tobacco plant

Abstract

The present invention relates to a tobacco plant, etc.　This tobacco plant has either one or both of the following: (i) an endogenous gene containing, as an encoding region, a nucleic acid containing a base sequence encoding SEQ ID NO: 2 or an amino acid sequence having at least 95% identity with SEQ ID NO: 2, in which at least one codon corresponding to the amino acid sequence has mutated to a stop codon; and (ii) an endogenous gene containing, as an encoding region, a nucleic acid containing a base sequence encoding SEQ ID NO: 4 or an amino acid sequence having at least 95% identity with SEQ ID NO: 4, in which at least one codon corresponding to the amino acid sequence has mutated to a stop codon.

Description

[Technical Field]

[0001] The present invention relates to tobacco plants, methods for producing said tobacco plants, tobacco leaves harvested from said tobacco plants, and uses thereof. [Background technology]

[0002] Tobacco-specific nitrosamines (TSNAs) are nitrosation products of tobacco alkaloids, primarily produced during tobacco leaf curing. Tobacco plants accumulate high levels of free nitrate in their leaves, which is related to the formation of TSNAs. Nitrite is believed to be the substance directly involved in TSNA formation during tobacco leaf curing. Free nitrate accumulated in tobacco leaves is converted to nitrite by the tobacco's nitrate reductase (NR). However, because nitrite is cytotoxic and rapidly metabolized, the amount of endogenous nitrite in plant tissues is generally very low. Most of the nitrite involved in TSNA formation during tobacco leaf curing is thought to be produced from nitrate by microorganisms living on the leaf surface. Specifically, as leaf tissue decomposes during the tobacco leaf curing process, nitrate accumulated in the leaf is leached and converted to nitrite by the nitrate reductase (NR) of microorganisms living on the leaf surface. Once nitrite is formed, these compounds combine with various tobacco alkaloids (e.g., pyridine-containing compounds) to form nitrosamines.

[0003] Plant J. 2000, 21(3) pp. 259-267 reports that Arabidopsis CLCa mutants have reduced nitrate and increased nitrite levels in leaves. The amount of nitrate accumulated in leaves of Arabidopsis mutants was approximately 40% of that of controls. New Phytologist 2009, 183, pp. 88-94 reports that Arabidopsis CLCe mutants have reduced nitrate and increased nitrite levels in leaves. In tobacco, it is expected that increased nitrite levels will also increase TSNA levels.

[0004] WO 2014 / 096283 describes the creation of recombinant plants in which the expression of the CLC-NT2 gene (corresponding to the NtCLCa-S gene described below) and the NtCLCe gene, which are presumed to be orthologs of the Arabidopsis CLCa and CLCe genes in tobacco, was silenced by RNAi. In both RNAi recombinant plants, expression of both the CLC-NT2 and NtCLCe genes was silenced. Furthermore, both RNAi recombinant plants were confirmed to have reduced nitrate levels in leaves, but it is unclear whether this nitrate reduction was due to the effect of CLC-NT2, NtCLCe, or a synergistic effect. Furthermore, the degree of nitrate reduction was approximately 40%-50% (Example 6, Figure 3).

[0005] The CLC-NT2 mutant G163R disclosed in WO2014 / 096283 has the following characteristics: (i) the amount of nitrate in leaves from early morning to the morning was lower than that of the control, but exceeded that of the control before noon (Example 8, Figure 5); and (ii) the degree of nitrate reduction was only about 50% of that of the wild type. The NtCLCe P143L mutant had lower nitrate in leaves before noon than that of the control, but exceeded that of the control in the early morning (Example 9, Figure 6). Both the G163R and P143L mutants are missense mutants. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] WO2014 / 096283 [Patent Document 2] WO2022 / 124361 [Non-patent literature]

[0007] [Non-Patent Document 1] Plant J.2000,21(3)p259-267 [Non-patent document 2] New Phytologist, 2009, 183, p88-94 [Non-patent document 3] Nature(2006) 442 (7105):939-42 [Non-patent document 4] Communicative & Integrative Biology.2010;3(2)122-129 [Non-patent document 5] Mol.Genet.Genomics.(2010) 283:233-241 [Non-patent document 6] Phil. Trans. R. Soc. B (2009) 364,195-201 [Non-Patent Document 7] BMC genomics,(2017) 18(1),1-14 Summary of the Invention [Problem to be solved by the invention]

[0008] Nitrate contained in tobacco leaves is known to be involved in TSNA production. There is a need for a method for significantly reducing the nitrate content in tobacco leaves (preferably by 50% or more), and for the development of tobacco plants with reduced nitrate content. As a result of intensive research by the present inventors to solve the above problems, they found that tobacco plants having a stop codon in the NtCLCa-S gene and / or the NtCLCa-T gene have significantly reduced nitrate content in their leaves without adversely affecting growth, compared to control tobacco plants without the stop codon, and thus conceived the present invention. [Means for solving the problem]

[0009] The present invention includes, but is not limited to, the following aspects. [Aspect 1] (i) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2, in which at least one codon corresponding to the amino acid sequence is mutated to a stop codon; and (ii) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4, in which at least one codon corresponding to the amino acid sequence is mutated to a stop codon; Tobacco plants that contain either or both of the endogenous genes. [Aspect 2] The following requirements: In the nucleic acid contained in the endogenous gene of (i), at least one codon corresponding to the amino acids at positions 233 to 285 of SEQ ID NO: 2 is mutated to a stop codon; and (ii) In the nucleic acid contained in the endogenous gene, at least one codon corresponding to the amino acids at positions 233 to 285 of SEQ ID NO: 4 is mutated to a stop codon. The tobacco plant of embodiment 1, which satisfies either one or both of the above requirements. [Aspect 3] The tobacco plant of embodiment 1 or 2, which has both endogenous genes (i) and (ii). [Aspect 4] The tobacco plant according to any one of Aspects 1 to 3, wherein the endogenous gene (i) and / or the endogenous gene (ii) is homozygous. [Aspect 5] The tobacco plant according to any one of Aspects 1 to 4, wherein in the nucleic acid contained in the endogenous gene of (i), the codon corresponding to the amino acid at position 279 of SEQ ID NO: 2 is mutated to a stop codon. [Aspect 6] The tobacco plant according to any one of Aspects 1 to 5, wherein in the nucleic acid contained in the endogenous gene (ii), the codon corresponding to the amino acid at position 285 of SEQ ID NO: 4 is mutated to a stop codon. [Aspect 7] The tobacco plant according to any one of Aspects 1 to 5, wherein in the nucleic acid contained in the endogenous gene (ii), the codon corresponding to the amino acid at position 233 of SEQ ID NO: 4 is mutated to a stop codon. [Aspect 8] In the nucleic acid contained in the endogenous gene of (i), the codon corresponding to the amino acid at position 279 of SEQ ID NO: 2 is mutated to a stop codon, and (ii) In the nucleic acid contained in the endogenous gene, the codon corresponding to the amino acid at position 233 or 285 of SEQ ID NO: 4 is mutated to a stop codon. 7. The tobacco plant of any one of aspects 1-6. [Aspect 9] The tobacco plant according to any one of Aspects 1 to 8, wherein in the nucleic acid contained in the endogenous gene of (i), the amino acid encoded by the nucleic acid corresponding to position 163 of SEQ ID NO: 2 is glycine. [Aspect 10] (iii) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding an amino acid sequence having SEQ ID NO: 8 or an amino acid sequence having at least 95% identity to SEQ ID NO: 8, wherein the amino acid at position 231 of the amino acid sequence is proline; 10. The tobacco plant of any one of aspects 1-9, further comprising: [Aspect 11] It has one or more of the following properties (a)-(c): (a) reduced nitrate content compared to the control; (b) equivalent nitrite content compared to the control; (c) increased amino acid content compared to the control; wherein the control is a tobacco plant containing a polypeptide having the amino acid sequence of SEQ ID NO: 2 and a polypeptide having the amino acid sequence of SEQ ID NO: 4; 11. The tobacco plant of any one of aspects 1-10. [Aspect 12] Compared to the control, Nitric acid content 12. The tobacco plant of embodiment 11, wherein said tobacco plant has at least 80% reduction in [Aspect 13] 13. The tobacco plant of any one of aspects 1-12, wherein the tobacco plant is a mutant or genetically modified. [Aspect 14] Aspect 14. The tobacco plant of any one of aspects 1-13, wherein the tobacco plant is Nicotiana tabacum. [Aspect 15] An endogenous gene comprising, as a coding region, a nucleotide sequence encoding a polypeptide lacking the amino acid sequence from amino acid residues between positions 233 and 285 to the C-terminal amino acid residue in SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2; and A tobacco plant having either or both of the endogenous genes: an endogenous gene having as its coding region a base sequence encoding a polypeptide lacking the amino acid sequence from amino acid residues 233 to 285 to the C-terminal amino acid residue in an amino acid sequence having at least 95% identity to SEQ ID NO: 4; [Aspect 16] In tobacco plants, (i) introducing a mutation into an endogenous gene containing, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2, so that at least one codon corresponding to said amino acid sequence becomes a stop codon; and / or (ii) In an endogenous gene containing, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4, a mutation is introduced so that at least one codon corresponding to the amino acid sequence becomes a stop codon. 15. A method for producing the tobacco plant of any one of aspects 1-14, comprising: [Aspect 17] (i) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2, in which at least one codon corresponding to the amino acid sequence is mutated to a stop codon; and (ii) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4, in which at least one codon corresponding to the amino acid sequence is mutated to a stop codon; Selecting tobacco plants that have either one or both of the endogenous genes. 15. A method for producing the tobacco plant of any one of aspects 1-14, comprising: [Aspect 18] 18. The method of embodiment 16 or 17, further comprising selecting a tobacco plant having reduced nitrate content. [Aspect 19] 15. Tobacco leaf harvested from the tobacco plant of any one of aspects 1-14. [Aspect 20] 20. A cured leaf produced from the tobacco leaf of embodiment 19. [Aspect 21] A cut filler, powder, sheet, backbone, granules, or extract produced from the dried leaves according to aspect 20. [Aspect 22] A tobacco product comprising the dried leaves according to Aspect 20 and / or the cut filler, powder, sheet, rib, granules, or extract according to Aspect 21. [Effects of the Invention]

[0010] Tobacco plants of the present invention that have a stop codon in the NtCLCa-S gene and / or the NtCLCa-T gene have significantly reduced nitrate levels in their leaves (preferably by about 80% or more) compared to control tobacco plants that do not have a stop codon in those genes. By using tobacco plants of the present invention, TSNAs in tobacco raw materials and tobacco products can be reduced. Tobacco plants of the present invention not only have reduced nitrate levels in their leaves, but also do not have increased nitrite levels in their leaves. Preferably, the plants also grow well, and no increase in adaptation costs in cultivation, such as delayed flowering, is observed. Tobacco plants of the present invention also have increased amino acid content in their leaves. Amino acids are known to affect the aroma and flavor of tobacco. Therefore, an increased amino acid content improves the aroma and flavor, and is an excellent and significant effect when used as a leaf tobacco material for producing tobacco products. [Brief explanation of the drawings]

