Pharmaceutical composition for treating prostate cancer

The RNase H2 inhibitor composition targets AR variants in prostate cancer, enhancing p53 expression to inhibit cancer cell proliferation and induce apoptosis, addressing the ineffectiveness of current CRPC treatments.

JP7766904B2Active Publication Date: 2025-11-11TOKYO METROPOLITAN GERIATRIC HOSPITAL & INST OF GERONTOLOGY
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
JP2021094694
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-06-04
Publication Date
2025-11-11
Estimated Expiration
2041-06-04

AI Technical Summary

Technical Problem

Current treatments for prostate cancer, particularly castration-resistant prostate cancer (CRPC), are ineffective due to the emergence of androgen receptor (AR) variants, necessitating a new therapeutic approach.

Method used

A pharmaceutical composition comprising an RNase H2 inhibitor, specifically double-stranded nucleic acids with RNAi effects targeting the RNase H2 gene, is used to suppress the expression of AR variants and enhance the expression of the tumor suppressor gene p53, thereby inhibiting prostate cancer cell proliferation.

Benefits of technology

The RNase H2 inhibitor effectively treats prostate cancer, including CRPC, by reducing AR expression and enhancing p53 levels, leading to significant suppression of cancer cell growth and apoptosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007766904000012
    Figure 0007766904000012
  • Figure 0007766904000013
    Figure 0007766904000013
  • Figure 0007766904000014
    Figure 0007766904000014
Patent Text Reader

Abstract

To provide a drug for treating prostate cancer including castration-resistant prostate cancer.SOLUTION: The problem can be solved by using a pharmaceutical composition for prostate cancer treatment, the composition including an RNasa H2 inhibitor as an active ingredient.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a pharmaceutical composition for treating prostate cancer. According to the present invention, refractory prostate cancer can be treated. [Background technology]

[0002] In Japan, the number of prostate cancer cases in 2017 was 91,215, making it the leading cancer among men, affecting one in ten men. Prostate cancer is a malignant tumor that grows in an androgen-dependent manner. Therefore, for localized prostate cancer, where the cancer is confined to the prostate, surgery or radiation therapy is performed, while for advanced prostate cancer, androgen deprivation therapy (ADT) is performed. While ADT is highly effective in the early stages, it gradually becomes less effective, leading to castration-resistant prostate cancer (CRPC), which is a significant clinical issue (Patent Documents 1 and 2). [Prior art documents] [Patent documents]

[0003] [Patent Document 1] Japanese Patent Application Publication No. 2019-172700 [Patent Document 2] Japanese Patent Application Publication No. 2019-123671 Summary of the Invention [Problem to be solved by the invention]

[0004] Accordingly, it is an object of the present invention to provide a therapeutic agent for treating prostate cancer, including castration-resistant prostate cancer. [Means for solving the problem]

[0005] The present inventors have conducted extensive research into therapeutic agents for castration-resistant prostate cancer and have surprisingly found that an RNase H2 inhibitor is effective in treating prostate cancer. The present invention is based on this finding. Therefore, the present invention provides [1] A pharmaceutical composition for treating prostate cancer, comprising an RNase H2 inhibitor as an active ingredient; [2] The pharmaceutical composition for treating prostate cancer according to [1], wherein the RNase H2 inhibitor is a double-stranded nucleic acid having an RNAi effect on the RNase H2 gene, the double-stranded nucleic acid comprising a sense strand containing a nucleotide sequence corresponding to the target sequence of SEQ ID NO: 13 and an antisense strand containing a nucleotide sequence complementary to the sense strand. [3] The pharmaceutical composition for treating prostate cancer according to [2], wherein the double-stranded nucleic acid is a double-stranded nucleic acid selected from the group consisting of siRNA oligonucleotides consisting of the base sequences represented by SEQ ID NOs: 1 and 2, siRNA oligonucleotides consisting of the base sequences represented by SEQ ID NOs: 3 and 4, siRNA oligonucleotides consisting of the base sequences represented by SEQ ID NOs: 5 and 6, siRNA oligonucleotides consisting of the base sequences represented by SEQ ID NOs: 7 and 8, siRNA oligonucleotides consisting of the base sequences represented by SEQ ID NOs: 9 and 10, and siRNA oligonucleotides consisting of the base sequences represented by SEQ ID NOs: 11 and 12. [4] The RNase H2 inhibitor is The following formula (1): [ka] (In the formula, X represents a single bond, an alkylene group having 1 to 3 carbon atoms, or —NH—CO—C—; Y is a single bond or -CS-; R 1 is a 5- to 6-membered aromatic heterocyclic group which may have a substituent, a phenyl group which may have a substituent, a cycloalkyl group having 5 to 6 carbon atoms which may have a substituent, or an alkyl group having 3 to 8 carbon atoms, and R 2is a cycloalkyl group having 5 to 6 carbon atoms which may have a substituent, a 5 to 6-membered aromatic heterocyclic group which may have a substituent, a phenyl group which may have a substituent, or an alkyl group having 3 to 8 carbon atoms, and when the hydrogen atom (H) of -NH- is dissociated and the nitrogen atom (N) is replaced by R 2 The pharmaceutical composition for treating prostate cancer according to [1], wherein the compound is a compound represented by the formula (I), wherein the compound (II) is a methyl group, and ... [5] The RNase H2 inhibitor compound is represented by the following formula (2): [ka] 2-cyclopentanamido-4-ethyl-5-methylthiophene-3-carboxamide represented by the following formula (3): [ka] The pharmaceutical composition for treating prostate cancer according to [4], wherein the compound is N-[(furan-2-yl)methyl]-2-{8-thia-4,6-diazatricyclo[7.4.0.02,7]trideca-1(9),2(7),3,5-tetraen-3-ylsulfanyl}acetamide represented by the formula: Regarding. One of the causes of castration-resistant prostate cancer is reported to be the emergence of androgen receptor (AR) variants (AR-Vs). siRNA SEH2A and ribonuclease (RNase) H2 inhibitors suppressed the proliferation of prostate cancer cells by increasing the expression of the tumor suppressor gene p53 and decreasing the expression of AR. Furthermore, they suppressed the expression of AR-Vs in CRPC cells. [Effects of the Invention]

