Genotyping kits

Abstract

An example of a kit includes a flow cell and a genotyping probe fluid. The flow cell includes a substrate and first and second capture primers attached to the substrate. The genotyping probe fluid includes a liquid carrier and genotyping oligonucleotides in the liquid carrier. The genotyping oligonucleotides include a first primer sequence, a probe sequence representative of a target genotyping locus, a restriction endonuclease site, and a second primer sequence at least partially complementary to the second capture primer.

Description

[Technical Field]

[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application claims the benefit of U.S. Provisional Patent Application No. 62 / 981,866, filed February 26, 2020, the contents of which are incorporated herein by reference in their entirety.

[0002] (Reference to sequence listing) The sequence listing submitted via EFS-Web is incorporated herein by reference in its entirety. The file name is ILI184BPCT_IP-1897-PCT_Sequence_Listing_ST25.txt, the file size is 788 bytes, and the file creation date is December 29, 2020. [Background technology]

[0003] Detection of specific nucleic acids can be used in diagnostic medicine and molecular biology research. Gene probe assays can be useful, for example, in identifying infectious organisms such as bacteria and viruses, probing the expression of normal and mutant genes, identifying mutant genes such as cancer genes, typing tissues for compatibility before tissue transplantation, matching tissue or blood samples for forensic purposes, and investigating homologies between genes from different species. Summary of the Invention

[0004] Disclosed herein are genotyping oligonucleotides that contain specific nucleotide sequence sections designed to have a specified function in clustering, linearization, target locus identification, and / or sequencing. The genotyping oligonucleotides allow genotyping to be performed on unpatterned or patterned flow cells without additional immobilization components.

[0005] A first aspect disclosed herein is a kit comprising a flow cell and a genotyping probe fluid, wherein the flow cell comprises a substrate and a first capture primer and a second capture primer attached to the substrate, the genotyping probe fluid comprises a liquid carrier and a genotyping oligonucleotide in the liquid carrier, and the genotyping oligonucleotide comprises a first primer sequence, a probe sequence representative of a target genotyping locus, a restriction endonuclease site, and a second primer sequence that is at least partially complementary to the second capture primer.

[0006] It should be understood that any of the features of the kits disclosed herein may be combined together in any desired manner and / or configuration to achieve the advantages described in this disclosure, including, for example, achieving genotyping on a flow cell.

[0007] A second aspect disclosed herein is a method comprising: introducing a genotyping probe fluid comprising a plurality of genotyping oligonucleotides into a flow cell comprising a first capture primer and a second capture primer, each of the genotyping oligonucleotides comprising a first primer sequence, a probe sequence respectively representative of a target genotyping locus, a restriction endonuclease site, and a second primer sequence at least partially complementary to the second capture primer, whereby each genotyping oligonucleotide reacts to produce a respective clonal population of amplification products from each genotyping oligonucleotide; linearizing the amplification products to produce probe templates; sequencing at least one probe identification section of the probe templates to identify each of the probe sequences; removing at least each nascent strand from the probe templates, whereby a 3' OH group at the terminus of the probe templates is exposed; hybridizing each sample to the probe templates; and performing a genotyping reaction on each of the samples with the exposed 3' OH group.

[0008] It is understood that any features of the present methods can be combined together in any desired manner. Furthermore, it is understood that any combination of method and / or kit features can be used together and / or combined with any of the examples disclosed herein to achieve the advantages described in this disclosure, including, for example, achieving genotyping on a flow cell.

[0009] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numbers correspond to similar, but possibly non-identical, components. For the sake of brevity, reference numbers or features having a previously described function may or may not be described in conjunction with other drawings in which they appear. [Brief explanation of the drawings]

[0010] [Figure 1] Figure 1A is a schematic diagram of one example of a genotyping oligonucleotide disclosed herein. Figure 1B is a schematic diagram of another example of a genotyping oligonucleotide disclosed herein. [Figure 2] Figure 2A is a top view of an example flow cell, and Figure 2B is an enlarged, partial cross-sectional view of an example flow channel of a flow cell, including a depression formed along the flow channel. [Figure 3-1] Figure 3A, Figure 3B, and Figure 3C show a schematic representation of an example of a method disclosed herein. [Figure 3-2] Figure 3D and Figure 3E are schematic diagrams illustrating an example of a method disclosed herein. [Figure 3-3] Figure 3F and Figure 3G show a schematic representation of an example of the method disclosed herein. [Figure 3-4] FIG. 3H illustrates a schematic diagram of one example of the method disclosed herein. [Figure 4-1] FIG. 4A illustrates a schematic diagram of another example of the method disclosed herein. [Figure 4-2] Figure 4B and Figure 4C are schematic diagrams illustrating another example of the method disclosed herein. [Figure 4-3] Figure 4D and Figure 4E are schematic diagrams of another example of the method disclosed herein. [Figure 4-4] Figure 4F and Figure 4G schematically illustrate another example of the method disclosed herein. [Figure 4-5] FIG. 4H illustrates a schematic diagram of another example of the method disclosed herein. DETAILED DESCRIPTION OF THE INVENTION

[0011] Disclosed herein are genotyping oligonucleotides comprising specific nucleotide sequence sections, each nucleotide sequence section of the genotyping oligonucleotide designed to have a designated function in clustering, linearization, target locus identification, and / or sequencing.

[0012] Genotyping oligonucleotides can be used in unpatterned flow cells with capture primers on their surface, or in patterned flow cells containing wells with capture primers therein. At different regions on the unpatterned flow cell surface or within each well of a patterned flow cell, monoclonal populations (clusters) of amplification products can be generated from each genotyping oligonucleotide. The amplification products in a particular region or well can be different from the amplification products in each of the other regions or wells, and thus each monoclonal population of amplification products can represent a unique target locus for genotyping.

[0013] The genotyping oligonucleotides disclosed herein allow for genotyping to be performed on unpatterned or patterned flow cells without additional immobilization components such as solid phase beads. Additionally, the genotyping oligonucleotides disclosed herein may be suitable for use with any flow cell surface that utilizes clonal amplification clusters.

[0014] Also disclosed herein are methods for preparing target genotyping loci that can be used with genotyping oligonucleotides, amplification methods that introduce cleavage sites and generate genomic DNA (gDNA) fragments without the need for fragmentation.

[0015] definition

[0016] Terms used herein will be understood to take their ordinary meaning in the relevant art unless otherwise specified. Some terms used herein and their meanings are set forth below.

[0017] As used herein, the singular forms "a," "an," and "the" refer to both the singular and the plural unless the context clearly dictates otherwise. As used herein, the term "comprising" is synonymous with "including," "containing," or "characterized by" and is inclusive or open-ended and does not exclude further, unrecited elements or method steps.

[0018] References throughout this specification to "one example," "another example," "an example," etc. mean that a particular element (e.g., a feature, structure, composition, configuration, and / or characteristic) described in connection with an example is included in at least one example described herein and may or may not be present in other examples. Furthermore, unless the context clearly dictates otherwise, it should be understood that the described elements with respect to any example may be combined in any suitable manner in the various examples.

[0019] As used throughout this disclosure, including the claims, the terms "substantially" and "about" are used to describe and account for small variations, such as those due to variations in processing. These terms can refer to ±10% or less from the stated value, for example, ±5% or less from the stated value, ±2% or less from the stated value, ±1% or less from the stated value, ±0.5% or less from the stated value, ±0.2% or less from the stated value, ±0.1% or less from the stated value, or ±0.05% or less from the stated value.

[0020] Furthermore, ranges provided herein should be understood to include the stated range and any value or subrange within the stated range, as if expressly recited. For example, a range expressed by about 2 mm to about 300 mm should be interpreted to include not only the explicitly stated limits of about 2 mm to about 300 mm, but also individual values ​​such as about 15 mm, 22.5 mm, 245 mm, etc., and subranges such as about 20 mm to about 225 mm.

[0021] Attached: The state in which two entities are joined, fastened, adhered, connected, or bound to each other, either directly or indirectly. For example, a nucleic acid can be bound to a functionalized polymer by a covalent or non-covalent bond. A covalent bond is characterized by the sharing of electron pairs between atoms. A non-covalent bond is a physical bond that does not involve the sharing of electron pairs, and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions. When two entities are directly attached, there is no intervening component. For example, the first capture primer and probe sequence in some examples of genotyping oligonucleotides are directly covalently bound to each other. When two entities are indirectly attached, there is some intervening component. For example, the first capture primer and probe sequence in some examples of genotyping oligonucleotides are indirectly bound to each other through the index sequence portion and the priming site portion.

[0022] Deposition: Any suitable application technique, which may be manual or automated, and which in some cases results in the modification of surface properties. Generally, deposition can be carried out using evaporation techniques, coating techniques, grafting techniques, etc. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow-through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, etc.

[0023] Depression: A discrete concave feature in a substrate or patterned resin having a surface opening at least partially surrounded by a gap region(s) of the substrate or patterned resin. Depressions can have a variety of shapes at the surface opening, such as, for example, a circle, an ellipse, a square, a polygon, a star (with any number of vertices), etc. The cross section of the depression taken perpendicular to the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. By way of example, a depression can be a well or two interconnected wells. A depression can also have a more complex structure, such as a ridge, a stepped structure, etc.

[0024] Each: When used in reference to a collection of items, each identifies an individual item in the collection, but does not necessarily refer to every item in the collection. Exceptions may occur where explicit disclosure or context clearly dictates otherwise.

[0025] Flow cell: A container having a chamber (e.g., a flow channel) in which a reaction can occur, an inlet for delivering reagents to the chamber, and an outlet for removing reagents from the chamber. In some examples, the chamber allows for detection of the reaction occurring within the chamber. For example, the chamber may include one or more transparent surfaces that allow for optical detection of arrays, optically labeled molecules, etc.

[0026] Genomic DNA (gDNA): One or more chromosomal polymeric deoxyribonucleotide molecules that naturally occur in the nucleus of a eukaryotic cell or in a prokaryotic organism, virus, mitochondria, or chloroplast and contain sequences that are naturally transcribed into RNA by the cell and sequences that are not naturally transcribed into RNA by the cell. Eukaryotic gDNA contains at least one centromere, two telomeres, one origin of replication, and one sequence that is not transcribed into RNA by the eukaryotic cell, including, for example, an intron or a transcriptional promoter. Prokaryotic gDNA contains at least one origin of replication and one sequence that is not transcribed into RNA by the eukaryotic cell, including, for example, a transcriptional promoter. Eukaryotic genomic DNA can be distinguished from prokaryotic, viral, or organelle genomic DNA, for example, by the presence of introns in eukaryotic genomic DNA and the absence of introns in the gDNA of others.

[0027] Genotyping oligonucleotide: A single-stranded deoxyribonucleic acid sequence containing specific nucleotide sequence sections, one of which is a probe sequence representing a target locus for genotyping. Genotyping oligonucleotides can serve as templates for cluster generation.

[0028] Index sequence portion: A short chain ranging from 10 to 30 nucleobases that identifies the probe sequence, in some instances the probe sequence of a genotyping oligonucleotide.

[0029] Locus or Loci: A sequence-specific location in a nucleic acid sample. This term can include predetermined or predicted nucleic acid sequences expected to be present in an isolated nucleic acid molecule. These predetermined or predicted nucleic acid sequences can be referred to herein as "target genotyping loci," which can be the region(s) of interest for analysis. This term is meant to encompass single nucleotide polymorphisms (SNPs), mutations, variable number of tandem repeats (VNTRs) and simple tandem repeats (STRs), other polymorphisms, insertions, deletions, splice variants, or any other known genetic markers.

[0030] Nucleic Acid: An oligomeric or polymeric form of nucleotides of any length, which may contain deoxyribonucleotides, their analogs, or mixtures thereof. The term may refer to single- or double-stranded oligonucleotides or polynucleotides.