[0011] [Figure 1] Figure 1 shows the amount of nitrate in the leaf lamina of each mutant and wild-type. Ho, He, and W represent a homozygote for the mutant allele of the NtCLCa gene, a heterozygote for the mutant allele and the wild-type allele, and a wild-type with no mutation, respectively. The genotypes of the NtCLCa-S gene and the NtCLCa-T gene are listed in that order. For example, HeHo represents a heterozygote for the mutant allele and the wild-type allele for the NtCLCa-S gene, and a homozygote for the mutant allele for the NtCLCa-T gene. WT represents a homozygote for the wild-type gene and is the control tobacco (cultivar: Tsukuba No. 1). The number of repeats is 4 for WT and 5 for all others. Error bars represent standard deviation. Significant difference by t-test: *P<0.05, **P<0.01. [Figure 2]Figure 2 shows the amount of nitrite in the leaves (lamina) of each mutant and wild-type. Ho, He, and W represent a homozygote for the mutant allele of the NtCLCa gene, a heterozygote for the mutant allele and the wild-type allele, and a wild-type with no mutation, respectively. The genotypes of the NtCLCa-S gene and the NtCLCa-T gene are listed in that order. For example, HeHo represents a heterozygote for the mutant allele and the wild-type allele for the NtCLCa-S gene, and a homozygote for the mutant allele for the NtCLCa-T gene. WT represents wild-type tobacco (cultivar: Tsukuba No. 1). The number of repeats is 4 for WT and 5 for all others. Error bars represent standard deviation. [Figure 3] Figure 3 shows the amount of free amino acids in the leaves (lamina) of each mutant and wild-type. Ho and W represent a homozygote for the mutant allele of the NtCLCa gene and a wild-type with no mutation, respectively. The genotypes of the NtCLCa-S gene and the NtCLCa-T gene are listed in that order; for example, HeHo represents a heterozygote for the mutant allele and the wild-type allele for the NtCLCa-S gene, and a homozygote for the mutant allele for the NtCLCa-T gene. There are 5 replicates, and error bars represent standard deviations. Significant difference by t-test: *P<0.05, **P<0.01 [Figure 4] Figure 4 shows photographs of the growth of mutant and wild-type tobacco plants at the time of sampling (20 days after transplantation). Ho, He, and W represent a homozygote for the mutant allele of the NtCLCa gene, a heterozygote for the mutant allele and the wild-type allele, and a wild-type plant without the mutation. The genotypes of the NtCLCa-S gene and the NtCLCa-T gene are listed in that order. For example, HeHo represents a heterozygote for the mutant allele and the wild-type allele of the NtCLCa-S gene and a homozygote for the mutant allele of the NtCLCa-T gene. [Figure 5]Figure 5 shows the diurnal variation in nitrate levels in the leaves (lamina) of HoHo and WW. Ho and W represent the homozygote for a mutant allele of the NtCLCa gene, and the wild type without the mutation. The genotypes for the NtCLCa-S gene and the NtCLCa-T gene are listed in that order; for example, HoHo is a homozygote for mutant alleles of both the NtCLCa-S and NtCLCa-T genes. The number of repeats for HoHo after 8 hours in the dark is 3, while the others are 4. The error bars represent the standard deviation. In Figure 5, the black circles represent the results for HoHo, and the black squares represent the results for WW. [Figure 6] Figure 6 shows the diurnal variation in nitrite levels in the leaves (lamina) of HoHo and WW. Ho and W represent the homozygote for a mutant allele of the NtCLCa gene, and the wild type without the mutation. The genotypes for the NtCLCa-S gene and the NtCLCa-T gene are listed in that order; for example, HoHo is a homozygote for mutant alleles of both the NtCLCa-S and NtCLCa-T genes. The number of repeats for HoHo after 8 hours in the dark is 3, while the others are 4. The error bars represent the standard deviation. In Figure 6, the black circles represent the results for HoHo, and the black squares represent the results for WW. [Figure 7] Figure 7 shows the results of an analysis of NtCLCa gene expression levels in the NtCLCa mutant. Ribosomal protein L25 (accession number L18908) was used as a control gene, and the results are shown as the average relative quantification (ΔΔCt method) of the target expression level. There were 10 replicates, and error bars represent standard deviations. Significant difference by t-test: *P<0.05. For both sets of primers used, the expression level of the NtCLCa gene was significantly lower in HoHo than in WW, approximately half that of WW. [Figure 8]Figure 8 shows the results of an analysis of NtCLCe gene expression levels in the NtCLCa mutant. The results are shown as the average relative expression levels (ΔΔCt method) using ribosomal protein L25 (accession number L18908) as a control gene. No significant differences were observed in the NtCLCe gene expression levels between HoHo and WW. There were 10 replicates, and error bars represent standard deviations. [Figure 9] Figure 9 shows photographs of the growth of mutant and wild-type tobacco plants 54 days after transplantation. Ho and W represent homozygotes with a mutant allele of the NtCLCa gene, and wild-type plants without the mutation. The genotypes of the NtCLCa-S gene and the NtCLCa-T gene are listed in that order. For example, HoHo represents a homozygote with mutant alleles for both the NtCLCa-S gene and the NtCLCa-T gene. [Figure 10] Figure 10 is a photograph showing the growth of mutant and wild-type tobacco plants 20 days after transplantation (at the time of sampling). Ho and W represent homozygotes for mutant alleles of the NtCLCa gene and NtNIA1 gene, respectively, and wild-type plants without mutations. The genotypes of the NtCLCa-S gene, NtCLCa-T gene, and NtNIA1 gene are listed in this order. HoHoHe represents homozygotes for mutant alleles of both the NtCLCa-S gene and the NtCLCa-T gene, and heterozygotes for the mutant and wild-type alleles of the NtNIA1 gene. DETAILED DESCRIPTION OF THE INVENTION

[0012] The present invention includes, but is not limited to, the following embodiments. Unless otherwise specified herein, technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. The substances, materials, and examples disclosed herein are merely illustrative and are not intended to be limiting. When referring to "in one embodiment" in this specification, it means that the embodiment is not limited, i.e., is not limited.

[0013] 1. Tobacco plants In one aspect, the present invention relates to a tobacco plant. The tobacco plant of the present invention comprises: (i) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2, in which at least one codon corresponding to the amino acid sequence is mutated to a stop codon; and (ii) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4, in which at least one codon corresponding to the amino acid sequence is mutated to a stop codon; They have either one or both of the endogenous genes.

[0014] An "endogenous gene" refers to a gene that is endogenously present in the genome of a target tobacco plant, rather than a gene introduced from outside the body of the tobacco plant. The "endogenous gene" used in the present invention is not a wild-type gene containing a nucleic acid encoding the amino acid sequence of a so-called wild-type protein (e.g., SEQ ID NO: 2, SEQ ID NO: 4, etc.), but rather a gene containing a mutation, as described above. The endogenous gene (i) and / or the endogenous gene (ii) may be either a heterozygote of a mutant gene containing the mutation and a gene not containing the mutation, or a homozygote of a mutant gene containing the mutation.

[0015] "Tobacco plants" refer to plants of the genus Nicotina in the family Solanaceae, such as Nicotiana acaulis, Nicotiana acuminata, Nicotiana acuminata var. multzjlora, Nicotiana africana, Nicotiana alata, Nicotiana amplexicaulis, Nicotiana arentsii, Nicotiana attenuata, Nicotiana benavidesii, and Nicotiana benthamiana. benthamiana, Nicotiana bigelovii, Nicotiana bonariensis, Nicotiana cavicola, Nicotiana clevelandii, Nicotiana cordifolia, Nicotiana corymbosa, Nicotiana debneyi, Nicotiana excelsior, Nicotiana forgetiana, Nicotiana fragrans, Nicotiana glauca, Nicotiana glutinosa, Nicotiana goodspeedii goodspeedii), Nicotiana gossei, Nicotiana ingulba, Nicotiana kawakamii, Nicotiana naitianaknightiana, Nicotiana langsdorfi, Nicotiana linearis, Nicotiana longiflora, Nicotiana maritima, Nicotiana megalosiphon, Nicotiana miersii, Nicotiana noctiflora, Nicotiana nudicaulis, Nicotiana obtusifolia, Nicotiana occidentalis, Nicotiana occidentalis subsp. hesperis Hesperis, Nicotiana otophora, Nicotiana paniculata, Nicotiana pauczjlora, Nicotiana petunioides, Nicotiana plumbaginifolia, Nicotiana quadrivalvis, Nicotiana raimondii, Nicotiana repanda, Nicotiana rosulata, Nicotiana rosulata subsp. Ingulba, Nicotiana rotundifolia rotundifolia, Nicotiana rustica (Mullet tobacco), Nicotiana setchellii, Nicotiana simulans, Nicotiana solanifoliasolanifolia, Nicotiana spegauinii, Nicotiana stocktonii, Nicotiana suaveolens, Nicotiana sylvestris, Nicotiana tabacum, Nicotiana thyrsiflora, Nicotiana tomentosa, Nicotiana tomentosifomis, Nicotiana trigonophylla, Nicotiana umbratica, Nicotiana undulata, Nicotiana velutina Examples of suitable tobacco plants include, but are not limited to, Nicotiana benthamiana, Nicotiana rustica, and Nicotiana tabacum, and hybrids of Nicotiana plants. Examples of suitable tobacco plants include, but are not limited to, Nicotiana benthamiana, Nicotiana rustica, and Nicotiana tabacum, and particularly preferred are Nicotiana rustica and Nicotiana tabacum, which are used as raw materials for tobacco leaf production.

[0016] In one embodiment, the tobacco plant is Nicotiana tabacum.

[0017] Tobacco plants can include not only the adult, whole tobacco plant, but also parts thereof, including, but not limited to, leaves (including leaf blades and petioles), stems, roots, seeds, flowers, pollen, anthers, ovules, pedicels, meristems, cotyledons, hypocotyls, pericycles, embryos, endosperms, explants, calluses, tissue cultures, buds, cells, and protoplasts.

[0018] The tobacco plant (i) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2, in which at least one codon corresponding to the amino acid sequence is mutated to a stop codon; and (ii) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4, in which at least one codon corresponding to the amino acid sequence is mutated to a stop codon; They have either one or both of the endogenous genes.

[0019] Nicotiana tabacum is an amphidiploid plant whose genome contains two parts: one derived from the ancestor of Nicotiana sylvestris (S genome) and the other derived from the ancestor of Nicotiana tomentosiformis (T genome). In many cases, Nicotiana tabacum contains two types of genes: one derived from the S genome and one from the T genome.

[0020] SEQ ID NO:2 is the amino acid sequence of the NtCLCa-S protein, which is a tobacco homolog of AtCLCa, a member of the Arabidopsis chloride channel (CLC) family. The NtCLCa-S gene is located on the S genome of Nicotiana tabacum (Nt). SEQ ID NO:1 is the nucleotide sequence of the coding sequence (CDS) of the NtCLCa-S gene. SEQ ID NO:4 is the amino acid sequence of the NtCLCa-T protein, which is a tobacco homolog of AtCLCa, and is located on the T genome of Nicotiana tabacum (Nt). SEQ ID NO:3 is the nucleotide sequence of the CDS of the NtCLCa-T gene. The amino acid sequence of the NtCLCa-S protein is 98% identical to that of the NtCLCa-T protein, and the CDS of the NtCLCa-S gene is 97% identical to that of the NtCLCa-T gene.

[0021] The CLC family is a group of proteins that constitute a group of voltage-gated ion channels. In plants, chloride channels are involved in the transport of various anions (Phil. Trans. R. Soc. B (2009) 364,195-201) and contribute to numerous plant-specific functions, such as turgor regulation, stomatal movement, nutrient transport, and / or metal tolerance, among others.

