature Idua mRNA or the pre-mRNA, respectively. W392X The pre-mRNA transcript has the target sequence of SEQ ID NO: 23. W392X The mRNA transcript has the target sequence of SEQ ID NO: 25. circ-arRNA mRNA-151 (having the target RNA sequence of SEQ ID NO: 26) or circ-arRNA pre-mRNA-151 (having the targeting RNA sequence of SEQ ID NO: 24) was delivered to Idua-W392X mice by transduction with self-complementary AAV (scAAV) virus. After 4 weeks, the mice were sacrificed and liver tissue was collected to measure targeted RNA editing and α-L-iduronidase catalytic activity. Next-generation sequencing analysis identified circ-arRNA 151 / mRNA targeting and circ-arRNA 151 Both circ-arRNA and pre-RNA targeting were shown to achieve a targeted editing rate of 10% (Figure 7A). Furthermore, both circ-arRNAs significantly restored IDUA catalytic activity in the liver tissue of Idua-W392X mice (Figure 7B) without affecting the amount of Idua transcripts (Figure 7C). These results demonstrate the therapeutic potential of LEAPER2.0, which has precise, efficient, and sustained targeted RNA editing, in specific clinical monogenic diseases.

[0273] Example 8. circ-arRNA with flanking linker sequences and / or U deletions This example illustrates the effect of adding a flexible linker sequence (i.e., a flanking linker) within a circ-RNA and deleting one or more Us opposite a non-target adenosine on on-target and off-target editing rates.

[0274] (adjacent linker) To test whether adding flexible RNA linkers flanking the arRNA sequence to circ-arRNA could improve its ability to bind to the target RNA, thereby improving on-target editing efficiency and / or reducing bystander off-target editing effects, a 50-nt PolyAC RNA linker (referred to as AC50 (SEQ ID NO: 22)) was inserted into the circular 171-nt arRNA (circ-arRNA 171 ) were added adjacent to different nucleotide positions at the 5' or 3' end of the sequence. See Figures 8A-8B. In situations where there were more than five Gs in a stretch of arRNA sequence, the middle G in the stretch was replaced with an A.

[0275] Three target sequences were tested: (1) A at position 129 in the 3'UTR of the endogenous PPIA transcript ("mf-PPIA-UTR2"; SEQ ID NO: 27); (2) A at position 155 in the 3'UTR of the endogenous PPIA transcript ("mf-PPIA-3"; SEQ ID NO: 28); (3) A at position 134 in the 3'UTR of the endogenous IDUA-1 transcript ("mf-IDUA-1"; SEQ ID NO: 29). The reference sequence for cynomolgus monkey can be found at NCBI identifier NC_022274. The reference sequence for rhesus monkey Ush2a exon is XM_005540847. Each circ-arRNA 171 The targeting RNA sequence is complementary to the sequence of each target sequence.

[0276] Briefly, fetal rhesus monkey kidney cells (FRHK-4) and rhesus monkey kidney cells (LLC-MK2) were transfected with a recombinant AAV plasmid expressing circ-arRNA and eGFP. The rAAV plasmid contained the AAV2 ITRs flanking the expression cassette, operably linked 5' to 3' to the arRNA, a U6 promoter, a CAG promoter, eGFP, and a WPRE. Forty-eight hours after transfection, RNA samples were obtained from the cells. In the FRHK-4 experiment, cells were subjected to FACS sorting based on GFP expression. Target RNA amplicons were obtained and subjected to NGS analysis.

[0277] As shown in Figure 8C, various circ-arRNAs targeting mf-PPIA-UTR2 resulted in comparable on-target editing efficiencies, regardless of whether they were sorted, except for circ-arRNAs with a linker partially replacing the 5' sequence (-L) of the arRNA region, which showed improved on-target editing efficiency. Furthermore, as shown in Figure 8D, partial replacement of the arRNA sequence with an AC50 linker at the 5' end (-L) and / or 3' end (-R) reduced bystander off-target editing in the replaced region of the target RNA transcript. Furthermore, on-target editing efficiency and off-target editing pattern and efficiency were found to be similar for 171-nt linear and circular arRNAs (data not shown).

[0278] Depending on the target, different positions of the flanking linker have different effects on on-target editing efficiency. However, for example, for the mf-PPIA3 target, circ-arRNA with a linker that partially replaces the 3' sequence (-R) of the arRNA region consistently outperforms the original circ-arRNA. 171This resulted in on-target editing efficiencies comparable to those of mf-PPIA-UTR2 (Figure 8E). Similar to mf-PPIA-UTR2, partial substitution of the AC50 linker at the 5' end (-L) and / or 3' end (-R) of the arRNA sequence reduced bystander off-target editing in the replaced region of the target RNA transcript (Figure 8F; -L data not shown). High A to G conversion rates were observed at positions 127, 132, 160, and 168.

[0279] For the mf-IDUA-1 target, circ-arRNAs with linkers partially replacing the 5' (-L) or 3' (-R) sequences of the arRNA sequence both reduced on-target editing efficiency. Circ-arRNAs with linker sequences flanking both the 5' and 3' ends of the arRNA sequence (RL) reduced on-target editing efficiency. 171 The on-target editing efficiency of the bystander was comparable to that of the 62-A to 91-A (Figure 8G). The off-target editing effect of the bystander is shown in Figure 8H. High A to G conversion rates were observed at positions 62, 91, 102, and 118.