[0006] According to the pharmaceutical composition for treating prostate cancer of the present invention, prostate cancer, particularly castration-resistant prostate cancer, can be effectively treated. [Brief explanation of the drawings]

[0007] [Figure 1] Graphs showing the changes in mRNA (A, D) and protein expression levels (B, E) of RNASEH2A and AR in AR-positive prostate cancer cells (LNCaP cells and 22Rv1 cells) by siRNA, as well as the effects on cell proliferation (C, F). [Figure 2] These are photographs showing the expression of tumor suppressor genes p53 and Ac-p53 proteins (A, C) in AR-positive prostate cancer cells (LNCaP cells and 22Rv1 cells) by siRNA, and graphs showing the mRNA expression of p53 downstream signals (p53, p21, BAX) (B, D). [Figure 3] Graphs showing the effect of siRNA on the protein (A) and mRNA (B) expression of AR and AR-V7, and the effect of siRNA on the growth promotion of prostate cancer cells stimulated by the androgen dihydrotestosterone (DHT) (C). [Figure 4] FIG. 1 shows the in vivo therapeutic effect of siRNA on castration-resistant prostate cancer cells. [Figure 5] 1 is a graph showing the effect of RNase H2 inhibitor compounds (RNaseH2i#1 and RNaseH2i#2) on the proliferation of AR-positive prostate cancer cells (LNCaP cells and 22Rv1 cells). [Figure 6] 1 shows photographs of Western blots showing the effects of RNase H2 inhibitor compounds (RNaseH2i#1 and RNaseH2i#2) on the expression of p53 and AR. [Figure 7]7A and 7B show the effects of RNase H2 inhibitors (RNase H2i #1 and RNase H2i #2) on DNA damage (γH2AX) and apoptosis (c-PARP). In this example, we investigated the effects of RNase H2 inhibitors on DNA damage and apoptosis. The effect on DNA damage was detected by γH2AX, and apoptosis was assessed by measuring the expression of cleaved-poly(ADP-ribose) polymerase (c-PARP), which is generated by the degradation of poly(ADP-ribose) polymerase (PARP), and by the TUNEL assay. In 22Rv1, both RNase H2i #1 and #2 (1 and 5 μM) increased the expression of γH2AX and c-PARP (Figure 7A). In LNCaP cells, RNase H2i#1 (5 μM) and RNase H2i#2 (5 μM) increased γH2AX expression, and RNase H2i#1 (1 and 5 μM) and RNase H2i#2 (5 μM) increased c-PARP expression (Fig. 7B). Furthermore, TUNEL assays showed that both RNase H2i#1 and #2 (1 and 5 μM) significantly increased the number of apoptotic cells (Fig. 8). [Figure 8] 1 shows photographs and a graph showing the effect of RNase H2 inhibitor compounds (RNaseH2i#1 and RNaseH2i#2) on apoptosis measured by a TUNEL assay. [Figure 9] FIG. 1 shows the in vivo therapeutic effect of an RNase H2 inhibitor compound on castration-resistant prostate cancer cells. DETAILED DESCRIPTION OF THE INVENTION

[0008] The pharmaceutical composition for treating prostate cancer of the present invention contains an RNase H2 inhibitor as an active ingredient.

[0009] RNase H2 RNase H is an enzyme that hydrolyzes the RNA strand of an RNA / DNA hybrid. Eukaryotes have two types, RNase H1 and RNase H2, and in human cells, RNase H2 mainly possesses the enzymatic activity of RNase H. RNase H2 is composed of three subunits, A, B, and C, each of which is composed of 299 amino acids for RNase H2A, 308 amino acids for H2B, and 164 amino acids for H2C, and none of them are single large proteins with a domain structure. RNase H2 activity is exhibited when the three proteins form a complex.

[0010] In some cases of prostate cancer, particularly CRPC, the expression of the RNase H2A gene is elevated. In the present invention, prostate cancer can be treated by inhibiting RNase H2. Furthermore, inhibiting the expression or activity of RNase H2 increases the expression level of the tumor suppressor gene p53 and / or decreases the expression level of AR. These phenomena may potentially enable the treatment of prostate cancer, particularly CRPC, but are not limited to these.

[0011] The RNase H2 inhibitor is not particularly limited as long as it suppresses and / or inhibits the activity of RNase H2, and examples thereof include double-stranded nucleic acids having an RNAi effect, anti-RNase H antibodies, RNase H inhibitor compounds, etc. Specific examples of suppression or inhibition of RNase H2 activity include, but are not limited to, suppression of RNase H2 mRNA expression, suppression of RNase H2 protein expression, and suppression or inhibition of the function of RNase H2 protein.