[0031] Nucleotide: A nitrogen-containing heterocyclic base (nucleobase), a sugar, and one or more phosphate groups. Nucleotides are the monomeric units of nucleic acid sequences. In ribonucleotides (RNA), the sugar is ribose, and in deoxyribonucleotides (DNA), the sugar is deoxyribose, i.e., a sugar lacking the hydroxyl group at the 2' position of the ribose. The nitrogen-containing heterocyclic base (i.e., nucleobase) can be a purine or pyrimidine base. Purine bases include adenine (A) and guanine (G), as well as modified derivatives or analogs thereof. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), as well as modified derivatives or analogs thereof. The C-1 atom of deoxyribose is linked to the N-1 atom of a pyrimidine or the N-9 atom of a purine. Naturally occurring nucleotides generally have backbones containing phosphodiester bonds. Nucleic acid analogs can have alterations in either the phosphate backbone, sugar, or nucleobase. Examples of nucleic acid analogs include universal base or phosphate-sugar backbone analogs such as peptide nucleic acid (PNA).

[0032] Nucleotide sequence section: a portion of a genotyping oligonucleotide. Each portion of a genotyping oligonucleotide may be designed to participate in a particular process in the method(s) disclosed herein.

[0033] Primer: A single-stranded deoxyribonucleic acid sequence capable of hybridizing to a specific sequence. One example of a primer is a "capture primer." A capture primer may be present in a well of a flow cell and hybridize to a primer sequence of a genotyping oligonucleotide or its amplification product. A capture primer can serve as a starting point for amplification and cluster generation. Another example of a primer is a "sequencing primer." A sequencing primer can hybridize to a portion of a single-stranded probe template to prime the synthesis of at least a portion of the single-stranded probe template. Other primers, such as random primers, may be used in random primer amplification reactions to generate gDNA fragments, such as target genotyping loci. Any primer can contain any combination of nucleotides or their analogs. The length of a primer can be any number of bases and can include various unnatural nucleotides. In one example, a capture primer or sequencing primer is a short strand ranging from 10 to 60 nucleobases or 20 to 40 nucleobases.

[0034] Priming sequence portion: A priming site for sequencing of the index sequence portion, both of which are included in some examples of genotyping oligonucleotides.

[0035] Probe sequence: A specific section of a genotyping oligonucleotide that contains a nucleotide sequence representing a target locus for genotyping. The probe sequence or its amplification product contains 25-50 nucleic acid bases with a specific order of complementarity and therefore can hybridize to the target locus sequence.

[0036] Single-stranded probe template: A single-stranded deoxyribonucleic acid sequence generated during clustering. The genotyping oligonucleotide serves as a template for cluster generation, and therefore the single-stranded probe template is an amplification product or part of the amplification product of the genotyping oligonucleotide.

[0037] Genotyping oligonucleotides

[0038] 1A and 1B show schematic diagrams of two different examples of genotyping oligonucleotides 10, 10', each of which contains a specific nucleotide sequence section including a first primer sequence 12, a probe sequence 14, a restriction endonuclease site 16 or 16', and a second primer sequence 18 or 18'.

[0039] The exemplary genotyping oligonucleotides 10 shown in Figure 1A include a first primer sequence 12 directly covalently linked to a probe sequence 14, which is directly covalently linked to a restriction endonuclease site 16, which is directly covalently linked to a second primer sequence 18. An example of a method involving these genotyping oligonucleotides 10 is shown and described with reference to Figures 3A-3H.

[0040] The first primer sequence 12 of the genotyping oligonucleotide 10 may have the same polarity and sequence as the first capture primer 22 (see FIG. 2B) present on the surface of the flow cell 20 (see FIGS. 2A and 2B). In this manner, the number, order, and type of nucleobases in at least a portion of the first primer sequence 12 depend on the number, order, and type of nucleobases in the first capture primer 22. During clustering, an amplification product of the genotyping oligonucleotide 10 is generated that includes a sequence complementary to the first primer sequence 12 (e.g., P5'). This complementary portion (C in FIG. 3B) 12 ) can hybridize to the first capture primer 22.

[0041] In one example, the first capture primer 22 has a universal sequence for capture and / or amplification purposes. One example of a first capture primer 22 is the P5 primer, an example of which is used on the surface of commercially available flow cells sold by Illumina Inc. for sequencing on HISEQ™, HISEQX™, MISEQ™, MISEQDX™, MINISEQ™, NEXTSEQ™, NEXTSEQDX™, NOVASEQ™, ISEQ™ GENOME ANALYZER™, and other instrument platforms. In another example, the first capture primer 22 includes: First capture primer: 5'→3' AATGATACGGCGACCACCGA (SEQ ID NO: 1)

[0042] The first primer sequence 12 may have the same sequence as the first capture primer 22. While an example is provided, it should be understood that other sequences may be used for the first primer sequence 12 and the first capture primer 22. The first primer sequence 12 may also be at least partially identical to the first capture primer 22. "At least partially identical" means that a sufficient number of nucleic acid bases in the first primer sequence 12 and the first capture primer 22 are the same so that hybridization can occur between the two. The first primer sequence 12 of the genotyping oligonucleotide 10 is directly attached to the probe sequence 14. The probe sequence 14 represents the target genotyping locus. Thus, the probe sequence 14 can hybridize to the target locus sequence during genotyping.

[0043] The restriction endonuclease site 16 of the genotyping oligonucleotide 10 is attached directly to the probe sequence 14. This restriction endonuclease site 16 provides the genotyping oligonucleotide 10 with a digestion site. In one example, the restriction endonuclease site 16 is sensitive to a restriction enzyme selected from the group consisting of a four-base cutter restriction endonuclease, a five-base cutter restriction endonuclease, and a six-base cutter restriction endonuclease. Some example four-base cutters include DpnII, FatI, MluCI, BfuCI, MboI, Sau3AI, Bfal, BstUI, PmII, and Kasl, commercially available from, for example, New England BioLabs Inc., ThermoFisher Scientific, etc. Some example five-base cutters include BssKI, StyD41, MaeIII, PspGI, Ddel, Fmul, PspGI, and Tfil, commercially available from, for example, New England BioLabs Inc., ThermoFisher Scientific, etc. Some example 6-base cutters include AcII, Afel, Nspl, HaeII, and Tatl, commercially available from, for example, New England BioLabs Inc., ThermoFisher Scientific, etc. The restriction endonuclease site 16 is positioned such that after cleavage / digestion with the restriction enzyme, the last base of the probe sequence 14 is the last 3'OH exposed for the sequencing / genotyping reaction.

[0044] The second primer sequence 18 of the genotyping oligonucleotide 10 is at least partially complementary to the second capture primer 24 (see FIG. 2B) present on the surface of the flow cell 20. By "at least partially complementary" is meant that a sufficient number of nucleobases in the second primer sequence 18 and the second capture primer 24 are complementary so that hybridization can occur between the two of 18, 24. Thus, the number, order, and types of nucleobases in the second primer sequence 18 depend on the number, order, and types of nucleobases in the second capture primer 24.

[0045] In one example, second capture primer 24 has a universal sequence for capture and / or amplification purposes. An example of second capture primer 24 is the P7 primer, an example of which is used on the surface of commercially available flow cells sold by Illumina Inc. for sequencing on HISEQ™, HISEQX™, MISEQ™, MISEQDX™, MINISEQ™, NEXTSEQ™, NEXTSEQDX™, NOVASEQ™, ISEQ™ GENOME ANALYZER™, and other instrument platforms. In another example, second capture primer 24 includes: Second capture primer: 5'→3' CAAGCAGAAGACGGCATACGA (SEQ ID NO: 2) The second capture primer sequence 18 is at least partially complementary to the sequence of the second primer sequence 24. In this example, the second primer sequence 18 may include: Second primer sequence: 5'→3' GTTCGTCTTCTGCCGTATGCT (SEQ ID NO: 3) Although an example is provided, it should be understood that other sequences may be used for the second primer sequence 18 and the second capture primer 24 .

[0046] The second capture primer 24 on the flow cell 20 also includes a cleavage site (see reference numeral 46 in FIG. 3A). The cleavage site may be used to linearize the cross-linked probe template after cluster formation (described in more detail with reference to FIG. 3E). The chemical nature of the cleavage site of the second capture primer 24 may be different from the chemical nature of the restriction endonuclease site 16 of the genotyping nucleotide 10 to prevent premature digestion of the restriction endonuclease site 16. The cleavage site and the restriction endonuclease site 16 have separate and specific cleavage reactions. These reactions may be considered orthogonal in that one reaction does not initiate, affect, or otherwise interfere with the other. Examples of suitable cleavage sites for the second capture primer 24 include enzymatically or chemically cleavable nucleobases, modified nucleobases, or linkers (e.g., attachments between the nucleobases). Enzymatically cleavable nucleobases may be susceptible to cleavage by reaction with glycosylases and endonucleases or by reaction with exonucleases. A specific example of a cleavable nucleobase is deoxyuracil (dU), which can be targeted with the USER enzyme. In one example, a uracil base may be incorporated at the seventh base position from the 3' end of the second capture primer 24. Other abasic sites may also be used. Examples of chemically cleavable nucleobases, modified nucleobases, or linkers include 8-oxoguanine, vicinal diols, disulfides, silanes, azobenzenes, photocleavable groups, allyl T (a thymine nucleotide analog with an allyl functionality), allyl ethers, or azide-functional ethers.

[0047] Referring now to FIG. 1B, another example of a genotyping oligonucleotide 10′ is shown schematically. The exemplary genotyping oligonucleotide 10′ shown in FIG. 1B includes more nucleotide sequence sections than the genotyping oligonucleotide 10 shown in FIG. 1A. Specifically, the genotyping oligonucleotide 10′ further includes an index sequence portion 26 and a priming site portion 28. In this example, the genotyping oligonucleotide 10′ includes a first primer sequence 12 covalently linked directly to the index sequence portion 26, which is covalently linked directly to the priming site portion 28, which is covalently linked directly to the probe sequence 14, which is linked to a second primer sequence 18′. In this example, the restriction endonuclease site 16′ may be located between the probe sequence 14 and the second primer sequence 18′, or may be incorporated into the second primer sequence 18′. An example of a method involving these genotyping oligonucleotides 10′ is shown and described with reference to FIGS. 4A-4H.

[0048] The first primer sequence 12 of the genotyping oligonucleotide 10' may be any of the examples of the genotyping oligonucleotide 10 described herein.

[0049] The first primer sequence 12 of the genotyping oligonucleotide 10' is attached directly to an index sequence portion 26. The index sequence portion 26 is unique to the probe sequence 14 in the genotyping oligonucleotide 10'. In this manner, the index sequence portion 26 provides an identifier or distinct barcode that can be used to identify the target locus sequence represented by the probe sequence 14.

[0050] Index sequence portion 26 is directly attached to priming site portion 28. Priming site portion 28 can hybridize to a sequencing primer that initiates nucleotide incorporation along index sequence portion 26, one nucleobase at a time, in a template-dependent manner.

[0051] The priming site portion 28 of the genotyping oligonucleotide 10' is attached directly to the probe sequence 14. As described herein, the probe sequence 14 is capable of hybridizing to a target locus sequence during genotyping.

[0052] In the genotyping oligonucleotide 10', the probe sequence 14 is attached to the second primer sequence 18'. In some instances, the probe sequence 14 is indirectly attached to the second primer sequence 18', and the restriction endonuclease site 16' is positioned between the two sections 14, 18'. In other instances, the probe sequence 14 is directly attached to the second primer sequence 18', and the restriction endonuclease site 16' is incorporated into the second primer sequence 18'. In any of these examples, the restriction endonuclease site 16' may be sensitive to a Type IIS restriction enzyme. Type IIS restriction enzymes may or may not be methyl-sensitive. Type IIS restriction enzymes are a specific group of enzymes that recognize asymmetric DNA sequences (e.g., restriction endonuclease site 16') and cleave at a defined distance (e.g., from 1 nucleotide to about 20 nucleotides) outside the recognition sequence. Some examples of Type IIS restriction enzymes that are not methyl-sensitive are selected from the group consisting of BbvI (BseXI), BmrI, Bvel (BspMI), etc. Some Type IIS restriction enzymes that are methyl-sensitive are selected from the group consisting of SfaNI, FoKI, HGAI, etc. Although some examples are provided, any suitable Type IIS restriction enzyme may be used, depending on the recognition sequence of the restriction endonuclease site 16'. Methyl-sensitive and non-methyl-sensitive enzymes are commercially available from, for example, New England BioLabs Inc., ThermoFisher Scientific, etc.