[0022] Arabidopsis CLCa (AtCLCa) mediates the accumulation of nitrate in plant vacuoles as a nitrate / proton exchange transporter (Nature (2006) 442 (7105):939-42). The paper also reports that, as a result of electrophysiological analysis, AtCLCa specifically accumulates nitrate ions in vacuoles. 3- / 1H + It has been reported that AtCLCe is a nitrate exchanger. A similar method can be used to test the nitrate transporter activity of NtCLCe. Communicative & Integrative Biology. 2010; 3(2) 122-129 and New Phytol. 2009; 183(1): 88-94 disclose that AtCLCe may be involved in the transport of nitrite taken up by the nitrite transporter in the chloroplast envelope from the stroma to the thylakoid of the chloroplast. The method for measuring this activity described in Nature (2006) 442 (7105): 939-42 may be used to measure the activity of NtCLCe, but is not limited to this.

[0023] NtCLCa herein is presumed to be an orthologue of Arabidopsis CLCa (AtCLCa) from the viewpoints of sequence homology and function.

[0024] The base sequence contained in the nucleic acid may be a base sequence encoding SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2. SEQ ID NO: 4 orIt may be a nucleotide sequence encoding an amino acid sequence having at least 95% identity to SEQ ID NO: 4. In one embodiment, the identity is at least 96%, at least 97%, at least 98%, or at least 99%.

[0025] As used herein, the percent identity between two amino acid sequences can be determined by visual inspection and mathematical calculation. Percent identity can also be determined using a computer program. Examples of such computer programs include BLAST and ClustalW. In particular, the various conditions (parameters) for identity searches using the BLAST program are described in Altschul et al. (Nucl. Acids. Res., 25, pp. 3389-3402, 1997) and are publicly available from the websites of NCBI and the DNA Data Bank of Japan (DDBJ) (BLAST Manual, Altschul et al., NCB / NLM / NIH, Bethesda, MD 20894; Altschul et al.). Percent identity can also be determined using genetic information processing software programs such as GENETYX (Genetyx), DNASIS Pro (Hitachi Software), and Vector NTI (Infomax).

[0026] As used herein, the percent identity between two nucleotide sequences can be determined by visual inspection and mathematical calculation. Percent identity can also be determined using a computer program. Examples of such sequence comparison computer programs include the BLASTN program (Altschul et al. (1990) J. Mol. Biol. 215:403-10): version 2.2.7, available from the U.S. National Library of Medicine website: https: / / blast.ncbi.nlm.nih.gov / Blast.cgi, or the WU-BLAST2.0 algorithm. Standard default parameter settings for WU-BLAST2.0 can be found at the following internet site: http: / / blast.wustl.edu.

[0027] An "amino acid sequence having at least 95% identity with SEQ ID NO: 2 or at least 95% identity with SEQ ID NO: 4" may be an amino acid sequence in which one or several amino acids have been deleted, substituted, inserted, or added from the amino acid sequence of SEQ ID NO: 2 or 4. The phrase "one or several amino acids have been deleted, substituted, inserted, or added" refers to an amino acid sequence in which one or several amino acids have been deleted, substituted, inserted, and / or added from the target amino acid sequence. "Several amino acids" refers to, but is not limited to, 40 or less, 35 or less, 30 or less, 25 or less, 20 or less, 15 or less, 12 or less, 10 or less, 8 or less, 6 or less, 5 or less, 4 or less, 3 or less, or 2 or less amino acids. Alternatively, "several amino acids" refers to 5%, preferably 4%, 3%, 2%, or 1% of the total amino acid sequence.

[0028] The substitution of an amino acid residue in an amino acid sequence having at least 95% identity with SEQ ID NO: 2 or at least 95% identity with SEQ ID NO: 4 is preferably a conservative substitution. A conservative substitution refers to the replacement of a specific amino acid residue with a residue having similar physicochemical characteristics. Any substitution is acceptable as long as it does not substantially change the structural characteristics of the original sequence, for example, as long as the substituted amino acid does not disrupt the helix present in the original sequence or other types of secondary structure that characterize the original sequence. Below, conservative substitutions of amino acid residues are categorized by substitutable residue, and examples of such substitutions are provided; however, the substitutable amino acid residues are not limited to those listed below.

[0029] Group A: leucine, isoleucine, valine, alanine, methionine, glycine, cysteine, proline Group B: aspartic acid, glutamic acid Group C: asparagine, glutamine D group: lysine, arginine Group E: serine, threonine Group F: phenylalanine, tyrosine, tryptophan, histidine In the case of non-conservative substitutions, one member of the above-mentioned group can be exchanged for a member of another group. For example, amino acids in the above-mentioned groups B, D, and E can be substituted with amino acids from other groups to eliminate inadvertent glycosylation. Alternatively, cysteines can be deleted or substituted with other amino acids to prevent folding into a protein in a tertiary structure. Alternatively, amino acids can be substituted taking into account the hydropathic index of amino acids, which is an index of hydrophobicity / hydrophilicity for amino acids (J. Kyte and R. Doolittle, J. Mol. Biol., Vol. 157, pp. 105-132, 1982), to maintain a balance between hydrophilicity and hydrophobicity or to increase hydrophilicity for easier synthesis.

[0030] In another embodiment, substitution with an amino acid that is less sterically hindered than the original amino acid may be performed, for example, substitution of group F with group A, B, C, D, or E; or substitution of a charged amino acid with an uncharged amino acid, for example, substitution of group B with group C.

[0031] A protein comprising an amino acid sequence having at least 95% identity with SEQ ID NO: 2 or an amino acid sequence having at least 95% identity with SEQ ID NO: 4, or consisting of these amino acid sequences, has the function of a protein comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or the amino acid sequence of SEQ ID NO: 4, respectively, preferably the function of CLCa, which is a CLC family member. Having the function of CLCa means that in a plant body, nitrate ions can be specifically accumulated in vacuoles, and 2NO 3- / 1H + It means that it functions as an exchanger.

[0032] In "SEQ ID NO: 2 or a nucleotide sequence encoding an amino acid sequence having at least 95% identity to SEQ ID NO: 2," or "SEQ ID NO: 4 or a nucleotide sequence encoding an amino acid sequence having at least 95% identity to SEQ ID NO: 4," at least one codon corresponding to the amino acid sequence is mutated to a stop codon. By mutating at least one codon corresponding to the amino acid sequence to a stop codon, a protein may be produced that lacks the amino acid residues preceding the stop codon (downstream). Alternatively, no protein may be produced.

[0033] The tobacco plant has either or both of the following endogenous genes: (i) an endogenous gene comprising, as a coding region, a nucleic acid comprising a nucleotide sequence encoding SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2, wherein at least one codon corresponding to the amino acid sequence has been mutated to a stop codon, and (ii) an endogenous gene comprising, as a coding region, a nucleic acid comprising a nucleotide sequence encoding SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4, wherein at least one codon corresponding to the amino acid sequence has been mutated to a stop codon. In one embodiment, the tobacco plant has both endogenous genes.

[0034] In one embodiment, the tobacco plant meets the following requirements: In the nucleic acid contained in the endogenous gene of (i), at least one codon corresponding to the amino acids at positions 233 to 285 of SEQ ID NO: 2 is mutated to a stop codon; and (ii) In the nucleic acid contained in the endogenous gene, at least one codon corresponding to the amino acids at positions 233 to 285 of SEQ ID NO: 4 is mutated to a stop codon. In one embodiment, the present invention satisfies either one or both of the above requirements.

[0035] "Corresponding to amino acids at positions 233 to 285 of SEQ ID NO: 2" refers to amino acid residues that can be understood to "correspond to amino acids at positions 233 to 285 of SEQ ID NO: 2" based on information about the surrounding amino acid sequences when compared with SEQ ID NO: 2 in an "amino acid sequence having at least 95% identity to SEQ ID NO: 2." The amino acid positions at positions 233 to 285 in an "amino acid sequence having at least 95% identity to SEQ ID NO: 2" do not necessarily have to be completely identical. For example, even if an amino acid sequence not present in SEQ ID NO: 2 is added to the N-terminus or if intermediate amino acid residues are deleted, amino acid residues that can be understood to "correspond to amino acids at positions 233 to 285 of SEQ ID NO: 2" can be identified by comparison with SEQ ID NO: 2. "Corresponding to amino acids at positions 233 to 285 of SEQ ID NO: 4" also has the same meaning.

[0036] In the Examples, two mutants were obtained: a mutant (222T) in which the codon encoding tryptophan (W) at position 233 in the polypeptide translated from the NtCLCa-T gene is changed to a stop codon, and a mutant (223T) in which the codon encoding tryptophan (W) at position 285 is changed to a stop codon. Both mutants were confirmed to have the effect of reducing nitrate. Therefore, a tobacco plant containing as an endogenous gene at least (ii) a nucleic acid in which at least one of the codons corresponding to the amino acids between positions 233 and 285 of SEQ ID NO: 4 is mutated to a stop codon as a coding region can obtain the same effect.

[0037] We also isolated a mutant (220S) in which the codon encoding tryptophan (W) at position 279 in the polypeptide translated from the NtCLCa-S gene was mutated to a stop codon, and confirmed that this mutant had the ability to reduce nitrate. The amino acid sequences from positions 233 to 285 in SEQ ID NO:2 and SEQ ID NO:4 are identical. Therefore, similar to the NtCLCa-T gene, tobacco plants containing the NtCLCa-S gene as an endogenous gene (i) containing a nucleic acid in which at least one of the codons corresponding to amino acids between positions 233 and 285 in SEQ ID NO:2 has been mutated to a stop codon are expected to achieve similar effects. This is consistent with the results described in the Examples, which suggest that NtCLCa-S and NtCLCa-T have equivalent nitrate transport abilities.

[0038] In the present invention, the mutation to a "stop codon" includes a case where a nonsense mutation occurs in the NtCLCa gene, resulting in a stop codon at (only) the corresponding codon, and a case where a frameshift occurs due to the insertion or deletion of bases in the NtCLCa gene, resulting in a mutation to a "stop codon." In the latter case, it is preferable that a base be inserted or deleted at position 697 or later in the CDS sequence set forth in SEQ ID NO: 1 or 3.

[0039] In one aspect, in the nucleic acid contained in the endogenous gene of (i), a nonsense mutation due to a single base substitution has occurred in at least one of the codons corresponding to the amino acids at positions 233, 235, 238, 246, 251, 253, 254, 255, 258, 273, 278, 279, 280, or 285 of SEQ ID NO: 2. One is It has been mutated to a stop codon.

[0040] In one aspect, in the nucleic acid contained in the endogenous gene of (i), a frameshift occurs due to the insertion of one base, and at least one base is inserted in the codon corresponding to the amino acid at position 233, 235, 238, 240, 241, 242, 244, 245, 247, 251, 258, 278, 279, 280, 281, or 285 from the beginning of the translatable amino acid sequence. One is It has been mutated to a stop codon.

[0041] In one aspect, in the nucleic acid contained in the endogenous gene of (i), one base is deleted, resulting in a deletion of the 794th to 796th bases of the CDS sequence set forth in SEQ ID NO: 1. base TAG, 815-817 Eye bases becomes TAG, and the amino acids at positions 265 and 272 of SEQ ID NO: 2 are The codon corresponding to is mutated to a stop codon.

[0042] In one aspect, in the nucleic acid contained in the endogenous gene of (ii), a nonsense mutation due to a single base substitution has occurred in at least one codon corresponding to an amino acid at position 233, 235, 238, 246, 251, 253, 254, 255, 258, 273, 278, 279, 280, or 285 of SEQ ID NO: 4. One is It has been mutated to a stop codon.

[0043] In one aspect, in the nucleic acid contained in the endogenous gene of (ii), a frameshift occurs due to the insertion of one base, and at least one base is inserted in a codon corresponding to an amino acid at positions 233, 235, 238, 240, 241, 242, 244, 245, 247, 251, 258, 278, 279, 280, 281, or 285 from the beginning of the translatable amino acid sequence. One is It has been mutated to a stop codon.

