Use of Janus Kinase Inhibitors and Telomerase Inhibitors for the Treatment of Myeloproliferative Neoplasms - Patent application

Co-administration of JAK and telomerase inhibitors in tailored cycles and dosages addresses the limitations of current myeloproliferative neoplasm treatments, achieving sustained clinical remission and reducing malignant hematopoietic stem cells in conditions like myelofibrosis.

JP7767279B2Active Publication Date: 2025-11-11GERON CORP +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2022525704
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-11-04
Filing Date
2020-11-03
Publication Date
2025-11-11
Estimated Expiration
2040-11-03

AI Technical Summary

Technical Problem

Current treatments for myeloproliferative neoplasms, such as myelofibrosis, are inadequate in achieving complete clinical remission and often lead to complications like thrombosis and bleeding, with existing therapies failing to effectively target the underlying cellular proliferation.

Method used

The co-administration of a Janus kinase (JAK) inhibitor, such as ruxolitinib, and a telomerase inhibitor, like imetelstat, in specific cycles and dosages, either simultaneously or sequentially, to induce apoptosis in myeloproliferative neoplasm cells, with varying administration schedules and dosages tailored to individual patient platelet counts.

Benefits of technology

This approach achieves significant clinical remission and morphological improvement in myeloproliferative neoplasms, including myelofibrosis, by effectively reducing malignant hematopoietic stem cells and minimizing side effects, with potential long-term treatment durations up to 10 years.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007767279000005
    Figure 0007767279000005
  • Figure 0007767279000006
    Figure 0007767279000006
  • Figure 0007767279000007
    Figure 0007767279000007
Patent Text Reader

Abstract

Aspects of the present disclosure include methods for treating myeloproliferative neoplasms. In certain embodiments, the method comprises co-administering to a subject a Janus kinase (JAK) inhibitor and a telomerase inhibitor comprising an oligonucleotide and a lipid moiety attached to the 5' and / or 3' end of the oligonucleotide. Also described is a method for inducing apoptosis in myeloproliferative neoplasm cells by contacting the cells with a JAK inhibitor and a telomerase inhibitor in amounts sufficient to induce apoptosis. Compositions containing a JAK inhibitor and a telomerase inhibitor for carrying out the method are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 62 / 930,251, filed November 4, 2019, the disclosure of which is incorporated herein by reference in its entirety.

[0002] Introduction Myeloproliferative neoplasms (MPNs) are a group of blood disorders that occur when the body produces too many white or red blood cells or platelets. This overproduction of blood cells in the bone marrow can cause problems with blood flow and lead to a variety of symptoms. MPNs can arise from myeloid lineage precursors in the bone marrow. MPNs are characterized by myeloproliferation without dysplasia, myeloid hyperplasia, and a predisposition to thrombosis, bleeding, and myelofibrosis.

[0003] Imetelstat or imetelstat sodium is a telomerase inhibitor that binds with high affinity to the template region of the RNA component of telomerase. Studies have shown that imetelstat or imetelstat sodium inhibits telomerase activity and is effective against cell proliferation in many different cancer cell lines and human tumors. Imetelstat or imetelstat sodium has been used in clinical trials for patients with hematological malignancies. Clinical trials for patients with myelofibrosis have shown that imetelstat or imetelstat sodium can achieve complete clinical remission in certain patients. In these patients, imetelstat reversed myelofibrosis, resulting in morphological and molecular remission. Summary of the Invention [Means for solving the problem]

[0004] Aspects of the present disclosure include methods for treating myeloproliferative neoplasms. In certain embodiments, the method comprises co-administering to a subject a Janus kinase (JAK) inhibitor and a telomerase inhibitor comprising an oligonucleotide and a lipid moiety attached to the 5' and / or 3' end of the oligonucleotide. Also described is a method for inducing apoptosis in myeloproliferative neoplasm cells by contacting the cells with a JAK inhibitor and a telomerase inhibitor in amounts sufficient to induce apoptosis. Compositions containing a JAK inhibitor and a telomerase inhibitor for carrying out the method are also provided.

[0005] In some embodiments, the JAK inhibitor and the telomerase inhibitor are administered simultaneously. In other embodiments, the JAK inhibitor and the telomerase inhibitor are administered sequentially. In some cases, the telomerase inhibitor is administered to the subject after the JAK inhibitor is administered to the subject. In some cases, the JAK inhibitor is administered to the subject after the telomerase inhibitor is administered to the subject. In one example, the telomerase inhibitor is administered to the subject on the same day that the JAK inhibitor is administered to the subject. In another example, the telomerase inhibitor is administered to the subject within 13 days after the JAK inhibitor is administered to the subject, for example, within 3 days after the JAK inhibitor is administered to the subject. For example, the telomerase inhibitor is administered within 3 days after the last dose of the JAK inhibitor is administered to the subject. In some cases, the JAK inhibitor is administered to the subject within 13 days after the telomerase inhibitor is administered to the subject. For example, the JAK inhibitor is administered within 3 days after the last dose of the telomerase inhibitor is administered to the subject, and is administered twice daily thereafter.

[0006] The dosage is administered in cycles of administration of the JAK inhibitor and the telomerase inhibitor.In some embodiments, the cycle is 21 days, and in some cases, the cycle is 28 days or more.The drug administration cycle can be repeated 1, 2, 3, 4, 5, 6, 7, 8 or more than 8 times, for a total period of 6 months, 1 year, 2 years, 3 years, 4 years or more.

[0007] In certain embodiments, the JAK inhibitor is administered to a subject at a dosage of about 10 mg / day to about 40 mg / day. The JAK inhibitor can be administered to a subject once or twice a day. In some cases, the JAK inhibitor is administered to a subject once or twice a day in a cycle that lasts for 30 days, 29 days, 28 days, 27 days, 26 days, 25 days, 24 days, 23 days, 22 days, 21 days, 20 days, 19 days, 18 days, 17 days, 16 days, 15 days, 14 days, 13 days, 12 days, 11 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, or 2 days, or 1 day. In some cases, the JAK inhibitor is administered to the subject once per day for a period of about 1 day to about 30 days, e.g., once per day for a period of about 1 day to about 28 days, 1 day to 21 days, or 7 days to 14 days. In other cases, the JAK inhibitor is administered to the subject twice per day for a period of about 1 day to about 30 days, e.g., twice per day for a period of about 1 day to about 28 days, 1 day to 21 days, or 7 days to 14 days.

[0008] In certain embodiments, the JAK inhibitor is selected from the group consisting of ruxolitinib, fedratinib, momelotinib, and pacritinib, or pharmaceutically acceptable salts thereof, and combinations thereof.In certain embodiments, the JAK inhibitor is ruxolitinib or a pharmaceutically acceptable salt thereof.In certain embodiments, the JAK inhibitor is fedratinib or a pharmaceutically acceptable salt thereof.In certain embodiments, the JAK inhibitor is momelotinib or a pharmaceutically acceptable salt thereof.In certain embodiments, the JAK inhibitor is pacritinib or a pharmaceutically acceptable salt thereof.

[0009] In some embodiments, the dosage of the JAK inhibitor administered to a subject by the methods of the present disclosure can range from about 5 mg / day to about 500 mg / day, etc. In certain embodiments, the JAK inhibitor is ruxolitinib or a pharmaceutically acceptable salt thereof, and the subject is administered about 100×10 9 5 mg twice daily if the subject has a baseline platelet count less than 100 x 10 / L platelets 9 / L platelets ~ approx. 200×109 15 mg twice daily if the subject has a baseline platelet count of approximately 200 x 10 9 If the patient has a baseline platelet count greater than 1 / L platelets, the patient will be given a dose of 20 mg twice daily.

[0010] In certain embodiments, the JAK inhibitor is fedratinib or a pharmaceutically acceptable salt thereof, and the subject is 9 If the subject has a baseline platelet count of 1 / L or greater, the subject is administered a dose of 400 mg once per day. In certain cases, fedratinib or a pharmaceutically acceptable salt thereof is administered to the subject at a dose of 300 mg once per day. In other cases, fedratinib or a pharmaceutically acceptable salt thereof is administered to the subject at a dose of 200 mg once per day. In still other cases, fedratinib or a pharmaceutically acceptable salt thereof is administered to the subject at a dose of 100 mg once per day. In still other cases, fedratinib or a pharmaceutically acceptable salt thereof is administered to the subject at a dose of less than 100 mg once per day.

[0011] In other embodiments, the JAK inhibitor is momelotinib or a pharmaceutically acceptable salt thereof, and is administered to the subject at a dose of 400 mg once per day. In certain cases, momelotinib or a pharmaceutically acceptable salt thereof is administered to the subject at a dose of 300 mg once per day. In other cases, momelotinib or a pharmaceutically acceptable salt thereof is administered to the subject at a dose of 200 mg once per day. In some cases, momelotinib or a pharmaceutically acceptable salt thereof is administered at a dose of 150 mg twice per day. In some cases, momelotinib or a pharmaceutically acceptable salt thereof is administered at a dose of 100 mg twice per day.

[0012] In other embodiments, the JAK inhibitor is pacritinib or a pharmaceutically acceptable salt thereof, and is administered to the subject at a dosage of about 50 mg to about 600 mg once per day, including about 100 mg to about 500 mg once per day, such as about 150 mg to about 400 mg once per day, and about 200 mg to about 350 mg once per day. In certain instances, pacritinib or a pharmaceutically acceptable salt thereof is administered to the subject at a dosage of about 50 mg to about 600 mg twice per day, including about 100 mg to about 500 mg twice per day, such as about 150 mg to about 400 mg twice per day, and about 200 mg to about 350 mg twice per day. In other cases, pacritinib or a pharmaceutically acceptable salt is administered to the subject at a dosage of 100 mg once per day, or about 100 mg twice per day, or 200 mg twice per day.

[0013] Methods according to certain embodiments also include determining a baseline platelet count for the subject prior to administering the JAK inhibitor to the subject. In these embodiments, the methods may include determining the subject's baseline platelet count and determining an amount of the JAK inhibitor to administer to the subject based on the subject's baseline platelet count.