[0280] Without being bound by theory, whether the inclusion of flanking sequences in circ-arRNAs improves on-target editing efficiency may depend on the ability of the arRNA to form complex secondary structures. The reduction in off-target editing in mRNA regions corresponding to the AC50 linker-substituted regions of arRNA using -L, -R, and -LR circ-arRNAs is consistent with previous observations that ADAR editing requires the formation of double-stranded RNA.

[0281] U deletion To reduce bystander off-target editing, circ-arRNAs targeting mf-PPIA-3 and mf-IDUA-1 were constructed with a U opposite a specific non-target A. Table 1 below lists the positions of the non-target A residues corresponding to the deleted U residues in the circ-arRNAs and the corresponding circ-arRNA sequences.

[0282] [Table 13]

[0283] The A-to-G editing ratios at non-target and target A positions in mf-PPIA-3 and mf-IDUA-1 using circ-arRNA are shown in heat maps in Figures 9A and 9B, respectively. Constructs marked with an "X" have no data available. For mf-PPIA-3 (Figure 9A), the four off-target A residues had high intramolecular off-target editing ratios. Deleting the U residue opposite each off-target A residue in the arRNA significantly reduced the off-target editing ratio, sometimes to nearly zero. Deleting the U residues opposite multiple off-target A residues in the arRNA can simultaneously reduce the off-target editing ratios of multiple off-target A residues. Deleting specific U residues or combinations of U residues may improve the on-target editing ratio.

[0284] For mf-IDUA-1 (Figure 9B), the intramolecular off-target rate was generally not high. However, because the target A is close to the end of the IDUA 3'UTR, the reverse primer may amplify arRNA, resulting in an abnormally high on-target rate. The similar off-target editing patterns in both cell types suggest that deleting the U opposite the non-target A may increase the on-target editing rate of mf-IDUA-1.