[0053] When the restriction endonuclease site 16' is attached to the end of the second primer sequence 18', any example of the second primer sequence 18' may be used. When the restriction endonuclease site 16' is incorporated into the second primer sequence 18', the restriction endonuclease site 16' may be introduced at any desired position along the length of the second primer sequence 18'. The position may depend on the location of the second restriction endonuclease site along the second capture primer 24', the predetermined cleavage distance of the Type IIS restriction enzyme used, and where cleavage is desired along the genotyping oligonucleotide 10' (or its amplification product). This cleavage occurs prior to the genotyping reaction (during linearization, as discussed further herein), preparing the genotyping oligonucleotide 10' or its amplification product for analysis of the target genotyping locus at the nucleobase of interest. As an example, during a genotyping reaction, a single-stranded DNA sample, e.g., a target genotyping locus, is hybridized to, for example, an amplification product, and a single sequencing by synthesis reaction is performed to identify the nucleobase of interest. To perform this analysis, the amplification product must be cleaved at a predetermined position, and the next nucleobase to be sequenced is complementary to the nucleobase of interest. In this manner, the restriction endonuclease site 16' is positioned so that after cleavage / digestion with the restriction enzyme, the last base of the probe sequence 14 is the final 3'OH exposed in the sequencing / genotyping reaction. In one example, the restriction endonuclease site 16' can be incorporated anywhere from the 7th base position to the 15th base position from the 3' end of the second primer sequence 18'.

[0054] In the genotyping oligonucleotide 10', the second primer sequence 18' is complementary to the second capture primer 24 (see FIG. 2B) present on the surface of the flow cell 20. In this way, the genotyping oligonucleotide 10' can hybridize to the second capture primer 24' on the flow cell 20.

[0055] The second capture primer 24' may also contain a second restriction endonuclease site (see reference number 46' in Figure 4A), which is complementary to the restriction endonuclease site 16' of the genotyping oligonucleotide 10'. The asymmetric sequence may be sensitive to a type IIS restriction endonuclease. Cleavage within some predetermined distance of the hybridized restriction endonuclease site 16', 46' is performed during linearization (as described above and further explained with reference to Figure 4F). This removes the strand that is not to be genotyped. The location of the second restriction endonuclease site 46' may be at the end of the second capture primer 24' or may be incorporated into the second capture primer 24', as long as the two restriction endonuclease sites 16', 46' can hybridize to form a recognition site for the type IIS restriction endonuclease.

[0056] Any of the exemplary genotyping oligonucleotides 10, 10' may be prepared using an oligonucleotide synthesis process.

[0057] Flow cell

[0058] The genotyping oligonucleotides 10, 10' may be used in any patterned flow cell 20. Although not shown, it should be understood that other non-patterned flow cells (e.g., not including depressions) utilizing the clustering chemistry disclosed herein may alternatively be used in the embodiments disclosed herein. In non-patterned flow cells, software may be used to identify clusters.

[0059] An example of a patterned flow cell 20 is shown in Figure 2A, and an example of a patterned structure within the flow cell 20 is shown in Figure 2B. The flow cell 20 includes a substrate 30 that at least partially defines lanes or flow channels 32.

[0060] The substrate 30 can be a single layer / material. Examples of suitable single layer substrates include epoxy siloxane, glass, modified or functionalized glass, plastics (acrylic, polystyrene and copolymers of styrene with other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (e.g., TEFLON® from Chemours), cycloolefin / cycloolefin polymer (COP) (e.g., ZEONOR® from Zeon), polyimide, etc.), nylon (polyamide), ceramic / ceramic oxide, silica, fused silica, or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5), or other tantalum oxides (TaO x ), hafnium oxide (HfO2), carbon, metals, inorganic glass, etc.

[0061] If the substrate 30 is a single layer, the depressions 38 (see FIG. 2B) are defined in the single layer.

[0062] As shown in FIG. 2B, the substrate 30 may also be a multi-layer substrate 30′. Some examples of multi-layer substrates 30′ include glass or silicon having a coating layer of tantalum oxide or another ceramic oxide on its surface. Another example of a multi-layer substrate 30′ may be a silicon-on-insulator (SOI) substrate. In the example shown in FIG. 2B, the multi-layer substrate 30′ includes a lower support 34 (e.g., glass or silicon) and a patterned material 36 positioned on the support 34.

[0063] The patterned material 36 defines depressions 38 separated by interstitial regions 40. A depression 38 is located within each of the flow channel(s) 32.

[0064] It should be understood that any material that can be selectively deposited, or deposited and patterned, to form recesses 38 and interstitial regions 40 can be used for patterning material 36 .

[0065] As one example, inorganic oxides can be selectively applied via vapor deposition, aerosol printing, or inkjet printing to the substrate 34. Examples of suitable inorganic oxides include tantalum oxide (e.g., TaO), aluminum oxide (e.g., AlO), silicon oxide (e.g., SiO), hafnium oxide (e.g., HfO), and the like.

[0066] As another example, the resin may be patterned after being applied to the support 34. Suitable deposition techniques include chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, puddle dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, and the like. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, printing techniques, and the like. Some examples of suitable resins include polyhedral oligomeric silsesquioxane-based resins (e.g., POSS® from Hybrid Plastics), non-polyhedral oligomeric silsesquioxane epoxy resins, poly(ethylene glycol) resins, polyether resins (e.g., ring-opened epoxies), acrylic resins, acrylate resins, methacrylate resins, amorphous fluoropolymer resins (e.g., CYTOP® from Bellex), and combinations thereof.

[0067] As used herein, the term "polyhedral oligomeric silsesquioxane" refers to a hybrid intermediate between silica (SiO) and silicone (RSiO) (e.g., RSiO 1.5An example of a polyhedral oligomeric silsesquioxane may be that described by Kehagias et al., Microelectronic Engineering, Vol. 86 (2009), pp. 776-778, which is incorporated by reference in its entirety. In one example, the composition may have the chemical formula [RSiO 3 / 2 ] n where the R groups can be the same or different. Exemplary R groups of the polyhedral oligomeric silsesquioxanes include epoxy, azide / azido, thiol, poly(ethylene glycol), norbornene, tetrazine, acrylate, and / or methacrylate, or further, for example, alkyl, aryl, alkoxy, and / or haloalkyl groups. The resin compositions disclosed herein can include one or more different cage or core structures as monomer units.

[0068] In one example, the substrates 30, 30' can be fabricated using circular wafers having diameters ranging from about 2 mm to about 300 mm, or rectangular sheets or panels having maximum dimensions of up to about 10 feet (about 3 meters). In one example, the substrates 30, 30' are fabricated using circular wafers having diameters ranging from about 200 mm to about 300 mm. In another example, rectangular support panels having a larger surface area than a 300 mm circular wafer may be used. Wafers, panels, and other large substrate materials may be diced into individual flow cell substrates 30, 30'. In another example, the substrates 30, 30' are dies having widths ranging from about 0.1 mm to about 10 mm. While exemplary dimensions are provided, it should be understood that substrate materials having any suitable dimensions may be used to fabricate the substrates 30, 30'.

[0069] The flow cell 20 also includes flow channels 32. While several flow channels 32 are shown in FIG. 2A, it should be understood that any number of channels 32 may be included in the flow cell 20 (e.g., a single channel 32, four channels 32, etc.). Each flow channel 32 is an area defined between two coupled components (e.g., a substrate 30, 30′ and a lid, or two substrates 30, 30′) through which fluids can be introduced and removed. Each flow channel 32 may be isolated from one another such that fluids introduced into any particular flow channel 32 do not flow into any adjacent flow channels 32. Some examples of fluids introduced into flow channels 32 may introduce reaction components (e.g., target genotyping locus library fragments, polymerase, etc.), wash solutions, etc.

[0070] As mentioned above, flow channel 32 is defined between substrate 30, 30' and a lid (not shown), or between substrate 30, 30' and another substrate (not shown, but similar to substrate 30, 30').

[0071] In one example, the lid or additional substrate may be bonded to at least a portion of the substrate 30, 30′, such as in a portion of the gap region 40. The bond formed between the lid or additional substrate and the substrate 30, 30′ may be a chemical bond or a mechanical bond (e.g., using fasteners, etc.).

[0072] The lid can be any material that is transparent to the excitation light directed toward the substrate 30, 30'. By way of example, the lid can be glass (e.g., borosilicate, fused silica, etc.), plastic, etc. A commercially available example of a suitable borosilicate glass is D 263® available from Schott North America, Inc. Commercially available examples of suitable plastic materials, i.e., cycloolefin polymers, are ZEONOR® products available from Zeon Chemicals LP.

[0073] The lid or additional substrate may be bonded to the substrate 30, 30' using any suitable technique, such as laser bonding, diffusion bonding, anodic bonding, eutectic bonding, plasma activated bonding, glass frit bonding, or other methods known in the art. In one example, a spacer layer may be used to bond the lid or additional substrate to the substrate 30, 30'. The spacer layer may be any material that seals at least a portion of the substrate 30, 30' and the lid or additional substrate together. In some examples, the spacer layer may be a radiation-absorbing material that aids in bonding.

[0074] In one example, the flow channels 32 have a rectangular configuration. The length and width of the flow channels 32 may be smaller than the length and width, respectively, of the substrate 30, 30′, such that a portion of the substrate surface surrounding the flow channels 32 is available for attachment to a lid (not shown) or another substrate 30, 30′. In some cases, the width of each flow channel 32 may be at least about 1 mm, at least about 2.5 mm, at least about 5 mm, at least about 7 mm, at least about 10 mm, or more. In some cases, the length of each lane / flow channel 32 may be at least about 10 mm, at least about 25 mm, at least about 50 mm, at least about 100 mm, or more. The width and / or length of each flow channel 32 may be greater than, less than, or between the values ​​specified above. In another example, the flow channels 32 are square (e.g., 10 mm x 10 mm).

[0075] The depth of each flow channel 32 can be as small as the thickness of a single layer, for example, if microcontact, aerosol, or inkjet printing is used to deposit the spacer layer that defines the flow channel walls. The depth of the flow channel 32 can be greater, for example, if the flow channel 32 is partially defined within the substrate 30, 30' (e.g., via etching, lithography, etc.), such that a portion of the substrate and spacer layer define the flow channel walls. In other examples, the depth of each flow channel 32 can be about 1 μm, about 10 μm, about 50 μm, about 100 μm, or more. In one example, the depth can range from about 10 μm to about 100 μm. In another example, the depth can range from about 10 μm to about 30 μm. In yet another example, the depth is about 5 μm or less. It should be understood that the depth of each flow channel 32 can be greater than, less than, or between the values ​​specified above.

[0076] Referring now specifically to FIG. 2B, an example of the structure within one of the flow channels 32 of the flow cell 20 is shown.

[0077] As shown in FIG. 2B , the patterned material 36 includes depressions 38 defined therein and interstitial regions 40 separating adjacent depressions 38. Many different layouts of the depressions 38 can be envisioned, including regular, repeating, and irregular patterns. In one example, the depressions 38 are arranged in a hexagonal grid for close packing and improved density. Other layouts may include, for example, rectangular layouts, triangular layouts, etc. In some examples, the layout or pattern may be an xy format of depressions 38 in rows and columns. In other examples, the layout or pattern may be a repeating arrangement of depressions 38 and / or interstitial regions 40. In yet other examples, the layout or pattern may be a random arrangement of depressions 38 and / or interstitial regions 40. The pattern may include stripes, swirls, lines, triangles, rectangles, circles, arcs, checkerboards, diagonals, arrows, squares, and / or crosshatching.