[0014] The dosage of the telomerase inhibitor administered to a subject can range from about 4.0 mg / kg to about 10 mg / kg, about 7.5 mg / kg to 9.4 mg / kg, and the like. In certain embodiments, the telomerase inhibitor is 4.0 mg / kg, 4.1 mg / kg, 4.2 mg / kg, 4.3 mg / kg, 4.4 mg / kg, 4.5 mg / kg, 4.6 mg / kg, 4.7 mg / kg, 4.8 mg / kg, 4.9 mg / kg, 5.0 mg / kg, 5.1 mg / kg, 5.2 mg / kg, 5.3 mg / kg, 5.4 mg / kg, 5.5 mg / kg, 5.6 mg / kg, 5.7 mg / kg, 5.8 mg / kg, 5.9 mg / kg, 6.0 mg / kg, 6.1 mg / kg, 6.2 mg / kg, 6.3 mg / kg, 6.4 mg / kg, 6.5 mg / kg, 6.6 mg / kg, 6.7 mg / kg, 6.8 mg / kg, 6.9 mg / kg, 7.0 mg / kg, 7.1 mg / kg, 7.2 mg / kg, 7.3 mg / kg, 7.4 mg / kg, 7.5 mg / kg, 7.6 mg / kg, 7.7 mg / kg, 7.8 mg / kg, 7.9 mg / kg, 8.0 mg / kg, 8.1 mg / kg, 8.2 mg / kg, 8.3 mg / kg, 8.4 mg / kg, 8.5 mg / kg, 8.6 mg / kg, 8.7 mg / kg, 8.8 mg / kg, 8.9 mg / kg, 8.9 mg / kg, 9.0 mg / kg, 9.1 mg / kg, 9.2 mg / kg, 9.3 mg / kg, 9.4 mg / kg, 9.5 mg / kg, 9.6 mg / kg, 9.7 mg / kg, 9.8 mg / kg, 9.9 mg / kg, 9.0 mg / kg, 9.1 The subject is administered a dose of 0.0mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8.0mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9.0mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / kg, 9.8mg / kg, 9.9mg / kg, or 10.0mg / kg.

[0015] The dosage of the telomerase inhibitor may be administered to a subject in cycles in which the telomerase inhibitor is administered once per week, once per 2 weeks (14 days), once per 3 weeks (21 days), once per 4 weeks (28 days), once per 6 weeks, once per 8 weeks, once per 10 weeks, or once per 12 weeks. In certain embodiments, imetelstat or a pharmaceutically acceptable salt thereof may be administered for 1, 2, 3, 4, 5, 6, 7, 8, or more than 8 administration cycles. In certain embodiments, each cycle comprises intravenous administration of about 4-10 mg / kg of imetelstat or a pharmaceutically acceptable salt thereof once every three weeks, about 4-10 mg / kg of imetelstat or imetelstat sodium once every four weeks, about 4-10 mg / kg of imetelstat or imetelstat sodium once every two weeks, or about 7.5-9.4 mg / kg of imetelstat or imetelstat sodium once every three weeks. In certain instances, each dosage cycle comprises intravenous administration of about 7.5-9.4 mg / kg of imetelstat or imetelstat sodium once every four weeks. In some instances, each dosage cycle comprises intravenous administration of about 9.4 mg / kg of imetelstat or imetelstat sodium once every three weeks.

[0016] In some cases, the telomerase inhibitor oligonucleotide contains at least one N3'→P5' thiophosphoramidate internucleoside linkage. In some cases, the lipid moiety of the telomerase inhibitor is attached to the 5' and / or 3' end of the oligonucleotide via a linker, such as a glycerol or aminoglycerol linker. In some cases, the lipid moiety of the telomerase inhibitor is a palmitoyl (C16) moiety. In certain embodiments, the telomerase inhibitor is imetelstat or a pharmaceutically acceptable salt thereof, such as imetelstat sodium.

[0017] In certain embodiments, treating a myeloproliferative neoplasm comprises treating a subject with a 21-day administration cycle of ruxolitinib, or a pharmaceutically acceptable salt thereof, and imetelstat, or a pharmaceutically acceptable salt thereof, wherein the method comprises administering ruxolitinib, or a pharmaceutically acceptable salt thereof, once or twice per day for 21 days, and administering imetelstat, or a pharmaceutically acceptable salt thereof, to the subject on day 1 of the 21-day administration cycle (i.e., both ruxolitinib, or a pharmaceutically acceptable salt thereof, and imetelstat, or a pharmaceutically acceptable salt thereof, are administered to the subject on day 1 of the 21-day cycle). In certain instances, the method comprises a 21-day administration cycle of ruxolitinib or a pharmaceutically acceptable salt thereof and imetelstat or a pharmaceutically acceptable salt thereof, wherein ruxolitinib or a pharmaceutically acceptable salt thereof is administered once per day for 21 days and imetelstat or a pharmaceutically acceptable salt thereof is administered on day 1 of the 21-day cycle. In other instances, the method comprises a 21-day administration cycle of ruxolitinib or a pharmaceutically acceptable salt thereof and imetelstat or a pharmaceutically acceptable salt thereof, wherein ruxolitinib or a pharmaceutically acceptable salt thereof is administered twice per day for 21 days and imetelstat or a pharmaceutically acceptable salt thereof is administered on day 1 of the 21-day cycle. The 21-day administration cycle of ruxolitinib or a pharmaceutically acceptable salt thereof followed by imetelstat or a pharmaceutically acceptable salt thereof according to these embodiments can be repeated one or more times, including two or more times, such as three or more times, such as four or more times, such as five or more times, such as six or more times, such as seven or more times, such as eight or more times, such as nine or more times, and ten or more times. When the 21-day administration cycle of ruxolitinib and imetelstat is repeated one or more times, the period between each 21-day administration cycle can be zero or more days, including one or more days, such as two or more days, such as three or more days, such as four or more days, such as five or more days, such as six or more days, and seven or more days.Depending on the number of 21-day administration cycles of ruxolitinib and imetelstat used and the duration between each cycle, the duration of treatment for a subject according to these embodiments can be about 1.5 months or longer, including 3 months or longer, such as 6 months or longer, such as 1 year or longer, such as 2 years or longer, such as 3 years or longer, such as 4 years or longer, such as 5 years or longer, such as 6 years or longer, such as 7 years or longer, such as 8 years or longer, such as 9 years or longer, and 10 years or longer.

[0018] In certain embodiments, treating a myeloproliferative neoplasm comprises treating a subject with a 28-day administration cycle of ruxolitinib or a pharmaceutically acceptable salt thereof and imetelstat or a pharmaceutically acceptable salt thereof. In these embodiments, the method comprises administering ruxolitinib or a pharmaceutically acceptable salt thereof once or twice per day for 28 days, and administering imetelstat or a pharmaceutically acceptable salt thereof to the subject on day 1 of the 28-day cycle (i.e., both ruxolitinib or a pharmaceutically acceptable salt thereof and imetelstat or a pharmaceutically acceptable salt thereof are administered to the subject on day 1 of the 28-day cycle). In certain instances, the method comprises a 28-day administration cycle of ruxolitinib or a pharmaceutically acceptable salt thereof and imetelstat or a pharmaceutically acceptable salt thereof, wherein ruxolitinib or a pharmaceutically acceptable salt thereof is administered once per day for 28 days and imetelstat or a pharmaceutically acceptable salt thereof is administered on day 1 of the 28-day cycle. In other instances, the method comprises a 28-day administration cycle of ruxolitinib or a pharmaceutically acceptable salt thereof and imetelstat or a pharmaceutically acceptable salt thereof, wherein ruxolitinib or a pharmaceutically acceptable salt thereof is administered twice per day for 28 days and imetelstat or a pharmaceutically acceptable salt thereof is administered on day 1 of the 28-day cycle.

[0019] The 28-day administration cycle of ruxolitinib or a pharmaceutically acceptable salt thereof followed by imetelstat or a pharmaceutically acceptable salt thereof according to these embodiments can be repeated one or more times, including two or more times, such as three or more times, such as four or more times, such as five or more times, such as six or more times, such as seven or more times, such as eight or more times, such as nine or more times, and ten or more times. When the 28-day administration cycle of ruxolitinib and imetelstat is repeated one or more times, the period between each 28-day administration cycle can be zero or more days, including one or more days, such as two or more days, such as three or more days, such as four or more days, such as five or more days, such as six or more days, and seven or more days. Depending on the number of 28-day administration cycles of ruxolitinib and imetelstat used and the duration between each cycle, the duration of treatment of a subject according to these embodiments can be from about 2 months or more, including 4 months or more, such as 6 months or more, such as 1 year or more, such as 2 years or more, such as 3 years or more, such as 4 years or more, such as 5 years or more, such as 6 years or more, such as 7 years or more, such as 8 years or more, such as 9 years or more, and 10 years or more.

[0020] In certain embodiments, treating a myeloproliferative neoplasm comprises treating a subject with administration cycles of ruxolitinib or a pharmaceutically acceptable salt thereof and imetelstat or a pharmaceutically acceptable salt thereof, wherein ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject once or twice daily for 14 or 21 days, followed by one or more doses of imetelstat or a pharmaceutically acceptable salt thereof administered to the subject 1 to 7 days after the last dose of ruxolitinib or a pharmaceutically acceptable salt thereof administered in that administration cycle. In one example, the method comprises an administration cycle in which ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject once daily for 14 days, followed by one or more doses of imetelstat or a pharmaceutically acceptable salt thereof administered 1 to 7 days after the last dose of ruxolitinib or a pharmaceutically acceptable salt thereof administered. In another example, the method includes a dosing cycle in which ruxolitinib or a pharmaceutically acceptable salt thereof is administered to a subject once daily for 21 days, followed by one or more doses of imetelstat or a pharmaceutically acceptable salt thereof, administered 1 to 7 days after the last administered dose of ruxolitinib or a pharmaceutically acceptable salt thereof. In yet another example, the method includes a dosing cycle in which ruxolitinib or a pharmaceutically acceptable salt thereof is administered to a subject twice daily for 14 days, followed by one or more doses of imetelstat or a pharmaceutically acceptable salt thereof, administered 1 to 7 days after the last administered dose of ruxolitinib or a pharmaceutically acceptable salt thereof. In yet another example, the method includes a dosing cycle in which ruxolitinib, or a pharmaceutically acceptable salt thereof, is administered to the subject twice daily for 21 days, followed by one or more doses of imetelstat, or a pharmaceutically acceptable salt thereof, administered 1 to 7 days after the last administered dose of ruxolitinib, or a pharmaceutically acceptable salt thereof.In these embodiments, one or more doses of imetelstat or a pharmaceutically acceptable salt thereof are administered to the subject 1 to 7 days after the last administered dose of ruxolitinib or a pharmaceutically acceptable salt thereof, including administering one dose of imetelstat or a pharmaceutically acceptable salt thereof 1 day, such as 2 days, such as 3 days, such as 4 days, such as 5 days, such as 6 days, and 7 days thereafter after the last administered dose of ruxolitinib or a pharmaceutically acceptable salt thereof. The administration cycle of ruxolitinib or a pharmaceutically acceptable salt thereof followed by imetelstat or a pharmaceutically acceptable salt thereof according to these embodiments can be repeated one or more times, such as 2 or more times, such as 3 or more times, such as 4 or more times, such as 5 or more times, such as 6 or more times, such as 7 or more times, such as 8 or more times, such as 9 or more times, and including 10 or more times.