[0285] References 1. Porteus, MH & Carroll, D. Gene targeting using zinc finger nucleases. Nat Biotechnol 23, 967-973(2005). 2. Boch, J. et al. Breaking the code of DNA binding specificity of TAL-type III effectors. Science 326, 1509-1512(2009). 3. Moscou, M.J. & Bogdanove, A.J. A simple cipher governs DNA recognition by TAL effectors. Science 326, 1501(2009). 4. Miller, J.C. et al. A TALE nuclease architecture for efficient genome editing. Nat Biotechnol 29, 143-148(2011). 5. Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821(2012). 6. Cong, L. et al. Multiplex genome engineering using CRISPR / Cas systems. Science 339, 819-823(2013). 7. Mali, P. et al. RNA-guided human genome engineering via Cas9. Science 339, 823-826(2013). 8. Komor, A.C., Kim, Y.B., Packer, M.S., Zuris, J.A. & Liu, D.R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 533, 420-424(2016). 9. Ma, Y. et al. Targeted AID-mediated mutagenesis(TAM)enables efficient genomic diversification in mammalian cells. Nat Methods 13, 1029-1035(2016). 10. Gaudelli, N.M. et al. Programmable base editing of A*T to G*C in genomic DNA without DNA cleavage. Nature 551, 464-471(2017). 11. Fry, L.E., Peddle, C.F., Barnard, A.R., McClements, M.E. & MacLaren, R.E.RNAediting as a therapeutic approach for retinal gene therapy requiring long coding sequences. Int J Mol Sci 21(2020). 12. Tan, M.H. et al. Dynamic landscape and regulation ofRNAediting in mammals. Nature 550, 249-254(2017). 13. Nishikura, K. Functions and regulation ofRNAediting byADARdeaminases. Annu Rev Biochem 79, 321-349(2010). 14. Bass, B.L. & Weintraub, H. An unwinding activity that covalently modifies its double-strandedRNAsubstrate. Cell 55, 1089-1098(1988). 15. Wong, S.K., Sato, S. & Lazinski, D.W. Substrate recognition by ADAR1 and ADAR2.RNA7, 846-858(2001). 16. Montiel-Gonzalez, M.F., Vallecillo-Viejo, I., Yudowski, G.A. & Rosenthal, J.J. Correction of mutations within the cystic fibrosis transmembrane conductance regulator by site-directedRNAediting. Proc Natl Acad Sci U S A 110, 18285-18290(2013). 17. Sinnamon, J.R. et al. Site-directedRNArepair of endogenous Mecp2RNAin neurons. Proc Natl Acad Sci U S A 114, E9395-E9402(2017). 18. Montiel-Gonzalez, M.F., Vallecillo-Viejo, I.C. & Rosenthal, J.J. An efficient system for selectively altering genetic information within mRNAs. Nucleic Acids Res 44, e157(2016). 19. Hanswillemenke, A., Kuzdere, T., Vogel, P., Jekely, G. & Stafforst, T. Site-DirectedRNAEditing in Vivo Can Be Triggered by the Light-Driven Assembly of an Artificial Riboprotein. J Am Chem Soc 137, 15875-15881(2015). 20. Schneider, M.F., Wettengel, J., Hoffmann, P.C. & Stafforst, T. Optimal guideRNAs for re-directing deaminase activity of hADAR1 and hADAR2 in trans. Nucleic Acids Res 42, e87(2014). 21. Vogel, P., Hanswillemenke, A. & Stafforst, T. Switching Protein Localization by Site-DirectedRNAEditing under Control of Light. ACS Synth Biol 6, 1642-1649(2017). 22. Vogel, P., Schneider, M.F., Wettengel, J. & Stafforst, T. Improving site-directedRNAediting in vitro and in cell culture by chemical modification of the guideRNA. Angew Chem Int Ed Engl 53, 6267-6271(2014). 23. Vogel, P. et al. Efficient and precise editing of endogenous transcripts with SNAP-tagged ADARs. Nat Methods 15, 535-538(2018). 24. Cox, D.B.T. et al.RNAediting with CRISPR-Cas13. Science 358, 1019-1027(2017). 25. Fukuda, M. et al. Construction of a guide-RNA for site-directedRNAmutagenesis utilising intracellular A-to-IRNAediting. Sci Rep 7, 41478(2017). 26. Wettengel, J., Reautschnig, P., Geisler, S., Kahle, P.J. & Stafforst, T. Harnessing human ADAR2 forRNArepair - Recoding a PINK1 mutation rescues mitophagy. Nucleic Acids Res 45, 2797-2808(2017). 27. Heep, M., Mach, P., Reautschnig, P., Wettengel, J. & Stafforst, T. Applying Human ADAR1p110 and ADAR1p150 for Site-DirectedRNAEditing-G / C Substitution Stabilizes GuideRNAs against Editing. Genes(Basel)8(2017). 28. Katrekar, D. et al. In vivoRNAediting of point mutations via RNA-guided adenosine deaminases. Nat Methods 16, 239-242(2019). 29. Zhou, C. et al. Off-targetRNAmutation induced by DNA base editing and its elimination by mutagenesis. Nature 571, 275-278(2019). 30. Grunewald, J. et al. Transcriptome-wide off-targetRNAediting induced by CRISPR-guided DNA base editors. Nature 569, 433-437(2019). 31. Grunewald, J. et al. CRISPR DNA base editors with reducedRNAoff-target and self-editing activities. Nat Biotechnol 37, 1041-1048(2019). 32. Jin, S. et al. Cytosine, but not adenine, base editors induce genome-wide off-target mutations in rice. Science 364, 292-295(2019). 33. Vallecillo-Viejo, I.C., Liscovitch-Brauer, N., Montiel-Gonzalez, M.F., Eisenberg, E. & Rosenthal, J.J.C. Abundant off-target edits from site-directedRNAediting can be reduced by nuclear localization of the editing enzyme.RNABiol 15, 104-114(2018). 34. Chew, W.L. et al. A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods 13, 868-874(2016). 35. Wagner, D.L. et al. High prevalence of Streptococcus pyogenes Cas9-reactive T cells within the adult human population. Nat Med 25, 242-248(2019). 36. Simhadri, V.L. et al. Prevalence of Pre-existing Antibodies to CRISPR-Associated Nuclease Cas9 in the USA Population. Mol Ther Methods Clin Dev 10, 105-112(2018). 37. Charlesworth, C.T. et al. Identification of preexisting adaptive immunity to Cas9 proteins in humans. Nat Med 25, 249-254(2019). 38. Teoh, P.J. et al. Aberrant hyperediting of the myeloma transcriptome by ADAR1 confers oncogenicity and is a marker of poor prognosis. Blood 132, 1304-1317(2018). 39. Haapaniemi, E., Botla, S., Persson, J., Schmierer, B. & Taipale, J. CRISPR-Cas9 genome editing induces a p53-mediated DNA damage response. Nat Med 24, 927-930(2018). 40. Ihry, R.J. et al. p53 inhibits CRISPR-Cas9 engineering in human pluripotent stem cells. Nat Med 24, 939-946(2018). 41. Merkle, T. et al. PreciseRNAediting by recruiting endogenous ADARs with antisense oligonucleotides. Nat Biotechnol 37, 133-138(2019). 42. Qu, L. et al. ProgrammableRNAediting by recruiting endogenousADARusing engineered RNAs. Nat Biotechnol 37, 1059-1069(2019). 43. Memczak, S. et al. Circular RNAs are a large class of animal RNAs with regulatory potency. Nature 495, 333-338(2013). 44. Enuka, Y. et al. Circular RNAs are long-lived and display only minimal early alterations in response to a growth factor. Nucleic Acids Res 44, 1370-1383(2016). 45. Kristensen, L.S. et al. The biogenesis, biology and characterization of circular RNAs. Nat Rev Genet 20, 675-691(2019). 46. Zhang, X.O. et al. Complementary sequence-mediated exon circularization. Cell 159, 134-147(2014). 47. Chen, L.L. The biogenesis and emerging roles of circular RNAs. Nat Rev Mol Cell Biol 17, 205-211(2016). 48. Litke, J.L. & Jaffrey, S.R. Highly efficient expression of circularRNAaptamers in cells using autocatalytic transcripts. Nat Biotechnol 37, 667-675(2019). 49. Wesselhoeft, R.A. et al.RNACircularization Diminishes Immunogenicity and Can Extend Translation Duration In Vivo. Mol Cell 74, 508-520 e504(2019). 50. Beaudry, D. & Perreault, J.P. An efficient strategy for the synthesis of circularRNAmolecules. Nucleic Acids Res 23, 3064-3066(1995). 51. Puttaraju, M. & Been, M.D. Group I permuted intron-exon(PIE)sequences self-splice to produce circular exons. Nucleic Acids Res 20, 5357-5364(1992). 52. Wesselhoeft, R.A., Kowalski, P.S. & Anderson, D.G. Engineering circularRNAfor potent and stable translation in eukaryotic cells. Nat Commun 9, 2629(2018). 53. Kuttan, A. & Bass, B.L. Mechanistic insights into editing-site specificity of ADARs. Proc Natl Acad Sci U S A 109, E3295-3304(2012). 54. Wahlstedt, H. & Ohman, M. Site-selective versus promiscuous A-to-I editing. Wiley Interdiscip RevRNA2, 761-771(2011). 55. Gallo, A., Vukic, D., Michalik, D., O'Connell, M.A. & Keegan, L.P.ADARRNA editing in human disease; more to it than meets the I. Hum Genet 136, 1265-1278(2017). 56. Eggington, J.M., Greene, T. & Bass, B.L. Predicting sites ofADARediting in double-stranded RNA. Nat Commun 2, 319(2011). 57. Bazak, L. et al. A-to-IRNAediting occurs at over a hundred million genomic sites, located in a majority of human genes. Genome Res 24, 365-376(2014). 58. Tian, N. et al. A structural determinant required forRNAediting. Nucleic Acids Res 39, 5669-5681(2011). 59. Floquet, C., Deforges, J., Rousset, J.P. & Bidou, L. Rescue of non-sense mutated p53 tumor suppressor gene by aminoglycosides. Nucleic Acids Res 39, 3350-3362(2011). 60. Kern, S.E. et al. Identification of p53 as a sequence-specific DNA-binding protein. Science 252, 1708-1711(1991). 61. Doubrovin, M. et al. Imaging transcriptional regulation of p53-dependent genes with positron emission tomography in vivo. Proc Natl Acad Sci USA 98, 9300-9305(2001). 62. Samaridou, E., Heyes, J. & Lutwyche, P. Lipid nanoparticles for nucleic acid delivery: Current perspectives. Adv Drug Deliv Rev 154-155, 37-63(2020). 63. Bennett, CF Therapeutic Antisense Oligonucleotides Are Coming of Age. Annu Rev Med 70, 307-321(2019). 64. Roberts, TC, Langer, R. & Wood, MJA Advances in oligonucleotide drug delivery. Nat Rev Drug Discov 19, 673-694(2020).