[0044] In one aspect, in the nucleic acid contained in the endogenous gene of (ii), one base is deleted to form the 794th to 796th bases of the CDS sequence set forth in SEQ ID NO: 3. base TAG, 815-817 Eye basesbecomes TAG, and the amino acids at positions 265 and 272 of SEQ ID NO: 4 are The codon corresponding to is mutated to a stop codon.

[0045] In one embodiment, in the nucleic acid contained in the endogenous gene of (i), the codon corresponding to the amino acid at position 279 of SEQ ID NO: 2 is mutated to a stop codon.

[0046] In one embodiment, in the nucleic acid contained in the endogenous gene of (ii), the codon corresponding to the amino acid at position 285 of SEQ ID NO: 4 is mutated to a stop codon.

[0047] In one embodiment, in the nucleic acid contained in the endogenous gene of (ii), the codon corresponding to the amino acid at position 233 of SEQ ID NO: 4 is mutated to a stop codon.

[0048] In one aspect, In the nucleic acid contained in the endogenous gene of (i), the codon corresponding to the amino acid at position 279 of SEQ ID NO: 2 is mutated to a stop codon, and In the nucleic acid contained in the endogenous gene of (ii), the codon corresponding to the amino acid at position 233 or 285 of SEQ ID NO: 4 is mutated to a stop codon.

[0049] The endogenous gene (i) and / or the endogenous gene (ii) may be either a heterozygote of a mutant gene containing the above mutation and a gene not containing the above mutation, or a homozygote of the mutant gene containing the above mutation. Here, the term "homozygote" refers to any mutant gene in which both alleles contain the above mutation. This term refers not only to combinations of alleles in which the same stop codon position is mutated, but also to combinations of alleles in which different stop codon positions are mutated. Preferably, the endogenous gene (i) and / or the endogenous gene (ii) are homozygotes of the mutant gene containing the above mutation. Preferably, the endogenous gene (i) and the endogenous gene (ii) are homozygotes of mutant genes containing the above mutation, both of which contain the above mutation, i.e., individuals with the sstt NtCLCa genotype. Here, "S" refers to the NtCLCa-S gene not containing the above mutation, "s" refers to the NtCLCa-S gene containing the above mutation, "T" refers to the NtCLCa-T gene not containing the above mutation, and "t" refers to the NtCLCa-T gene containing the above mutation.

[0050] In one embodiment, in the nucleic acid contained in the endogenous gene of (i), the amino acid corresponding to position 163 of SEQ ID NO: 2 encoded by the nucleic acid is glycine. The "amino acid corresponding to position 163 of SEQ ID NO: 2" can be identified by comparison with SEQ ID NO: 2, similar to the case of "corresponding to amino acids at positions 233 to 285 of SEQ ID NO: 2." WO 2014 / 096283 describes an EMS mutant containing a missense mutation in which position 163 of the S genome (SEQ ID NO: 2) of NtCLCa is mutated from glycine to arginine. In one embodiment, in the nucleic acid contained in the endogenous gene of (i), the amino acid corresponding to position 163 of SEQ ID NO: 2 encoded by the nucleic acid is not arginine. In one embodiment, the nucleic acid contained in the endogenous gene of (i) does not contain a mutation in the codon corresponding to the amino acid at position 163 of SEQ ID NO: 2 encoded by the nucleic acid.

[0051] In one embodiment, the tobacco plant is (iii) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding an amino acid sequence having SEQ ID NO: 8 or an amino acid sequence having at least 95% identity to SEQ ID NO: 8, wherein the amino acid corresponding to position 231 of the amino acid sequence is proline; Further includes:

[0052] SEQ ID NO:6 is the amino acid sequence of the protein encoded by the NtCLCe-S gene, which is a tobacco homolog of AtCLCe, a member of the Arabidopsis CLC family, and is located on the S genome of Nicotiana tabacum (Nt). SEQ ID NO:5 is the nucleotide sequence of the CDS of the NtCLCe-S gene. Tobacco plants may or may not contain mutations in the NtCLCe-S gene.

[0053] SEQ ID NO: 8 is the amino acid sequence of the protein encoded by the NtCLCe-T gene, a tobacco homolog of AtCLCe, a member of the Arabidopsis CLC family, located on the T genome of Nicotiana tabacum (Nt). SEQ ID NO: 7 is the nucleotide sequence of the CDS of the NtCLCe-T gene. The "amino acid corresponding to position 231 in SEQ ID NO: 8" can be identified by comparison with SEQ ID NO: 8. WO 2014 / 096283 describes an EMS mutant containing a missense mutation in which proline is mutated to leucine at position 143 of the NtCLCe protein derived from the NtCLCe-T gene (SEQ ID NO: 13 in the document). Position 143 in SEQ ID NO: 13 in the document corresponds to position 231 in SEQ ID NO: 8 herein. In one aspect, in the nucleic acid contained in the endogenous gene (iii), the amino acid corresponding to position 231 in SEQ ID NO: 8 encoded by the nucleic acid is not leucine. In one embodiment, the nucleic acid contained in the endogenous gene of (iii) does not contain a mutation in the codon corresponding to the amino acid at position 231 of SEQ ID NO: 8 encoded by the nucleic acid.

[0054] In one embodiment, the tobacco plant may be mutant or genetically modified.

[0055] As used herein, a "mutant" refers to a modified tobacco plant resulting from random mutations, either naturally or artificially. The method for creating mutants is described in detail in "3. Method for Creating Tobacco Plants" below. Furthermore, mutants can be obtained by crossing a mutant plant with a tobacco plant, but are not limited to the following: (i) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2, in which at least one codon corresponding to the amino acid sequence is mutated to a stop codon; and (ii) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4, in which at least one codon corresponding to the amino acid sequence is mutated to a stop codon; The tobacco plant may be a tobacco plant obtained by selecting a tobacco plant having either one or both of the endogenous genes, or a progeny thereof.

[0056] "Genetically modified" means, in tobacco plants, (i) introducing a mutation into an endogenous gene containing, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2, so that at least one codon corresponding to said amino acid sequence becomes a stop codon; and / or (ii) In an endogenous gene containing, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4, a mutation is introduced so that at least one codon corresponding to the amino acid sequence becomes a stop codon. The term "tobacco plant" refers to a tobacco plant in which the endogenous gene has been modified, as described above, and includes its progeny.

[0057] In one embodiment, the tobacco plant of the present invention comprises: An endogenous gene comprising, as a coding region, a nucleotide sequence encoding a polypeptide lacking the amino acid sequence from amino acid residues between positions 233 and 285 to the C-terminal amino acid residue in SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2; and A tobacco plant having either or both of the endogenous genes of SEQ ID NO: 4 or an endogenous gene having as its coding region a base sequence encoding a polypeptide lacking the amino acid sequence from amino acid residues 233 to 285 to the C-terminal amino acid residue in an amino acid sequence having at least 95% identity to SEQ ID NO: 4, and its progeny are also included.

[0058] Here, the amino acid sequence of SEQ ID NO: 2 or 4 (these and at least A polypeptide lacking the amino acid sequence from the amino acid residues between positions 233 and 285 to the C-terminal amino acid residue in the amino acid sequence of SEQ ID NO: 2 or 4 (including an amino acid sequence having 95% identity with SEQ ID NO: 2 or 4) may be a polypeptide that does not contain the amino acid sequence from the amino acid residues between positions 233 and 285 to the C-terminal amino acid residue in the amino acid sequence of SEQ ID NO: 2 or 4. In other words, the polypeptide is defined as "a polypeptide that does not contain the amino acid sequence from the amino acid residues between positions 233 and 285 to the C-terminal amino acid residue in the amino acid sequence of SEQ ID NO: 2 or 4, but which contains an amino acid sequence other than the amino acid sequence of SEQ ID NO: 2 or 4 generated by frameshift as a C-terminal region." 」、 may include:

[0059] The amino acid sequence of SEQ ID NO: 2 or 4 (these and at least In the CDS sequence of SEQ ID NO: 1 or 3 (including amino acid sequences having 95% identity), a polypeptide lacking the amino acid sequence from the amino acid residues between positions 233 and 285 to the C-terminal amino acid residue may be in an embodiment in which at least one of the codons corresponding to the amino acids at positions 233 to 285 in the amino acid sequence of SEQ ID NO: 2 or 4 has been mutated to a stop codon, and / or in which a frameshift has occurred due to a deletion or insertion of bases in the nucleic acid sequence from positions 697 to 855 in the CDS sequence of SEQ ID NO: 1 or 3.

[0060] The tobacco plant includes a mutant such as an EMS mutant, or a genetically modified plant obtained by genome editing, etc. In one embodiment, the tobacco plant is a mutant or a genetically modified plant.

[0061] "Mutants" and "genetically modified organisms" include not only adult, whole tobacco plants, but also parts thereof, including, but not limited to, leaves (including leaf blades and petioles), stems, roots, seeds, flowers, pollen, anthers, ovules, pedicels, meristems, cotyledons, hypocotyls, pericycles, embryos, endosperms, explants, calluses, tissue cultures, shoots, cells, and protoplasts.

[0062] In one embodiment, the tobacco plant of the present invention comprises: (iv) The present invention further includes a nitrate reductase in which the amino acid residue at position 525 in the amino acid sequence corresponding to SEQ ID NO: 42 or 44 has been mutated from proline to an amino acid residue other than proline. The amino acid residue other than proline is preferably leucine or serine.

[0063] Nicotiana tabacum has two highly homologous nitrogen metabolism enzyme genes, designated NIA1 (derived from the T genome) and NIA2 (derived from the S genome). (iv) Nitrate reductase includes the NIA1 protein and its variants encoded by the NIA1 gene and / or the NIA2 protein and its variants encoded by the NIA2 gene.

[0064] The NIA1 gene and the NIA2 gene have the nucleotide sequences of SEQ ID NOs: 41 and 43, respectively. The NIA1 protein and the NIA2 protein have the amino acid sequences of SEQ ID NOs: 42 and 44, respectively, encoded by the nucleotide sequences of SEQ ID NOs: 41 and 43 (with the exception that the amino acid residue at position 525 is mutated from proline to an amino acid residue other than proline). The amino acid sequence of the mutated nitrate reductase in (iv) may be a variant having some degree of diversity (mutation) from SEQ ID NO: 2 or 4, as long as it satisfies the condition that the nitrate reductase is one in which the amino acid residue at position 525 in the amino acid sequence corresponding to SEQ ID NO: 2 or 4 is mutated from proline to an amino acid residue other than proline.

[0065] The inventors have found that tobacco plants containing a nitrate reductase in which the amino acid residue corresponding to position 525 in the amino acid sequence of the NIA1 protein or NIA2 protein is mutated from proline to an amino acid residue other than proline have reduced nitrate levels in leaves and good plant growth (PCT / JP2021 / 45295, WO2022 / 124361).