[0021] In certain embodiments, treating a myeloproliferative neoplasm comprises treating a subject with a 21-day administration cycle of imetelstat or a pharmaceutically acceptable salt thereof and ruxolitinib or a pharmaceutically acceptable salt thereof, wherein the method comprises administering imetelstat or a pharmaceutically acceptable salt thereof to the subject on day 1 of the 21-day administration cycle, followed by administering ruxolitinib or a pharmaceutically acceptable salt thereof to the subject once or twice per day on each subsequent day of the 21-day cycle (i.e., imetelstat or a pharmaceutically acceptable salt thereof is administered to the subject on day 1 of the 21-day cycle, and ruxolitinib or a pharmaceutically acceptable salt thereof is administered once or twice per day on days 2 through 21 of the 21-day administration cycle). In certain instances, the method comprises administering imetelstat or a pharmaceutically acceptable salt thereof to the subject on day 1 of a 21-day administration cycle, followed by administering ruxolitinib or a pharmaceutically acceptable salt thereof to the subject once per day on each subsequent day of the 21-day cycle. In other instances, the method comprises administering imetelstat or a pharmaceutically acceptable salt thereof to the subject on day 1 of a 21-day administration cycle, followed by administering ruxolitinib or a pharmaceutically acceptable salt thereof to the subject twice per day on each subsequent day of the 21-day cycle. The 21-day administration cycle of administering imetelstat or a pharmaceutically acceptable salt thereof followed by ruxolitinib or a pharmaceutically acceptable salt thereof according to these embodiments can be repeated one or more times, such as two or more times, such as three or more times, such as four or more times, such as five or more times, such as six or more times, such as seven or more times, such as eight or more times, such as nine or more times, and including ten or more times. When 21-day dosing cycles of imetelstat and ruxolitinib are repeated one or more times, the period between each 21-day dosing cycle can be 0 days or more, such as 1 day or more, such as 2 days or more, such as 3 days or more, such as 4 days or more, such as 5 days or more, such as 6 days or more, and including 7 days or more.Depending on the number of 21-day administration cycles of imetelstat and ruxolitinib used and the duration between each cycle, the duration of treatment of a subject according to these embodiments may be about 1.5 months or longer, including 3 months or longer, such as 6 months or longer, such as 1 year or longer, such as 2 years or longer, such as 3 years or longer, such as 4 years or longer, such as 5 years or longer, such as 6 years or longer, such as 7 years or longer, such as 8 years or longer, such as 9 years or longer, and 10 years or longer.

[0022] In other embodiments, treating a myeloproliferative neoplasm comprises treating a subject with a 28-day administration cycle of imetelstat or a pharmaceutically acceptable salt thereof and ruxolitinib or a pharmaceutically acceptable salt thereof, wherein the method comprises administering imetelstat or a pharmaceutically acceptable salt thereof to the subject on day 1 of the 28-day administration cycle, followed by administering ruxolitinib or a pharmaceutically acceptable salt thereof to the subject once or twice per day on each subsequent day of the 28-day cycle (i.e., imetelstat or a pharmaceutically acceptable salt thereof is administered to the subject on day 1 of the 28-day cycle, and ruxolitinib or a pharmaceutically acceptable salt thereof is administered once or twice per day on days 2 through 28 of the 28-day administration cycle). In certain instances, the method comprises administering imetelstat or a pharmaceutically acceptable salt thereof to the subject on day 1 of a 28-day administration cycle, followed by administering ruxolitinib or a pharmaceutically acceptable salt thereof to the subject once per day on each subsequent day of the 28-day cycle. In other instances, the method comprises administering imetelstat or a pharmaceutically acceptable salt thereof to the subject on day 1 of a 28-day administration cycle, followed by administering ruxolitinib or a pharmaceutically acceptable salt thereof to the subject twice per day on each subsequent day of the 28-day cycle. The 28-day administration cycle of administering imetelstat or a pharmaceutically acceptable salt thereof followed by ruxolitinib or a pharmaceutically acceptable salt thereof according to these embodiments can be repeated one or more times, such as two or more times, such as three or more times, such as four or more times, such as five or more times, such as six or more times, such as seven or more times, such as eight or more times, such as nine or more times, and including ten or more times. When 28-day administration cycles of imetelstat and ruxolitinib are repeated one or more times, the period between each 28-day administration cycle can be 0 days or more, such as 1 day or more, such as 2 days or more, such as 3 days or more, such as 4 days or more, such as 5 days or more, such as 6 days or more, and including 7 days or more.Depending on the number of 28-day administration cycles of imetelstat and ruxolitinib used and the duration between each cycle, the duration of treatment of a subject according to these embodiments may be from about 2 months or more, including 4 months or more, such as 6 months or more, such as 1 year or more, such as 2 years or more, such as 3 years or more, such as 4 years or more, such as 5 years or more, such as 6 years or more, such as 7 years or more, such as 8 years or more, such as 9 years or more, and 10 years or more.

[0023] In other embodiments, the method includes administering ruxolitinib or a pharmaceutically acceptable salt thereof for a predetermined period (1 to 21 days), discontinuing administration of ruxolitinib or a pharmaceutically acceptable salt thereof, and administering imetelstat within 7 days (e.g., 2 days, 1 day, or the same day) of the last dose of ruxolitinib or a pharmaceutically acceptable salt thereof administered to the subject. This administration cycle can be repeated two or more times, such as three or more times, such as four or more times, such as five or more times, such as six or more times, such as seven or more times, such as eight or more times, such as nine or more times, and including ten or more times.

[0024] In some embodiments, the myeloproliferative neoplasm is myelofibrosis (MF), e.g., primary myelofibrosis, or myelofibrosis after a previous ET or PV (post-ET MF or post-PV MF). In other embodiments, the myeloproliferative neoplasm includes essential thrombocythemia (ET), polycythemia vera (PV), chronic myelogenous leukemia (CML), chronic neutrophilic leukemia, chronic eosinophilic leukemia, and acute myeloid leukemia (AML). In other embodiments, the myeloproliferative neoplasm is myelodysplastic syndrome (MDS). In yet other embodiments, the myeloproliferative neoplasm is myelodysplastic syndrome (MDS) with isolated del(5q). Myelodysplastic syndrome (MDS) includes diseases such as refractory anemia, refractory anemia with excess blasts, refractory cytopenia with polycythemia gravis, refractory cytopenia with monocytic dysplasia, and chronic myelomonocytic leukemia (CMML). The method according to certain embodiments also includes diagnosing a subject with a myeloproliferative neoplasm. In one example, the method includes diagnosing a subject with myelofibrosis, such as primary myelofibrosis. In some embodiments, the subject has not previously been administered a JAK inhibitor (i.e., is JAK inhibitor naive). In other embodiments, the subject has not previously been administered a telomerase inhibitor (e.g., is telomerase inhibitor naive). In yet other embodiments, the subject has not previously been administered a JAK inhibitor or a telomerase inhibitor (i.e., is both JAK inhibitor naive and telomerase inhibitor naive). [Brief explanation of the drawings]

[0025] [Figure 1] 1 shows an in vivo treatment design for imetelstat treatment in combination with ruxolitinib according to certain embodiments. [Figure 2] 1 shows a hematopoietic progenitor cell (HPC) assay with imetelstat treatment in combination with ruxolitinib in vitro, according to certain embodiments. [Figure 3] 1 shows an in vitro treatment design for imetelstat treatment in combination with ruxolitinib according to certain embodiments. [Figure 4]Figure 4 shows short-term in vitro combination treatment of normal CD34+ cells by administration of imetelstat and ruxolitinib according to certain embodiments. Normal CB CD34+ cells were treated with vehicle alone, ruxolitinib (Rux, 50 nM) alone, mismatched oligonucleotide (MM, 1.8 μM) or imetelstat (Ime, 1.8 μM) alone, Rux and MM or Ime, simultaneously and sequentially as described in the text. Cells were exposed to Rux for 3 days and MM or Ime for 7 days. Cells generated in the cultures were phenotypically characterized and assayed for HPCs. The absolute percentages of Lin-CD34+ cells (Figure 4, panel A), all classes of assayable HPCs (Figure 4, panel B), and CD15+CD34- (Figure 4, panel C) generated in cultures of normal CD34+ cells exposed to various treatments are shown compared to those generated in corresponding cultures exposed to vehicle alone. n=3. All P > 0.05, cultures containing vehicle alone versus cultures containing Rux, cultures containing MM versus corresponding cultures containing Ime. [Figure 5] Figure 5 shows the lack of additive inhibitory effect on normal HSCs / HPCs observed with long-term combined in vitro treatment with imetelstat and ruxolitinib according to certain embodiments. Normal CB CD34+ cells were treated with vehicle alone, ruxolitinib (Rux, 50 nM) alone, mismatched oligonucleotide (MM, 1.8 μM) or imetelstat (Ime, 1.8 μM) alone, Rux and MM or Ime, simultaneously and sequentially as described in the text. Cells were exposed to Rux for 3 days and to MM or Ime for 14 days. The absolute percentages of Lin-CD34+ cells (Figure 5, panel A), all classes of assayable HPCs (Figure 5, panel B), and CD15+CD34- (Figure 5, panel C) generated in cultures of normal CD34+ cells exposed to various treatments are shown compared to those generated in corresponding cultures exposed to vehicle alone. n=3. All P > 0.05, cultures containing vehicle alone versus cultures containing Rux, and cultures containing MM versus corresponding cultures containing Ime unless indicated. [Figure 6]Figure 6 shows the lack of additive inhibitory effect on MF HSCs / HPCs following simultaneous or sequential short-term combination treatment with imetelstat and ruxolitinib in vitro, according to certain embodiments. MF splenic CD34+ cells were treated with the two drugs in the same manner as CB CD34+ cells. Cells were exposed to Rux for 3 days and MM or Ime for 7 days. Cells generated after culture were phenotypically characterized and assayed for HPCs. The absolute percentages of Lin-CD34+ cells (Figure 6, panel A), all classes of assayable HPCs (Figure 6, panel B), and CD15+CD34- (Figure 6, panel C) generated in cultures of MF splenic CD34+ cells exposed to various treatments are shown compared to those generated in corresponding cultures exposed to vehicle alone. JAK2V617F+MF, n=3; JAK2V617F-MF, n=4. All P > 0.05, cultures containing vehicle alone versus cultures containing Rux, and cultures containing MM versus corresponding cultures containing Ime unless indicated. [Figure 7] Figure 7 shows additive inhibitory activity against MF HSCs / HPCs following sequential, long-term combination treatment with imetelstat and ruxolitinib in vitro, according to certain embodiments. MF splenic CD34+ cells were treated with the two drugs alone and in combination in the same manner as CB CD34+ cells. Cells were exposed to Rux for 3 days and MM or Ime for 14 days. Cells generated after culture were phenotypically characterized and assayed for HPCs. The absolute percentages of Lin-CD34+ cells (Figure 7, panel A), all classes of assayable HPCs (Figure 7, panel B), and CD15+CD34- (Figure 7, panel C) generated in cultures of MF splenic CD34+ cells exposed to various treatments are shown, compared to those generated in cultures exposed to the corresponding vehicle alone. JAK2V617F+MF, n=3; JAK2V617F-MF, n=4. P values ​​are as indicated, otherwise P>0.05, Panel A: Vehicle vs. Rux alone, Rux+MM vs. Rux+Ime, Panel C: Rux+MM vs. Rux+Ime. [Figure 8]Figure 8 shows the reduction of JAK2V617F+ hematopoietic progenitor cells upon sequential, long-term combination treatment in vitro with imetelstat and ruxolitinib according to certain embodiments. (Figure 8, Panel A) Individual colonies (CFU-GM) from two JAK2V617F+ MF patients exposed to various treatments were removed and genotyped for JAK2V617F using nested allele-specific polymerase chain reaction (PCR). The percentage of JAK2V617F+ CFU-GM was then determined. (Figure 8, Panels B and C) The absolute number of JAK2V617F+ CFU-GM was calculated by multiplying the total number of CFU-GM generated in each culture by the percentage of JAK2V617F+ CFU-GM shown in Panel A. Sequential, long-term combination treatment of splenic CD34+ cells from both patients with Rux followed by imetelstat has additive inhibitory activity against malignant MF HPCs. [Figure 9-1] Figure 9 shows the lack of effect on normal NSG repopulating cells (SRCs) by simultaneous or sequential combination treatment with imetelstat and ruxolitinib in vivo, according to certain embodiments. (Figure 9, panels A and D) Representative FACS plots showing human (h)CD45+ cell chimerism (Figure 9, panel A) and hCD34+ cells (Figure 9, panel D) generated in the bone marrow of mice. (Figure 9, panels B-C; Figure 9, panels E-F) Absolute numbers of hCD45+ (Figure 9, panels B-C) ​​and hCD34+ cells (Figure 9, panels E-F) generated in the bone marrow (Figure 9, panels B and E) and spleen (Figure 9, panels C and F) of NSG mice 4 months after transplantation. NSG mice were transplanted with normal CB CD34+ cells and treated with various drugs alone or in combination one week after transplantation. These treatments resulted in a minimal reduction in the degree of hCD45+ cell chimerism and hCD34+ cell generation in the bone marrow and spleen of recipient mice (hCD45+ cells in spleen: Rux+Ime, hCD34+ cells in spleen: Ime alone, Rux+Ime). [Figure 9-2] Same as above. [Figure 10-1]