[0286] Sequence Listing SEQ ID NO: 1 mCherry-SpeI-F TATAACTAGTATGGTGAGCAAGGGCGAGGAG

[0287] SEQ ID NO: 2 mCherry-BsmBI-R1 TATACGTCTCATCTACAGATTCTTCCGGCGTGTATACCTTC

[0288] SEQ ID NO: 3 EGFP-BsmBI-F1 TATACGTCTCATAGAGATCCCCGGTCGCCACCGTGAGCAAGGGCGAGGAGCTG

[0289] Array No. 4 arRNA 151 ACUACAGUUGCUCCGAUAUUUAGGCUACGUCAAUAGGCACUAACUUAUUGGCGCUGGUGAACGGACUUCCUCUCGAGUACCAGAAGAUGACUACAAAACUCCUUUCCAUUGCGAGUAUCGGAGUCUGGCUCAGUUUGGCCAGGGAGGCACU

[0290] Array No. 5 CMV promoter CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT

[0291] Array No. 6 U6 promoter GAGGGCCTATTTCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTATTTGCAGTTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGAC

[0292] Sequence number 7 mCherry ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAG

[0293] SEQ ID NO: 8 3×GS linker and targeted adenosine CTGCAGGGCGGAGGAGGCAGCGGCGGAGGAGGCAGCGGCGGAGGAGGCAGCAGAAGGTATACACGCCGGAAGAATCTGTAGAGATCCCCGGTCGCCACC

[0294] SEQ ID NO: 9 eGFP GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA

[0295] SEQ ID NO: 10 Linker sequence CTGCCATCAGTCGGCGTGGACTGTAGAACCATGCCGACTGATGGCAG

[0296] SEQ ID NO: 11 3'-Linker sequence CTGCCATCAGTCGGCGTGGACTGTAG

[0297] SEQ ID NO: 12 5'-Linker sequence AACCATGCCGACTGATGGCAG

[0298] SEQ ID NO: 13 PPIA target sequence GAUGUAGGCUUUAUUUUAAGCAGUAAUGGGUUACUUCUGAAACAUCACUUGUUGCUUAAUUCUACACAGUACUUAGAUUUUUUUUUACUUUCCAGUCCCAGGAAGUGUCAAUGUUUGUUGAGUGGAAUAUUGAAAAUGUAGGCAGCAACUG

[0299] SEQ ID NO: 14 PPIA circ-arRNA 151 Targeted RNA sequence CAGUUGCUGCCUACAUUUUCAAUAUUCCACUCAACAAACAUUGACACUUCCUGGGACUGGAAAGUAAAAAAAAAUCCAAGUACUGUGUAGAAUUAAGCAAACAAGUGAUGUUUCAGAAGUAACCCAUUACUGCUUAAAAUAAAGCCUACAUC

