DNA fragment, recombinant vector, transformant, and nitrogen-fixing enzyme

Abstract

A DNA fragment encoding a nitrogen-fixing enzyme, the DNA fragment having the nucleotide sequence of SEQ ID NO: 1 or a nucleotide sequence having 50% or more identity to SEQ ID NO: 1. A recombinant vector containing the DNA fragment. A transformant transformed with the recombinant vector. A nitrogen-fixing enzyme expressed by the transformant. A nitrogen-fixing enzyme having any one or more of the amino acid sequences of SEQ ID NOs: 34 to 65.

Description

[Technical Field]

[0001] The present invention relates to a DNA fragment encoding a nitrogen-fixing enzyme, a recombinant vector containing the DNA fragment, a transformant transformed with the recombinant vector, and the nitrogen-fixing enzyme. [Background technology]

[0002] Generally, growth of Escherichia coli is inhibited in a medium without a nitrogen source (ammonium chloride, sodium nitrate, etc.), and therefore, it is necessary to add a nitrogen source to the medium for its growth.

[0003] In addition to the conventional Haber-Bosch process, there is also an enzymatic method using nitrogenase for nitrogen fixation. This method can fix atmospheric nitrogen as ammonia under normal temperature and pressure, making it unnecessary to add a nitrogen source in the presence of nitrogenase.

[0004] On the other hand, the nitrogenase is a metalloenzyme containing V or Mo (see, for example, Patent Document 1). [Prior art documents] [Patent documents]

[0005] [Patent Document 1] JP 2016-136972 A (paragraphs [0006, 0007]) Summary of the Invention [Problem to be solved by the invention]

[0006] However, when nitrogen fixation is performed using E. coli with nitrogenase introduced, the metal elements V and Mo, which act as the active center, are insufficient, so the addition of metal elements V and Mo is essential for E. coli with nitrogenase introduced to grow in a medium that does not contain a nitrogen source.

[0007] An object of the present invention is to provide a DNA fragment encoding a nitrogen-fixing enzyme that can eliminate the need to add a nitrogen source, which is necessary for the growth of Escherichia coli, to the culture medium; a recombinant vector containing the DNA fragment; a transformant transformed with the recombinant vector; and the nitrogen-fixing enzyme.

[0008] Another object of the present invention is to provide a DNA fragment encoding a nitrogen-fixing enzyme that enables Escherichia coli to grow without adding metal elements such as V or Mo to the culture medium, a recombinant vector containing the DNA fragment, a transformant transformed with the recombinant vector, and the nitrogen-fixing enzyme. [Means for solving the problem]

[0009] One embodiment of the present invention provides the following DNA fragments, recombinant vectors, transformants, and nitrogen-fixing enzymes [1] to

[12] . In this specification, nitrogen-fixing enzyme refers to an enzyme that promotes the growth (growth) of Escherichia coli in a medium without a nitrogen source (ammonium chloride, sodium nitrate, etc.).

[0010] [1] A DNA fragment encoding a nitrogen fixation enzyme, comprising the nucleotide sequence of SEQ ID NO: 1 or a nucleotide sequence having 50% or more identity to SEQ ID NO: 1. [2] The DNA fragment according to [1] above, wherein the DNA fragment having the base sequence of SEQ ID NO: 1 is derived from the genomic DNA of a cyanobacterium. [3] A DNA fragment encoding a nitrogen-fixing enzyme, comprising one or more of the nucleotide sequences of SEQ ID NOs: 2 to 33. [4] The DNA fragment according to [3] above, wherein the DNA fragment is derived from the genomic DNA of a cyanobacterium. [5] The DNA fragment according to [2] or [4] above, wherein the cyanobacterium is Cyanothece sp. ATCC 51142. [6] A recombinant vector comprising the DNA fragment according to any one of [1] to [5] above. [7] The recombinant vector according to [6] above, wherein the DNA fragment is incorporated into a fosmid vector. [8] A transformant transformed with the recombinant vector according to [6] or [7] above. [9] A nitrogen fixation enzyme expressed by the transformant according to [8] above.