[0012] <Double-stranded nucleic acid with RNAi effect> The double-stranded nucleic acid is a double-stranded nucleic acid that has an RNAi effect on the RNase H2 gene, and is characterized by comprising a sense strand containing a nucleotide sequence corresponding to the target sequence of SEQ ID NO: 13, and an antisense strand containing a nucleotide sequence complementary to the sense strand. As used herein, "double-stranded nucleic acid" refers to a nucleic acid molecule containing a double-stranded nucleic acid region formed by hybridization of a desired sense strand and antisense strand, and is preferably siRNA (small interfering RNA).

[0013] The double-stranded nucleic acid of the present invention comprises a sense strand containing a nucleotide sequence corresponding to the target sequence of SEQ ID NO: 13, and an antisense strand containing a nucleotide sequence complementary to the sense strand. Here, "a nucleotide sequence corresponding to the target sequence" means a nucleotide sequence identical to the target sequence, or a nucleotide sequence in which one or several (e.g., two to three) nucleotides in the target sequence have been substituted. When the double-stranded nucleic acid is an siRNA, it is known that the RNAi effect can be achieved even if the double-stranded nucleic acid contains one to several mismatched nucleotides. In the present invention, the nucleotide sequence may not only be identical to the target sequence, but may also contain mismatches, as long as the RNAi effect is achieved.

[0014] Furthermore, the "base sequence complementary to the sense strand" in the antisense strand may be a base sequence that is sufficiently complementary to the sense strand so as to be able to hybridize with the sense strand, and may be a base sequence that is completely complementary to the sense strand, or a base sequence in which one or several (e.g., two to three) bases have been substituted in the base sequence that is completely complementary to the sense strand.

[0015] (Nucleic acid types and modifications) The type of nucleic acid constituting the double-stranded nucleic acid is not particularly limited and can be selected appropriately, and examples thereof include double-stranded RNA and DNA-RNA chimeric double-stranded nucleic acid. Chimeric types are double-stranded nucleic acids in which part of a double-stranded RNA having an RNAi effect is replaced with DNA, and are known to be highly stable in serum and to have a low ability to induce immune responses. Furthermore, the resistance and stability of double-stranded nucleic acids to nucleases can be improved by, for example, modifying the 2'-OH group, substituting the backbone with phosphorothioate or modifying it with a boranophosphate group, or introducing locked nucleic acid (LNA) in which the 2nd and 4th positions of ribose are crosslinked. Alternatively, for the purpose of increasing the efficiency of introduction into cells, the 5' or 3' end of the sense strand of the double-stranded nucleic acid can be modified with, for example, nanoparticles, cholesterol, cell membrane-penetrating peptides, etc.

[0016] (siRNA) The double-stranded RNA of the present invention is preferably an siRNA (including a chimeric type). Here, "siRNA" refers to a small double-stranded RNA having a length of 18 to 29 bases (preferably 21 to 23 bases), which cleaves the mRNA of a target gene having a sequence complementary to the antisense strand (guide strand) of the siRNA, thereby suppressing the expression of the target gene. In other words, siRNA can disrupt messenger RNA (mRNA) through RNA interference (RNAi) and suppress gene expression in a sequence-specific manner. The base sequence of the siRNA can be appropriately designed based on the base sequence of the mRNA of RNase H2A (SEQ ID NO: 13). The terminal structure of the siRNA is not particularly limited and can be appropriately selected, as long as it contains the sense strand and antisense strand described above and exhibits the desired RNAi effect. For example, the siRNA may have a blunt end or a protruding end (overhang). In particular, the siRNA preferably has a structure in which the 3'-end of each strand overhangs by 2 to 6 bases, more preferably by 2 bases. Furthermore, siRNA prepared from the base sequence of RNase H2A mRNA can be used as an active ingredient in a pharmaceutical composition for treating prostate cancer, regardless of the degree of effect.

[0017] As shown in Table 1, examples of the siRNA of the present invention include an siRNA consisting of a sense strand of SEQ ID NO: 1 (21 bases) and an antisense strand of SEQ ID NO: 2 (21 bases) targeting SEQ ID NO: 14 (23 bases) (siRNASEH2A#1 in the Examples below), an siRNA consisting of a sense strand of SEQ ID NO: 3 (21 bases) and an antisense strand of SEQ ID NO: 4 (21 bases) targeting SEQ ID NO: 15 (23 bases) (siRNASEH2A#2 in the Examples below), an siRNA consisting of a sense strand of SEQ ID NO: 5 (21 bases) and an antisense strand of SEQ ID NO: 6 (21 bases) targeting SEQ ID NO: 16 (23 bases) (siRNASEH2A#3 in the Examples below), and an siRNA consisting of a sense strand of SEQ ID NO: 5 (21 bases) and an antisense strand of SEQ ID NO: 6 (21 bases) targeting SEQ ID NO: 16 (23 bases) (siRNASEH2A#4 in the Examples below). Examples include siRNAs consisting of a sense strand of SEQ ID NO: 7 (21 bases) and an antisense strand of SEQ ID NO: 8 (21 bases) with SEQ ID NO: 17 (23 bases) as the target sequence (siRNASEH2A#4); siRNAs consisting of a sense strand of SEQ ID NO: 9 (21 bases) and an antisense strand of SEQ ID NO: 10 (21 bases) with SEQ ID NO: 18 (23 bases) as the target sequence (siRNASEH2A#5); and siRNAs consisting of a sense strand of SEQ ID NO: 11 (21 bases) and an antisense strand of SEQ ID NO: 12 (21 bases) with SEQ ID NO: 19 (23 bases) as the target sequence (siRNASEH2A#6).