[0300] SEQ ID NO: 15 PPIA circ-arRNA 151-AΔ8 Targeted RNA sequence CAGUUGCUGCCUACAUUUUCAAUAUUCCACUCAACAAACAUUGACACUUCCUGGGACUGGAAAGAAAAAAAAUCCAAGUACUGUGUAGAAUAAGCAAACAAGGAUGUCAGAAGAACCCAUACUGCUAAAAUAAAGCCUACAUC

[0301] SEQ ID NO: 16 TP53 target sequence CUACUUCCUGAAAACAACGUUCUGUCCCCCUUGCCGUCCCAAGCAAUGGAUGAUUUGAUGCUGUCCCCGGACGAUAUUGAACAAUGGUUCACUGAAGACCCAGGUCCAGAUGAAGCUCCCAGAAUGCCAGAGGCUGCUCCCCCCGUGGCCC

[0302] SEQ ID NO: 17 TP53 circ-arRNA 151 Targeted RNA sequence GCUGGUGCAGGGGCCACGGGGGGAGCAGCCUCUGGCAUUCUGGGAGCUUCAUCUGGACCUGGGUCUUCAGUGAACCAUUGUUCAAUAUCGUCCGGGGACAGCAUCAAAUCAUCCAUUGCUUGGGACGGCAAGGGGGACAGAACGUUGUUUU

[0303] SEQ ID NO: 18 TP53 circ-arRNA 151-AG1 Targeted RNA sequence GCUGGUGCAGGGGCCACGGGGGGAGCAGCCUCUGGCAUUCUGGGAGCUUCAUCUGGACCUGGGUCUUCAGUGAACCAUUGUCAAGAUCGUCCGGGGACAGCAUCAAAUCAUCCAUUGCUUGGGACGGCAAGGGGGACAGAACGUUGUUUU

[0304] SEQ ID NO: 19 TP53 circ-arRNA 151-AG4 Targeted RNA sequence GCUGGUGCAGGGGCCACGGGGGGAGCAGCCUCUGGCAGUCGGGGAGCUUCAUCUGGACCUGGGUCUUCAGUGAACCAUUGUCAAGAUCGUCCGGGGACAGCAUCAAAUCAUCCAGUGCUUGGGACGGCAAGGGGGACAGAACGUUGUUUU

[0305] SEQ ID NO: 20 TP53 circ-arRNA 151-AΔ1 Targeted RNA sequence GCUGGUGCAGGGGCCACGGGGGGAGCAGCCUCUGGCAUUCUGGGAGCUUCAUCUGGACCUGGGUCUUCAGUGAACCAUUGUUCAAAUCGUCCGGGGACAGCAUCAAAUCAUCCAUUGCUUGGGACGGCAAGGGGGACAGAACGUUGUUUU

[0306] SEQ ID NO: 21 TP53 circ-arRNA 151-AΔ4 Targeted RNA sequence GCUGGUGCAGGGGCCACGGGGGGAGCAGCCUCUGGCAUCGGGAGCUUCAUCUGGACCUGGGUCUUCAGUGAACCAUUGUUCAAAUCGUCCGGGGACAGCAUCAAAUCAUCCAUGCUUGGGACGGCAAGGGGGACAGAACGUUGUUUU

[0307] SEQ ID NO: 22 AC50 linker sequence AAAAAACAAAAAACAAAAAAAACAAAAAAAAAACCAAAAAAACAAAACACA

[0308] SEQ ID NO: 23 IDUA pre-mRNA sequence AGGAAGCCAGAUGCUAGGUAUGAGAGAGCCAACAGCCUCAGCCCUCUGCUUGGCUUAUAGAUGGAGAACAACUCUAGGCAGAGGUCUCAAAGGCUGGGGCUGUGUUGGACAGCAAUCAUACAGUGGGUGUCCUGGCCAGCACCCAUCACCC

[0309] SEQ ID NO: 24 circ-arRNA used in IDUA pre-mRNA sequence 151 Targeting RNA sequence (underlined C is opposite target A) GGGUGAUGGGUGCUGGCCAGGACACCCACUGUAUGAUUGCUGUCCAACACAGCCCCAGCCUUUGAGACCUCUGCC C AGAGUUGUUCUCCAUCUAUAAGCCAAGCAGAGGGCUGAGGCUGUUGGCUCUCUCAUACCUAGCAUCUGGCUUCCU

[0310] SEQ ID NO: 25 IDUA mRNA sequence CCCACGUGCAGUUGCUGCGAAAGCCAGUACUCACAGUCAUGGGGCUCAUGGCCCUGUUGGAUGGAGAACAACUCUAGGCAGAGGUCUCAAAGGCUGGGGCUGUGUUGGACAGCAAUCAUACAGUGGGUGUCCUGGCCAGCACCCAUCACCC

[0311] circ-arRNA used for SEQ ID NO:26 IDUA mRNA sequence 151 Targeted RNA sequence (underlined C is opposite to target A) GGGUGAUGGGUGCUGGCCAGGACACCCACUGUAUGAUUGCUGUCCAACACAGCCCCAGCCUUUGAGACCUCUGCC C AGAGUUGUUCUCCAUCUAUAAGCCAAGCAGAGGGCUGAGGCUGUUGGCUCUCUCAUACCUAGCAUCUGGCUUCCU