[0049] Figure 10 shows the additive effect of in vivo combination treatment with imetelstat and ruxolitinib, according to certain embodiments, on depleting myelofibrosis NSG repopulating cells (SRCs). (Figure 10, panels A and D) FACS plots showing human (h)CD45+ cell chimerism (Figure 10, panel A) and hCD34+ cells (Figure 10, panel D) generated in the bone marrow of mice. (Figure 10, panels B-C; Figure 10, panel E) Absolute numbers of hCD45+ (Figure 10, panels B-C) ​​and hCD34+ cells (Figure 10, panel E) generated in the bone marrow (Figure 10, panels B and E) and spleen (Figure 10, panel C) of NSG mice 4 months after transplantation. The percentage of absolute numbers of hCD45+ and hCD34+ cells generated in the bone marrow and spleen of mice receiving each drug treatment compared to those generated in mice receiving vehicle alone is shown. NSG mice were transplanted with splenic CD34+ cells from Pt5 and treated with various drugs alone or in combination 1 week after transplantation as described in the text. Sequential treatment with Rux followed by imetelstat had additive activity in depleting Pt5 MF long-term SRCs. [Figure 10-2] Same as above. [Figure 10-3] Same as above. [Figure 11]

[0033] Figure 1 shows the synergistic effect of in vivo combined treatment with imetelstat and ruxolitinib in depleting myelofibrosis NSG repopulating cells (SRCs) according to certain embodiments. NSG mice were transplanted with splenic CD34+ cells from Pt10 and, due to the limited availability of CD34+ cells from this patient, were treated with Rux alone, Ime alone, and Rux followed by imetelstat. The absolute number of hCD45+ cells detected in the bone marrow of mice receiving drug treatment is shown compared to that generated in mice receiving vehicle alone. Sequential treatment with Rux followed by imetelstat had synergistic activity in depleting Pt10's MF long-term SRCs. [Figure 12A][Figures 12A and 12B] Comparison of side effects between in vivo combination treatment of imetelstat and ruxolitinib according to certain embodiments and imetelstat alone. (Figures 12A and 12B) NSG mice were transplanted with normal CB (Figure 12A) or MF (Figure 12B) pancreatic CD34+ cells. One week after transplantation, mice began treatment with vehicle alone, 45 mg / kg Rux alone for 7 days, 10 mg / kg MM or imetelstat alone for 4 weeks, or simultaneous or sequential combinations of Rux and MM or imetelstat. Mice were sacrificed 4 months after transplantation (W17). Sequential combination therapy of mice receiving either normal CB (Figure 12A) or MF (Figure 12B) splenic CD34+ cells did not result in additional weight loss in the mice compared to treatment with an equivalent 10 mg / kg dose of imetelstat alone. Furthermore, at the time mice transplanted with MF splenic CD34+ cells (Pt5) were sacrificed, the extent of weight loss in mice receiving 45 mg / kg Rux sequentially and a 10 mg / kg dose of imetelstat (6.5%) was less than that of the equivalent dose of imetelstat alone (9.6%) or the 30 mg / kg dose of imetelstat alone (13.1%). The x-axis indicates the number of weeks after transplantation. [Figure 12B] Same as above. DETAILED DESCRIPTION OF THE INVENTION

[0026] Select a definition The term "nucleoside" refers to a nucleotide with the general structure: [ka] where B represents a nucleobase, and the 2' carbon can be substituted as described below. When incorporated into an oligomer or polymer, the 3' carbon is further linked to an oxygen or nitrogen atom. Nucleosides can include 2'-deoxy and 2'-hydroxyl (i.e., deoxyribose and ribose) forms, as well as analogs thereof. In certain cases, the 5'-NH group can be substituted for the 5'-oxygen. "Analog," with respect to nucleosides, includes synthetic nucleosides with modified nucleobase moieties (see the definition of "nucleobase" below) and / or modified sugar moieties, such as 2'-fluorosugars, among other analogs. Such analogs are typically designed to affect binding properties, such as stability, specificity, etc. The term "nucleoside" includes natural nucleosides, including 2'-deoxy and 2'-hydroxy forms, as well as analogs, for example, as described in Komberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992). "Analog" includes, with respect to nucleosides, synthetic nucleosides with modified nucleobase moieties (see the definition of "nucleobase" below) and / or modified sugar moieties, generally as described by Scheit, Nucleotide Analogs (John Wiley, New York, 1980). Such analogs include synthetic nucleosides designed to enhance binding properties, such as stability, specificity, etc., as disclosed, for example, by Uhlmann and Peyman, Chemical Reviews 90:543-584, 1990). Oligonucleotides containing such nucleosides, typically containing synthetic nuclease-resistant internucleoside linkages, can themselves be referred to as "analogs."

[0027] "Polynucleotide" or "oligonucleotide" refers to a ribose and / or deoxyribose nucleoside subunit polymer or oligomer having from about 2 to about 200 consecutive subunits. The nucleoside subunits can be linked by various intersubunit linkages, including, but not limited to, phosphodiester, phosphotriester, methylphosphonate, P3'→N5' phosphoramidate, N3'→P5' phosphoramidate, N3'→P5' thiophosphoramidate, and phosphorothioate linkages. The term also includes such polymers or oligomers with modifications to the sugar (e.g., 2' substitutions), base, and 3' and 5' termini. In embodiments where an oligonucleotide moiety contains multiple intersubunit linkages, each linkage may be formed using the same chemical, or a mixture of linkage chemistries may be used. When an oligonucleotide is represented by a series of letters, such as "ATGUCCTG," it will be understood that the nucleotides are in 5'→3' order from left to right. Representing the base sequence of an oligonucleotide in this manner does not imply the use of any particular type of internucleoside subunit in the oligonucleotide.

[0028] "Nucleobase" includes (i) natural DNA and RNA nucleobases (uracil, thymine, adenine, guanine, and cytosine), (ii) modified nucleobases or nucleobase analogs (e.g., 5-methylcytosine, 5-bromouracil, or inosine), and (iii) nucleobase analogs. Nucleobase analogs are compounds whose molecular structure mimics that of a typical DNA or RNA base.

[0029] The term "lipid" is used broadly herein to encompass substances that are soluble in organic solvents but poorly soluble in water. The term lipid includes, but is not limited to, hydrocarbons, oils, fats (such as fatty acids and glycerides), sterols, steroids, and derivative forms of these compounds. In some embodiments, lipids are fatty acids and their derivatives, hydrocarbons and their derivatives, and sterols such as cholesterol. Fatty acids typically contain an even number of carbon atoms in a straight chain (generally 12-24 carbons), may be saturated or unsaturated, and can contain or be modified to contain various substituents. For simplicity, the term "fatty acid" also encompasses fatty acid derivatives, such as fats or esters. In some embodiments, the term "lipid" also includes amphiphilic compounds containing both a lipid portion and a hydrophilic portion.

[0030] An "individual" or "patient" or "subject" may be a mammal, such as any common laboratory model organism. Mammals include, but are not limited to, human and non-human primates, farm animals, sport animals, pets, mice, rats, and other rodents. In some embodiments, the individual or patient or subject is human. In certain embodiments, the subject or patient has not previously received JAK inhibitor therapy and / or telomerase inhibitor therapy prior to the particular embodiment; such patients are "JAK inhibitor naive" or "telomerase inhibitor naive," respectively.

[0031] An "effective amount" or "therapeutically effective amount" or "clinically effective amount" refers to an amount of a therapeutic compound, such as a JAK inhibitor or a telomerase inhibitor, administered to a mammalian subject, either as a single dose or as part of a series of doses, that is effective to produce a desired therapeutic effect. One advantage of the present invention is that when a telomerase inhibitor is administered in combination with a JAK inhibitor, it can be administered at a lower dose than the single-dose dose, thereby achieving comparable or superior therapeutic effects while reducing the side effects and overall toxicity of the compound. In certain embodiments, when a telomerase inhibitor is co-administered with a JAK inhibitor according to embodiments described herein, the amount of the JAK inhibitor required to achieve a therapeutically effective response can be reduced by 1% by weight or more, for example, 2% by weight or more, for example, 3% by weight or more, for example, 5% by weight or more, for example, 10% by weight or more, for example, 15% by weight or more, for example, 25% by weight or more, including a reduction of 50% by weight or more of the amount of the JAK inhibitor required to achieve a therapeutically effective response. In other words, the amount of the JAK inhibitor required to achieve a therapeutically effective response is reduced by 1% or more by weight compared to the amount of the JAK inhibitor alone required to achieve a therapeutically effective response. In other embodiments, when a JAK inhibitor is co-administered with a telomerase inhibitor according to embodiments described herein, the amount of the telomerase inhibitor required to achieve a therapeutically effective response can be reduced by 1% or more by weight, for example, 2% or more by weight, for example, 3% or more by weight, for example, 5% or more by weight, for example, 10% or more by weight, for example, 15% or more by weight, for example, 25% or more by weight, including reducing the amount of the telomerase inhibitor required to achieve a therapeutically effective response by 50% or more by weight. In other words, the amount of the telomerase inhibitor required to achieve a therapeutically effective response is reduced by 1% or more by weight compared to the amount of the telomerase inhibitor alone required to achieve a therapeutically effective response, for example, by 2% or more by weight, for example, by 3% or more by weight, for example, by 5% or more by weight, for example, by 10% or more by weight, for example, by 15% or more by weight, for example, by 25% or more by weight, and including 50% or more by weight.