[0078] The layout or pattern of the dimples 38 may be characterized in terms of the density of the dimples 38 (the number of dimples 38) within a given area. For example, the dimples 38 may be spaced apart from each other by 1 mm. 2 The density may be, for example, approximately 2 million per mm. 2 Approximately 100 per 1mm 2 Approximately 1,000 per 1mm 2 Approximately 100,000 per mm 2 Approximately 1 million per mm 2 Approximately 2 million per 1mm 2 Approximately 5 million per mm 2 Approximately 10 million per mm 2 The density of the depressions 38 in the patterned material 36 can be adjusted to different densities, including densities of about 50 million per depression. It should further be understood that the density of the depressions 38 in the patterned material 36 can be between one of the low and high values ​​selected from the ranges above. By way of example, a high-density array can be characterized as having depressions 38 separated by less than about 100 nm, a medium-density array can be characterized as having depressions 38 separated by about 400 nm to about 1 μm, and a low-density array can be characterized as having depressions 38 separated by more than about 1 μm. While example densities are provided, it should be understood that any suitable density can be used. The density of the depressions 38 may depend in part on the depth of the depressions 38. In some cases, it may be desirable for the spacing between the depressions 38 to be even greater than the examples described herein.

[0079] The layout or pattern of the recesses 38 may also, or alternatively, be characterized in terms of average pitch, or the spacing from the center of a recess 38 to the center of an adjacent recess 38 (center-to-center spacing), or the spacing from the left edge of one recess 38 to the right edge of the adjacent recess 38 (edge-to-edge spacing). The pattern may be regular so that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, approximately about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, or about 100 μm. The average pitch of a particular pattern of recesses 38 may be between one of the lower and upper values ​​selected from the ranges above. In one example, the recesses 38 have a pitch (center-to-center spacing) of about 1.5 μm. While example average pitch values ​​are provided, it should be understood that other average pitch values ​​may also be used.

[0080] The size of each recess 38 may be characterized by its volume, opening area, depth, and / or diameter.

[0081] Each well 38 can have any volume capable of containing fluid. The minimum or maximum volume can be selected to correspond, for example, to the expected throughput (e.g., multiplexing), resolution, nucleotide, or analyte reactivity for downstream use of the flow cell 20. For example, the volume can be at least about 1×10- 3 μm 3 , at least about 1 × 10 2 μm 3 , at least about 0.1 μm 3 , at least about 1 μm 3 , at least about 10 μm 3 , at least about 100 μm 3 Alternatively, or in addition, the volume may be at most about 1×10 4 μm 3 , up to about 1 × 10 3 μm 3 , up to about 100 μm 3 , up to about 10 μm 3 , up to about 1 μm3 , up to about 0.1 μm 3 , or even less.

[0082] The area occupied by the opening of each well can be selected based on the same criteria as for the volume described above. For example, the area of ​​the opening of each well is at least about 1×10 -3 μm 2 , at least about 1 x 10 -2 μm 2 , at least about 0.1 μm 2 , at least about 1 μm 2 , at least about 10 μm 2 , at least about 100 μm 2 Alternatively, or in addition, the area may be at most about 1×10 3 μm 2 , up to about 100 μm 2 , up to about 10 μm 2 , up to about 1 μm 2 , up to about 0.1 μm 2 , up to about 1 × 10 -2 μm 2 The area occupied by the opening of each recess may be greater than, less than, or between the above values.

[0083] The depth of each 38 may be large enough to accommodate a portion of the polymer hydrogel 42. In one example, the depth may be at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively, or in addition, the depth may be at most about 1×10 3 The depth of each depression 38 may be greater than, less than, or between the values ​​indicated above.

[0084] In some cases, the diameter or length and width of each depression 38 can be at least about 50 nm, at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively, or in addition, the diameter or length and width can be at most about 1×10 3 The diameter or length and width of each depression 38 may be greater than, less than, or between the values ​​specified above.

[0085] In the example shown in Figure 2B, a polymer hydrogel 42 is positioned within each of the depressions 38. One example of a polymer hydrogel 42 is an acrylamide copolymer, such as poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide), PAZAM. PAZAM and some other forms of acrylamide copolymers are represented by the following structure (I): [ka] (In the formula, R A is selected from the group consisting of azide, optionally substituted amino, optionally substituted alkenyl, optionally substituted alkyne, halogen, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxy, optionally substituted tetrazole, optionally substituted tetrazine, nitrile oxide, nitrone, sulfate, and thiol; R B is H or optionally substituted alkyl; R C , R D , and R E are each independently selected from the group consisting of H and optionally substituted alkyl; -(CH2) p - may be optionally replaced by each p is an integer ranging from 1 to 50; n is an integer ranging from 1 to 50,000, and and m is an integer ranging from 1 to 100,000.

[0086] Those skilled in the art will recognize that the arrangement of the "n" and "m" repeating features in structure (I) is representative, and that the monomer subunits may be present in any order in the polymer structure (e.g., random, block, patterned, or combinations thereof).

[0087] The molecular weight of PAZAM and other forms of acrylamide copolymers can range from about 5 kDa to about 1500 kDa, or from about 10 kDa to about 1000 kDa, or in a particular example, about 312 kDa.

[0088] In some instances, PAZAM and other forms of acrylamide copolymers are linear polymers. In other instances, PAZAM and other forms of acrylamide copolymers are lightly crosslinked polymers.

[0089] In another example, the polymer hydrogel 42 may be a variation of structure (I). In one example, the acrylamide units are N,N-dimethylacrylamide. [ka] In this example, the acrylamide unit of structure (I) is [ka] where R D , R E , and R F are each H or C1-C6 alkyl, and R G and R Hare each C1-C6 alkyl (rather than H as in acrylamide). In this example, q can be an integer ranging from 1 to 100,000. In another example, in addition to the acrylamide unit, N,N-dimethylacrylamide can be used. In this example, structure (I) contains, in addition to the "n" and "m" repeating features, [ka] wherein R D , R E , and R F are each H or C1-C6 alkyl, and R G and R H are each C1-C6 alkyl. In this example, q can be an integer ranging from 1 to 100,000.

[0090] As another example of polymer hydrogel 42, the repeating "n" feature in structure (I) can be structure (II): [ka] (In the formula, R 1 is H or C1-C6 alkyl; R2 is H or C1-C6 alkyl; L is a linker comprising a linear chain having 2-20 atoms selected from the group consisting of carbon, oxygen, and nitrogen, with 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a linear chain comprising 1-4 atoms selected from the group consisting of carbon, oxygen, and nitrogen, with optional substituents on the carbon and any nitrogen atoms in the linear chain; A is an N-substituted amide with H or C1-C4 alkyl attached to N; and Z is a nitrogen-containing heterocycle. Examples of Z include 5- to 10-membered rings present as monocyclic or fused structures. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.

[0091] As yet another example, the polymer hydrogel 42 may have the structures (III) and (IV): [ka] (In the formula, R 1a , R 2a , R 1b and R 2b each independently selected from hydrogen, optionally substituted alkyl, or optionally substituted phenyl; R 3a and R 3b each is independently selected from hydrogen, optionally substituted alkyl, optionally substituted phenyl, or optionally substituted C7-C14 aralkyl; 1 and L 2 may each comprise a repeat unit of each of (independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker).

[0092] It should be understood that other molecules can be used to form the polymer hydrogel 42, as long as they are functionalized to graft capture primers 22, 24, or 22, 24′. Other examples of suitable polymer layers include those with colloidal structures, such as agarose, or polymer mesh structures, such as gelatin, or cross-linked polymer structures, such as polyacrylamide polymers and copolymers, silane-free acrylamide (SFA), or azide-decomposed versions of SFA. Examples of suitable polyacrylamide polymers can be synthesized from acrylamide and acrylic acid or acrylic acid containing vinyl groups, or from monomers that form [2+2] photocycloaddition products. Still other examples of suitable polymer hydrogels 42 include mixed copolymers of acrylamide and acrylate. Various polymeric structures containing acrylic monomers (e.g., acrylamide, acrylate, etc.) can be utilized in the embodiments disclosed herein, including star polymers, star-shaped or star-block polymers, branched polymers, including dendrimers, etc. For example, monomers (such as acrylamide) can be incorporated into the branches (arms) of a star polymer, either randomly or in blocks.

[0093] To introduce the polymer hydrogel 42 into the flow channels 32, a mixture of the polymer hydrogel 42 can be generated and then applied to the substrate 30, 30′ (including the recesses 38). In one example, the polymer hydrogel 42 can be present in a mixture (e.g., with water or with ethanol and water). The mixture can then be applied to the substrate surface (included in the recesses 38) using spin coating, immersion or dip coating, spray coating, flow of material under positive or negative pressure, or another suitable technique. These types of techniques deposit the polymer hydrogel 42 over the substrate 30, 30′ (e.g., within the recesses 38 and over the interstitial regions 40 surrounding the recesses 38) in a blanket manner. Other selective deposition techniques (e.g., involving masks, controlled printing techniques, etc.) can be used to specifically deposit the polymer hydrogel 42 within the recesses 38 and not over the interstitial regions 40.

[0094] In some examples, the substrate surface (including the portion exposed in the recess 38) may be activated, and then the mixture (including the polymer hydrogel 42) may be applied thereto. In one example, a silane or silane derivative (e.g., norbornene silane) may be deposited on the substrate surface using vapor deposition, spin coating, or other deposition methods. In another example, the substrate surface may be exposed to plasma ashing to generate surfactants (e.g., —OH groups) that can adhere to the polymer hydrogel 42.

[0095] Depending on the polymer hydrogel 42, the applied mixture may be subjected to a curing process. In one example, curing may occur at temperatures ranging from room temperature (e.g., about 18°C ​​to about 25°C) to about 95°C for a time period ranging from about 1 millisecond to about several days.

[0096] In some examples, polishing can then be performed to remove the polymer hydrogel 42 from the gap region 40 surrounding the depression 38, while leaving the polymer hydrogel 42 at least substantially intact on the surface within the depression 38.

[0097] The flow cell 20 also includes first and second capture primers 22, 24, or 22, 24'. Any example of the capture primers 22, 24, or 22, 24' described herein may be used. The set of capture primers 22, 24, or 22, 24' selected for a particular flow cell 20 may depend, in part, on which genotyping oligonucleotides 10, 10' are to be used therewith.

[0098] A grafting process may be performed to graft the first and second capture primers 22, 24 or 22, 24' to the polymer hydrogel 42 within the recess 38. In one example, the first and second capture primers 22, 24 or 22, 24' may be immobilized to the polymer hydrogel 42 by a single-point covalent bond at or near the 5' end of each of the first and second capture primers 22, 24 or 22, 24'. This attachment may be accomplished by (i) attaching the cognate primer sequence 12 or copied primer sequence C of the primer sequence-specific portion to the polymer hydrogel 42. 18 , C 18’ and (ii) a 3' hydroxyl (OH) group, which frees capture primer extension. Any suitable covalent bond may be used to attach the first and second capture primers 22, 24 or 22, 24' to the polymer hydrogel 42. Examples of terminal primers that may be used include alkyne-terminated primers, which may be attached to the azide moiety of the polymer hydrogel 42. As noted above, specific examples of suitable capture primers 22, 24 include P5 and P7 primers, and a specific example of a suitable capture primer 24' is P7 that has been modified to include a second restriction endonuclease site.

[0099] In one example, grafting may involve flow-through deposition (e.g., using a temporarily or permanently attached lid or additional substrate), dunk coating, spray coating, paddle dispensing, or another suitable method of attaching the capture primer(s) 22, 24, or 22, 24′ to the polymer hydrogel 42. Each of these exemplary techniques may utilize a primer solution or mixture, which may include the capture primer(s) 22, 24, or 22, 24′, water, a buffer, and a catalyst. Using any of the grafting methods, the capture primer(s) 22, 24, or 22, 24′ react with reactive groups on the polymer hydrogel 42 within the recesses 38 and have no affinity for the surrounding interstitial regions 40. In this manner, the capture primer(s) 22, 24, or 22, 24′ selectively graft to the polymer hydrogel 42 within the recesses 38.