[10] A nitrogen-fixing enzyme having the same amino acid sequence as the nitrogen-fixing enzyme described in [9] above or an amino acid sequence having 40% or more identity with said amino acid sequence.

[11] The nitrogen-fixing enzyme according to [9] or

[10] above, which comprises one or more of the amino acid sequences of SEQ ID NOs: 34 to 65.

[12] A nitrogen fixation enzyme having one or more of the amino acid sequences of SEQ ID NOs: 34 to 65. [Effects of the Invention]

[0011] According to one embodiment of the present invention, there are provided a DNA fragment encoding a nitrogen-fixing enzyme that can eliminate the need to add a nitrogen source to the culture medium, which is required for the growth of Escherichia coli; a recombinant vector containing the DNA fragment; a transformant transformed with the recombinant vector; and the nitrogen-fixing enzyme.

[0012] Furthermore, according to one embodiment of the present invention, it is possible to provide a DNA fragment encoding a nitrogen-fixing enzyme that enables Escherichia coli to grow without adding metal elements such as V or Mo to the culture medium, a recombinant vector containing the DNA fragment, a transformant transformed with the recombinant vector, and the nitrogen-fixing enzyme. [Brief explanation of the drawings]

[0013] [Figure 1] FIG. 1 is an explanatory diagram showing the location of a DNA fragment in genomic DNA according to an embodiment of the present invention and 32 open reading frames contained in the DNA fragment. [Figure 2] FIG. 2 is an explanatory diagram showing the site of integration of a DNA fragment into a fosmid vector according to an embodiment of the present invention. [Figure 3] FIG. 3 is a graph showing the evaluation results of nitrogen fixation ability in the examples. DETAILED DESCRIPTION OF THE INVENTION

[0014] [DNA fragment] FIG. 1 is an explanatory diagram showing the location of a DNA fragment in genomic DNA according to an embodiment of the present invention and 32 open reading frames contained in the DNA fragment.

[0015] DNA fragment 2 according to an embodiment of the present invention comprises the nucleotide sequence of SEQ ID NO: 1, which encodes a nitrogen-fixing enzyme, or a nucleotide sequence having 50% or more identity to SEQ ID NO: 1. In the embodiment of the present invention, the nitrogen-fixing enzyme refers to a nitrogen-fixing enzyme that eliminates the need to add a nitrogen source, which is required for the growth of Escherichia coli, to the culture medium, or a nitrogen-fixing enzyme that enables the growth of Escherichia coli without adding metal elements, such as V and Mo, required for nitrogenase to the culture medium. In a more preferred embodiment of the present invention, the nitrogen-fixing enzyme refers to a nitrogen-fixing enzyme that can function in oxygen-producing photosynthetic organisms, such as algae and plants.

[0016] The DNA fragment having the nucleotide sequence of SEQ ID NO: 1 (reference numeral 2 in FIG. 1) is derived from, for example, the genomic DNA (reference numeral 1 in FIG. 1) of a cyanobacterium (also known as blue-green algae) (a sequence of 31,247 nucleotides from bases 2,982,634 to 3,013,880). An example of a cyanobacterium is Cyanothece sp. ATCC 51142. Cyanothece sp. ATCC 51142 is available, for example, from the American Type Culture Collection (ATCC).

[0017] The nucleotide sequence encoding the nitrogen-fixing enzyme may be a nucleotide sequence having 50% or more identity with SEQ ID NO: 1. Preferably, it is a nucleotide sequence having 60% or more identity with SEQ ID NO: 1, more preferably a nucleotide sequence having 70% or more identity with SEQ ID NO: 1, even more preferably a nucleotide sequence having 80% or more identity with SEQ ID NO: 1, even more preferably a nucleotide sequence having 90% or more identity with SEQ ID NO: 1, even more preferably a nucleotide sequence having 95% or more identity with SEQ ID NO: 1, and even more preferably a nucleotide sequence having 98% or more identity with SEQ ID NO: 1.