[0032] As used herein, "tumor cells" refers to cells that exhibit relatively autonomous growth, exhibiting an abnormal growth phenotype characterized by a significant loss of cell proliferation control. Tumor cells include cells that can actively replicate or be in a temporary non-replicative quiescent state (G1 or G0); similarly, tumor cells can include cells with a well-differentiated phenotype, a poorly differentiated phenotype, or a mixture of both types of cells. Thus, not all tumor cells are replicating cells at a given time. "Tumor cells" encompass such cells in benign tumors and cells in malignant tumors.

[0033] As used herein, "neoplastic progenitor cell" refers to a cell of a cellular composition that has the potential to become neoplastic.

[0034] As used herein, the term "tumor" or "tumor formation" or "neoplastic" refers to abnormal new cell growth. Unlike hyperplasia, neoplastic growth continues in the absence of the original stimulus.

[0035] As used herein, the singular forms "a," "an," and "the" include plural references unless otherwise indicated.

[0036] Every maximum numerical limitation given throughout this specification is intended to include every lower numerical limitation, as if such lower numerical limitation were expressly written herein. Every minimum numerical limitation given throughout this specification will include every upper numerical limitation, as if such upper numerical limitations were expressly written herein. Every numerical range given throughout this specification will include every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein.

[0037] Before further describing the present invention, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0038] Where a range of values ​​is provided, unless the context clearly dictates otherwise, it is understood that each intervening value between the upper and lower limits, and to one-tenth of the unit of any other value or lower limit of that intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded limits in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also encompassed in the invention.

[0039] For clarity, it is understood that certain features of the invention described in the context of separate embodiments can also be provided in combination in a single embodiment. Conversely, for brevity, various features of the invention described in the context of a single embodiment can also be provided separately or in any suitable subcombination. All combinations of the embodiments related to the invention are specifically embraced by the present invention and are disclosed herein as if each and every combination were individually and explicitly disclosed, to the extent that such combinations include subject matter that is, for example, a stable compound (i.e., a compound that can be made, isolated, characterized, and tested for biological activity). In addition, all subcombinations of the various embodiments and their elements (e.g., elements of chemical groups listed in the embodiments describing such variables) are also specifically embraced by the present invention and are disclosed herein as if each and every such subcombination were individually and explicitly disclosed herein.

[0040] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs.Any methods and materials similar or equivalent to those described herein can also be used to practice or test the present invention, but the methods and materials of interest are described below.All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials related to the cited publications.

[0041] It should be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. It is further noted that the claims may be drafted to exclude any optional element. Accordingly, this statement is intended to serve as a predicate for the use of exclusive terminology such as "solely," "only," or the use of a "negative" limitation in connection with the recitation of claim elements.

[0042] It will be understood that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination.

[0043] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual dates of publication, which may need to be independently confirmed.

[0044] The compounds described herein can be purified by any of the methods known in the art, including chromatographic methods such as high performance liquid chromatography (HPLC), preparative thin-layer chromatography, flash column chromatography and ion exchange chromatography.Any suitable stationary phase can be used, including normal phase and reverse phase, and ionic resin.For example, see Introduction to Modern Liquid Chromatography, 2nd Edition, ed.L.Snyder and J.J.Kirkland, John Wiley and Sons, 1979, and Thin Layer Chromatography, ed.E.Stahl, Springer-Verlag, New York, 1969.

[0045] The compounds described herein may contain one or more chiral centers and / or double bonds and therefore may exist as stereoisomers, such as double bond isomers (i.e., geometric isomers), enantiomers, or diastereomers. Accordingly, all possible enantiomers and stereoisomers of the compounds, including stereoisomerically pure forms (e.g., geometrically pure, enantiomerically pure, or diastereomerically pure), as well as mixtures of enantiomers and stereoisomers, are included in the description of the compounds herein. Mixtures of enantiomers and stereoisomers can be resolved into their component enantiomers or stereoisomers using separation or chiral synthesis techniques well known to those skilled in the art. Compounds may also exist in several tautomeric forms, including enol forms, keto forms, and mixtures thereof. Thus, the chemical structures depicted herein encompass all possible tautomeric forms of the exemplified compounds. The compounds described also include isotopically labeled compounds, in which one or more atoms have an atomic mass different from the atomic mass conventionally found in nature. Examples of isotopes that can be incorporated into compounds disclosed herein include, but are not limited to, 2 H, 3 H, 11 C. 13 C.14 C. 15 N, 18 O. 17 O and the like. Compounds can exist in unsolvated and solvated forms, including hydrated forms. Generally, compounds can be hydrated or solvated. Certain compounds can exist in multiple crystalline or amorphous forms. Generally, all physical forms are equivalent for the uses contemplated herein and are intended to be within the scope of the present disclosure. [Mode for Carrying Out the Invention]

[0046] Aspects of the present disclosure include methods for treating myeloproliferative neoplasms. The method, according to certain embodiments, includes co-administering to a subject a Janus kinase (JAK) inhibitor and a telomerase inhibitor comprising an oligonucleotide and a lipid moiety attached to the 5' and / or 3' end of the oligonucleotide. In some cases, treating a myeloproliferative neoplasm includes inducing apoptosis of myeloproliferative neoplasm cells, such as inducing apoptosis of myeloproliferative neoplasm cells in vitro. In other cases, treating a myeloproliferative neoplasm includes inducing apoptosis of myeloproliferative neoplasm cells in a subject. In some embodiments, the myeloproliferative neoplasm cells are malignant hematopoietic stem cells (HSCs). In other embodiments, the myeloproliferative neoplasm cells are malignant hematopoietic progenitor cells (HPCs). Myeloproliferative neoplasms treated according to the present methods can include, for example, myelofibrosis (MF), such as primary myelofibrosis, or myelofibrosis after previous ET or PV (post-ET MF or post-PV MF). In other embodiments, myeloproliferative neoplasms include essential thrombocythemia (ET), polycythemia vera (PV), chronic myelogenous leukemia (CML), chronic neutrophilic leukemia, chronic eosinophilic leukemia, and acute myeloid leukemia (AML). In other embodiments, myeloproliferative neoplasms are myelodysplastic syndromes (MDS). In yet other embodiments, myeloproliferative neoplasms are myelodysplastic syndromes (MDS) with isolated del(5q). Myelodysplastic syndromes (MDS) include diseases such as refractory anemia, refractory anemia with excess blasts, refractory cytopenia with polycythemia versicolor, refractory cytopenia with monocytic dysplasia, and chronic myelomonocytic leukemia (CMML).

[0047] In some embodiments, co-administering a JAK inhibitor and a telomerase inhibitor comprises administering a JAK inhibitor and a telomerase inhibitor simultaneously.In some cases where a JAK inhibitor and a telomerase inhibitor are administered simultaneously, the JAK inhibitor and the telomerase inhibitor are co-formulated (e.g., combined into a single dosage form, such as a tablet, an injection, a lyophilized agent, an intravenous fluid, etc.) and administered to a subject as a single dose.In other cases where a JAK inhibitor and a telomerase inhibitor are administered simultaneously, the JAK inhibitor and the telomerase inhibitor are formulated as two different compositions and administered to a subject simultaneously.

[0048] In other embodiments, co-administering a JAK inhibitor and a telomerase inhibitor comprises sequentially administering the JAK inhibitor and the telomerase inhibitor.In some embodiments, the JAK inhibitor is administered to the subject first, and then the telomerase inhibitor is administered to the subject.In one example, the telomerase inhibitor is administered to the subject on the same day that the JAK inhibitor is administered to the subject.In another example, the telomerase inhibitor is administered to the subject within 13 days after the JAK inhibitor is administered to the subject.For example, the telomerase inhibitor is administered within 3 days after the last dose of the JAK inhibitor is administered to the subject.

[0049] In embodiments, the telomerase inhibitor can be administered to the subject within about 14 days after administration of the JAK inhibitor, including administering the telomerase inhibitor to the subject about 0 to 13 days, e.g., about 1 to about 12 days, e.g., about 2 to about 11 days, e.g., about 3 to about 10 days, e.g., about 4 to about 9 days, e.g., about 5 to about 8 days, and about 6 to about 7 days after administration of the JAK inhibitor. In some embodiments, the telomerase inhibitor is administered to the subject within 3 days after administration of the JAK inhibitor. In certain cases, the JAK inhibitor is administered to the subject over a predetermined period of time (e.g., over a period of 0 to 7 days, as described in more detail below), and the telomerase inhibitor is administered to the subject within about 14 days after the last dose of the JAK inhibitor, including administering the telomerase inhibitor to the subject about 0 to 13 days, e.g., about 1 to about 12 days, e.g., about 2 to about 11 days, e.g., about 3 to about 10 days, e.g., about 4 to about 9 days, e.g., about 5 to about 8 days, after the last dose of the JAK inhibitor, and about 6 to about 7 days after the last dose of the JAK inhibitor. In some cases, the telomerase inhibitor is administered within 3 days after the last dose of the JAK inhibitor.

[0050] In some embodiments, the telomerase inhibitor is administered to the subject first, and then the JAK inhibitor is administered to the subject.In some cases, the JAK inhibitor is administered to the subject within 13 days after the telomerase inhibitor is administered to the subject.For example, the JAK inhibitor is administered to the subject within 3 days after the last dose of the telomerase inhibitor is administered to the subject, and then is administered twice a day.

[0051] The dosage is administered in cycles of administration of the JAK inhibitor and the telomerase inhibitor.In some embodiments, the cycle is 21 days, and in some cases, the cycle is 28 days or more.The drug administration cycle can be repeated 1, 2, 3, 4, 5, 6, 7, 8 or more than 8 times, for a total period of 6 months, 1 year, 2 years, 3 years, 4 years or more.