[0100] Methods Involving Genotyping Oligonucleotides

[0101] An example of a method disclosed herein generally includes introducing a genotyping probe fluid into a flow cell 20 containing individual wells 38 and first and second capture primers 22, 24 or 22, 24' in each of the individual wells 38, the genotyping probe fluid including a plurality of genotyping oligonucleotides 10 or 10', whereby each genotyping oligonucleotide 10 or 10' reacts in at least some of the individual wells 38 to produce a respective clonal population of amplification products from each genotyping oligonucleotide 10 or 10'; linearizing the amplification products to produce probe templates; sequencing at least one probe identification section of the probe templates to identify each of the probe sequences; removing at least each nascent strand from the probe templates, thereby exposing a 3' OH group at the end of the probe template; hybridizing each sample to the probe templates; and performing a genotyping reaction on each of the samples with the exposed 3' OH group.

[0102] In an example method, the flow cell 20 may be incorporated into a system (not shown) that is in fluid communication with a fluid control system (e.g., pumps, valves, etc.) and in optical communication with an illumination system and a detection system.

[0103] 3A-3H together show an example of a method involving genotyping oligonucleotide 10.

[0104] 3A shows one well 38 of flow cell 20 containing a polymeric hydrogel 42 having first and second capture primers 22, 24 attached thereto. As described herein, second capture primer 24 includes a cleavage site 46.

[0105] In FIG. 3B , a genotyping probe fluid (not shown) is introduced into the flow cell 20 (e.g., into each flow channel 32). In this example, the genotyping probe fluid includes a liquid carrier and genotyping oligonucleotides 10 in the liquid carrier. The liquid carrier of the genotyping probe fluid may be any suitable hybridization buffer, such as Tris-HCl buffer or 0.5× saline sodium citrate (SSC) buffer. In some examples, the genotyping probe fluid includes multiple genotyping oligonucleotides 10, each of which includes a different probe sequence 14 for each genotyping oligonucleotide 10. In this fluid, different genotyping oligonucleotides 10 (each with a unique probe sequence 14) can be delivered to different wells 38.

[0106] As shown in Figure 3B, one genotyping oligonucleotide 10 is seeded into a recess 38. More specifically, the second primer sequence 18 of one genotyping oligonucleotide 10 hybridizes to one of the second capture primers 24 in the recess 38.

[0107] If one genotyping oligonucleotide 10 is seeded, cluster generation may begin immediately. In other examples, separate hybridization (seeding) and cluster generation may occur. The processes involved in cluster generation are shown in Figures 3B, 3C, 3D, and 3E.

[0108] As represented by the arrow in Figure 3B, the genotyping oligonucleotide 10 is copied from the hybridized primer by 3' extension using DNA polymerase. This generates an amplification product 44A that is attached to the flow cell surface via the second capture primer 24. C of the amplification product 44A 16 , C 14 , C 12 The labeled sections are complementary copies of the restriction endonuclease site 16, the probe sequence 14, and the first primer sequence 12, respectively.

[0109] The original genotyping oligonucleotide 10 is denatured, leaving an amplification product 44A immobilized in the well 38 via the second capture primer 24. The single-stranded amplification product 44A may be, for example, a first primer sequence copy C to the adjacent complementary first capture primer 22. 12 The hybridization of the primers reverses and forms a bridge. This is shown in Figure 3C. As represented by the arrow in Figure 3C, the hybridized primer (first capture primer 22) is then extended by polymerase(s) to form another amplification product 44B. Section CC of amplification product 44B 16 , C.C. 14 Section C 16 , C 14 and therefore have the same sequences as the original restriction endonuclease site 16 and probe sequence 14, respectively. 24 is a complementary copy of second capture primer 24 and therefore has the same sequence as second primer sequence 18. As shown in Figure 3C, the formation of amplification product 44B generates a double-stranded bridge comprising amplification products 44A and 44B.

[0110] The double-stranded bridge is then denatured, as shown in Figure 3D. This results in two copies (amplification products 44A and 44B) that are covalently attached to the flow cell 20. Isothermal bridge amplification or some other form of amplification amplifies the immobilized copy. For example, the copied template loops over and hybridizes to adjacent complementary capture primers 22, 24, and a polymerase copies the copied template to form a double-stranded bridge, which denatures to form two single strands. These two strands loop over and hybridize to adjacent complementary capture primers 22, 24 and are extended again to form two new double-stranded loops. This process is repeated for each template copy through cycles of isothermal denaturation and amplification, creating a dense clonal cluster of double-stranded bridges. A simplified cluster containing two double-stranded bridges is shown in Figure 3E.

[0111] It should be understood that the seeding of each genotyping oligonucleotide 10 in each well 38, and the amplification of such genotyping oligonucleotide 10 in each well 38, can be performed under conditions in which the amplification rate exceeds the seeding rate. In this manner, the relatively rapid rate at which one genotyping oligonucleotide 10 makes copies (amplification products 44A, 44B) in a seeded well 38 effectively excludes a second genotyping oligonucleotide 10 from seeding in that well 38 for amplification. In this manner, different genotyping oligonucleotides 10 (having unique probe sequences 14) can be captured and amplified in each of the wells 38, allowing multiple different target genotyping loci to be analyzed simultaneously on the flow cell 20.

[0112] Linearization of the crosslinked amplification products 44A, 44B may be achieved by cleaving the amplification product attached to the second capture primer (e.g., amplification product 44A) at the respective cleavage sites 46 of the second capture primer 24 and denaturing the cleaved portion of the amplification product attached to the second capture primer 24 (e.g., amplification product 44A) to produce a probe template 48 (Figure 3F).

[0113] To initiate cleavage, a cleavage agent may be introduced into the flow cell 20, for example, via an input port (not shown). The cleavage agent selected will depend on the cleavage site 46 of the second capture primer 24. The cleavage agent may be a chemical cleavage agent or an enzymatic cleavage agent, depending on the cleavage site 46. Cleavage at the cleavage site 46 separates the second capture primer 24 from the remainder of the amplified product sequence (see Section C). 16 , C 14 , and C 12 , or Section C 16 , C 14 , and C 22 The amplification product 44A is cleaved between the primers 44A and 44B (which contain a complementary copy of the capture primer 22).

[0114] As a result of the disconnection, Section C 16 , C 14 , and C 12 , and Section C 16 , C 14 , and C 22 is no longer attached to the flow cell surface via primer 24 and can therefore be removed via denaturation. Denaturation may be performed using any suitable conditions. Section C 16 , C 14 , and C 12 , and Section C 16 , C 14 , and C 22 The removal of the ions is achieved by attaching them to the flow cell surface through the first capture primer 22 and then to the second capture primer 24 (see Section C). 24 ) hybridized to the exposed single-stranded portion of amplification product 44B, specifically section CC 16 and CC 14 constitutes the probe template 48. Section CC 14 Section C 14 and therefore has the same sequence as probe sequence 14. Sequencing of this Section CC 14can identify / decode the original probe sequence 14. In some cases, section CC 14 A portion of may be sequenced to identify or decode the original probe sequence. Section CC 16 Section C 16 is a complementary copy of the restriction enzyme site 16 and therefore has the same sequence as the restriction enzyme site 16. When sequenced, CC 16 and N 16 The double-stranded section containing (Figure 3G) provides a substrate for restriction enzyme cleavage.

[0115] After cleavage and denaturation, each second capture primer 24 may have a 3' phosphate at its end that needs to be removed before further processing. The 3' phosphate is removed by introducing a kinase, which deprotects the second capture primer 24, making it suitable for use as a sequencing primer (as described with reference to Figure 3G).

[0116] Figure 3G shows Section CC 16 and CC 14 1 shows the sequencing of a probe template 48 comprising at least one probe identification section.

[0117] In the example shown, sequencing the probe template 48 involves using the second capture primer 24 as a sequencing primer and performing a base extension reaction (one base at a time) along the probe template 48.

[0118] In another example, Section C 24 The second capture primer 24 may be denatured and a separate sequencing primer (in solution) may be added. The separate sequencing primer is described in Section C. 24 and a base extension reaction (one base at a time) is carried out along the probe template 48.

[0119] The chemical process underlying sequencing can be polymerization (e.g., catalyzed by a polymerase enzyme). In certain polymerase-based processes, fluorescently labeled nucleotides are added to the second capture primer 24 in a template-dependent manner, allowing detection of the order and type of nucleotides added to the second capture primer 24. This allows for the sequence of the probe identification section, e.g., section CC 14 can be determined, which can be used to decode the original probe sequence 14.

[0120] To initiate the first sequencing cycle, one or more labeled nucleotides, a DNA polymerase, or the like may be delivered into / through flow cell 20, or the like, and by extension of the sequencing primer, the labeled nucleotides are incorporated into probe template 48. This incorporation can be detected by an imaging event. During the imaging event, an illumination system may provide excitation light to flow cell 20.

[0121] In some examples, the fluorescently labeled nucleotide can further include a reversible termination property that stops further primer extension once the nucleotide is added to template 48. For example, a nucleotide analog having a reversible terminator moiety can be added to template 48 such that no further extension can occur until a deblocking agent is delivered to remove the moiety. Thus, in examples using reversible termination, a deblocking reagent can be delivered to flow cell 20, etc. (after detection has occurred).

[0122] Wash(es) may be performed between the various fluid delivery steps. The sequencing cycle is then repeated n times to extend template 48 by n nucleotides, resulting in nascent section N 16 (Section CC 16 (Complementary to) and emerging section N 14 (Section CC 14 A nascent strand can be generated that contains a nucleotide sequence complementary to the nucleotide sequence of the target gene.

[0123] Section CC 14 Sequencing of nascent chain section N 14 , which can be used to decode the original probe sequence 14 of the genotyping oligonucleotide 10. This information allows the user to identify the target genotyping locus to be analyzed in a particular well 38 (all of the templates 48 of a well 38 have the same probe identification section, e.g., CC 14 (Because it has).

[0124] Section CC 16 Sequencing of the nascent strand section N 16 In this way, this sequencing example also provides CC 16 and N 16 This produces a double-stranded section containing both the nucleotides, which provides a substrate for restriction enzyme cleavage.

[0125] After sequencing the probe identification section(s), the method comprises sequencing at least each nascent strand (section N 14 and N 16 (including ) from the probe template 48, thereby exposing the 3' OH group at the end of the probe template 48. In this example, the removal is 14 and N 16 In this example, the removal involves more than the removal of a restriction endonuclease site, e.g., section CC 16 and N 16 and Section N 14 and denaturing the remaining nascent strands, including the

[0126] Probe template 48 is in section CC 16 (having the same sequence as restriction endonuclease site 16), and the nascent strand is 16 (complementary to restriction endonuclease site 16). This double-stranded portion (see section CC 16 and N 16) creates a substrate for an appropriate restriction endonuclease (restriction enzyme). Thus, the introduction of the restriction endonuclease creates a restriction endonuclease site, in this example section CC 16 and Section N 16 As described herein above, the restriction enzyme may be a 4-base cutter restriction endonuclease, a 5-base cutter restriction endonuclease, or a 6-base cutter restriction endonuclease, etc. Restriction enzymes may be capable of digesting the section CC at specific nucleotides. 16 , N 16 , which is identified schematically by an asterisk in Figure 3G. In this example, the restriction endonuclease site digestion cuts the second capture primer 24 and the section CC attached thereto. 14 leaving the first capture primer 22 with 14 Section CC 14 The nascent chain N hybridizes to 14 Then, Section CC 14 After digestion and denaturation, Section CC 16 , and nascent chain N 14 , N 16 can be removed from the well 38 and the flow cell 20, for example, via a washing step.