[0018] The DNA fragment having the base sequence of SEQ ID NO: 1 or a base sequence having 50% or more identity to SEQ ID NO: 1 may be artificially synthesized by genetic engineering techniques.

[0019] A DNA fragment according to an embodiment of the present invention encodes a nitrogen-fixing enzyme and comprises one or more of the nucleotide sequences of SEQ ID NOs: 2 to 33. The nucleotide sequences of SEQ ID NOs: 2 to 33 correspond to the open reading frames (gene IDs: cce_2943 to cce_2974) shown in FIG. 1, respectively. Gene IDs are defined, for example, in CyanoBase ([genome.microbedb.jp / cyanobase / ]) or KEGG, Kyoto Encyclopedia of Genes and Genomes ([http: / / www.genome.jp / kegg / ]).

[0020] A DNA fragment according to an embodiment of the present invention preferably comprises 5 or more of the base sequences of SEQ ID NOs: 2 to 33, more preferably 10 or more, even more preferably 15 or more, even more preferably 20 or more, even more preferably 25 or more, even more preferably 28 or more, and even more preferably 30 or more. The order of the base sequences of SEQ ID NOs: 2 to 33 may be rearranged, but is preferably not changed.

[0021] 1 according to an embodiment of the present invention comprises the nucleotide sequence of SEQ ID NO: 1, and also comprises all of the nucleotide sequences of SEQ ID NOs: 2 to 33. DNA fragment 2 according to an embodiment of the present invention may comprise a nucleotide sequence other than the nucleotide sequences of SEQ ID NOs: 2 to 33, and may, for example, comprise a nucleotide sequence that is a tRNA (gene ID: cce_RNA037).

[0022] A DNA fragment comprising one or more of the nucleotide sequences of SEQ ID NOs: 2 to 33 is derived from the genomic DNA of a cyanobacterium, for example, Cyanothece sp. ATCC 51142.

[0023] Isolation of DNA fragment 2 from cyanobacterial genomic DNA can be carried out according to the following commonly used procedures 1 to 5. More specifically, it can be carried out, for example, according to the Examples described below. The procedures for each procedure are not particularly limited, and various known methods can be used. 1. Mass Cultivation of Cyanobacteria 2. Extraction and fragmentation of cyanobacterial genomic DNA: After fragmentation, polysaccharide removal may be performed as a step to increase the purity of the DNA. 3. Cloning (1) Modify the ends of DNA fragments. (2) Size the fragments by electrophoresis (for example, at 18 V for 24 hours using low-melting-point agarose for polymer separation). (3) Recover DNA fragments of approximately 25 to 40 kb. (4) Each of the recovered DNA fragments is inserted into a vector (e.g., a fosmid vector) to create vectors (recombinant vectors) carrying various DNA fragments. 4. Preparation of Transformants (1) Vectors carrying various DNA fragments are introduced (packaged) into bacteriophages. (2) The bacteriophage (1) above is infected into a host such as E. coli, and a vector is introduced into the host to obtain E. coli (transformants) carrying vectors containing various DNA fragments. (3) The transformants are grown on agar medium and isolated as colonies. 5. Screening (1) Select E. coli that can grow in a medium that does not contain a nitrogen source (nitrogen compounds such as ammonium chloride and sodium nitrate). (2) Extract the vector from E. coli. (3) Decode the genetic information of the DNA fragment inserted into the vector.

[0024] The DNA fragments comprising one or more of the base sequences of SEQ ID NOs: 2 to 33 may be artificially synthesized by genetic engineering techniques.

[0025] [Recombinant vector] FIG. 2 is an explanatory diagram showing the site of integration of a DNA fragment into a fosmid vector according to an embodiment of the present invention.

[0026] The recombinant vector 3 according to an embodiment of the present invention includes the DNA fragment according to an embodiment of the present invention. The recombinant vector 3 is preferably a vector in which the DNA fragment has been incorporated (inserted) into a fosmid vector, but is not limited thereto. For example, the DNA fragment may be incorporated into a plasmid vector, a cosmid vector, a viral vector, etc.