[0066] Tobacco plants having (i) an endogenous gene (NtCLCa-S gene) containing, as a coding region, a nucleic acid comprising a nucleotide sequence encoding SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2, in which at least one codon corresponding to the amino acid sequence has been mutated to a stop codon, and / or (ii) an endogenous gene (NtCLCa-T gene) containing, as a coding region, a nucleic acid comprising a nucleotide sequence encoding SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4, in which at least one codon corresponding to the amino acid sequence has been mutated to a stop codon, and which also contain a nitrate reductase in which the amino acid residue at position 525 in the amino acid sequence of the NIA1 protein or the NIA2 protein has been mutated from proline to an amino acid residue other than proline, exhibit significantly reduced nitrate levels in leaves compared to controls (Example 5). Here, the NtCLCa-S gene and the NtCLCa-T gene may be endogenous genes comprising, as a coding region, a nucleotide sequence encoding a polypeptide lacking the amino acid sequence from amino acid residues between positions 233 and 285 to the C-terminal amino acid residue in SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2, and endogenous genes comprising, as a coding region, a nucleotide sequence encoding a polypeptide lacking the amino acid sequence from amino acid residues between positions 233 and 285 to the C-terminal amino acid residue in SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4.

[0067] 2. Characteristics of Tobacco Plants The tobacco plant of the present invention has one or more of the following properties (a) to (c): (a) reduced nitrate content compared to the control; (b) equivalent nitrite content compared to the control; (c) increased amino acid content compared to the control; Here, the control is a tobacco plant containing a polypeptide having the amino acid sequence of SEQ ID NO:2 and a polypeptide having the amino acid sequence of SEQ ID NO:4.

[0068] The control "tobacco plant comprising a polypeptide having the amino acid sequence of SEQ ID NO: 2 and a polypeptide having the amino acid sequence of SEQ ID NO: 4" refers to a tobacco plant that does not have a stop codon at the codon corresponding to the amino acid sequence and has the full-length NtCLCa-S protein (SEQ ID NO: 2) and NtCLCa-T protein (SEQ ID NO: 4). The control tobacco plant may be Nicotiana tabacum, preferably wild-type Nicotiana tabacum. Wild-type Nicotiana tabacum has the full-length NtCLCa-S protein (SEQ ID NO: 2) and NtCLCa-T protein (SEQ ID NO: 4), the expression and activity of which have not been modified in any way.

[0069] In one embodiment, the tobacco plant of the present invention has two or more, or all three of the characteristics (a)-(c).

[0070] (a) Nitrate content is reduced compared to the control. In one embodiment, the tobacco plant contains a reduced amount of nitrate compared to a control. Nitrate can be measured, for example, by the method described in "(3) Nitrate Analysis" in Example 3 of the present specification, but is not limited thereto. For example, leaves collected from tobacco plants may be dried, extracted with water, and the filtrate obtained by filtration may be used as a measurement sample.

[0071] In one embodiment, the tobacco plant has a reduced nitrate content compared to a control. content is preferably reduced by at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%. content is reduced by at least 80%.

[0072] (b) Equivalent nitrite content compared to the control In one embodiment, the tobacco plant contains substantially the same amount of nitrite as a control. Nitrite can be measured, for example, by the method described in "(4) Nitrite Analysis" in Example 3 of the present specification. For example, leaves collected from tobacco plants may be dried to prepare a powder, which may then be extracted with water, filtered, and the filtrate may be used as a measurement sample, and nitrite may be quantified by a colorimetric method.

[0073] " Compared to the control, The term "similar nitrite content" includes, but is not limited to, an increase or decrease in nitrite of 30% or less, 28% or less, 25% or less, 23% or less, 20% or less, 18% or less, 15% or less, compared to the control. below In one embodiment, " Compared to the control, "Having equivalent nitrite content" includes, but is not limited to, an increase in nitrite of 30% or less, 28% or less, 25% or less, 23% or less, 20% or less, 18% or less, 15% or less, compared to the control. below This means that

[0074] The tobacco plants are preferably characterized by a reduced nitrate content and an equal nitrite content.

[0075] (c) Increased amino acid content compared to the control In one embodiment, the tobacco plant contains an increased amount of amino acids compared to a control. In one embodiment, the amino acids are free amino acids. (Free) amino acids can be measured, for example, by the method described in "(5) Free Amino Acid Analysis" in Example 3 of the present specification. For example, measurements can be made by sonicating a solution containing powder prepared by drying leaves collected from a tobacco plant and analyzing it with HPLC.

[0076] In one embodiment, the tobacco plant contains at least a 1.1-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.8-fold, or 2-fold increase in an amino acid compared to a control. especiallyThere is no upper limit. In one embodiment, the tobacco plant has an amino acid content increased by 4-fold or less, 3.5-fold or less, 3-fold or less, 2.8-fold or less, 2.5-fold or less, or 2.2-fold or less compared to a control. In another embodiment, the tobacco plant has an amino acid content increased by 1.1-fold to 4-fold, 1.3-fold to 3.5-fold, 1.4-fold to 3-fold, or 1.5-fold to 2.5-fold compared to a control. In another embodiment, the tobacco plant has an amino acid content increased by about 2-fold compared to a control.

[0077] The tobacco plant of the present invention may further have the following property (d):

[0078] (d) The growth of the individual is essentially equivalent to that of the control. In one embodiment, the tobacco plant contains a nitrate reductase consisting of the amino acid sequence of SEQ ID NO: 2 or 4, and the growth of the individual is essentially equivalent to that of a control tobacco plant.

[0079] " Compared to the control, "Individual growth is essentially equivalent" means that the size (growth) of the individual, such as the height of the plant, the number and size of the leaves, the mass (e.g., dry weight of aboveground leaves (biomass)), the flowering time, etc., are substantially equivalent. For example, when comparing heights, this means that the difference is within 20%, 15%, 10%, or 5%.

[0080] For example, as shown in Example 4 herein, the tobacco plants contained nitrate reductase consisting of the amino acid sequence of SEQ ID NO: 2 or 4 and had lamina weights equivalent to those of control tobacco plants. Pyramiding Even when this was done (accumulation of gene mutations), there was no effect on tobacco growth.

[0081] It is preferable that one or more of the properties (a)-(d) above are inherited not only by the M1 generation, which is a mutant or genetically modified organism, but also by subsequent generations (M2 generation, M3 generation, and thereafter).

[0082] 3. How to create a tobacco plant In one aspect, the present invention relates to a method for producing a tobacco plant.

[0083] The method for producing tobacco plants is as follows: (i) introducing a mutation into an endogenous gene containing, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2, so that at least one codon corresponding to said amino acid sequence becomes a stop codon; and / or (ii) In an endogenous gene containing, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4, a mutation is introduced so that at least one codon corresponding to the amino acid sequence becomes a stop codon. This includes:

[0084] Alternatively, the method for producing a tobacco plant may include, in a tobacco plant, (i) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2, in which at least one codon corresponding to the amino acid sequence is mutated to a stop codon; and (ii) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4, in which at least one codon corresponding to the amino acid sequence is mutated to a stop codon; Selecting tobacco plants that have either one or both of the endogenous genes. This includes:

[0085] Introduction of a mutation into an endogenous gene (modification of an endogenous gene) may be performed, for example, using a genome editing system. The genome editing system can introduce a nonsense mutation by deleting, inserting, or substituting bases at any position in an endogenous gene containing, as its coding region, a nucleic acid comprising a base sequence encoding "SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2" or "SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4," so that at least one codon corresponding to the amino acid sequence becomes a stop codon. The endogenous gene can be modified using a genome editing system containing a site-specific nuclease that cleaves the CDS (SEQ ID NO: 1) of the gene in the S genome of NtCLCa and / or the CDS (SEQ ID NO: 3) of the gene in the T genome of NtCLCa. The genome editing system can also utilize nuclease-mediated non-homologous end joining or homologous recombination repair. The site-specific nuclease used in the genome editing system can be modified as appropriate. For example, the modified site-specific nuclease may be a CRISPR / Cas9 system, ZFN, or TALEN. The site-specific nuclease can cleave the NtCLC gene. The genome editing system may be a modified CRISPR / Cas system, such as a modified CRISPR / Cas-9 system, a modified transcription activator-like effector nuclease, a modified zinc finger nuclease, or a modified meganuclease.

[0086] The method for producing the tobacco plant may include, for example, by mutation: (i) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2, in which at least one codon corresponding to the amino acid sequence is mutated to a stop codon; and (ii) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4, in which at least one codon corresponding to the amino acid sequence is mutated to a stop codon; Selecting tobacco plants that have either one or both of the endogenous genes. It may also include the following.

[0087] Techniques for generating mutations in plants are well known in the art, and mutations can be generated in the CLC gene of a plant using mutagens, including chemical mutagens or radiation, which primarily generate point mutations and short deletions, insertions, base substitutions, and / or transpositions. Chemical mutagens include, but are not limited to, ethyl methanesulfonate (EMS), methyl methanesulfonate, N-ethyl-N-nitrosourea, triethylmelamine, N-methyl-N-nitrosourea, procarbazine, chlorambucil, cyclophosphamide, diethyl sulfate, acrylamide monomer, melphalan, nitrogen mustard, vincristine, dimethylnitrosamine, N-methyl-N'-nitro-nitrosoguanidine, nitrosoguanidine, 2-aminopurine, 7,12 dimethyl-benz(a)anthracene, ethylene oxide, hexamethylphosphoramide, bisulfan, diepoxyalkanes (diepoxyoctane, diepoxybutane, and the like), 2-methoxy-6-chloro-9[3-(ethyl-2-chloro-ethyl)aminopropylamino]acridine dihydrochloride, and formaldehyde. Radiation also includes, but is not limited to, gamma rays, heavy ion beams, X-rays, neutron rays, or UV.

[0088] The step of selecting tobacco plants containing a mutation to a stop codon at the desired position in the NtCLCa gene due to mutation may include one or more crossbreeding steps. In one embodiment, the seeds after mutagenesis may be sown and cultivated to obtain first-generation plants, which may then be self-pollinated to obtain second-generation plants, which may then be screened for mutants. The advantage of screening second-generation plants is that the mutation will be a germline mutation. The target of mutagenesis may be, but is not limited to, seeds or pollen. When mutagenesis is performed on pollen, the pollen may be crossed with a non-mutagenized plant to obtain seeds, and plants grown from these seeds may be screened for mutants.

[0089] Selection of a genetic variant or mutant containing a stop codon at a desired position can be performed, but is not limited to, by extracting genomic DNA from a tobacco plant, amplifying it by PCR or the like, and analyzing the base sequence of the DNA encoding the amino acid sequence corresponding to SEQ ID NO: 2 or 4. Other methods include using the SSCP (Single strand conformation Polymorphism) method to detect sequence differences based on differences in electrophoretic distance, and using the T7 Endonu c and detecting the presence or absence of a mutation by cleaving the mismatch site using, for example, LeaseI.

[0090] In one aspect, the present invention may be a selectable nucleic acid marker used to select a tobacco plant containing an endogenous gene that includes, as a coding region, a nucleic acid containing a nonsense mutation and / or a frameshift mutation that results in a mutation to a target stop codon in a nucleic acid that includes a nucleotide sequence encoding "SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2" or "SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4." Alternatively, the present invention may be a detection polynucleotide used to detect the mutation to a target stop codon. In one embodiment, the selection nucleic acid marker or detection polynucleotide may be a nucleic acid amplification primer for amplifying the nucleotide sequence of DNA encoding the amino acid residues at positions 233 to 285 of SEQ ID NO: 2 or a portion containing the amino acid residues at positions 233 to 285 of SEQ ID NO: 4; a sequencing primer for the nucleotide sequence of DNA encoding the amino acid residues at positions 233 to 285 of SEQ ID NO: 2 or a portion containing the amino acid residues at positions 233 to 285 of SEQ ID NO: 4; or a probe that binds to DNA encoding the amino acid residues at positions 233 to 285 of SEQ ID NO: 2 or a portion containing the amino acid residues at positions 233 to 285 of SEQ ID NO: 4. Those skilled in the art can appropriately select these selection nucleic acid markers or detection polynucleotides based on known techniques.