[0127] Digestion and denaturation exposes a 3'OH at the remaining end of probe template 48. The remaining probe template is shown in Figure 3H at reference numeral 52. The remaining probe template 52 is a first capture primer 22 and a section CC 14 which is the same as the original probe sequence 14 and is therefore complementary to the DNA sample having the target genotyping locus 54 in this example.

[0128] A sample of denatured DNA fragments containing target genotyping loci 54 is introduced into the flow cell 20. The target genotyping loci 54 may be contained in a library fluid containing a plurality of target genotyping loci, at least some of which have different loci to be genotyped. The target genotyping loci may be prepared from a larger DNA sample using any genotyping library preparation technique. Some genotyping library preparation techniques involve amplification and fragmentation. Others involve amplification without fragmentation (examples of which are described herein below). In this manner, several copies of any one type of target genotyping locus 54 may be present in the library fluid.

[0129] When introduced into the flow cell 20, the target genotyping loci 54 are aligned with the complementary sections CC of each of the remaining probe templates 52 within the wells 38. 14 hybridize to

[0130] A genotyping reaction may then be performed, in which the remaining probe template 52 is used as a sequencing primer to perform one cycle of sequencing as described herein. As shown in Figure 3H, one labeled nucleotide 57, complementary to the nucleic acid base of interest on the target genotyping locus 54, is incorporated into the remaining probe template 52.

[0131] Although the description herein is directed to one well 38 and therefore to genotyping one target genotyping locus 54, each well 38 may be located in a different section CC 14 It should be understood that the flow cell 20 includes different probe templates 52 having different sequences. In this manner, hundreds to thousands to millions (depending on the number of wells in the flow cell 20) of different loci can be simultaneously genotyped using this method.

[0132] 4A-4H together show another example of a method involving a genotyping oligonucleotide 10'.

[0133] 4A shows one well 38 of flow cell 20 containing a polymeric hydrogel 42 having first and second capture primers 22, 24' attached thereto. As described herein, second capture primer 24' contains a second restriction endonuclease site 46'.

[0134] In FIG. 4B , a genotyping probe fluid (not shown) is introduced into the flow cell 20 (e.g., into each flow channel 32). In this example, the genotyping probe fluid includes a liquid carrier and genotyping oligonucleotides 10′ in the liquid carrier. The liquid carrier may be any of the embodiments disclosed herein. In some examples, the genotyping probe fluid includes multiple genotyping oligonucleotides 10′, each genotyping oligonucleotide 10′ including a different probe sequence 14 for each genotyping oligonucleotide 10′. In this fluid, different genotyping oligonucleotides 10′ (each with a unique probe sequence 14) may be delivered to different recesses 38.

[0135] As shown in Figure 4B, one genotyping oligonucleotide 10' is seeded into recess 38. More specifically, the second primer sequence 18' and the restriction endonuclease site 16' of one genotyping oligonucleotide 10' hybridize to one of the second capture primer 24' and its restriction endonuclease site 46' of recess 38, respectively.

[0136] If one genotyping oligonucleotide 10' is seeded, cluster generation may begin immediately. In other examples, separate hybridization (seeding) and cluster generation may occur. The processes involved in cluster generation are shown in Figures 4B, 4C, 4D, and 4E.

[0137] As represented by the arrow in Figure 4B, the genotyping oligonucleotide 10' is copied from the hybridized primer by 3' extension using a high-fidelity DNA polymerase. This generates an amplification product 44C that is attached to the flow cell surface via the second capture primer 24'. The C of the amplification product 44C 14 , C 28 , C 26 , and C 12 are complementary copies of the probe sequence 14, the priming site portion 28, the index sequence portion 26, and the first primer sequence 12, respectively.

[0138] The original genotyping oligonucleotide 10' is denatured, leaving the amplification product 44C immobilized in the recess 38 via the second capture primer 24' and the second restriction endonuclease site 46'. The single-stranded amplification product 44C may, for example, be a first primer sequence copy C to the adjacent complementary first capture primer 22. 12 Hybridization of the nucleotides reverses the process, forming a bridge, as shown in Figure 4C.

[0139] As represented by the arrow in Figure 4C, the hybridized primers are then extended by polymerase(s) to form another amplification product 44D. Section CC of amplification product 44D 14 , C.C. 26 , C.C. 28 Section C 14 , C 26 , C 28 and therefore have the same sequences as the original probe sequence 14, index sequence portion 26, and priming site portion 28, respectively. 46’ is a complementary copy of the second restriction endonuclease site 46' and therefore has the same sequence as the restriction endonuclease site 16' of the genotyping oligonucleotide 10'. Section C of amplification product 44D 24is a complementary copy of second capture primer 24' and therefore has the same sequence as second primer sequence 18'. As shown in Figure 4C, the formation of amplification product 44D produces a double-stranded bridge comprising amplification products 44C and 44D covalently attached to flow cell 20.

[0140] The double-stranded bridge is then denatured, as shown in Figure 4D. This results in two copies (amplification products 44C and 44D) that are covalently attached to the flow cell 20. Isothermal bridge amplification or some other form of amplification amplifies the immobilized copy. For example, the copied template loops over and hybridizes to adjacent complementary capture primers 22, 24', and a polymerase copies the copied template to form a double-stranded bridge, which denatures to form two single strands. These two strands loop over and hybridize to adjacent complementary capture primers 22, 24' and are extended again to form two new double-stranded loops. This process is repeated for each template copy through cycles of isothermal denaturation and amplification, creating a dense clonal cluster of double-stranded bridges. A simplified cluster containing two double-stranded bridges is shown in Figure 4E.

[0141] It should be understood that the seeding of each genotyping oligonucleotide 10' in each well 38, and the amplification of such genotyping oligonucleotide 10' in each well 38, can be performed under conditions in which the amplification rate exceeds the seeding rate. In this manner, the relatively rapid rate at which one genotyping oligonucleotide 10' makes copies (amplification products 44C, 44D) in a seeded well 38 effectively excludes a second genotyping oligonucleotide 10' from seeding in that well 38 for amplification. In this manner, a different genotyping oligonucleotide 10' (having a unique probe sequence 14) can be captured and amplified in each of the wells 38, allowing multiple different target genotyping loci to be analyzed simultaneously on the flow cell 20.

[0142] In this example, amplification is performed to generate a complementary copy of restriction endonuclease site 16' and a second restriction endonuclease site 46'. 46’ To protect the nucleotide sequence, methylated dCTP (deoxycytidine triphosphate) may be used. This modification leaves the amplification products 44C, 44D fully methylated and the capture primers 22, 24' (containing the second restriction endonuclease site 46') hemimethylated.

[0143] The double-stranded bridge is then linearized. Linearization is described with reference to Figures 4E and 4F. Linearization of bridged amplification products 44C, 44D in this exemplary method may be performed by digesting restriction endonuclease portions 56 of amplification products 44C, 44D to leave second capture primer 24' in recess 38 and denaturing the remaining portions of amplification products 44C, 44D to produce single-stranded probe template 49 comprising first capture primer 22 and at least one probe identifier section in recess 38. The result of the linearization process is shown in Figure 4F.

[0144] In this example, each of the second capture primers 24' further comprises a second restriction endonuclease site 46' that is complementary to the restriction endonuclease site 16' of the genotyping oligonucleotide 10', and thus also comprises a second capture primer 24' that is complementary to the restriction endonuclease site 16' of the genotyping oligonucleotide 10'. 46’ As shown in Figure 4E, the double-stranded bridge is complementary to the hybridized section 46', C 46’ , which provide respective substrates for restriction enzyme cleavage. More specifically, the hybridized sections C of the crosslinked amplification products 44C and 44D 46’ and 46' constitute a restriction endonuclease portion 56, which is recognizable by a type IIS restriction enzyme. In this example, digestion of the restriction endonuclease portion 56 is achieved by the introduction of a type IIS restriction enzyme. The type IIS restriction enzyme may or may not be methyl-sensitive. The methylation protocol involves the addition of a probe sequence copy C 14 , C.C. 14The type IIS restriction enzyme may recognize an asymmetric DNA sequence in portion 56 and cleave at a defined distance (e.g., 1 nucleotide to about 20 nucleotides) outside portion 56. The digestion leaves second capture primer 24' attached to flow cell 20 and also cleaves amplification product 44C at the desired location for genotyping.

[0145] The remaining portions of amplification products 44C, 44D may then be denatured, leaving single-stranded probe template 49 attached to flow cell 20. As shown in FIG. 4F, single-stranded probe template 49 includes first capture primer 22 and at least one probe identification section, in this example, section CC 14 , and Section CC 28 and CC 26 Includes part or all of the above.

[0146] The method may further include blocking the second capture primers 24′ prior to sequencing along at least one probe identification section of each of the first single-stranded probe templates 49. A blocking group (e.g., a 3′ phosphate) may be added attached to the exposed 3′ end of the second capture primers 24′ to prevent undesired extension of these primers 24′.

[0147] Referring now to Figure 4F, there is shown the sequencing of at least one probe identification section of a single-stranded probe template 49. In this example, the at least one probe identification section is section CC 26 which is identical to the index sequencing portion 26.

[0148] Sequencing of at least one probe identification section is performed in section CC 28 This involves introducing a sequencing primer 50 that hybridizes to at least one probe identification section of the single-stranded probe template 49, e.g., CC26 The base extension reaction is then carried out in section CC 26 Follow the instructions.

[0149] The chemical process underlying sequencing can be polymerization (eg, catalyzed by a polymerase enzyme), as described herein with reference to Figure 3G.

[0150] To initiate a first sequencing cycle, one or more labeled nucleotides, a DNA polymerase, etc. may be delivered into / through flow cell 20, etc., and extension of the sequencing primers causes the labeled nucleotides to be transferred to section CC of single-stranded probe template 49. 26 Nascent chain N formed along 26 This incorporation can be detected by an imaging event.

[0151] In some instances, the fluorescently labeled nucleotide is used to identify the nascent strand N 26 The primer may further include a reversible termination feature that, when added to the primer, terminates further primer extension. Thus, in examples using reversible termination, an unblocking reagent may be delivered to the flow cell 20 or the like (after detection has occurred).

[0152] Wash(es) may be performed between the various fluid delivery steps. The sequencing cycle is then repeated n times to extend the single-stranded probe template 49 by n nucleotides to produce a nascent section N. 26 (Section CC 26 , which has the same sequence as the index sequencing portion 26).

[0153] New chain N 26 Section CC using sequencing 26 and thus identifies probe sequence 14 (and its complementary copy C 14) to identify the original index sequencing portion 26 that is unique to that particular well 38. This information allows the user to identify the target genotyping locus to be analyzed within a particular well 38 (assuming all of the templates 49 within a well 38 share the same probe identification section, e.g., CC 26 , and a probe sequence section, e.g., CC 14 (Because it has).

[0154] After sequencing the probe identification section(s), the method comprises sequencing at least each nascent strand (section N 26 ) from the single-stranded probe template 49. In this example, the removal includes removing the sequencing primer 50 and the nascent strand N 26 This involves denaturing the

[0155] A sample of single-stranded DNA fragments containing target genotyping loci 54 is introduced into flow cell 20, as shown in FIG. 4H. The target genotyping loci 54 may be contained in a library fluid containing multiple target genotyping loci, at least some of which have different loci to be genotyped. The target genotyping loci may be prepared from a larger DNA sample using any genotyping library preparation technique. Some genotyping library preparation techniques involve amplification and fragmentation. Others involve amplification without fragmentation, as described herein below. In this manner, several copies of any one type of target genotyping locus 54 may be present in the library fluid.

[0156] When introduced into the flow cell 20, the target genotyping loci 54 are aligned with the respective complementary sections CC of the single-stranded probe templates 49 within the wells 38. 14 hybridize to

[0157] A genotyping reaction may then be performed, in which the single-stranded probe template 49 is used as a sequencing primer to perform one cycle of sequencing as described herein. As shown in Figure 4H, one labeled nucleotide 57, complementary to the nucleic acid base of interest on the target genotyping locus 54, is incorporated into the single-stranded probe template 49.