[0027] The recombinant vector 3 according to the embodiment of the present invention can be obtained, for example, by following the procedure for isolating the DNA fragment 2 from the genomic DNA of a cyanobacterium described above.

[0028] [Transformant] The transformant according to the embodiment of the present invention is obtained by transforming a host such as Escherichia coli with the recombinant vector according to the embodiment of the present invention.

[0029] The transformant according to the embodiment of the present invention can be obtained, for example, by following the procedure for isolating DNA fragment 2 from cyanobacterial genomic DNA.

[0030] [Nitrogen-fixing enzyme] The nitrogen-fixing enzyme according to an embodiment of the present invention is expressed by the transformant according to the embodiment of the present invention. The nitrogen-fixing enzyme according to an embodiment of the present invention preferably comprises the amino acid sequences of SEQ ID NOS: 34 to 65, which correspond to the nucleotide sequences of SEQ ID NOS: 2 to 33, respectively (see Table 1 below; SEQ ID NOS: 2 corresponds to SEQ ID NOS: 34, ..., SEQ ID NOS: 33 corresponds to SEQ ID NOS: 65), in this order (SEQ ID NOS: 34 on the left end and 65 on the right end). The nitrogen-fixing enzyme according to an embodiment of the present invention may encode a nitrogen-fixing enzyme functionally equivalent to the nitrogen-fixing enzyme described above, by inserting, substituting, deleting, and / or adding one or more amino acids in one or more of the amino acid sequences of SEQ ID NOS: 34 to 65 (the same applies hereinafter to the nitrogen-fixing enzyme according to another embodiment of the present invention). Such a nitrogen-fixing enzyme may have, for example, 1 to 30, preferably 1 to 20, more preferably 1 to 10, even more preferably 1 to 5, and most preferably 1 to 2 amino acids inserted, substituted, deleted, and / or added (the same applies hereinafter to the nitrogen-fixing enzyme according to another embodiment of the present invention).

[0031] [Table 1]

[0032] Furthermore, the nitrogen-fixing enzyme according to an embodiment of the present invention may have one or more of the amino acid sequences of SEQ ID NOs: 34 to 65.

[0033] The nitrogen-fixing enzyme according to the embodiment of the present invention preferably comprises 5 or more of the amino acid sequences of SEQ ID NOs: 34 to 65, more preferably 10 or more, even more preferably 15 or more, even more preferably 20 or more, even more preferably 25 or more, even more preferably 28 or more, and even more preferably 30 or more. The order of the amino acid sequences of SEQ ID NOs: 34 to 65 may be rearranged, but is preferably not changed.

[0034] Furthermore, the nitrogen-fixing enzyme according to another embodiment of the present invention is not limited to that expressed by the transformant according to the embodiment of the present invention, but may be any nitrogen-fixing enzyme having the same amino acid sequence as the nitrogen-fixing enzyme according to the embodiment of the present invention. For example, it may be synthesized using a commercially available protein synthesizer.

[0035] The nitrogen-fixing enzyme is not limited to one having the same amino acid sequence as the nitrogen-fixing enzyme according to the embodiment of the present invention, but may be a nitrogen-fixing enzyme having an amino acid sequence having 40% or more identity with the amino acid sequence. Preferably, the nitrogen-fixing enzyme has an amino acid sequence having 50% or more identity with the amino acid sequence, more preferably an amino acid sequence having 60% or more identity with the amino acid sequence, even more preferably an amino acid sequence having 70% or more identity with the amino acid sequence, even more preferably an amino acid sequence having 80% or more identity with the amino acid sequence, even more preferably an amino acid sequence having 90% or more identity with the amino acid sequence, even more preferably an amino acid sequence having 95% or more identity with the amino acid sequence, and even more preferably an amino acid sequence having 98% or more identity with the amino acid sequence.