[0312] SEQ ID NO:27 mf-PPIA-UTR2 GGCCACCAUGCCCAGCUGCUGCCUACAUUUUCAAUAUUCUACUCAACAAACAUUGAGACUUCCUGGGUCUGGAAAGAAAGAAAUCCAAGUAUUAUGUAGACUUAAGCAAACAAGUGAUGUUUCAGAAGUAACCCAUUACUGCUUAAAAUAAAGCCUACAUCAACACUCUAA

[0313] SEQ ID NO:28 mf-PPIA-3 CAUGGAACCCAAAGGGAACUGCAGCGAGAGCACAAAGAUUCUAGGAUACUGCGAGCAAAUGGGGUGGAGGGGUGCUCUCCUGAGCCACAGAAGGAAUGGUCUGGUGGUUAAGAUAAAACACAAGUCAAACUUAUUCGAGUUGUCCACAGUCAGCAAUGGUGAUCUUCUUGC

[0314] SEQ ID NO:29 mf-IDUA-1 UAAAAGAAAAUAAUAAAAUAUAAAAAUAUAUUGCAAAGGAGGUGAUGAGAGGGCAGCGUGGGCACAGUGCAACCCCAGCUCGCCGACCGCCAGUGGAGGUGCAGCCCAGUGGGGCUCAGCACAGGCUCAUGGAUUUCCAGGGGCUGGAGGCCCUCUUGGCACAGGGACCUC

[0315] SEQ ID NO: 30 mf-PPIA-3 circ-arRNA-1 CAUGGAACCCAAAGGGAACUGCAGCGAGAGCACAAAGAUUCUAGGAUACUGCGAGCAAAUGGGGUGGAGGGGGCUCUCCUGAGCCACAGAAGGAAUGGUCUGGUGGUUAAGAUAAAACACAAGUCAAACUUAUUCGAGUUGUCCACAGUCAGCAAUGGUGAUCUUCUUGC

[0316] SEQ ID NO: 30 mf-PPIA-3 circ-arRNA-2 CAUGGAACCCAAAGGGAACUGCAGCGAGAGCACAAAGAUUCUAGGAUACUGCGAGCAAAUGGGGUGGAGGGGUGCUCUCCGAGCCACAGAAGGAAUGGUCUGGUGGUUAAGAUAAAACACAAGUCAAACUUAUUCGAGUUGUCCACAGUCAGCAAUGGUGAUCUUCUUGC

[0317] SEQ ID NO: 32 mf-PPIA-3 circ-arRNA-3 CAUGGAACCCAAAGGGAACUGCAGCGAGAGCACAAAGAUUCUAGGAUACUGCGAGCAAAUGGGGUGGAGGGGUGCUCUCCUGAGCCACAGAAGGAAUGGUCUGGUGGUAAGAUAAAACACAAGUCAAACUUAUUCGAGUUGUCCACAGUCAGCAAUGGUGAUCUUCUUGC

[0318] SEQ ID NO: 33 mf-PPIA-3 circ-arRNA-4 CAUGGAACCCAAAGGGAACUGCAGCGAGAGCACAAAGAUUCUAGGAUACUGCGAGCAAAUGGGGUGGAGGGGUGCUCUCCUGAGCCACAGAAGGAAUGGUCUGGUGGUUAAGAAAAACACAAGUCAAACUUAUUCGAGUUGUCCACAGUCAGCAAUGGUGAUCUUCUUGC

[0319] SEQ ID NO: 34 mf-PPIA-3 circ-arRNA-43 CAUGGAACCCAAAGGGAACUGCAGCGAGAGCACAAAGAUUCUAGGAUACUGCGAGCAAAUGGGGUGGAGGGGUGCUCUCCUGAGCCACAGAAGGAAUGGUCUGGUGGUAAGAAAAACACAAGUCAAACUUAUUCGAGUUGUCCACAGUCAGCAAUGGUGAUCUUCUUGC

[0320] SEQ ID NO: 35 mf-PPIA-3 circ-arRNA-432 CAUGGAACCCAAAGGGAACUGCAGCGAGAGCACAAAGAUUCUAGGAUACUGCGAGCAAAUGGGGUGGAGGGGUGCUCUCCGAGCCACAGAAGGAAUGGUCUGGUGGUAAGAAAAACACAAGUCAAACUUAUUCGAGUUGUCCACAGUCAGCAAUGGUGAUCUUCUUGC

[0321] SEQ ID NO: 36 mf-PPIA-3 circ-arRNA-4321 CAUGGAACCCAAAGGGAACUGCAGCGAGAGCACAAAGAUUCUAGGAUACUGCGAGCAAAUGGGGUGGAGGGGGCUCUCCGAGCCACAGAAGGAAUGGUCUGGUGGUAAGAAAAACACAAGUCAAACUUAUUCGAGUUGUCCACAGUCAGCAAUGGUGAUCUUCUUGC

[0322] sequence number 37 mf-IDUA-1 circ-arRNA-1 UAAAAGAAAAUAUAAAAAUAUAAAAAAAUAUAUUGCAAAGGAGGUGAUGAGAGGGCAGCGUGGGCACAGUGCAACCCCAGCUCGCCGACCGCCAGUGGAGGGCAGCCCAGUGGGGCUCAGCACAGGCUCAUGGAUUUCCAGGGGCUGGAGGCCUCUUGGCACAGGGACCUC