[0052] In certain embodiments, treating a myeloproliferative neoplasm comprises treating a subject with a 21-day administration cycle of a JAK inhibitor, or a pharmaceutically acceptable salt thereof, and a telomerase inhibitor, or a pharmaceutically acceptable salt thereof, wherein the method comprises administering the JAK inhibitor once or twice per day for 21 days, and administering the telomerase inhibitor to the subject on day 1 of the 21-day administration cycle (i.e., both the JAK inhibitor, or a pharmaceutically acceptable salt thereof, and the telomerase inhibitor, or a pharmaceutically acceptable salt thereof, are administered to the subject on day 1 of the 21-day cycle). In certain cases, the method comprises a 21-day administration cycle of a JAK inhibitor, or a pharmaceutically acceptable salt thereof, and a telomerase inhibitor, or a pharmaceutically acceptable salt thereof, wherein the JAK inhibitor is administered once per day for 21 days, and the telomerase inhibitor is administered on day 1 of the 21-day cycle. In other cases, the method includes a 21-day administration cycle of a JAK inhibitor or a pharmaceutically acceptable salt thereof and a telomerase inhibitor or a pharmaceutically acceptable salt thereof, where the JAK inhibitor is administered twice per day for 21 days and the telomerase inhibitor is administered on day 1 of the 21-day cycle. The 21-day administration cycle of administering the JAK inhibitor or a pharmaceutically acceptable salt thereof and the telomerase inhibitor or a pharmaceutically acceptable salt thereof according to these embodiments can be repeated one or more times, such as two or more times, such as three or more times, such as four or more times, such as five or more times, such as six or more times, such as seven or more times, such as eight or more times, such as nine or more times, and ten or more times. When the 21-day administration cycle of the JAK inhibitor and the telomerase inhibitor is repeated one or more times, the period between each 21-day administration cycle can be zero or more days, such as one or more days, such as two or more days, such as three or more days, such as four or more days, such as five or more days, such as six or more days, and seven or more days. Depending on the number of 21-day administration cycles of the JAK inhibitor and telomerase inhibitor used and the duration between each cycle, the duration of treatment of a subject according to these embodiments may be about 1.5 months or longer, including 3 months or longer, such as 6 months or longer, such as 1 year or longer, such as 2 years or longer, such as 3 years or longer, such as 4 years or longer, such as 5 years or longer, such as 6 years or longer, such as 7 years or longer, such as 8 years or longer, such as 9 years or longer, and 10 years or longer.

[0053] In certain embodiments, treating a myeloproliferative neoplasm comprises treating a subject with a 28-day administration cycle of a JAK inhibitor, or a pharmaceutically acceptable salt thereof, and a telomerase inhibitor, or a pharmaceutically acceptable salt thereof, wherein the method comprises administering the JAK inhibitor once or twice per day for 28 days, and administering the telomerase inhibitor to the subject on day 1 of the 28-day administration cycle (i.e., both the JAK inhibitor, or a pharmaceutically acceptable salt thereof, and the telomerase inhibitor, or a pharmaceutically acceptable salt thereof, are administered to the subject on day 1 of the 28-day cycle). In certain cases, the method comprises a 28-day administration cycle of a JAK inhibitor, or a pharmaceutically acceptable salt thereof, and a telomerase inhibitor, or a pharmaceutically acceptable salt thereof, wherein the JAK inhibitor is administered once per day for 28 days, and the telomerase inhibitor is administered on day 1 of the 28-day cycle. In other cases, the method includes a 28-day administration cycle of a JAK inhibitor or a pharmaceutically acceptable salt thereof and a telomerase inhibitor or a pharmaceutically acceptable salt thereof, where the JAK inhibitor is administered twice per day for 28 days and the telomerase inhibitor is administered on day 1 of the 28-day cycle. The 28-day administration cycle of the JAK inhibitor or a pharmaceutically acceptable salt thereof and the telomerase inhibitor or a pharmaceutically acceptable salt thereof according to these embodiments can be repeated one or more times, such as two or more times, such as three or more times, such as four or more times, such as five or more times, such as six or more times, such as seven or more times, such as eight or more times, such as nine or more times, and ten or more times. When the 28-day administration cycle of the JAK inhibitor and the telomerase inhibitor is repeated one or more times, the period between each 28-day administration cycle can be zero or more days, such as one or more days, such as two or more days, such as three or more days, such as four or more days, such as five or more days, such as six or more days, and seven or more days. Depending on the number of 28-day administration cycles of the JAK inhibitor and telomerase inhibitor used and the duration between each cycle, the duration of treatment of a subject according to these embodiments may be from about 2 months or more, including 4 months or more, such as 6 months or more, such as 1 year or more, such as 2 years or more, such as 3 years or more, such as 4 years or more, such as 5 years or more, such as 6 years or more, such as 7 years or more, such as 8 years or more, such as 9 years or more, and 10 years or more.

[0054] In certain embodiments, treating a myeloproliferative neoplasm comprises treating a subject with an administration cycle of a JAK inhibitor or a pharmaceutically acceptable salt thereof and a telomerase inhibitor or a pharmaceutically acceptable salt thereof, wherein the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered to the subject once or twice daily for 14 or 21 days, followed by one or more doses of the telomerase inhibitor or a pharmaceutically acceptable salt thereof administered to the subject between 1 day and 7 days after the last administered dose of the JAK inhibitor or a pharmaceutically acceptable salt thereof in that administration cycle. In one example, the method comprises an administration cycle in which the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered to the subject once daily for 14 days, followed by one or more doses of the telomerase inhibitor or a pharmaceutically acceptable salt thereof administered between 1 day and 7 days after the last administered dose of the JAK inhibitor or a pharmaceutically acceptable salt thereof. In another example, the method includes a dosing cycle in which a JAK inhibitor or a pharmaceutically acceptable salt thereof is administered to a subject once daily for 21 days, followed by one or more doses of a telomerase inhibitor or a pharmaceutically acceptable salt thereof administered between 1 day and 7 days after the last administered dose of the JAK inhibitor or a pharmaceutically acceptable salt thereof. In yet another example, the method includes a dosing cycle in which a JAK inhibitor or a pharmaceutically acceptable salt thereof is administered to a subject twice daily for 14 days, followed by one or more doses of a telomerase inhibitor or a pharmaceutically acceptable salt thereof administered between 1 day and 7 days after the last administered dose of the JAK inhibitor or a pharmaceutically acceptable salt thereof. In yet another example, the method includes a dosing cycle in which a JAK inhibitor or a pharmaceutically acceptable salt thereof is administered to a subject twice daily for 21 days, followed by one or more doses of a telomerase inhibitor or a pharmaceutically acceptable salt thereof administered between 1 day and 7 days after the last administered dose of the JAK inhibitor or a pharmaceutically acceptable salt thereof.In these embodiments, one or more doses of the telomerase inhibitor or a pharmaceutically acceptable salt thereof are administered to the subject 1 to 7 days after the last administered dose of the JAK inhibitor or a pharmaceutically acceptable salt thereof, including administering the telomerase inhibitor or a pharmaceutically acceptable salt thereof 1 day, such as 2 days, 3 days, such as 4 days, such as 5 days, such as 6 days, and 7 days thereafter after the last administered dose of the JAK inhibitor or a pharmaceutically acceptable salt thereof. The administration cycle of the JAK inhibitor or a pharmaceutically acceptable salt thereof and the telomerase inhibitor or a pharmaceutically acceptable salt thereof according to these embodiments can be repeated one or more times, such as 2 or more times, such as 3 or more times, such as 4 or more times, such as 5 or more times, such as 6 or more times, such as 7 or more times, such as 8 or more times, such as 9 or more times, and including 10 or more times.

[0055] In certain embodiments, treating a myeloproliferative neoplasm comprises treating a subject with a 21-day administration cycle of a telomerase inhibitor or a pharmaceutically acceptable salt thereof and a JAK inhibitor or a pharmaceutically acceptable salt thereof, wherein the method comprises administering the telomerase inhibitor or a pharmaceutically acceptable salt thereof to the subject on day 1 of the 21-day administration cycle, followed by administering the JAK inhibitor or a pharmaceutically acceptable salt thereof to the subject once or twice per day on each subsequent day of the 21-day cycle (i.e., the telomerase inhibitor or a pharmaceutically acceptable salt thereof is administered to the subject on day 1 of the 21-day administration cycle, and the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered once or twice per day on days 2-21 of the 21-day administration cycle). In certain instances, the method comprises administering the telomerase inhibitor or a pharmaceutically acceptable salt thereof to the subject on day 1 of the 21-day administration cycle, followed by administering the JAK inhibitor or a pharmaceutically acceptable salt thereof to the subject once per day on each subsequent day of the 21-day cycle. In other instances, the method includes administering a telomerase inhibitor or a pharmaceutically acceptable salt thereof to the subject on day 1 of a 21-day administration cycle, followed by administering a JAK inhibitor or a pharmaceutically acceptable salt thereof twice per day on each subsequent day of the 21-day cycle. In a 21-day cycle, administration of the JAK inhibitor or a pharmaceutically acceptable salt thereof can be delayed for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 days before either the once-daily or twice-daily administration. The 21-day administration cycle of administering a telomerase or a pharmaceutically acceptable salt thereof followed by a JAK inhibitor or a pharmaceutically acceptable salt thereof according to these embodiments can be repeated one or more times, such as two or more times, such as three or more times, such as four or more times, such as five or more times, such as six or more times, such as seven or more times, such as eight or more times, such as nine or more times, and including ten or more times. When the 21-day administration cycle of the telomerase inhibitor and JAK inhibitor is repeated one or more times, the period between each 21-day administration cycle can be 0 days or more, such as 1 day or more, such as 2 days or more, such as 3 days or more, such as 4 days or more, such as 5 days or more, such as 6 days or more, and including 7 days or more.Depending on the number of 21-day administration cycles of the telomerase inhibitor and JAK inhibitor used and the duration between each cycle, the duration of treatment of a subject according to these embodiments may be about 1.5 months or longer, including 3 months or longer, such as 6 months or longer, such as 1 year or longer, such as 2 years or longer, such as 3 years or longer, such as 4 years or longer, such as 5 years or longer, such as 6 years or longer, such as 7 years or longer, such as 8 years or longer, such as 9 years or longer, and 10 years or longer.

[0056] In certain embodiments, treating a myeloproliferative neoplasm comprises treating a subject with a 28-day administration cycle of a telomerase inhibitor or a pharmaceutically acceptable salt thereof and a JAK inhibitor or a pharmaceutically acceptable salt thereof, wherein the method comprises administering the telomerase inhibitor or a pharmaceutically acceptable salt thereof to the subject on day 1 of the 28-day administration cycle, followed by administering the JAK inhibitor or a pharmaceutically acceptable salt thereof to the subject once or twice per day on each subsequent day of the 28-day cycle (i.e., the telomerase inhibitor or a pharmaceutically acceptable salt thereof is administered to the subject on day 1 of the 28-day administration cycle, and the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered once or twice per day on days 2 through 28 of the 28-day administration cycle). In certain instances, the method comprises administering the telomerase inhibitor or a pharmaceutically acceptable salt thereof to the subject on day 1 of the 28-day administration cycle, followed by administering the JAK inhibitor or a pharmaceutically acceptable salt thereof to the subject once per day on each subsequent day of the 28-day cycle. In other instances, the method includes administering a telomerase inhibitor or a pharmaceutically acceptable salt thereof to a subject on day 1 of a 28-day administration cycle, followed by administering a JAK inhibitor or a pharmaceutically acceptable salt thereof twice per day on each subsequent day of the 28-day cycle. In a 28-day cycle, administration of the JAK inhibitor or a pharmaceutically acceptable salt thereof can be delayed for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 days before either the once-daily or twice-daily administration. The 28-day administration cycle of administering a telomerase or a pharmaceutically acceptable salt thereof followed by a JAK inhibitor or a pharmaceutically acceptable salt thereof according to these embodiments can be repeated one or more times, including two or more times, three or more times, four or more times, five or more times, six or more times, seven or more times, eight or more times, nine or more times, and ten or more times. When the 28-day administration cycle of the telomerase inhibitor and the JAK inhibitor is repeated one or more times, the period between each 28-day administration cycle can be 0 days or more, such as 1 day or more, such as 2 days or more, such as 3 days or more, such as 4 days or more, such as 5 days or more, such as 6 days or more, and including 7 days or more.Depending on the number of 28-day administration cycles of the telomerase inhibitor and JAK inhibitor used and the duration between each cycle, the duration of treatment of a subject according to these embodiments can be from about 2 months or more, including 4 months or more, such as 6 months or more, such as 1 year or more, such as 2 years or more, such as 3 years or more, such as 4 years or more, such as 5 years or more, such as 6 years or more, such as 7 years or more, such as 8 years or more, such as 9 years or more, and 10 years or more.