[0158] Although the description herein is directed to one well 38 and therefore to genotyping one target genotyping locus 54, each well 38 may be located in a different section CC. 14 It should be understood that the flow cell 20 includes different single-stranded probe templates 49 having the following structure: 1) a single-stranded probe template 49 having a sequence of 1 to 2; 2) a single-stranded probe template 49 having a sequence of 1 to 2; 3) a single-stranded probe template 49 having a sequence of 1 to 2; 4) a single-stranded probe template 49 having a sequence of 1 to 2; 5) a single-stranded probe template 49 having a sequence of 1 to 2; 6) a single-stranded probe template 49 having a sequence of 1 to 2; 7) a single-stranded probe template 49 having a sequence of 1 to 2; 8) a single-stranded probe template 49 having a sequence of 1 to 2; 9) a single-stranded probe template 49 having a sequence of 1 to 2; 10) a single-stranded probe

[0159] In the examples disclosed herein, instead of blocking the second capture primers 24 or 24' during sequencing and / or genotyping, these primers 24 or 24' could be cleaved following the decoding reaction using a cleavage process that does not adversely affect the template 48 or 49 being genotyped.

[0160] Genotyping library preparation techniques

[0161] Any suitable genotyping library preparation technique may be used to prepare the target genotyping loci 54.

[0162] The target genotyping loci 54 may be prepared from genomic DNA. Genomic DNA may be isolated from one or more cells, bodily fluids, or tissues. Any suitable method may be used to obtain bodily fluids (e.g., blood, sweat, tears, lymph, urine, saliva, semen, cerebrospinal fluid, feces, or amniotic fluid). Some specific examples include buccal swabs, mouthwash, surgical resections, or aspiration biopsies. Genomic DNA may also be obtained from one or more cells or tissues in primary cultures, expanded cell lines, fixed archival samples, forensic samples, or archaeological samples.

[0163] gDNA can be prepared by lysing cells containing DNA. Cells may be lysed under conditions that substantially preserve the integrity of the cellular gDNA. In one specific example, heat lysis may be used to lyse cells. In another specific example, exposure of cells to an alkaline pH can be used to lyse cells while causing relatively little damage to the gDNA. Any of a variety of basic compounds, including potassium hydroxide and sodium hydroxide, can be used for lysis. Additionally, relatively undamaged gDNA can be obtained from cells lysed with enzymes that degrade the cell wall. Cells lacking a cell wall, either naturally or due to enzymatic removal, can also be lysed by exposure to osmotic stress. Other conditions that can be used to lyse cells include exposure to detergents, mechanical disruption, sonication, heat, pressure differentials such as a French press apparatus, or Dounce homogenization. Agents that stabilize gDNA can be included in the cell lysate or isolated gDNA sample, including, for example, nuclease inhibitors, chelating agents, salts, and buffers.

[0164] In some instances, crude cell lysates containing gDNA can be directly amplified without further isolation of the gDNA. For example, a blood sample can be subjected to heat lysis, and the crude cell lysate can then be amplified using any suitable method, including those described herein. Alternatively, gDNA can be further isolated from other cellular components prior to amplification. Thus, amplification can be performed on purified or partially purified gDNA. Genomic DNA can be isolated using known methods, including, for example, liquid-phase extraction, precipitation, solid-phase extraction, and chromatography.

[0165] A population of amplified representative genomic fragments (target genotyping loci 54) can be obtained by amplifying the intact genome under conditions that replicate the genomic DNA (gDNA) template to produce one or more copies in which the relative proportion of each copied sequence is substantially the same as its proportion in the original gDNA. Any of a variety of methods that replicate genomic DNA in a sequence-independent manner can be used to prepare the target genotyping loci 54. In examples disclosed herein, double-stranded genomic DNA may be denatured to generate single-stranded genomic DNA template that can be used in the amplification process.

[0166] In one particular example, the amplification method involves contacting a single-stranded genomic DNA template with a low-processivity polymerase, a plurality of primers, and free nucleotides, thereby generating complementary fragments of the single-stranded genomic DNA template, and displacing the complementary fragments from the single-stranded genomic DNA template, thereby generating at least some of the respective samples.

[0167] Low-processivity polymerases can synthesize short strands because they spontaneously shed from single-stranded genomic DNA templates before the entire strand is replicated. Some examples of low-processivity polymerases can synthesize fewer than 100 bases per polymerization event. Shorter fragments can be obtained by using polymerases that synthesize fewer than 50, 40, 30, 20, 10, or 5 bases per polymerization event under amplification conditions. Low-processivity polymerases are selected from the group consisting of T4 DNA polymerase, T7 DNA polymerase, Taq polymerase, Stoffel fragment (a fragment of Taq DNA polymerase), Klenow fragment (a large fragment of Escherichia coli DNA polymerase I), Bsu DNA polymerase, Bst DNA polymerase, and engineered polymerases. In this exemplary method, the term "engineered polymerase" refers to any synthetic polymerase designed to synthesize fewer than 100 bases per polymerization event. Other suitable low processivity polymerases include monomeric E. coli Pol III (lacking the β subunit) or E. coli Pol I.

[0168] The processivity of some polymerases can vary depending on the processing conditions used. For example, processivity can vary depending on the temperature of the reaction, the amount of salt in the reaction (e.g., Mg 2+The processivity can be varied by the pH level (e.g., ionic strength), pH, buffer composition (e.g., creatine kinase or cAMP (cyclic adenosine monophosphate)), or a combination thereof. As one example, T7 DNA polymerase has low processivity at temperatures below 37°C and also low processivity at high ionic strength, e.g., above about 100 mM NaCl, but is otherwise highly processive. As another example, Taq polymerase has high processivity at temperatures of about 70°C when reacted with a 10-fold molar excess of DNA sample and random primers. In another example, Escherichia coli DNA polymerase polymerization of the Klenow fragment can be slowed by lowering the pH to below pH 6.2. In yet another example, the efficiency of BST DNA polymerase (BST polymerase), an A-family DNA polymerase, can be manipulated several-fold through the substitution of metal cofactors such as Mg++ and Cd++.

[0169] The primers may be random primers. A population of random primers can be synthesized to contain a higher content of guanine (G) and / or cytosine (C) nucleotides compared to adenine (A) and thymidine (T) nucleotides. The resulting random primer population is GC-rich and therefore has a higher probability of hybridizing to GC-rich regions of the genome, such as gene-coding regions of the human genome, which typically have a higher GC content than non-coding gDNA regions. Primers in the population of random primers can also have regions of identical sequence, such as universal tails. The universal tail can include a universal priming site for amplification.

[0170] In this exemplary method, the free nucleotides may include any naturally occurring nucleotide, such as dedeoxyadenine triphosphate, deoxythymine triphosphate, deoxyguanine triphosphate, and deoxycytosine triphosphate.

[0171] Contacting a single-stranded genomic DNA template with a low-processivity polymerase, multiple primers, and free nucleotides may involve mixing the various components together and exposing them to amplification conditions suitable for the low-processivity polymerase used. During amplification, the primers attach to different portions of the single-stranded genomic DNA template, and the low-processivity polymerase introduces complementary free nucleotides into the template strand according to the sequence of the template strand. The low-processivity polymerase typically spontaneously drops off from the template strand after 100 bases or less have been replicated. The replicated complementary fragments can be replaced, for example, using denaturation. The method may include repeating both the contact and the replacement for a predetermined number of cycles to generate additional complementary fragments in each of the predetermined number of cycles.

[0172] Below are some examples of this method:

[0173] T4 DNA polymerase can be used, for example, to amplify single-stranded or denatured gDNA in about 50 mM N-(2-hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) (HEPES) (pH 7.5), about 50 mM Tris-HCl (pH 8.6), or about 50 mM glycinate (pH 9.7). An exemplary reaction mixture can also include about 50 mM KCl, about 5 mM MgCl, about 5 mM dithiothreitol (DTT), about 40 μg / mL gDNA, about 0.2 mM of each dNTP, about 50 μg / mL bovine serum albumin (BSA), about 100 μM random primers (n=6), and about 10 units of T4 DNA polymerase incubated at 37° C. for at least 1 hour. Temperature cycling may be used to displace replicate strands for multiple rounds of amplification.

[0174] Taq polymerase has low processivity at temperatures below 70°C. Therefore, small fragments of gDNA can be obtained by using Taq polymerase at low temperatures or other conditions where Taq has low processivity. In another example, the Stoffel fragment, which lacks the N-terminal 289 amino acid residues of Taq polymerase and has low processivity at 70°C, can be used to generate relatively small gDNA fragments. Taq or the Stoffel fragment can be used to amplify single-stranded or denatured DNA templates, and temperature cycling can be used to displace replicated strands for multiple rounds of amplification.

[0175] Klenow fragment can be used for isothermal amplification of genomes to produce small genomic DNA fragments, for example, in a low-salt (I = 0.085) reaction incubated at temperatures between about 5°C and 37°C. Exemplary buffer and pH conditions that can be used to amplify gDNA with Klenow fragment include, for example, about 50 mM Tris-HCl (pH 7.5), about 5 mM MgCl, about 50 mM NaCl, about 50 μg / mL bovine serum albumin (BSA), about 0.2 mM of each dNTP, about 2 μg of random primers (n = 6), about 10 ng of gDNA template, and about 5 units of Klenow fragment incubated at 37°C for about 16 hours. Similar reactions can be performed if one or more reaction components are omitted or substituted. For example, the buffer may be replaced with about 50 mM phosphate (pH 7.4), or other pH values ​​may be used in the range of about 7.0 to 7.8. In another example, conditions for amplification using Klenow fragment may include, for example, about 10 ng of gDNA template, about 2 mM dNTPs, about 10 mM MgCl, about 0.5 U / μL (microliter) polymerase, about 50 uM (micromolar) random primers (n=6), and isothermal incubation at 37°C for 16 hours.

[0176] Another example of an amplification method disclosed herein involves contacting a single-stranded genomic DNA template with a polymerase, a plurality of primers, and a mixture of free nucleotides including natural nucleotides and dideoxythymidine triphosphate (ddTTP), thereby generating a truncated complementary fragment of the single-stranded genomic DNA template, and displacing the truncated complementary fragment from the single-stranded genomic DNA template, thereby generating at least some of the respective samples.

[0177] Any suitable polymerase may be used in this example. ddTTP acts as a truncating agent, and therefore, a highly processive polymerase may be used. Any of the polymerases described herein may be used in this example method, as long as the polymerase can be modified to exhibit higher processivity (e.g., capable of synthesizing more than 100 bases per polymerization event). In one example, the highly processive polymerase is selected from the group consisting of T4 DNA polymerase, T7 DNA polymerase, Taq polymerase, Stoffel fragment, Klenow fragment, Bsu DNA polymerase, Bst DNA polymerase, and engineered polymerases. In this exemplary method, the term "engineered polymerase" refers to any synthetic polymerase designed to synthesize more than 100 bases per polymerization event. Highly processive polymerases can produce fragments that are 10 kb (kilobases) to 20 kb in length. Other suitable highly processive polymerases include Φ29 polymerase.

[0178] In this example, any of the random primers described herein may be used.

[0179] In this exemplary method, the free nucleotides in the mixture include natural nucleotides and dideoxythymidine triphosphate (ddTTP). Dideoxythymidine triphosphate functions as a synthesis-terminating nucleotide or truncating agent. In one example, the natural nucleotides include deoxyadenine triphosphate, deoxythymine triphosphate, deoxyguanine triphosphate, and deoxycytosine triphosphate. In one example, the mixture of free nucleotides includes a ratio of deoxythymine triphosphate (dTTP) to dideoxythymidine triphosphate (ddTTP) ranging from about 10:5 to about 10:0.01. A ratio within this range helps ensure that the desired number of deoxythymidine triphosphates are incorporated into generated fragments before dideoxythymidine triphosphate truncates the amplification. In one specific example, the ratio of dTTP to ddTTP is about 10:1.