[0323] sequence number 38 mf-IDUA-1 circ-arRNA-2 UAAAAGAAAAUAUAAAAAUAUAAAAAAAUAUAUUGCAAAGGAGGUGAUGAGAGGGCAGCGUGGGCACAGUGCAACCCCAGCUCGCCGACCGCCAGUGGAGGUGCAGCCCAGUGGGGCCAGCACAGGCUCAUGGAUUUCCAGGGGCUGGAGGGCCCUCUUGGCACAGGGACCUC

[0324] sequence number 39 mf-IDUA-1 circ-arRNA-3 UAAAAGAAAAUAUAAAAAUAUAAAAAAAUAUAUUGCAAAGGAGGUGAUGAGAGGGCAGCGUGGGCACAGUGCAACCCCAGCUCGCCGACCGCCAGUGGAGGUGCAGCCCAGUGGGGCUCAGCACAGGCCAUGGAUUUCCAGGGGCUGGAGGGCCCUCUUGGCACAGGGACCUC

[0325] sequence number 40 mf-IDUA-1 circ-arRNA-4 UAAAAGAAAAUAAUAAAAUAUAAAAAAAUAUAUUGCAAAGGAGGUGAUGAGAGGGCAGCGUGGGCACAGUGCAACCCCAGCUCGCCGACCGCCAGUGGAGGUGCAGCCCAGUGGGGCUCAGCACAGGCUCAUGGAUUUCCAGGGGCUGGAGGCCCUCUGGCACAGGGACCUC

[0326] Sequence number 41 mf-IDUA-1 circ-arRNA-43 UAAAAGAAAAUAAUAAAAUAUAAAAAUAUAUUGCAAAGGAGGUGAUGAGAGGGCAGCGUGGGCACAGUGCAACCCCAGCUCGCCGACCGCCAGUGGAGGUGCAGCCCAGUGGGGCUCAGCACAGGCCAUGGAUUUCCAGGGGCUGGAGGCCCUCUGGCACAGGGACCUC

[0327] Sequence number 42 mf-IDUA-1 circ-arRNA-432 UAAAAGAAAAUAAUAAAAUAUAAAAAUAUAUUGCAAAGGAGGUGAUGAGAGGGCAGCGUGGGCACAGUGCAACCCCAGCUCGCCGACCGCCAGUGGAGGUGCAGCCCAGUGGGGCCAGCACAGGCCAUGGAUUUCCAGGGGCUGGAGGCCCUCUGGCACAGGGACCUC

[0328] Sequence number 43 mf-IDUA-1 circ-arRNA-4321 UAAAAGAAAAUAAUAAAAUAUAAAAAUAUAUUGCAAAGGAGGUGAUGAGAGGGCAGCGUGGGCACAGUGCAACCCCAGCUCGCCGACCGCCAGUGGAGGGCAGCCCAGUGGGGCCAGCACAGGCCAUGGAUUUCCAGGGGCUGGAGGCCCUCUGGCACAGGGACCUC

[0329] Sequence number 44 Target sequence of KRAS ACUGAAGGCGGCGGCGGGGCCAGAGGCUCAGCGGCUCCCAGGCCUGCUGAAAAUGACUGAAUAUAAACUUGUGGUAGUUGGAGCUGGUGGCGUAGGCAAGAGUGCCUUGACGAUACAGCUAAUUCAGAAUCAUUUUGUGGACGAAUAUGAU

[0330] Sequence number 45 Target sequence of RAB7A AAUGCAGGCCUGUAAGGUGGAGGGUUGAACCCUGUUUGGAUUGCAGAGUGUUACUCAGAAUUGGGAAAUCCAGCUAGCGGCAGUAUUCUGUACAGUAGACACAAGAAUUAUGUACGCCUUUUAUCAAAGACUUAAGAGCCAAAAAGCUUUU

[0331] Target sequence of FANCC, SEQ ID NO: 46 CUGCGGAGGUCCCUUUGAGAGCUGGUUCCUGUUCAUUCACUUCGGAGGAUGGGCUGAGAUGGUGGCAGAGCAAUUACUGAUGUCGGCAGCCGAACCCCCCACGGCCCUGCUGUGGCUCUUGGCCUUCUACUACGGCCCCCGUGAUGGGAGG

[0332] Target sequence of MALAT1, SEQ ID NO: 47 UCAGUUGCGUAAUGGAAAGUAAAGCCCUGAACUAUCACACUUUAAUCUUCCUUCAAAAGGUGGUAAACUAUACCUACUGUCCCUCAAGAGAACACAAGAAGUGCUUUAAGAGGUAUUUUAAAAGUUCCGGGGGUUUUGUGAGGUGUUUGAU

Claims

1. 1. A method for editing a target adenosine in a target RNA in a host cell, comprising introducing into the host cell ex vivo a deaminase-recruiting RNA (dRNA), or a construct comprising a nucleic acid sequence encoding a dRNA, (1) The dRNA comprises a targeting RNA sequence capable of hybridizing to a target RNA to form a double-stranded RNA, the double-stranded RNA comprising a bulge containing a non-target adenosine in the target RNA, the bulge being an asymmetric bubbling region in a nucleic acid duplex formed by one or more unpaired non-target adenosines in the target RNA of the nucleic acid duplex; (2) the dRNA is capable of recruiting adenosine deaminase (ADAR) that acts on RNA; and (3) The method, wherein the dRNA is linear RNA or circular RNA.