[0036] The nitrogen-fixing enzyme having an amino acid sequence that shares 40% or more identity with the nitrogen-fixing enzyme may be artificially synthesized using a commercially available protein synthesizer.

[0037] As used herein, the term "identity" of a base sequence or amino acid sequence refers to the degree of correspondence between the bases or amino acid residues constituting each sequence between the sequences being compared. For amino acid sequences, the presence of gaps and the properties of the amino acids are taken into consideration (Wilbur, Proc. Natl. Acad. Sci. USA 80:726-730 (1983)). Identity calculations can be performed using commercially available software such as BLAST (Altschul: J. Mol. Biol. 215:403-410 (1990)) or FASTA (Peasron: Methods in Enzymology 183:63-69 (1990)). Any "identity" value may be calculated using a homology search program known to those skilled in the art, and can be calculated, for example, using the default (initial setting) parameters in the National Center for Biotechnology Information (NCBI) homology algorithm BLAST (Basic local alignment search tool) http: / / www.ncbi.nlm.nih.gov / BLAST / .

[0038] [Advantages of the embodiment of the present invention] According to the embodiment of the present invention, the following effects are achieved. (1) The present invention provides a DNA fragment encoding a nitrogen-fixing enzyme that can eliminate the need to add a nitrogen source required for the growth of Escherichia coli to the culture medium, a recombinant vector containing the DNA fragment, a transformant transformed with the recombinant vector, and the nitrogen-fixing enzyme. (2) We provide a DNA fragment encoding a nitrogen-fixing enzyme that enables Escherichia coli to grow without adding rare metal elements such as V or Mo to the culture medium, a recombinant vector containing the DNA fragment, a transformant transformed with the recombinant vector, and the nitrogen-fixing enzyme. (3) Because this nitrogen fixation enzyme (a nitrogen fixation enzyme different from nitrogenase) is expressed using a gene derived from cyanobacteria, a photosynthetic organism that produces oxygen, it can fix nitrogen in photosynthetic organisms that produce oxygen, such as algae and plants. (4) Compared to the Haber-Bosch process, which requires a large amount of energy under high temperature and pressure, this is an energy-saving nitrogen fixation reaction that functions under normal temperature and pressure, which allows for significant reductions in energy costs. (5) By introducing the DNA fragment according to the embodiment of the present invention into industrially useful bacteria, algae, or plants, it is possible to obtain varieties that can grow without the need for nitrogen fertilizers (ammonia, ammonium chloride, sodium nitrate, etc.). [Example]

[0039] The present invention will be described in more detail below based on examples, but the present invention is not limited to these examples.

[0040] [Isolation of a DNA fragment encoding the nitrogen-fixing enzyme according to the present invention] Genomic DNA extracted from the cyanobacterium Cyanothece sp. ATCC 51142 (ATCC number (accession number): 51142) was physically sheared. Specifically, the extracted genomic DNA solution was pipetted five times with a fine-tipped pipette tip (QSP) and blunt-ended using End-Repair Enzyme Mix (Epicentre). Physical shearing may also be performed by vortexing or ultrasonic treatment. The blunt-ended DNA fragments were size-separated by electrophoresis, and DNA fragments with an average chain length of 25-40 kb were extracted. The DNA fragments were then fused to CopyControl DNA carrying a chloramphenicol resistance gene. TM pCC2FOS TM Each fragment was ligated to a fosmid vector (manufactured by Epicentre) (cut at the Eco72 I site (between C at position 382 and G at position 383), linearized, and dephosphorylated) (see Figure 2). T4 DNA ligase (manufactured by TaKaRa) was used for ligation to the fosmid vector. The fragments ligated to this fosmid vector were then ligated using MaxPlax TMIn vitro packaging was performed using Lambda Packaging Extracts (Epicentre). Escherichia coli EPI-300T1R (Epicentre) (hereafter referred to as EPI300) was used as the host microorganism. Transformed E. coli (transformants) were obtained on LB medium (LB / Cm) agar plates containing 12.5 mg / mL chloramphenicol.