[0018] [Table 1] (target sequence) #1: CTCAGCATCCGAGAATCAGGAGG (858-880) (SEQ ID NO: 14) #2: CCGTTCTTCCCACCGATATTTCC (933-935) (SEQ ID NO: 15) #3: GTCTACGCCATCTGTTATTGTCC (226-248) (SEQ ID NO: 16) #4: GCCACTGGGCTTATACAGTATGC (451-473) (SEQ ID NO: 17) #5: CTGCAGGACTTGGATACTGATTA (685-707) (SEQ ID NO: 18) #6: TGGGTGTTGGTTGATTAATTTTA (1147-1169) (SEQ ID NO: 19)

[0019] (Manufacturing method) The double-stranded RNA (particularly siRNA) of the present invention can be prepared based on conventionally known techniques. For example, single-stranded RNAs of 18 to 29 bases in length corresponding to the desired sense and antisense strands can be chemically synthesized using an existing automated DNA / RNA synthesizer, etc., and then annealed to produce siRNA. Alternatively, a desired siRNA expression vector, such as the vector of the present invention described below, can be constructed, and the expression vector can be introduced into cells, allowing intracellular reactions to be utilized to produce siRNA.

[0020] The DNA contained in the vector preferably has a promoter sequence linked upstream (5' side) of the nucleotide sequence encoding the double-stranded nucleic acid for controlling transcription of the double-stranded nucleic acid. The promoter sequence is not particularly limited and can be selected appropriately, and examples include pol II promoters such as the CMV promoter, and pol III promoters such as the H1 promoter and the U6 promoter. Furthermore, it is more preferable that a terminator sequence for terminating transcription of the double-stranded nucleic acid is linked downstream (3' side) of the nucleotide sequence encoding the double-stranded nucleic acid. The terminator sequence is also not particularly limited and can be selected appropriately depending on the purpose.

[0021] The vector is not particularly limited as long as it contains the DNA, and can be appropriately selected depending on the purpose, and examples thereof include a plasmid vector, a viral vector, etc. The vector is preferably an expression vector capable of expressing the double-stranded nucleic acid (particularly siRNA). The expression mode of the double-stranded nucleic acid is not particularly limited and can be appropriately selected depending on the purpose. For example, methods for expressing siRNA as double-stranded nucleic acid include a method of expressing two short single-stranded RNAs (tandem type) and a method of expressing single-stranded RNA as shRNA (short hairpin RNA) (hairpin type). Here, shRNA is a single-stranded RNA containing a dsRNA region of about 18 to 29 bases and a loop region of about 3 to 9 bases. When expressed in vivo, shRNA forms base pairs to become a hairpin-shaped double-stranded RNA. The shRNA is then cleaved by Dicer (RNase III enzyme) to become siRNA, which can function to suppress the expression of target genes.

[0022] The tandem siRNA expression vector contains a DNA sequence encoding the sense strand and a DNA sequence encoding the antisense strand that constitute the siRNA, and contains DNA in which a promoter sequence is linked upstream (5' side) of the DNA sequence encoding each strand, and a terminator sequence is linked downstream (3' side) of the DNA sequence encoding each strand.

[0023] Furthermore, the hairpin siRNA expression vector contains DNA in which the DNA sequence encoding the sense strand and the DNA sequence encoding the antisense strand that constitute the siRNA are arranged in opposite directions, the sense strand DNA sequence and the antisense strand DNA sequence are connected via a loop sequence, and a promoter sequence is linked upstream (5' side) and a terminator sequence is linked downstream (3' side) of them.

[0024] 《RNase H2 inhibitor compound》 The pharmaceutical composition of the present invention may contain an RNaseH2 inhibitory compound. The RNaseH2 inhibitory compound is not particularly limited, but may be a compound represented by the following formula (1): [ka] (In the formula, X represents a single bond, an alkylene group having 1 to 3 carbon atoms, or —NH—CO—C—; Y is a single bond or -CS-; R 1 represents a 5- or 6-membered aromatic heterocyclic group which may have a substituent, a phenyl group which may have a substituent, a cycloalkyl group having 5 to 6 carbon atoms which may have a substituent, or an alkyl group having 3 to 8 carbon atoms, R 2 represents an optionally substituted cycloalkyl group having 5 to 6 carbon atoms, an optionally substituted 5 to 6 membered aromatic heterocyclic group, an optionally substituted phenyl group, or an alkyl group having 3 to 8 carbon atoms, The hydrogen atom (H) of -NH- dissociates and the nitrogen atom (N) becomes R 2 may bond with the sulfur atom (S) of a substituent of the group to form a ring structure) Examples of the compound include compounds represented by the following formula:

[0025] As used herein, "X is a single bond" means that R 1 and the nitrogen atom (N) are bonded directly. Also, "Y is a single bond" means that R 2 and the carbon atom (C) are bonded as they are. Examples of the alkylene group having 1 to 3 carbon atoms include a methylene group, an ethylene group, and a propylene group. A 5- or 6-membered aromatic heterocyclic group that may have a substituent refers to a group obtained by removing one hydrogen atom from an aromatic heterocyclic ring containing a heteroatom within the ring. Examples of the heteroatom include an oxygen atom, a sulfur atom, and a nitrogen atom. Specific examples of aromatic heterocyclic groups or fused rings thereof include pyridyl, pyrazyl, pyrimidyl, quinolyl, isoquinolyl, pyrrolyl, indolenyl, imidazolyl, carbazolyl, thienyl, and furyl groups. When substituted, the hydrogen atoms of the aromatic heterocyclic group are replaced with other groups, but the number of substituents is not limited and may be, for example, one to five. Furthermore, two substituents may be combined to form an aromatic ring, an aromatic heterocyclic ring, a saturated heterocyclic ring, or a cycloalkyl ring, which may be fused with the 5- or 6-membered aromatic heterocyclic group, or may be fused with two or more rings. Examples of the cycloalkyl group having 5 to 6 carbon atoms include a cyclopentyl group and a cyclohexyl group. Examples of the alkyl group having 3 to 8 carbon atoms include a propyl group, a butyl group, a pentyl group, a hexyl group, a heptyl group, and an octyl group.

[0026] Examples of the substituent include an alkyl group having 1 to 3 carbon atoms, a halogen atom (for example, a chlorine atom, a fluorine atom, or a bromine atom), an amide group (—CO—NH 2 ), a carboxy group, a methoxycarbonyl group, or an ethoxycarbonyl group. As for the substituents of the aromatic heterocyclic group, phenyl group, or cycloalkyl group, two substituents may be combined together to form an aromatic ring, aromatic heterocyclic ring, saturated heterocyclic ring, or cycloalkyl ring, which may be condensed with the aromatic heterocyclic group, phenyl group, or cycloalkyl group, or may be a condensed ring of two or more rings. The aromatic ring, aromatic heterocyclic ring, saturated heterocyclic ring, or cycloalkyl ring is preferably 5- or 6-membered. These condensed rings may further have the above-mentioned substituents.

[0027] The hydrogen atom (H) of the -NH- dissociates, and the nitrogen atom (N) is 2 When the group is bonded to a sulfur atom (S) of a substituent to form a ring structure, R 2 This will form a condensed ring with the cycloalkyl group, aromatic heterocyclic group, or phenyl group.

[0028] Specific examples of the compound of formula (1) include compounds represented by the following chemical formula: [ka]

[0029] The compound represented by the formula (1) is preferably a compound represented by the following formula (2): [ka] 2-cyclopentaneamido-4-ethyl-5-methylthiophene-3-carboxamide (hereinafter, sometimes referred to as Compound A) represented by the formula: The following formula (3): [ka] The compound is N-[(furan-2-yl)methyl]-2-{8-thia-4,6-diazatricyclo[7.4.0.02,7]trideca-1(9),2(7),3,5-tetraen-3-ylsulfanyl}acetamide (hereinafter, sometimes referred to as Compound B), represented by the formula:

[0030] The RNase H2 inhibitor compound used in the present invention includes such salts. The salts of the RNase H2 inhibitor compound are pharmaceutically acceptable salts and may form acid addition salts or salts with bases depending on the type of substituent. Specific examples include acid addition salts with inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; and organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, mandelic acid, tartaric acid, dibenzoyltartaric acid, ditoluoyltartaric acid, citric acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, aspartic acid, and glutamic acid; salts with inorganic bases such as sodium, potassium, magnesium, calcium, and aluminum; and organic bases such as methylamine, ethylamine, ethanolamine, lysine, and ornithine; and salts with various amino acids and amino acid derivatives such as acetylleucine, as well as ammonium salts.

[0031] Furthermore, the compounds used in the present invention include the above-mentioned RNase H2 inhibitor compounds and various hydrates, solvates, and crystalline polymorphs of their salts, as well as compounds labeled with various radioactive or non-radioactive isotopes.

[0032] Pharmaceutical compositions containing one or more of the RNase H2 inhibitor compounds or salts thereof as active ingredients can be prepared by commonly used methods using excipients commonly used in the art, i.e., pharmaceutical excipients and pharmaceutical carriers. Administration may be in the form of oral administration using tablets, pills, capsules, granules, powders, liquids, etc., or parenteral administration using intra-articular, intravenous, intramuscular, etc. injections, suppositories, eye drops, eye ointments, transdermal liquids, ointments, transdermal patches, transmucosal liquids, transmucosal patches, inhalants, etc.

[0033] Solid compositions for oral administration include tablets, powders, granules, etc. In such solid compositions, one or more active ingredients are mixed with at least one inert excipient, such as lactose, mannitol, glucose, hydroxypropyl cellulose, microcrystalline cellulose, starch, polyvinylpyrrolidone, and / or magnesium aluminum metasilicate. The compositions may contain inert additives, such as lubricants such as magnesium stearate, disintegrants such as sodium carboxymethyl starch, stabilizers, and solubilizers, according to conventional methods. Tablets or pills may be coated with a sugar coating or a film of a gastric or enteric substance, if necessary. Liquid compositions for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, elixirs, etc., and contain commonly used inert diluents, such as purified water or ethanol. In addition to the inert diluents, the liquid compositions may contain adjuvants such as solubilizing agents, wetting agents, and suspending agents, as well as sweeteners, flavors, aromatics, and preservatives.

[0034] Injectable preparations for parenteral administration contain sterile aqueous or non-aqueous solutions, suspensions, or emulsions. Aqueous solvents include, for example, distilled water for injection or physiological saline. Non-aqueous solvents include, for example, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, alcohols such as ethanol, or polysorbate 80 (pharmacopoeia name). These compositions may further contain an isotonicity agent, preservative, wetting agent, emulsifier, dispersant, stabilizer, or solubilizer. These can be sterilized, for example, by filtration through a bacteria-retaining filter, addition of a sterilizer, or irradiation. Alternatively, sterile solid compositions can be prepared and dissolved or suspended in sterile water or a sterile injectable solvent before use.