[0057] In other embodiments, the method includes administering a JAK inhibitor or a pharmaceutically acceptable salt thereof for a predetermined period (1 to 21 days), discontinuing administration of the JAK inhibitor or a pharmaceutically acceptable salt thereof, and administering a telomerase inhibitor or a pharmaceutically acceptable salt thereof within 7 days (e.g., 2 days, 1 day, or the same day) of the last dose of the JAK inhibitor or a pharmaceutically acceptable salt thereof administered to the subject. This administration cycle can be repeated, such as 2 or more times, such as 3 or more times, such as 4 or more times, such as 5 or more times, such as 6 or more times, such as 7 or more times, such as 8 or more times, such as 9 or more times, and including 10 or more times.

[0058] The term Janus kinase (JAK) inhibitor, as used herein, refers to a compound that inhibits the activity of one or more Janus kinase enzymes, such as Janus kinase 1 (JAK1), Janus kinase 2 (JAK2), Janus kinase 3 (JAK3), and tyrosine kinase 2 (TYK2). In certain embodiments, the JAK inhibitor of interest interferes with the Janus kinase / signal transducer and activator of transcription (JAK-STAT) pathway. Examples of JAK inhibitors include, but are not limited to, ruxolitinib ((3R)-3-cyclopentyl-3-[4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)pyrazol-1-yl]propanenitrile), tofacitinib (3-[(3R,4R)-4-methyl-3-[methyl(7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino]piperidin-1-yl]propanenitrile), and tyrosine kinase inhibitors (TYK2). trans-4-[methyl(7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino]cyclohexyl}methanesulfonamide), baricitinib (2-[1-ethylsulfonyl-3-[4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)pyrazol-1-yl]azetidin-3-yl]azetidin-3-yl]amide), oclacitinib (N-methyl{trans-4-[methyl(7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino]cyclohexyl}methanesulfonamide), baricitinib (2-[1-ethylsulfonyl-3-[4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)pyrazol-1-yl]azetidin-3-yl]azetidin-3-yl]amide), cetonitrile), peficitinib (4-[[(1R,3S)-5-hydroxy-2-adamantyl]amino]-1H-pyrrolo[2,3-b]pyridine-5-carboxamide), fedratinib (N-tert-butyl-3-{5-methyl-2-[4-(2-pyrrolidin-1-yl-ethoxy)-phenylamino]-pyrimidin-4-ylamino}-benzenesulfonamide d), upadacitinib ((3S,4R)-3-ethyl-4-(3H-imidazo[1,2-a]pyrrolo[2,3]-e]pyrazin-8-yl)-N-(2,2,2-trifluoroethyl)pyrrolidine-1-carboxamide), filgotinib (N-[5-[4-[(1,1-dioxo-1,4-thiazinan-4-yl)methyl]phenyl]-[1,2,4]triazolo[1,5-a]pyridin-2-yl]cyclopropanecarboxamide), celdulatinib (4-(cyclopropylamino)-2-[4-(4-ethylsulfonylpiperazin-1-yl)anilino]pyrimidine-5-carboxamide), gandotinib (3-(4-chloro-2-fluorobenzyl)-2-methyl-N-(5-methyl-1H-pyrazol-3-yl)-8-(morpholinomethyl)imidazo[1,2-b]pyridazin-6-amine), lestaurtinib ((5S,6S,8R)-6-hydroxy-6-(hydroxymethyl)-5-methyl-7,8,14,15-tetrahydro-5H-16-oxa-4b,8a,14- triaza-5,8-methanodibenzo[b,h]cycloocta[jkl]cyclopenta[e]-as-indacen-13(6H)-one), momelotinib (N-(cyanomethyl)-4-{2-[4-(morpholin-4-yl)anilino]pyrimidin-4-yl}benzamide), and pacritinib ((16E)-11-[2-(1-pyrrolidinyl)ethoxy]-14,19-dioxa-5,7,26-triazatetracyclo[19.3.1.12,6.18,12]heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decane), and pharmaceutically acceptable salts thereof. In certain embodiments, the JAK inhibitor is selected from the group consisting of ruxolitinib, fedratinib, momelotinib, and pacritinib, or pharmaceutically acceptable salts thereof, and combinations thereof. In certain embodiments, the JAK inhibitor is ruxolitinib or a pharmaceutically acceptable salt thereof. In certain embodiments, the JAK inhibitor is fedratinib or a pharmaceutically acceptable salt thereof. In certain embodiments, the JAK inhibitor is momelotinib or a pharmaceutically acceptable salt thereof. In certain embodiments, the JAK inhibitor is pacritinib or a pharmaceutically acceptable salt thereof.

[0059] In embodiments, the term "telomerase inhibitor" as used herein refers to a compound capable of reducing or inhibiting the activity of telomerase reverse transcriptase in mammalian cells. Telomerase inhibitors of interest, in some cases, include hTR template inhibitors, which comprise oligonucleotides. An "hTR template inhibitor" is a compound capable of blocking the template region of the RNA component of human telomerase and inhibiting enzyme activity. In some embodiments, the oligonucleotide comprises a sequence effective to hybridize to a more specific portion of this region, having the sequence 5'-CUAACCCUAAC-3'.

[0060] The telomerase inhibitor of interest comprises an oligonucleotide and a lipid moiety attached to the 5' and / or 3' end of the oligonucleotide. In some embodiments, the telomerase inhibitor comprises an oligonucleotide having a "nuclease-resistant linkage" having a backbone with subunit bonds that are substantially resistant to nuclease cleavage by extracellular and intracellular nucleases in an unhybridized or hybridized form. In some cases, the oligonucleotide exhibits little or no nuclease cleavage under physiological conditions.

[0061] In some embodiments, the region of therapeutic oligonucleotide that targets hTR sequence is complementary to the corresponding hTR sequence.In certain embodiments, the base sequence of oligonucleotide comprises a sequence of 5 or more nucleotides that are complementary to hTR target, such as 8 or more nucleotides, such as 10 or more nucleotides, such as 12 or more nucleotides, such as 15 or more nucleotides that are complementary to hTR target.In certain embodiments, the oligonucleotide in the telomerase inhibitor of the present disclosure is completely complementary to the hTR target sequence, for example, the entire length of the oligonucleotide is complementary to the hTR target sequence.

[0062] Telomerase inhibitors include internucleoside linkages such as phosphodiester, phosphotriester, methylphosphonate, P3'→N5' phosphoramidate, N3'→P5' phosphoramidate, N3'→P5' thiophosphoramidate, and phosphorothioate linkages. In certain embodiments, the telomerase inhibitor of interest contains at least one N3'→P5' phosphoramidate (NP) or N3'→P5' thiophosphoramidate (NPS) linkage, which can be represented by the structure: 3'-(-NH--P(=O)(--XR)--O-)-5', where XR is OH or SH, X is O or S, and R is selected from the group consisting of hydrogen, alkyl, and aryl, and pharmaceutically acceptable salts thereof. In other embodiments, the oligonucleotide contains all NP, or in some embodiments, all NPS linkages.In one embodiment, the sequence of the hTR template inhibitor oligonucleotide is complementary to nucleotides 42-54 of SEQ ID NO: 1 (GGGUUGCGGAGGGUGGGCCUGGGAGGGGUGGUGGCCAUUU UUUGUCUAACCCUAACUGAGAAGGGCGUAGGCGCCGUGCUUUUGCUCCCC GCGCGCUGUUUUUCUCGCUGACUUUCAGCGGGCGGAAAAGCCUCGGCCUG CCGCCUUCCACCGUUCAUUCUAGAGCAAACAAAAAAUGUCAGCUGCUGGC CCGUUCGCCUCCCGGGGACCUGCGGCGGGUCGCCUGCCCAGCCCCCGAAC CCCGCCUGGAGCCGCGGUCGGCCCGGGGCUUCUCCGGAGGCACCCACUGC CACCGCGAAGAGUUGGGCUCUGUCAGCCGCGGGUCUCUCGGGGGCGAGGG CGAGGUUCACCGUUUCAGGCCGCAGGAAGAGGAACGGAGCGAGUCCCGCC GCGGCGCGAUUCCCUGAGCUGUGGGACGUGCACCCAGGACUCGGCUCACA CAUGCAGUUCGCUUUCCUGUUGGUGGGGGGAACGCCGAUCGUGCGCAUCC GUCACCCCUCGCCGGCAGUGGGGGCUUGUGAACCCCCAAACCUGACUGAC UGGGCCAGUGUGCU). In certain embodiments, the oligonucleotide comprises a sequence that is complementary or nearly complementary to some portion of an 11-nucleotide region having the sequence 5'-CUAACCCUAAC-3'. An oligonucleotide having this sequence (TAGGGTTAGACAA, SEQ ID NO: 12) and an N3'→P5' thiophosphoramidate (NPS) linkage is referred to herein as GRN163. See, for example, Asai et al., Cancer Research 63:3931-3939 (2003) and Gryaznov et al., Nucleosides Nucleotides Nucleic Acids 22(5-8):577-81 (2003).Another target region is the region spanning nucleotides 137-179 of hTR (see Pruzan et al., Nucl. Acids Research, 30:559-568, 2002). Within this region, the sequence spanning 141-153 is a preferred target. PCT Publication No. 98 / 28442 describes the use of oligonucleotides at least 7 nucleotides in length to inhibit telomerase, where the oligonucleotides are designed to be complementary to accessible portions of the hTR sequence outside the template region, including nucleotides 137-196, 290-319, and 350-380 of hTR. Preferred hTR target sequences are shown below and identified by SEQ ID NOs: 2-22. In certain embodiments, telomerase inhibitor oligonucleotides have sequences that target human telomerase RNA (hTR), including, but not limited to, the following sequences: [Table A]

[0063] The telomerase inhibitors of the present disclosure include a lipid moiety attached to the 5' and / or 3' end of an oligonucleotide. In some cases, the structural group provides superior cellular uptake properties, such that a comparable biological effect can be achieved using a smaller amount of conjugated oligonucleotide compared to the unmodified form. The lipid moiety can be an aliphatic hydrocarbon or fatty acid, such as a hydrocarbon or fatty acid derivative. For example, the lipid moiety can be a saturated linear compound having 14 to 20 carbons, such as myristic acid (tetradecanoic acid), palmitic acid (hexadecanoic acid), and stearic acid (octadecanoic acid), and their corresponding aliphatic hydrocarbon forms, tetradecane, hexadecane, and octadecane. Other examples of lipid moieties include sterols, such as cholesterol, and substituted fatty acids and hydrocarbons, particularly polyfluorinated forms of these groups. In certain embodiments, the lipid moiety includes one or more derivatives, such as amine, amide, ester, and carbamate derivatives of the lipid moiety. In one example, the lipid moiety is a palmitoyl (C16) moiety, such as palmitoylamide. The lipid moiety can be conjugated to the oligonucleotide through a linker, such as a glycerol or aminoglycerol linker.