[0180] Contacting a single-stranded genomic DNA template with a polymerase, multiple primers, and a free nucleotide mixture can involve mixing the various components together and exposing them to amplification conditions suitable for the polymerase being used. During amplification, primers attach to different portions of the single-stranded genomic DNA template, and the polymerase introduces complementary natural nucleotides into the template strand according to the sequence of the template strand. Incorporation of dideoxythymidine triphosphate (ddTTP) instead of deoxythymidine triphosphate (dTTP) halts amplification of a particular strand. In this way, ddTTP truncates the replicated DNA fragment. The ratio of dTTP to ddTTP in the mixture helps ensure that the generated fragments are long enough for subsequent analysis.

[0181] The replicated truncated complementary fragments can be displaced, for example, using denaturation. The method may include repeating both the contacting and the displacing for a predetermined number of cycles to generate additional truncated complementary fragments at each of the predetermined number of cycles.

[0182] Any of buffers (e.g., HEPES, Tris-HCl, glycinate, etc.), salts (e.g., KCl, MgCl, etc.), redox reagents (e.g., dithiothreitol), and / or stabilizers (e.g., bovine serum albumin (BSA)) may be used in this exemplary method in amounts suitable for high throughput.

[0183] In one particular example, T7 DNA polymerase has high processivity in the following reaction conditions: about 40 mM Tris-HCl (pH 7.5), about 15 mM MgCl, about 25 mM NaCl, about 5 mM DTT, about 0.25 mM of each dNTP, about 0.00025 mM to about 0.125 mM ddTTP, 50 μg / mL single-stranded gDNA, about 100 μM random primers (n=6), about 0.5 to about 1 unit of T7 DNA polymerase, and a reaction temperature above 37°C.

[0184] In another specific example, Taq polymerase has high processivity at a temperature of about 70°C when reacted with a 10-fold molar excess of DNA sample and random primers (n=6). Amplification reactions performed under these conditions may further comprise a buffer such as about 20 mM Tris-HCl (pH of about 7), about 1 mM to 2 mM MgCl, about 0.2 mM of each dNTP, and about 0.0002 mM to about 0.1 mM ddTTP. Additionally, stabilizers such as glycerol, gelatin, BSA, or non-ionic detergents may be added.

[0185] In yet another particular example, the Klenow fragment has high processivity in the following reaction conditions: about 10 mM Tris-HCl (pH 7.9), about 10 mM MgCl 2 , about 50 mM NaCl, about 1 mM DTT, and about 100 g / mol BSA.

[0186] In yet another specific example, Bst DNA polymerase has high processivity in the following reaction conditions: about 20 mM Tris-HCl (pH 8.8), about 10 mM (NH4)2SO4, about 10 mM KCl, about 2 mM MgSO4, and about 0.1% non-ionic surfactant (e.g., TRITON™ X-100 from The Dow Chemical Co.).

[0187] Both amplification processes disclosed herein generate multiple gDNA fragments without the need for a fragmentation process. Single-stranded gDNA serves as a template for several target genotyping loci 54, and several amplification products are generated for each target genotyping locus 54. When the template 48 or 49 to be genotyped is introduced onto the flow cell 20, the amplified gDNA fragments (target genotyping loci 54) hybridize to their respective complementary sections of the template 48 or 49 to be genotyped.

[0188] kit

[0189] The genotyping nucleotides 10 or 10' and the flow cell 20 may be part of a genotyping kit.

[0190] In one example, the kit includes a flow cell 20 and a genotyping probe fluid, wherein the flow cell 20 includes a substrate 30, 30' having recesses 38 separated by a gap region 40 and first and second capture primers 22, 24 or 22, 24' attached within each of the recesses 38, and the genotyping probe fluid includes a liquid carrier and a genotyping oligonucleotide 10 or 10' in the liquid carrier, and the genotyping oligonucleotide 10 or 10' includes a first primer sequence 12, a probe sequence 14 representing a target genotyping locus 54, a restriction endonuclease site 16, 16', and a second primer sequence 18, 18' that is at least partially complementary to the second capture primer 24, 24'.

[0191] The kit may also include genotyping library preparation components, such as a whole genome sample, a polymerase (which may be a low processivity polymerase as defined herein), a plurality of primers, and free nucleotides (which in some instances include natural nucleotides, and in other instances include a mixture of natural nucleotides and dideoxythymidine triphosphate (ddTTP)).

[0192] Any example of genotyping oligonucleotide 10 or 10' may be used in the kit, and any example of flow cell 20 may be used in the kit.

[0193] Alternatively, the kit may include a non-patterned flow cell having primers over the entire surface of the flow channel.

[0194] Additional Notes

[0195] It should be understood that all combinations of the foregoing concepts and additional concepts discussed in more detail below (unless such concepts are mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. Specifically, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be understood that terms used expressly herein, and which may also appear in any disclosures incorporated by reference, should be given the meaning most consistent with the particular concepts disclosed herein.

[0196] Although several embodiments have been described in detail, it should be understood that the disclosed examples may be modified, and therefore the foregoing description should be considered non-limiting.

Claims

1. 1. A kit comprising a flow cell and genotyping probe fluidics, The flow cell Substrate, and a first capture primer and a second capture primer attached to the substrate, the second capture primer comprising a restriction endonuclease site; the genotyping probe fluid a liquid carrier, and a genotyping oligonucleotide in the liquid carrier, the genotyping oligonucleotide comprising: a first primer sequence, an index sequence portion directly linked to the first primer sequence; a priming site portion directly linked to the index sequence portion; a probe sequence directly attached to said priming site portion and representative of a target genotyping locus having a nucleobase of interest, wherein the last base of the probe sequence represents a nucleobase of the target genotyping locus located immediately adjacent to said nucleobase of interest; a second restriction endonuclease site that is complementary to the restriction endonuclease site of the second capture primer; and a second primer sequence that is at least partially complementary to the second capture primer; the second restriction endonuclease site is located between the probe sequence and the second primer sequence; or the probe sequence is directly linked to a second primer sequence, and the second restriction endonuclease site is incorporated into the second primer sequence at a cleavage distance from the last base of the probe sequence; Genotyping kit.

2. 10. The genotyping kit of claim 1, wherein the genotyping probe fluid comprises a plurality of genotyping oligonucleotides, each genotyping oligonucleotide comprising a different probe sequence for each genotyping oligonucleotide.

3. A kit as described in claim 1 or 2, further comprising a type IIS methyl-sensitive restriction endonuclease, wherein the restriction endonuclease site and the second restriction endonuclease site are sensitive to the type IIS methyl-sensitive restriction endonuclease.

4. the substrate having depressions separated by gap regions; The genotyping kit of any one of claims 1 to 3, wherein the first and second capture primers are attached within each of the recesses.

5. A labeled nucleotide, and DNA polymerase The genotyping kit according to any one of claims 1 to 4, further comprising:

6. A polymerase, a plurality of random primers, and Free nucleotides 6. The genotyping kit of any one of claims 1 to 5, further comprising genotyping library preparation components comprising:

7. The polymerase is selected from a high processivity polymerase selected from the group consisting of T4 DNA polymerase, T7 DNA polymerase, Taq polymerase, Stoffel fragment, Klenow fragment, Bsu DNA polymerase, Bst DNA polymerase, and engineered polymerases; or the polymerase is selected from a low processivity polymerase selected from the group consisting of T4 DNA polymerase, T7 DNA polymerase, Taq polymerase, Stoffel fragment, Klenow fragment, Bsu DNA polymerase, Bst DNA polymerase, monomeric E. coli Pol III or E. coli Pol I, and engineered polymerases; and the free nucleotides include dedeoxyadenine triphosphate, deoxythymine triphosphate, deoxyguanine triphosphate, and deoxycytosine triphosphate; The genotyping kit of claim 6.

8. A genotyping kit as described in claim 6 or 7, wherein the plurality of random primers is a population of random primers synthesized to contain a higher content of guanine and / or cytosine nucleotides compared to adenine and thymidine nucleotides.

9. A method for using the genotyping kit of claim 1, comprising: introducing the genotyping probe fluid into the flow cell; whereby each genotyping oligonucleotide hybridizes and reacts with a second capture primer at the restriction endonuclease site to produce a respective clonal population of amplification products from each genotyping oligonucleotide by 3' extension and high fidelity DNA polymerase; digesting the restriction endonuclease portion of the amplification product to leave a second capture primer; denaturing the remaining portion of the amplification product to produce a single-stranded probe template comprising the first capture primer and the at least one probe identifier section; linearizing the amplification product to produce a probe template; sequencing at least one probe identification section of said single-stranded probe template to identify each of said probe sequences using a sequencing primer, a labeled nucleotide, and a first polymerase; removing at least each nascent strand from the single-stranded probe template, thereby exposing a 3' OH group at the end of the single-stranded probe template; hybridizing each sample to said single-stranded probe template; performing a genotyping reaction on each of said samples on said exposed 3' OH groups using labeled nucleotides and a second polymerase.

10. sequencing the at least one probe identifier section portion of the single-stranded probe template; introducing a sequencing primer; 10. The method of claim 9, further comprising: performing a base extension reaction along the at least one probe identification section of each of the single-stranded probe templates.

11. removing at least each nascent strand from the single-stranded probe template; 11. The method of claim 10, which involves denaturing the nascent strand from the at least one probe identification section.

12. 12. The method of claim 10 or 11, further comprising blocking the second capture primer prior to sequencing along the at least one probe identification section of each of the single-stranded probe templates.

13. The method of any one of claims 9 to 11, further comprising correlating each identified probe sequence with a respective clonal population of amplification products.

14. Prior to hybridizing each of the samples to the probe templates, the method further comprises: contacting a single-stranded genomic DNA template with a low processivity polymerase, a plurality of primers, and free nucleotides, thereby generating complementary fragments of the single-stranded genomic DNA template; displacing the complementary fragment from the single-stranded genomic DNA template, thereby generating at least some of the respective samples; The method of any one of claims 9 to 13, further comprising preparing each of the samples by:

15. 15. The method of claim 14, further comprising denaturing double-stranded genomic deoxyribonucleic acid (DNA), thereby generating the single-stranded genomic DNA template.

16. 15. The method of claim 14, further comprising repeating both said contacting and said displacing for a predetermined number of cycles to generate additional complementary fragments in each of said predetermined number of cycles.

17. 15. The method of claim 14, wherein the low processivity polymerase is selected from the group consisting of T4 DNA polymerase, T7 DNA polymerase, Taq polymerase, Stoffel fragment, Klenow fragment, Bsu DNA polymerase, Bst DNA polymerase, and engineered polymerases.

18. Prior to hybridizing each of the samples to the probe templates, the method further comprises: contacting a single-stranded genomic DNA template with a polymerase, a plurality of primers, and a mixture of free nucleotides including natural nucleotides and dideoxythymidine triphosphate, thereby generating a truncated complementary fragment of said single-stranded genomic DNA template; 14. The method of any one of claims 9 to 13, further comprising preparing the respective samples by: displacing the truncated complementary fragment from the single-stranded genomic DNA template, thereby generating at least some of the respective samples.

19. 19. The method of claim 18, wherein the naturally occurring nucleotides comprise deoxyadenine triphosphate, deoxythymine triphosphate, deoxyguanine triphosphate, and deoxycytosine triphosphate, and the mixture of free nucleotides comprises a ratio of deoxythymine triphosphate to dideoxythymidine triphosphate in the range of about 10:5 to about 10:0.

01.

20. 20. The method of claim 18, further comprising denaturing double-stranded genomic deoxyribonucleic acid (DNA), thereby generating the single-stranded genomic DNA template.

21. 20. The method of claim 18, further comprising repeating both said contacting and said displacing for a predetermined number of cycles to generate additional truncated complementary fragments at each of said predetermined number of cycles.

22. 19. The method of claim 18, wherein the polymerase is selected from the group consisting of T4 DNA polymerase, T7 DNA polymerase, Taq polymerase, Stoffel fragment, Klenow fragment, Bsu DNA polymerase, Bst DNA polymerase, and engineered polymerases.

Images