[0091] In one aspect, the present invention may relate to a tobacco plant and its progeny that are obtained by crossing a tobacco plant containing a mutation in a target stop codon with a tobacco plant that has reduced nitrate content through a mechanism different from that of the tobacco plant of the present invention.

[0092] 4. Tobacco leaves and dried tobacco In one aspect, the present invention relates to tobacco leaf harvested from the tobacco plants of the present invention. The present invention also relates to cured leaf produced from the tobacco leaf of the present invention.

[0093] The meaning of "tobacco leaves of the present invention" is as explained up to "3. Method for producing tobacco plants."

[0094] The process for producing cured tobacco leaves is not particularly limited, and known methods can be used. Tobacco plants are harvested for their leaves, which can be used as material for the manufacture of tobacco products. Tobacco leaves may be air-dried, flame-cured, yellow-cured, or sun-dried. Air-curing involves hanging the leaves in a well-ventilated barn and curing them in the air for 4 to 8 weeks (curing). Flame-cured tobacco is dried by hanging the leaves in a large barn and heating them continuously or intermittently for 3 days to 10 weeks, depending on the process and the tobacco. Yellow-cured tobacco is dried by lining the tobacco in a drying shed and slowly increasing the temperature over a period of about a week. Sun-cured tobacco is dried in the sun. This method is used to produce Oriental tobacco in Turkey, Greece, and other Mediterranean countries.

[0095] In one aspect, the present invention relates to cured leaf derived from the tobacco leaf of the present invention.

[0096] 5. Cut fillers, powders, sheets, bones, granules, extracts, compositions In one aspect, the present invention relates to cut fillers, powders, sheets, backbone, granules, or extracts produced from the dried leaves of the present invention.

[0097] The meaning of "cured leaves of the present invention" is as explained up to "4. Tobacco leaves and cured leaves."

[0098] "Cut filler" is dried tobacco leaves cut into long, thin strips and used in cigarettes.

[0099] The "midrib" is the thickest vein running through the center of the leaf.

[0100] "Powder" refers to dried tobacco leaves that have been crushed into powder.

[0101] "Granules" are powders formed into granular form.

[0102] The "extract" is obtained by extracting materials such as leaves and stems derived from tobacco plants (including "parts," preferably "non-growing parts") for the purpose of improving the flavor of tobacco products or reducing the content of specific components in tobacco products. Any known extraction method for extracting essential oils, specific components, etc. from plants can be used.

[0103] Without limitation, the present invention relates to compositions containing the tobacco plants (including parts) or dried leaves of the present invention, or tobacco materials derived therefrom (such as cut filler). The compositions may use tobacco plants or parts thereof as they are, or may be cut, crushed, or ground into fine flakes, a slurry, or a fine powder. Tobacco plants or parts thereof may be harvested from fields or the like and used as they are, or may be left indoors or outdoors for a predetermined period of time to allow some of the moisture to evaporate, or may be used after allowing most of the moisture to evaporate in a dryer or the like.

[0104] Without limitation, the composition may include cut fillers, powders, sheets, backbone, granules, or extracts made from the dried leaves of the present invention.

[0105] In one embodiment, the cut filler, powder, sheet, backbone, granules, or extracts and compositions of the present invention comprise non-growing portions of a tobacco plant.

[0106] In one aspect, the cut filler, powder, sheet, bone, granule, or extract, and composition of the present invention comprise a nucleic acid comprising a base sequence encoding an amino acid sequence corresponding to SEQ ID NO: 2 and / or SEQ ID NO: 4, in which at least one codon corresponding to the amino acid sequence is mutated to a stop codon.

[0107] 6. Products In one aspect, the present invention relates to a tobacco product comprising the dried leaf of the present invention and / or the cut filler, powder, sheet, rib, granules, or extract of the present invention.

[0108] The meaning of "the dried leaves of the present invention, and / or the cut filler, powder, sheet, backbone, granules, or extract of the present invention" is as explained up to "5. Cut filler, powder, sheet, backbone, granules, extract, composition."

[0109] The type of "tobacco product" is not particularly limited. In addition to cigarettes, it includes cigars, pipe tobacco, snuff (including snus and snuff), chewing tobacco, shredded tobacco (including fine shredded tobacco), and water pipes. It also includes non-combustible heated tobacco products that use the aerosol generated by heating tobacco as the aerosol source, and unheated tobacco products that inhale the flavor of tobacco without heating it.

[0110] Without limitation, "tobacco products" include the non-growing portions of the tobacco plant.

[0111] In one aspect, the present invention provides use of the tobacco plant, tobacco leaf, cured leaf, or composition of the present invention for producing a tobacco product.

[0112] In one aspect, the present invention relates to the tobacco plants, tobacco leaves, cured leaves, and compositions of the present invention for use in producing tobacco products.

[0113] In one aspect, the present invention includes a method for producing a tobacco product. Without limitation, the method includes: (i) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2, in which at least one codon corresponding to the amino acid sequence is mutated to a stop codon; and (ii) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4, in which at least one codon corresponding to the amino acid sequence is mutated to a stop codon; and preparing a tobacco plant-derived material from a tobacco plant having either one or both of the endogenous genes. The production method may also include a step of harvesting leaves from the tobacco plant and preparing cured leaves. A known method can be used to produce a tobacco product. For example, leaves (tobacco leaves) harvested from the tobacco plant of the present invention can be dried (cured) and subjected to raw material processes (grading, deboning, conditioning / drying, storage / aging), raw material processing processes (sheeting, extraction, granulation, heating, flavoring), and product processes (blending, shredding, rolling, packaging) to produce a tobacco product.

[0114] "Tobacco products" is defined above. [Example]

[0115] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples. Those skilled in the art can easily make modifications and variations to the present invention based on the description in this specification, and such modifications and variations are within the technical scope of the present invention.

[0116] Example 1 Isolation of NtCLCa mutants In this example, we isolated the CLCa mutant of Nicotiana tabacum. CDS sequence of the wild-type NtCLCa-S gene located on the S genome (SEQ ID NO: 1) CDS sequence of the wild-type NtCLCa-T gene located on the T genome (SEQ ID NO: 3) is.

[0117] First, tobacco seeds (Tsukuba No. 1) were treated with EMS to create a mutant library. From this mutant library, mutants carrying a nonsense mutation in the NtCLCa gene were selected by sequencing the genome. The NtCLCa gene is a tobacco homolog of the AtCLCa gene. One mutant of the NtCLCa-S gene located on the S genome and two mutants of the NtCLCa-T gene located on the T genome were isolated. Selection was performed using the following method.

[0118] (1) Preparation of genomic DNA Leaf pieces approximately 5 mm square were placed in a 96-well deep-well tube or a 2 ml tube, and 200–500 μl of DNA extraction buffer (0.2 M Tris-HCl pH 8.0, 0.4 M NaCl, 25 mM EDTA, 0.5% SDS) and one bead (96-well deep-well tube) or one metal cone (2 ml dedicated tube) were added. The pieces were then ground at 1000 rpm for 3–5 minutes using a Shakemaster Neo (Biomedical Sciences). The mixture was centrifuged at 4400 rpm (96-well deep-well tube) or 12000 rpm (2 ml dedicated tube) for 20 minutes, and the supernatant was collected. Nucleic acids were precipitated from the supernatant by ethanol precipitation and suspended in 50–100 μl of TE buffer.

[0119] (2) PCR PCR was performed using the genomic DNA prepared as above as a template and KOD one (TOYOBO) or TKS Gflex DNA Polymerase (Takara Bio). The PCR reaction composition was determined according to the attached manual, and the following reaction conditions were applied. KOD one: 94°C 2 minutes, (98°C 10 seconds, 60°C 15 seconds, 68°C 5 seconds) x 40 cycles, 68°C 5 minutes TKS Gflex DNA Polymerase: 94°C 1 minute, (98°C 10 seconds, 55°C 15 seconds, 68°C 1 minute) x 40 cycles, 68°C 1 minute

[0120] Primers were prepared appropriately based on the sequence information of each gene and used for selection. The primers used for isolation and analysis of nonsense mutations are as follows: 220S is a primer for S gene analysis, and 222T and 223T are primers for T gene analysis. 220S-F: ATTACCGGCTCAGGTGGCGT (SEQ ID NO: 9), 220S-R: TGCCAGATTTGCAGTATTCA (SEQ ID NO: 10) 222T-F: CTTACCAACTCCTTTTTCCC (SEQ ID NO: 11), 222T-R: TGTGATAAAAAGACCATGT (SEQ ID NO: 12) 223T-F: ATAATTACCGGCTCAAATGG (SEQ ID NO: 13), 223T-R: TGTGATAAAAAGACCATGT (SEQ ID NO: 14)

[0121] (3) Sequence analysis Prior to sequencing, PCR products were purified using ExoSAP-IT® For PCR Product Clean-UP (AFP). y The sequencing reaction was performed using a BigDye Terminator v.3.1 cycle sequencing kit (Thermo Fisher Scientific) according to the attached protocol. The BigDye Terminator v.3.1 cycle sequencing kit (Thermo Fisher Scientific) was used to carry out the reaction according to the kit's instructions (94°C for 30 seconds, 96°C for 10 seconds, 50°C for 5 seconds, and 60°C for 2 minutes x 25 cycles). The DNA was then purified using a BigDye XTerminator™ Purification Kit (Thermo Fisher Scientific) according to the kit's instructions (45 μl of SAM Solution and 10 μl of XTerminator were added per sample, followed by shaking for 30 minutes and centrifugation at 1000 g for 2 minutes). Sequence information was obtained using an Applied Biosystems® 3730 DNA Analyzer (Thermo Fisher Scientific) and analyzed using the sequence assembly software ATGC (GENETYX).

[0122] As a result of screening, one mutant with a stop codon in the NtCLCa-S gene was isolated. This mutant (220S) had a change from the codon (TGG) encoding tryptophan 279 (W) to a stop codon (TAG). Two mutants with stop codons in the NtCLCa-T gene were also isolated. This mutant (222T) had a change from the codon (TGG) encoding tryptophan 233 (W) to a stop codon (TAG), and the other mutant (223T) had a change from the codon (TGG) encoding tryptophan 285 (W) to a stop codon (TAG). Hereinafter, the NtCLCa-S mutant gene carried by mutant 220S may be referred to as the NtCLCa-S-Δ1 gene, the NtCLCa-T mutant gene carried by mutant 222T as the NtCLCa-T-Δ1 gene, and the NtCLCa-T mutant gene carried by mutant 223T as the NtCLCa-T-Δ2 gene.

[0123] M2 individuals homozygous for the NtCLCa-S and NtCLCa-T mutant genes were crossed with each other to produce F1 lines, which were then self-fertilized to obtain F2 lines. The base sequences of each gene in the F2 lines were analyzed using the methods described above (1)-(3). This allowed us to determine whether each individual was homozygous for the mutant gene, heterozygous, or a wild-type individual without the mutation.

[0124] Nitrate and nitrite concentrations in leaves were analyzed using segregating lines of the F2 generation. In two independent F2 generation lines, homozygotes carrying nonsense mutations in both the NtCLCa-S and NtCLCa-T genes showed significantly reduced nitrate concentrations in leaves compared to wild-type individuals without mutations (methods were as described in Example 3; data not shown).

[0125] Example 2: Selection of F3 lines In this example, F3 lines were selected.