2. 2. The method of claim 1, wherein the targeting RNA sequence is complementary to the target RNA except that it lacks one or more nucleotides opposite a non-target adenosine in the target RNA.

3. The method described in claim 1, wherein the linear RNA is capable of forming a circular RNA.

4. 4. The method of claim 3, wherein the dRNA comprises a linker nucleic acid sequence adjacent to the end of the targeter RNA sequence, wherein the linker nucleic acid sequence does not form substantially a secondary structure with any portion of the dRNA, or wherein the dRNA comprises a linker nucleic acid sequence that replaces the end of the targeter RNA sequence, wherein the linker nucleic acid sequence does not form substantially a secondary structure with any portion of the dRNA.

5. 1. A method for editing a target adenosine in a target RNA in a host cell ex vivo, comprising introducing into said host cell a construct comprising a dRNA, or a nucleic acid sequence encoding the dRNA, (1) The dRNA comprises a targeting RNA sequence capable of hybridizing to a target RNA to form a double-stranded RNA, the double-stranded RNA comprises a bulge, the bulge being an asymmetric bubbling region in a nucleic acid duplex formed by one or more unpaired non-target adenosines in the target RNA of the nucleic acid duplex, the dRNA comprises a linker nucleic acid sequence adjacent to an end of the targeting RNA sequence, and the linker nucleic acid sequence does not substantially form a secondary structure with any part of the dRNA; (2) the dRNA is capable of recruiting ADAR; and (3) The method, wherein the dRNA is a circular RNA, a linear RNA, or a linear RNA capable of forming a circular RNA.

6. the linker nucleic acid sequence is 5 nucleotides (nt) to 500 nt in length; 6. The method of claim 5, wherein optionally, the linker nucleic acid sequence is 20 nt to 60 nt in length, or optionally, the linker nucleic acid sequence is 30 nt or 50 nt in length.

7. at least about any one of 50%, 60%, 70%, 80%, 85%, 90%, or 95% of the linker nucleic acid sequences comprise adenosine or cytidine, and optionally 100% of the linker nucleic acid sequences comprise adenosine or cytidine; and / or (b) the linker nucleic acid sequence comprises a polyadenosine (polyA), polyguanosine (polyG), or polycytosine (polyC) sequence; and / or (c) at least 50% of the linker nucleic acid sequences contain adenosines, and / or (d) the linker nucleic acid sequence comprises a dinucleotide repeat sequence, and / or (e) the linker nucleic acid sequence comprises SEQ ID NO: 22; 7. The method according to claim 5 or 6.

8. (a) the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence adjacent to the 3' end of the targeter RNA sequence; or (b) the dRNA comprises a first linker nucleic acid sequence adjacent to the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence replacing the 3' end of the targeter RNA sequence; or (c) the dRNA comprises a first linker nucleic acid sequence that replaces the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence that is adjacent to the 3' end of the targeter RNA sequence; or (d) the dRNA comprises a first linker nucleic acid sequence that replaces the 5' end of the targeter RNA sequence and a second linker nucleic acid sequence that replaces the 3' end of the targeter RNA sequence; or (e) the dRNA is a circular RNA, and the linker nucleic acid sequence connects the 5' end of the targeting RNA sequence to the 3' end of the targeting RNA sequence; 7. The method according to claim 5 or 6.

9. 7. The method of any one of claims 1, 5 and 6, wherein the targeting RNA sequence is greater than 50 nt in length, and optionally the targeting RNA sequence is 100-200 nt in length.

10. (a) an ADAR3 inhibitor and / or an interferon stimulator, and / or (b) multiple dRNAs or constructs, each targeting a different target RNA; and / or (c) ADAR, 7. The method of any one of claims 1, 5 and 6, further comprising introducing into said host cell.

11. deamination of the target adenosine in the target RNA causes a missense mutation, a premature stop codon, regulatory splicing, aberrant splicing or alternative splicing in the target RNA, or reversion of the missense mutation, a premature stop codon, regulatory splicing, aberrant splicing or alternative splicing in the target RNA; 7. The method of any one of claims 1, 5 and 6.

12. 7. The method of any one of claims 1, 5 and 6, wherein the host cell is a mammalian cell.

13. A construct comprising a dRNA or a nucleic acid sequence encoding said dRNA, A construct comprising a dRNA for editing a target RNA, the dRNA comprising a targeting RNA sequence capable of hybridizing to the target RNA to form a double-stranded RNA capable of recruiting adenosine deaminase (ADAR) acting on RNA, wherein the double-stranded RNA comprises a bulge containing a non-target adenosine in the target RNA, the bulge being an asymmetric bubbling region in a nucleic acid duplex formed by one or more unpaired non-target adenosines in the target RNA of the nucleic acid duplex, or a nucleic acid sequence encoding the dRNA.

14. A construct comprising a dRNA or a nucleic acid sequence encoding the dRNA, as described in claim 13, wherein the dRNA comprises a linker nucleic acid sequence adjacent to or replacing the end of the targeting RNA sequence, the linker nucleic acid sequence not forming substantially a secondary structure with any part of the dRNA, and the dRNA is a circular RNA, a linear RNA, or a linear RNA capable of forming a circular RNA.

Images