[0035] External preparations include ointments, plasters, creams, jellies, poultices, sprays, lotions, eye drops, eye ointments, etc. They contain commonly used ointment bases, lotion bases, aqueous or non-aqueous liquids, suspensions, emulsions, etc. Examples of ointment or lotion bases include polyethylene glycol, propylene glycol, white petrolatum, white beeswax, polyoxyethylene hydrogenated castor oil, glycerin monostearate, stearyl alcohol, cetyl alcohol, lauromacrogol, sorbitan sesquioleate, etc.

[0036] Transmucosal agents such as inhalants and nasal agents may be in solid, liquid, or semisolid form and may be prepared according to conventional methods. For example, known excipients, as well as pH adjusters, preservatives, surfactants, lubricants, stabilizers, thickeners, etc., may be added as appropriate. Administration can be performed using a suitable inhalation or insufflation device. For example, known devices such as metered-dose inhalers or nebulizers can be used to administer the compound alone or as a powder of a formulated mixture, or as a solution or suspension in combination with a pharmaceutically acceptable carrier. Dry powder inhalers and the like may be for single or multiple doses, and can utilize dry powders or powder-containing capsules. Alternatively, the agent may be in the form of a pressurized aerosol spray using a suitable propellant, for example, a suitable gas such as a chlorofluoroalkane, hydrofluoroalkane, or carbon dioxide.

[0037] The dosage varies depending on the individual patient, such as the type of disease, symptoms, age, and gender. Oral administration typically involves a daily dose of approximately 0.001 mg / kg to 500 mg / kg for adults, administered once or in two to four divided doses. Injection involves a rapid intravenous injection or intravenous drip infusion of approximately 0.0001 mg / kg to 10 mg / kg per day for adults, administered once or twice per day. Inhalation involves a single or multiple dose of approximately 0.0001 mg / kg to 10 mg / kg per day for adults. Transdermal administration involves application of approximately 0.01 mg / kg to 10 mg / kg per day to adults, applied once or twice per day.

[0038] The RNase H2 inhibitor compound or a salt thereof can be used in combination with various therapeutic or preventive agents for diseases for which the RNase H2 inhibitor compound or a salt thereof is considered to be effective. The combination may be administered simultaneously, or separately, consecutively, or at a desired time interval. The simultaneous administration preparation may be a combined preparation or may be formulated separately.

[0039] Prostate cancer, which is the target of treatment with the pharmaceutical composition of the present invention, is cancer that develops in the prostate gland, and antiandrogens may be administered as hormone therapy. The type of prostate cancer to be treated is not particularly limited, but the composition is particularly effective against androgen-independent prostate cancer (CRPC) that has acquired resistance to hormone therapy. The composition exhibits significant anticancer activity against AR-positive CRPC and AR-negative CRPC, and can be effectively used for CRPC that has acquired resistance to hormone therapy. However, prostate cancer that is not resistant to hormone therapy and prostate cancer that is resistant to treatment due to other mechanisms can also be treated.

[0040] <<Treatment methods for prostate cancer>> The RNase H2 inhibitor can be used in a method for treating prostate cancer. That is, the present specification discloses a method for treating prostate cancer, comprising the step of administering to a prostate cancer patient a therapeutically effective amount of an RNase H2 inhibitor, such as a double-stranded nucleic acid having an RNAi effect, an anti-RNase H antibody, or an RNase H inhibitor compound.

[0041] RNase H2 Inhibitors for Use in Methods of Treating Prostate Cancer The RNase H2 inhibitor can be used in a method for treating prostate cancer. That is, the present invention discloses an RNase H2 inhibitor, such as a double-stranded nucleic acid having an RNAi effect, an anti-RNase H antibody, or an RNase H inhibitor compound, for use in a method for treating prostate cancer.

[0042] <<Use of RNase H2 inhibitors in the production of pharmaceutical compositions>> The RNase H2 inhibitor can be used to manufacture a pharmaceutical composition for treating prostate cancer. That is, the present specification discloses the use of an RNase H2 inhibitor, such as the double-stranded nucleic acid having an RNAi effect, an anti-RNase H antibody, or an RNase H inhibitor compound, in the manufacture of a pharmaceutical composition for treating prostate cancer.

[0043] 《Effect》 Although the mechanism by which RNase H2 inhibitors are effective in treating prostate cancer has not been analyzed in detail, it can be assumed as follows: RNase H2 inhibitors can suppress prostate cancer with increased RNase H2 activity by inhibiting the expression of RNase H2 mRNA, inhibiting the expression of RNase H2 protein, and inhibiting the function (activity) of RNase H2. For example, it is assumed that suppressing the expression or activity of RNase H2 increases the expression level of the tumor suppressor gene p53 and / or decreases the expression level of AR, thereby suppressing the proliferation of prostate cancer cells. The RNase H2 inhibitor compound of the present invention can suppress prostate cancer in which RNase H2 activity is enhanced by inhibiting the function (activity) of RNase H2. In particular, the RNase H2 inhibitor compound of the present invention can suppress prostate cancer in which RNase H2 activity is enhanced by inhibiting the function (activity) of RNase H2. 1 and R 2 These compounds are presumed to exhibit RNase H2 inhibitory activity by having a 5- or 6-membered aromatic heterocyclic group, a phenyl group, a cycloalkyl group having 5 or 6 carbon atoms, or an alkyl group having 3 to 8 carbon atoms, respectively. [ka] [Example]

[0044] The present invention will be specifically described below with reference to examples, but these examples are not intended to limit the scope of the present invention.