[0041] A colony of transformed E. coli was picked and cultured in 4 mL of LB medium containing 12.5 mg / mL chloramphenicol (LB / Cm) in air at 37°C for 18 hours at 180 rpm. The cultured E. coli was then harvested, washed three times with M9-N medium (0.6% NaHPO, 0.3% KHPO, 0.05% NaCl, 0.2% glucose, 0.00147% CaCl × 2H2O, 0.05% MgSO × 7H2O, 0.01% L-leucine) containing no nitrogen sources (nitrogen compounds such as ammonium chloride or sodium nitrate), and then resuspended in M9-N medium. The resulting E. coli suspension was plated on agar plates of M9-N medium containing 12.5 mg / mL chloramphenicol (M9-N / Cm) and cultured at 37°C for 72 hours. The resulting colonies were again transferred to M9-N medium (M9-N / Cm) agar plates, and the strains that showed growth were isolated as clones that conferred the nitrogen fixation phenotype. The clones were named transformant 1.

[0042] Next, analysis of the nucleotide sequence inserted into the fosmid vector harbored by the clone exhibiting the nitrogen fixation phenotype revealed that the nucleotide sequence of SEQ ID NO: 1 described above was inserted into transformant 1. This nucleotide sequence contained 32 open reading frames with the nucleotide sequences of SEQ ID NOs: 2 to 33 described above, each encoding the amino acid sequences of SEQ ID NOs: 34 to 65 described above. The amino acid sequences of these proteins showed no homology to known nitrogen fixation proteins (nitrogenases), indicating that the nitrogen fixation enzyme and the DNA fragment encoding it obtained in this study are novel. The nucleotide sequence inserted into the fosmid vector was analyzed using primers pCC2 forward-b and pCC2 reverse-b. The nucleotide sequences of the primers used are as follows: pCC2 forward-b; CCAGTCACGACGTTGTAAACG pCC2 reverse-b; CGCCAAGCTATTTAGGTGAGAC

[0043] [Evaluation of nitrogen fixation ability of transformants] To evaluate the nitrogen fixation ability of transformant 1, a growth test was carried out in M9-N medium containing no nitrogen source. TM EPI300 (Comparative Example 1) carrying a fosmid vector (Epicentre) was cultured for 24 hours in M9+N medium (M9+N / Cm), which contained 0.1% ammonium chloride as a nitrogen source. The cells were harvested and washed three times with M9-N medium. Then, they were inoculated into 5 mL of M9-N medium (M9-N / Cm) to achieve an optical density at 660 nm (OD660) of 0.02. Shaking culture was performed at 37°C and 45 rpm using a compact shaking culture device (BioPhotoRecorder® TVS062CA, Toyo Seisakusho), and the OD660 of the culture was measured every hour. The results of the growth test are shown in Figure 3.

[0044] In M9-N medium containing no nitrogen source (M9-N / Cm), the growth of E. coli EPI300 (Comparative Example 1) was significantly inhibited, whereas transformant 1 (Example 1) showed rapid growth. These results demonstrate that nitrogen fixation ability can be imparted to E. coli by introducing the DNA fragment encoding the nitrogen-fixing enzyme obtained in this study.

[0045] The present invention is not limited to the above-described embodiments and examples, and various modifications are possible. [Explanation of symbols]

[0046] 1. Genomic DNA 2 DNA fragments 3. Fosmid vectors (recombinant vectors)

Claims

1. A DNA fragment encoding a nitrogen-fixing enzyme, which consists of the base sequence of SEQ ID NO: 1 or a base sequence having 90% or more identity to said base sequence.

2. The DNA fragment of claim 1 , wherein the DNA fragment is derived from genomic DNA of a cyanobacterium.

3. 3. The DNA fragment of claim 2, wherein the cyanobacterium is Cyanothece sp. ATCC 51142.

4. A recombinant vector comprising the DNA fragment according to any one of claims 1 to 3, and incorporated into a fosmid vector.

5. A transformant transformed with the recombinant vector according to claim 4.

Images