[0126] Self-pollinated F3 lines were obtained using the F2 generation segregating lines obtained in Example 1. Self-pollinated F3 seeds were obtained as Line 1 from two individuals segregating in the F2 generation: HeHo(1-7), which is heterozygous for the wild-type NtCLCa-S gene and the NtCLCa-S-Δ1 gene and homozygous for the NtCLCa-T-Δ2 gene, and WHe(1-55), which is homozygous for the wild-type NtCLCa-S gene and heterozygous for the wild-type NtCLCa-T gene and the NtCLCa-T-Δ2 gene.

[0127] Line 2 was obtained by obtaining self-pollinated F3 seeds from HoHe(2-9), which is homozygous for the NtCLCa-S-Δ1 gene and heterozygous for the wild-type NtCLCa-T gene and the NtCLCa-T-Δ1 gene, and WW(2-54), which is homozygous for the wild-type NtCLCa-S gene and homozygous for the wild-type NtCLCa-T gene, both of which were segregated in the F2 generation.

[0128] From the self-pollinated F3 lines of individual (1-7), the following three types of plants were selected: HoHo, which is homozygous for both the NtCLCa-S-Δ1 and NtCLCa-T-Δ2 genes; HeHo, which is heterozygous for the wild-type NtCLCa-S gene and the NtCLCa-S-Δ1 gene and homozygous for the NtCLCa-T-Δ2 gene; and WHo, which is homozygous for the wild-type NtCLCa-S gene and homozygous for the NtCLCa-T-Δ2 gene. From the self-pollinated F3 lines of individual (1-55), WW, which is homozygous for the wild-type NtCLCa-S gene and homozygous for the wild-type NtCLCa-T gene, was selected.

[0129] Meanwhile, the following three types of plants were selected from the self-pollinated F3 lines of individual (2-9): HoHo, which is homozygous for both the NtCLCa-S-Δ1 and NtCLCa-T-Δ2 genes; HoHe, which is homozygous for the NtCLCa-S-Δ1 gene and heterozygous for the wild-type NtCLCa-T and NtCLCa-T-Δ1 genes; and HoW, which is homozygous for the NtCLCa-S-Δ1 gene and homozygous for wild-type NtCLCa-T. From the self-pollinated F3 lines of 2-54, we obtained an individual called WW, which is homozygous for the wild-type NtCLCa-S gene and homozygous for wild-type NtCLCa-T.

[0130] Example 3 Analysis of F3 lines In this example, the F3 line obtained in Example 2 was analyzed.

[0131] (1) Cultivation Cultivation from sowing to sampling was carried out using a Koitotron (KGBH-2416, Koito Electric Works) artificial climate chamber. The cultivation conditions from sowing to transplanting were a 16-hour day length, a room temperature of 28°C, and a humidity of 60%.

[0132] Seeds of the F3 line obtained in Example 2 were sown, temporarily transplanted approximately two weeks later, and cultivated for another two weeks. The seedlings were then transplanted into 12 cm terracotta containers filled with 500-600 ml of vermiculite. After transplanting, they were cultivated for approximately three weeks under cultivation conditions of 25°C light / 18°C dark, a 12-hour photoperiod, and 60% (light) / 80% (dark) humidity. After transplanting, approximately 100 ml / day of nitrate liquid fertilizer (20 mM as NO3: 4 mM Ca(NO3)2, 4 mM Mg(NO3)2, 4 mM KNO3) was applied per plant.

[0133] (2) Preparation of analytical samples Twenty days after transplanting, the lamina of six aboveground leaves from each plant was sampled, packed into paper bags, and dried at a constant temperature of 80°C using a forced circulation incubator (Isuzu Manufacturing Co., Ltd.). The dried lamina was pulverized into a dry powder, which was used for the analysis of nitrate, nitrite, and free amino acids.

[0134] (3) Nitric acid analysis 0.1 g of the dry powder prepared in "(2) Preparation of analytical sample" was mixed with 1 ml of Milli-Q water and shaken at room temperature for at least 1 hour for extraction. The extract was filtered, and the nitrate concentration of the filtrate was measured using a Ntrachek 404 Meter (KPG Products Ltd) according to the attached manual. 7-8 μl of liquid was dropped onto Emquant test paper (Millipore), and the average of two measurements per sample was used as the measured value. The sample was diluted so that the measured value was 100 ppm or less.

[0135] The results are shown in Figure 1. The measured nitrate concentration was converted to nitrate nitrogen. The nitrate concentration in the leaves of HoHo was less than 1 / 20 of that of WW, the control, which does not have a mutation in the NtCLCa gene. Furthermore, HoHe, HeHo, HoW, and WHo also showed significantly reduced nitrate concentrations in the leaves compared to WW, the control, which does not have mutations in either gene.

[0136] (4) Nitrite analysis Nitrite was quantified by colorimetry using the filtrate prepared in "(3) Nitrate Analysis." 100 μl of the filtrate was mixed with 50 μl of color reagent 1 (2% sulfanilamide in 3N HCl) and incubated at room temperature for 5 minutes. 50 μl of color reagent 2 (0.1% N-naphthylethylenediamine in water) was added and mixed, and incubated at room temperature for 10 minutes. A540 and A700 as a reference were measured using the Infinite 200 PRO microplate reader (TECAN), and the difference between A540 and A700 was used as the measured value. Quantification was performed using NaNO2 (Wako Pure Chemical Industries, special grade) as a standard.

[0137] The results are shown in Figure 2. The presence or absence of a nonsense mutation in the NtCLCa gene did not significantly affect the concentration of nitrite in leaves. Even in HoHo, which showed a dramatic reduction in nitrate, no increase in nitrite concentration was observed. This was an unexpected result that differed from the results of analyzing the CLCa mutant of Arabidopsis thaliana (Non-Patent Document 2).

[0138] (5) Free amino acid analysis 0.4 g of the dry powder prepared in "(2) Preparation of analytical sample" was mixed with 20 ml of 80% methanol solution (V / V) and sonicated for 30 minutes. The treated solution was centrifuged. The supernatant after centrifugation was analyzed using an HPLC analyzer (Agilent 1290 infinity), an analytical column (Agilent ZORBAX Eclipse AAA 3.5um, 3.0 x 150mm), and a guard column (Agilent ZORBAX Eclipse AAA 5um, 4.6 x 12.5mm 4 / PK) with mobile phase A: 40mM phosphate buffer, mobile phase B: 45% acetonitrile / 45% methanol. aqueous solution Analysis was performed under gradient conditions. Only HoHo and the control WW were analyzed for 19 free amino acids.

[0139] The results are shown in Table 1 and Figure 3.

[0140] [Table 1]

[0141] At least 17 amino acids, excluding glutamic acid and aspartic acid, were found to have higher concentrations in leaves of HoHo than of WW in both Line 1 and Line 2 (Table 1).

[0142] The total concentration of 19 free amino acids was 1.5 to 2.6 times higher in HoHo than in WW (Figure 3). This was also an unexpected result that differed from the results of analyzing the Arabidopsis CLCa mutant (Non-Patent Document 1).

[0143] (6) Growth To compare growth, individuals of each genotype were lined up side by side and photographed 20 days after transplantation (Figure 4). No difference in growth was observed between Line 1 and Line 2 F3 individuals, regardless of whether they contained a nonsense mutation in the NtCLCa gene. These results demonstrate that by using a mutant with a nonsense mutation in the NtCLCa gene, it is possible to significantly reduce nitrate concentration in leaves without affecting growth, and to increase free amino acid concentrations without increasing nitrite concentrations.

[0144] (7) Sequence confirmation of the NtCLCe gene It was confirmed as follows that the mutant NtCLCa gene obtained in Example 2 had no mutation in the CDS sequence of the NtCLCe gene.

[0145] RNA was extracted from young leaves of two F3 lines obtained in Example 2, Line 1 HoHo and Line 2 HoHo individuals, using an RNeasy Plant Mini Kit (QIAGEN). Using this RNA as a template, cDNA was prepared using the PrimeScript™ RT reagent Kit with gDNA Eraser (Takara Bio). PCR primers were designed based on the estimated CDS sequence information of the NtCLCe gene in the S genome and T genome (estimated from the nucleotide sequence information of the NtCLCe gene described in Patent Document 1), and PCR was performed using cDNA as a template. TKS Gflex DNA Polymerase (Takara Bio) was used as the PCR enzyme, and the reaction conditions were as follows, according to the attached manual. 94℃ 1 min, (98℃ 10 sec, 55℃ 15 sec, 68℃ 1-2 min) x 40 cycles, 68℃ 1-2 min

[0146] The primer sequences used are listed in Table 2 below (SEQ ID NOs: 15-27).

[0147] [Table 2]

[0148] PCR was performed using the following primer pair, resulting in amplification of the cDNA sequences of the NtCLCe genes in the S and T genomes. S / T_FW1 and S_RT_R2; S_RT_F1 and S_RT_R3; S_RT_F2 and S_RT_R3; S / T_FW1 and S_RT_R3; S / T_FW1 and T_RT_R2; T_RT_F2 and T_RT_R3; T_RT_F3 and T_RT_R3; S / T_FW1 and T_RT_R3

[0149] The PCR products were analyzed by the method described in "(3) Sequence analysis" in Example 1, and all sequences were found to be identical. Therefore, it was confirmed that the NtCLCe gene sequence in the NtCLCa gene mutant obtained in Example 2 is exactly the same as that of the wild-type Tsukuba No. 1. CDS sequence of the NtCLCe-S gene located on the S genome (SEQ ID NO: 5) CDS sequence of the NtCLCe-T gene located on the T genome (SEQ ID NO: 7)

[0150] (8) Diurnal fluctuation of nitrate in leaves The HoHo individuals and WW individuals of the F3 line of Line2 obtained in Example 2 were classified as "(1) Cultivation The plants were cultivated as described in "(3) Nitrate Analysis" and "(4) Nitrite Analysis." 20 days after transplantation, leaves were sampled 1 hour, 3 hours, 5 hours, and 10.5 hours after the onset of the light period, and 4 hours and 8 hours after the onset of the dark period. The sampling times corresponded to early morning, mid-morning, early afternoon, 1.5 hours before sunset, 4 hours after sunset, and 8 hours after sunset, respectively. Nitrate and nitrite in the lamina were quantified as described in "(3) Nitrate Analysis" and "(4) Nitrite Analysis." The results are shown in Figures 5 and 6. The nitrate concentration in the lamina of HoHo was lower than that of WW, both day and night (Figure 5). Furthermore, the nitrite concentration in the lamina of HoHo and WW was almost the same, both day and night (Figure 6).

[0151] (9) Expression analysis of NtCLCa and NtCLCe genes in NtCLCa mutants Expression analysis of the NtCLCa and NtCLCe genes was carried out in expanded leaves of 10 individuals each of HoHo and WW, the F3 lines of Line1 obtained in Example 2.

[0152] Ten 5 mm diameter leaf discs were collected from each plant and mixed, and RNA was extracted using NucleoSpin Plant II (Takara Bio). The concentration of the extracted RNA was measured using Nanodrop 8000 (Thermo Fisher Scientific).

[0153] 750 ng of RNA from each sample was used in the following reaction. Using each RNA as a template, cDNA was prepared using ReverTra Ace® qPCR RT Master Mix with gDNA Remover (TOYOBO). cDNA synthesized from 10 ng of RNA was mixed with THUNDERBIRD® SYBR qPCR Mix (TOYOBO) and the primers listed in Table 3, and the expression level of each gene was measured using StepOne™ (Applied Biosystems). (SEQ ID NO: 28-37)

[0154] [Table 3]

[0155] The results are shown as the average relative quantification (ΔΔCt method) of the expression level of the target gene using ribosomal protein L25 (accession number L18908) as a control gene (Mol. Genet. Genomics. (2010) 283:233-241). The expression level of the NtCLCa gene was significantly lower in HoHo than in WW, approximately half that of WW, using both sets of primers used in the expression analysis (Figure 7). On the other hand, no significant difference was observed in the expression level of the NtCLCe gene between HoHo and WW (Figure 8).