[0045] Example 1 In this example, the effects of siRNA against RNase H2A on mRNA and protein expression and cell proliferation in AR-positive prostate cancer cells (LNCaP cells and 22Rv1 cells) were examined. Androgen receptor-positive prostate cancer cell lines LNCaP (human prostate cancer cells derived from a left clavicle lymph node metastasis) and 22Rv1 cells (human prostate cancer-derived epithelial cells) were cultured at 37°C and 5% CO2 in Roswell Park Memorial Institute (RPMI) 1640 medium (Sigma-Aldrich Japan, Tokyo, Japan) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (Thermofisher, Tokyo, Japan).

[0046] The following siRNAs were constructed: siRNASEH2A#1(858-880) 5'-CAGCAUCCGAGAAUCAGGAGG-3' 5'-UCCUGAUUCUCGGAUGCUGAG-3' siRNASEH2A#2(933-935) 5'-GUUCUUCCCACCGAUAUUUCC-3' 5'-AAAUAUCGGUGGGAAGAACGG-3' siRNASEH2A#3(226-248) 5'-CUACGCCAUCUGUUAUUGUCC-3' 5'-ACAAUAACAGAUGGCGUAGAC-3' siRNASEH2A#4(451-473) 5'-CACUGGGCUUAUACAGUAUGC-3' 5'-AUACUGUAUAAGCCCAGUGGC-3' siRNASEH2A#5(685-707) 5'-GCAGGACUUGGAUACUGAUUA-3' 5'-AUCAGUAUCCAAGUCCUGCAG-3' siRNASEH2A#6(1147-1169) 5'-GGUGUUGGUUGAUUAAUUUUA-3' 5'-AAAUUAAUCAACCAACACCCA-3'

[0047] Control siRNA (silencer select siRNA) was purchased from Thermofisher (Tokyo, Japan). siRNA was introduced into cells using Lipofectamine RNAiMAX (Thermofisher, Tokyo, Japan) according to the protocol. The suppression of RNASEH2A expression was measured by qRT-PCR and Western blot analysis using RNASEH2A and AR-specific antibodies. Cell proliferation was analyzed by counting the number of viable cells. 4 Cells were seeded in 24-well plates in individual wells, and RNase H2i was added the following day. Three days after the addition of RNase H2i, the cells were harvested with PBS and an equal volume of 0.5% trypan blue stain (Nacalaitesque, Kyoto, Japan) was added to stain for dead cells. The number of unstained cells was counted using a hemocytometer (NanoEnTek, Seoul, Korea). Each group was counted three times, and the mean and standard deviation were calculated.

[0048] In siRNASEH2A-treated cells, mRNA and protein expression of RNASEH2A and AR were suppressed compared to siControl (Fig. 1A, B, D, E). Furthermore, in 22Rv1, all siRNASEH2A treatments significantly suppressed cell proliferation, while in LNCaP, siRNASEH2A#2 and #5 significantly suppressed cell proliferation (Fig. 1C and F).

[0049] Example 2 In this example, the influence of siRNASEH2A#1 and siRNASEH2A#5 on the expression of the tumor suppressor gene p53 was examined. RNASEH2A expression was suppressed, and protein expression was examined by Western blotting using RNASEH2A, p53, and Ac-p53-specific antibodies. Expression levels of p53 and Ac-p53 were increased in cells treated with siRNASEH2A#1 and #5 compared with siControl (Fig. 2A and C). Furthermore, mRNA expression levels of p53 downstream signals (p53, p21, and BAX) were measured by qRT-PCR. Expression levels of p53, p21, and BAX were increased in cells treated with siRNASEH2A#1 and #5 compared with siControl (Fig. 2B and D).

[0050] Example 3 In this example, the effects on the expression of AR and AR-V7 were examined using siRNASEH2A#1 and siRNASEH2A#5. RNASEH2A expression was suppressed, and protein expression was examined by Western blot analysis using AR and AR-V7 specific antibodies. AR and AR-V7 mRNA expression was also measured by qPCR. Furthermore, the effect of the androgen dihydrotestosterone (DHT) on the growth inhibition was examined. In cells treated with siRNASEH2A#1 and #5, the expression levels of AR and AR-V7 were reduced compared to the siControl (Figure 3). Furthermore, the DHT-dependent growth-promoting effect was significantly suppressed compared to the siControl.

[0051] Example 4 In this example, the in vivo effect of siRNA against RNase H2A on castration-resistant prostate cancer cells was examined in nude mice. 22Rv1 cells were injected subcutaneously into nude mice, and after tumor formation was confirmed, the mice were castrated (N=10). siControl and siRNASEH2A#5 were injected into the tumors every 48 hours, and tumor size was measured. Compared to siControl, siRNASEH2A#5 significantly reduced tumor size. Furthermore, protein was extracted from the tumors, and the expression levels of AR and p53 were examined. Treatment with siRNASEH2A#5 increased p53 expression and decreased AR and AR-V7 expression (Figure 4).