[0156] Patent Document 1 discloses that in RNAi recombinant tobacco using the sequence of the CLC-Nt2-s gene (corresponding to NtCLCa-S), expression of the NtCLCe gene is also suppressed. In other words, the reduction in nitrate observed in RNAi recombinant tobacco using the sequence of the CLC-Nt2-s gene is the result of suppression of expression of both the NtCLCa and NtCLCe genes. In contrast, it has been revealed that the reduction in nitrate observed in the NtCLCa mutant of the present invention is not accompanied by suppression of expression of the NtCLCe gene.

[0157] (10) Confirmation that the 163rd amino acid of the NtCLCa-S gene is glycine in the NtCLCa mutant. The NtCLCa-S gene fragment was specifically amplified by PCR using the cDNA prepared from the NtCLCa mutants (HoHo) of Line1 and Line2 obtained in Example 2 as a template. The cDNA prepared in "(7) Confirmation of the NtCLCe gene sequence" was used for PCR using TKS Gflex DNA Polymerase (Takara Bio) as the PCR enzyme and under the following reaction conditions according to the attached manual. 94℃ 1 min, (98℃ 10 sec, 55℃ 15 sec, 68℃ 1 min) x 40 cycles, 68℃ 12 min

[0158] The following two sets of primers were used. CLCA_S_F1(5'-CATGACTGGAGAAGGAGATCT-3') CLCA_S_R1 (5'-AAGTGTGGTTGCTCCATACATA-3'); (SEQ ID NOs: 38 and 39) CLCA_S_F1(5'-CATGACTGGAGAAGGAGATCT-3') CLCa_220s_R (5'-TGCCAGATTTGCAGTATTCA-3') (SEQ ID NOs: 38 and 40)

[0159] These PCR amplification products were used as templates for sequence analysis by the method described in (3) Sequence analysis in Example 1. As a result, it was confirmed that the nucleic acid sequence corresponding to the 163rd amino acid of the NtCLCa-S gene was glycine.

[0160] CDS sequence of NtCLCa-S gene (SEQ ID NO: 1)

[0161] [ka]

[0162] The underlined sequence corresponds to the 163rd glycine. Example 4 Biomass of Plants Grown in the Field In this example, the leaf lamina weight of the F3 plants obtained in Example 2 was examined.

[0163] HoHo and WW derived from Line 1 and Line 2 were cultivated in a field according to the general tobacco cultivation method. Plant The photograph is shown in Figure 9 (Line 1).

[0164] The plants were pinned 70 days after transplantation. 15 days after pinning, the ninth and tenth leaves from the top were sampled from 12 plants, and 18 days later, the fifth and sixth leaves from the top were sampled from another 12 plants. The midribs of the sampled leaves were immediately removed, and the lamina was dried at 70°C for 2 days and at 50°C for 1 day. The weights of the dried lamina from two leaves were measured, and the results are shown in Table 4. The lamina weight of HoHo was equivalent to that of WW, a control that does not have the NtCLCa-S or NtCLCa-T mutant alleles.

[0165] [Table 4]

[0166] Example 5 Gene biramiding WO2022 / 124361 (international publication of international application PCT / JP2021 / 045295 by the same applicant as the present application) discloses tobacco plants containing a nitrate reductase in which the amino acid residue corresponding to position 525 in the amino acid sequence of the NIA1 protein (SEQ ID NO: 2) or the amino acid sequence of the NIA2 protein (SEQ ID NO: 4) has been mutated from proline to an amino acid residue other than proline (preferably leucine or serine). This document discloses that the tobacco plants have reduced nitrate levels in the leaves and exhibit good plant growth.

[0167] In this example, we investigated the effect of biramiding (accumulation of genetic mutations) of the above-mentioned NtNIA1 mutant alleles on the amount of nitrate accumulated in tobacco plants carrying mutant alleles of NtCLCa-S and NtCLCa-T.

[0168] HoHo, a tobacco plant homozygous for both the NtCLCa-S and NtCLCa-T mutant alleles derived from Line 1 obtained in Example 2, was used as the tobacco plant carrying the NtCLCa-S and NtCLCa-T mutant alleles. For gene biramiding, a homozygous NtNIA1 mutant allele encoding the P525L-NR protein (P525L_Homo) was used. This homozygous plant was a BC2F3 plant obtained by crossing the EMS mutant (M3) with the recurrent parent TN90 (burley type), as described in Example 7 of WO 2022 / 124361.

[0169] From the F2 population obtained by crossing the two, F2 plants carrying the homozygous NtCLCa-S mutant allele, the heterozygous NtCLCa-T mutant allele, and the heterozygous NtNIA1 mutant allele were selected. recessive The double homozygote possesses the recessive allele. This recessive allele, accompanied by a frameshift mutation, is thought to be the cause of chlorophyll deficiency and low nitrogen use efficiency in burley tobacco (BMC genomics, (2017) 18(1), 1-14).

[0170] Furthermore, F3 plants exhibiting the four types of genotypes shown in Table 5 were selected from the F3 population derived from this F2 plant, and cultivated by the method described in Example 3.

[0171] [Table 5]

[0172] In Table 5, Ho, He, and W indicate that the plants are homozygous for the mutant allele, heterozygous for the mutant allele and the wild-type allele, and homozygous for the wild-type allele, respectively.

[0173] After transplant 20th Leaves were sampled from the plants by the method described in Example 3, dried, and analyzed for nitrate nitrogen content (n=6). The results are shown in Table 6 (p values ​​are two-tailed tests between the HoHoW genotype and each genotype).

[0174] [Table 6]

[0175] HoHoHo and HoHoHe plants had significantly lower nitrate content than HoHoW plants. Therefore, biramiding the mutant alleles of NtNIA1 into tobacco plants carrying the mutant alleles of NtCLCa-S and NtCLCa-T further reduced the nitrate content of the tobacco plants.

[0176] Also, after transplantation 20th Photographs of the plants are shown in Figure 10. Biramidation of the above mutant alleles of NtNIA1 into tobacco plants carrying mutant alleles of NtCLCa-S and NtCLCa-T did not affect the growth of the tobacco plants. [Industrial Applicability]

[0177] By using the tobacco plants of the present invention, TSNAs in tobacco raw materials and tobacco products can be reduced. The tobacco plants of the present invention not only have reduced nitrate levels in their leaves, but also preferably exhibit good plant growth and increased amino acid content. The tobacco plants of the present invention can be used as excellent leaf tobacco materials for producing tobacco products.

Claims

1. (i) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2, in which at least one codon corresponding to the amino acids at positions 233 to 285 of SEQ ID NO: 2 is mutated to a stop codon; and (ii) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4, in which at least one codon corresponding to the amino acids at positions 233 to 285 of SEQ ID NO: 4 is mutated to a stop codon; Tobacco plants that contain either or both of the endogenous genes.

2. The tobacco plant of claim 1 , which has both endogenous genes (i) and (ii).

3. The tobacco plant of claim 1 , wherein the endogenous gene (i) and / or the endogenous gene (ii) are homozygous.

4. 2. The tobacco plant of claim 1, wherein the codon corresponding to the amino acid at position 279 of SEQ ID NO: 2 in the nucleic acid contained in the endogenous gene of (i) is mutated to a stop codon.

5. 2. The tobacco plant of claim 1, wherein the codon corresponding to the amino acid at position 285 of SEQ ID NO: 4 in the nucleic acid contained in the endogenous gene of (ii) is mutated to a stop codon.

6. 2. The tobacco plant of claim 1, wherein the codon corresponding to the amino acid at position 233 of SEQ ID NO: 4 in the nucleic acid contained in the endogenous gene of (ii) is mutated to a stop codon.

7. In the nucleic acid contained in the endogenous gene of (i), the codon corresponding to the amino acid at position 279 of SEQ ID NO: 2 is mutated to a stop codon, and (ii) In the nucleic acid contained in the endogenous gene, the codon corresponding to the amino acid at position 233 or 285 of SEQ ID NO: 4 is mutated to a stop codon. The tobacco plant of claim 1 .

8. 2. The tobacco plant of claim 1, wherein the amino acid encoded by the nucleic acid contained in the endogenous gene of (i) corresponding to position 163 of SEQ ID NO: 2 is glycine.

9. (iii) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding an amino acid sequence having SEQ ID NO: 8 or an amino acid sequence having at least 95% identity to SEQ ID NO: 8, wherein the amino acid corresponding to position 231 of the amino acid sequence is proline; 2. The tobacco plant of claim 1, further comprising:

10. The polymer has one or more of the following properties (a) to (c): (a) reduced nitrate content compared to the control; (b) equivalent nitrite content compared to the control; (c) increased amino acid content compared to a control; wherein the control is a tobacco plant comprising a polypeptide having the amino acid sequence of SEQ ID NO: 2 and a polypeptide having the amino acid sequence of SEQ ID NO: 4; The tobacco plant of claim 1 .

11. 11. The tobacco plant of claim 10, wherein the nitrate content is reduced by at least 80% compared to a control.

12. The tobacco plant of claim 1 , which is a mutant or genetically modified tobacco plant.

13. 2. The tobacco plant of claim 1, wherein the tobacco plant is Nicotiana tabacum.

14. An endogenous gene comprising, as a coding region, a base sequence encoding a polypeptide lacking the amino acid sequence from amino acid residues between positions 233 and 285 to the C-terminal amino acid residue in SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2; and An endogenous gene comprising, as a coding region, a base sequence encoding a polypeptide lacking the amino acid sequence from amino acid residues between positions 233 and 285 to the C-terminal amino acid residue in SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4; Tobacco plants that contain either or both of the endogenous genes.

15. In tobacco plants, (i) introducing a mutation into an endogenous gene containing, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2, so that at least one of the codons corresponding to the amino acids at positions 233 to 285 of SEQ ID NO: 2 becomes a stop codon; and / or (ii) In an endogenous gene containing, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4, a mutation is introduced so that at least one of the codons corresponding to the amino acids at positions 233 to 285 of SEQ ID NO: 4 becomes a stop codon.

10. A method for producing the tobacco plant of claim 1, comprising:

16. (i) an endogenous gene comprising, as a coding region, a nucleic acid comprising a base sequence encoding SEQ ID NO: 2 or an amino acid sequence having at least 95% identity to SEQ ID NO: 2, in which at least one codon corresponding to the amino acids at positions 233 to 285 of SEQ ID NO: 2 is mutated to a stop codon; and (ii) selecting a tobacco plant having either one or both of the endogenous genes, or an endogenous gene comprising, as a coding region, a nucleic acid comprising a nucleotide sequence encoding SEQ ID NO: 4 or an amino acid sequence having at least 95% identity to SEQ ID NO: 4, in which at least one codon corresponding to the amino acids at positions 233 to 285 of SEQ ID NO: 4 has been mutated to a stop codon; 10. A method for producing the tobacco plant of claim 1, comprising:

17. 17. The method of claim 15 or 16, further comprising selecting tobacco plants having reduced nitrate content.

18. Tobacco leaf harvested from the tobacco plant of claim 1.

19. Dried leaves produced from the tobacco leaves described in claim 18.

20. A cut filler, powder, sheet, backbone, or granule produced from the dried leaves of claim 19.

21. A tobacco product comprising the dried leaves described in claim 19 and / or the cut filler, powder, sheet, rib, or granules described in claim 20.

Images