[0052] Example 5 In this example, we investigated the effects of RNase H2 inhibitors on prostate cancer cell lines. The RNase H2 inhibitors used were 2-cyclopentaneamido-4-ethyl-5-methylthiophene-3-carboxamide (RNase H2i#1) and N-[(furan-2-yl)methyl]-2-{8-thia-4,6-diazatricyclo[7.4.0.02,7]trideca-1(9),2(7),3,5-tetraen-3-ylsulfanyl}acetamide (RNase H2i#2). 22Rv1, LNCaP, and RWPE cells were plated in a 24-well plate at 3 × 10 4Cells were seeded at 100, 50, 10, 5, 1, 0.5, 0.1, or 0.05 μM of Compound A or Compound B. After 24 hours, cells were harvested with PBS. Dead cells were stained with 0.5% trypan blue, and the number of unstained cells was counted. Each count was performed three times, and the percentage of viable cells was calculated and compared with the control number using a t-test for statistical analysis. In 22Rv1 cells, the number of cells was halved compared to the control at 5 μM for both Compound A and Compound B. In LNCaP cells, the number of cells was halved at 10 μM for RNase H2i#1 and 5 μM for RNase H2i#2. However, no inhibitory effect on cell proliferation was observed in RWPE cells, a normal prostate epithelial cell line (Figure 5).

[0053] Example 6 In this example, we investigated the effects of RNase H2 inhibitors on p53 and AR. 22Rv1 and LNCaP cells were cultured in 6-well plates at 1 × 10 5 RNase H2i #1 or #2 was added 24 hours later, and protein was harvested 48 hours later. In 22Rv1 cells, AR expression was decreased with RNase H2i #1 (5 μM) and RNase H2i #2 (1 and 5 μM), while p53 expression was increased with both RNase H2i #1 and #2 (1 and 5 μM) (Figure 6A). In LNCaP cells, AR expression was decreased with RNase H2i #2 (1 and 5 μM), while p53 expression was increased with both RNase H2i #1 and #2 (1 and 5 μM) (Figure 6B).

[0054] Example 7 In this example, we investigated the effects of RNase H2 inhibitors on DNA damage and apoptosis. DNA damage was detected by measuring γH2AX, and apoptosis was assessed by measuring the expression of cleaved-poly(ADP-ribose) polymerase (c-PARP), which is produced by the degradation of poly(ADP-ribose) polymerase (PARP), and by TUNEL analysis. In 22Rv1 cells, both RNaseH2i#1 and #2 (1 and 5 μM) increased γH2AX and c-PARP expression (Figure 7A). In LNCaP cells, RNaseH2i#1 (5 μM) and RNaseH2i#2 (5 μM) increased γH2AX expression, and RNaseH2i#1 (1 and 5 μM) and RNaseH2i#2 (5 μM) increased c-PARP expression (Figure 7B). Furthermore, a TUNEL assay revealed that both RNase H2i#1 and #2 (1 and 5 μM) significantly increased the number of apoptotic cells (FIG. 8).

[0055] Example 8 In this example, the effect of RNase H2 inhibitors on prostate cancer cell growth was investigated in vivo. 22Rv1 cells were implanted subcutaneously into BALB / c nude mice. After tumor formation was confirmed, CRPC model mice were generated by castration. RNase H2i #1 and #2 were administered intraperitoneally to the CRPC model mice at 0.5 mg / mouse / dose, 5 times / week, to investigate the effect on tumor growth. Tumor growth in mice treated with RNase H2i #1 and #2 was significantly suppressed compared to the control group (Figure 9). [Industrial Applicability]

[0056] The pharmaceutical composition for treating prostate cancer of the present invention can be effectively used in the treatment of prostate cancer.

Claims

1. A pharmaceutical composition for treating prostate cancer, comprising an RNase H2 inhibitor as an active ingredient, wherein the RNase H2 inhibitor is a double-stranded nucleic acid selected from the group consisting of an siRNA oligonucleotide consisting of the base sequences represented by SEQ ID NOs: 1 and 2, an siRNA oligonucleotide consisting of the base sequences represented by SEQ ID NOs: 3 and 4, an siRNA oligonucleotide consisting of the base sequences represented by SEQ ID NOs: 5 and 6, an siRNA oligonucleotide consisting of the base sequences represented by SEQ ID NOs: 7 and 8, an siRNA oligonucleotide consisting of the base sequences represented by SEQ ID NOs: 9 and 10, and an siRNA oligonucleotide consisting of the base sequences represented by SEQ ID NOs: 11 and 12; The following formula (2): 【Chemistry 2】 2-cyclopentanamido-4-ethyl-5-methylthiophene-3-carboxamide represented by the following formula (3): 【Transformation 3】 The pharmaceutical composition for treating prostate cancer is N-[(furan-2-yl)methyl]-2-{8-thia-4,6-diazatricyclo[7.4.0.02,7]trideca-1(9),2(7),3,5-tetraen-3-ylsulfanyl}acetamide represented by the formula:

2. A pharmaceutical composition for treating prostate cancer as described in claim 1, wherein the RNase H2 inhibitor is an siRNA of an oligonucleotide consisting of the base sequences represented by SEQ ID NOs: 9 and 10.

Citation Information

Patent Citations

  • Compositions and methods for the diagnosis and treatment of tumors

    JP2006516192A

  • Novel peptides and combinations of peptides with their scaffolds for use in immunotherapy against colorectal cancer (CRC) and other cancers

    JP2018520644A

  • Agent for prevention or treatment of prostate cancer

    JP2019123671A

  • Treatment of metastatic prostate cancer

    JP2019172700A