[0064] In some embodiments, the telomerase inhibitor is a compound described in U.S. Patent No. 9,375,485, the disclosure of which is incorporated herein by reference. In certain embodiments, the telomerase inhibitor is imetelstat (a 5' palmitoylated 13-mer thiophosphoramidate oligonucleotide consisting of the sequence 5'-TAGGGTTAGACAA-3'), or imetelstat sodium (GRN163L): [ka] and pharmaceutically acceptable salts thereof.

[0065] In practicing this method, the amount of JAK inhibitor or pharmaceutically acceptable salt administered to a subject can range from about 1 mg / day to about 600 mg / day, including about 10 mg / day to about 550 mg / day, such as 10 mg / day to about 400 mg / day, such as about 15 mg / day to about 300 mg / day, such as about 20 mg / day to about 200 mg / day, such as about 25 mg / day to about 100 mg / day, and about 30 mg / day to about 35 mg / day. In certain embodiments, the amount of JAK inhibitor administered to a subject is about 10 mg / day to about 400 mg / day.

[0066] Each dose of ruxolitinib or a pharmaceutically acceptable salt administered to a subject can range from about 5 mg to about 40 mg, including about 7.5 mg to about 27.5 mg, about 10 mg to about 25 mg, about 12.5 mg to about 22.5 mg, and about 15 mg to about 20 mg. In certain embodiments, the dose of the JAK inhibitor administered to a subject is 5.0 mg, 5.1 mg, 5.2 mg, 5.3 mg, 5.4 mg, 5.5 mg, 5.6 mg, 5.7 mg, 5.8 mg, 5.9 mg, 6.0 mg, 6.1 mg, 6.2 mg, 6.3 mg, 6.4 mg, 6.5 mg, 6.6 mg, 6.7 mg, 6.8 mg, 6.9 mg, 7 mg, 7.1 mg, 7.2 mg, 7.3 mg, 7.4 mg, 7.5 mg, 7.6 mg, 7.7 mg, 7.8 mg, 7.9 mg, 7.1 mg, 7.2 mg, 7.4 mg, 7.5 mg, 7.6 mg, 7.7 mg, 7.8 mg, 7.9 mg, 7.1 mg, 7.2 mg, 7.4 mg, 7.5 mg, 7.6 mg, 7.7 mg, 7.8 mg, 7.9 mg, 7.9 mg, 7.1 mg, 7.2 mg, 7.3 ... 3mg, 7.4mg, 7.5mg, 7.6mg, 7.7mg, 7.8mg, 7.9mg, 8mg, 8.1mg, 8.2mg, 8.3mg, 8.4mg, 8.5mg, 8.6mg, 8.7m g, 8.8mg, 8.9mg, 9mg, 9.1mg, 9.2mg, 9.3mg, 9.4mg, 9.5mg, 9.6mg, 9.7mg, 9.8mg, 9.9mg, 10mg, 10.1mg, 1 0.2mg, 10.3mg, 10.4mg, 10.5mg, 10.6mg, 10.7mg, 10.8mg, 10.9mg, 11mg, 11.1mg, 11.2mg, 11.3mg, 11. 4mg, 11.5mg, 11.6mg, 11.7mg, 11.8mg, 11.9mg, 12mg, 12.1mg, 12.2mg, 12.3mg, 12.4mg, 12.5mg, 12.6mg , 12.7mg, 12.8mg, 12.9mg, 13mg, 13.1mg, 13.2mg, 13.3mg, 13.4mg, 13.5mg, 13.6mg, 13.7mg, 13.8mg, 13.9mg, 14mg, 14.1mg, 14.2mg, 14.3mg, 14.4mg, 14.5mg, 14.6mg, 14.7mg, 14.8mg, 14.9mg, or 15mg.

[0067] In certain embodiments, the JAK inhibitor ruxolitinib is administered to a subject at a dose of about 100×10 9 5 mg twice daily if the subject has a baseline platelet count less than 100 x 10 / L platelets 9 / L platelets ~ approx. 200×10 915 mg twice daily if the subject has a baseline platelet count of approximately 200 x 10 9 If the patient has a baseline platelet count greater than 1 / L platelets, the patient will be given a dose of 20 mg twice daily.

[0068] In certain embodiments, the JAK inhibitor is fedratinib or a pharmaceutically acceptable salt thereof, and the subject is 9 If the subject has a baseline platelet count of 1 / L or greater, the subject is administered a dose of 400 mg once per day. In certain cases, fedratinib or a pharmaceutically acceptable salt thereof is administered to the subject at a dose of 300 mg once per day. In other cases, fedratinib or a pharmaceutically acceptable salt thereof is administered to the subject at a dose of 200 mg once per day. In still other cases, fedratinib or a pharmaceutically acceptable salt thereof is administered to the subject at a dose of 100 mg once per day. In still other cases, fedratinib or a pharmaceutically acceptable salt thereof is administered to the subject at a dose of less than 100 mg once per day.

[0069] In other embodiments, the JAK inhibitor is momelotinib or a pharmaceutically acceptable salt thereof, and is administered to the subject at a dose of 400 mg once per day. In certain cases, momelotinib or a pharmaceutically acceptable salt thereof is administered to the subject at a dose of 300 mg once per day. In other cases, momelotinib or a pharmaceutically acceptable salt thereof is administered to the subject at a dose of 200 mg once per day. In some cases, momelotinib or a pharmaceutically acceptable salt thereof is administered to the subject at a dose of 150 mg twice per day. In still other cases, momelotinib or a pharmaceutically acceptable salt thereof is administered to the subject at a dose of 100 mg once per day.

[0070] In other embodiments, the JAK inhibitor is pacritinib or a pharmaceutically acceptable salt thereof, and is administered to the subject at a dosage of about 50 mg to about 600 mg once per day, including about 100 mg to about 500 mg once per day, such as about 150 mg to about 400 mg once per day, and about 200 mg to about 350 mg once per day. In certain instances, pacritinib or a pharmaceutically acceptable salt thereof is administered to the subject at a dosage of about 50 mg to about 600 mg twice per day, including about 100 mg to about 500 mg twice per day, such as about 150 mg to about 400 mg twice per day, and about 200 mg to about 350 mg twice per day. In other cases, pacritinib or a pharmaceutically acceptable salt is administered to the subject at a dosage of 100 mg once per day, or about 100 mg twice per day, or 200 mg twice per day.

[0071] Methods according to certain embodiments also include determining a subject's baseline or pre-treatment platelet count before administering a JAK inhibitor to the subject. In these embodiments, the methods may include determining the subject's baseline or pre-treatment platelet count and determining the amount of JAK inhibitor to administer to the subject based on the subject's baseline or pre-treatment platelet count. Any convenient hematology protocol can be used to determine the subject's baseline or pre-treatment platelet count, such as by manual or automated hematology analyzer or by hemocytometer. The subject's baseline or pre-treatment platelet count (and the amount of JAK inhibitor to be administered) can be determined 1 minute or more, for example, 2 minutes or more, for example, 5 minutes or more, for example, 10 minutes or more, for example, 15 minutes or more, for example, 30 minutes or more, for example, 60 minutes or more, for example, 2 hours or more, for example, 3 hours or more, for example, 6 hours or more, for example, 12 hours or more before administering a JAK inhibitor dose to the subject according to embodiments of the methods described herein, including determining the subject's baseline or pre-treatment platelet count 24 hours before administering the JAK inhibitor to the subject.

[0072] Each dose of the JAK inhibitor can be administered to a subject one or more times per day, including twice per day, three times per day, and four times per day. In certain embodiments, the method comprises administering the JAK inhibitor to a subject once per day. In other embodiments, the method comprises administering the JAK inhibitor to a subject twice per day. In some cases, the JAK inhibitor is administered to a subject one or more times per day in a cycle spanning 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 days, or 1 day. In some cases, the JAK inhibitor is administered to the subject once per day for a period of about 1 day to about 30 days, e.g., once per day for a period of about 1 day to about 28 days, 1 day to 21 days, or 7 days to 14 days. In other cases, the JAK inhibitor is administered to the subject twice per day for a period of about 1 day to about 30 days, e.g., once per day for a period of about 1 day to about 28 days, 1 day to 21 days, or 7 days to 14 days.

[0073] The JAK inhibitor can be administered to the subject one or more times per day for a period of about 1 to about 21 days, such as from 2 to about 20 days, such as from about 3 to about 19 days, such as from about 4 to about 18 days, such as from about 5 to about 17 days, such as from about 6 to about 16 days, and including from about 7 to about 14 days. In one example, the method includes administering the JAK inhibitor to the subject once per day for a period of about 1 to about 21 days, such as from 2 to about 20 days, such as from about 3 to about 19 days, such as from about 4 to about 18 days, such as from about 5 to about 17 days, such as from about 6 to about 16 days, and includes administering the JAK inhibitor to the subject once per day for a period of about 7 to about 14 days. In another example, the method includes administering to the subject a JAK inhibitor twice per day for a period of about 1 day to about 21 days, such as from about 2 days to about 20 days, such as from about 3 days to about 19 days, such as from about 4 days to about 18 days, such as from about 5 days to about 17 days, such as from about 6 days to about 16 days, and includes administering to the subject a JAK inhibitor twice per day for a period of about 7 days to about 14 days. In certain embodiments, the JAK inhibitor is administered to the subject at a dose of about 100×10 9Approximately 5 mg twice daily if the subject has a baseline platelet count of less than 100 x 10 / L platelets 9 / L platelets ~ approx. 200×10 9 Approximately 15 mg twice daily, or approximately 200 x 10 9 If the subject has a baseline platelet count greater than 1 / L platelets, the subject is administered a dose of about 20 mg twice daily.

[0074] The dosage of a telomerase inhibitor, such as imetelstat or imetelstat sodium, administered to a subject can range from about 4 mg / kg to about 15 mg / kg, including about 4.0 mg / kg to about 10 mg / kg, about 6 mg / kg to about 14 mg / kg, about 7 mg / kg to about 13 mg / kg, about 8 mg / kg to about 12 mg / kg, about 7.5 mg / kg to about 9.4 mg / kg, and about 9 mg / kg to about 11 mg / kg. In some embodiments, the dosage of the telomerase inhibitor administered to a subject is about 7.5 mg / kg to about 9.4 mg / kg.For example, the dosage of the telomerase inhibitor may be 4.0 mg / kg, 4.1 mg / kg, 4.2 mg / kg, 4.3 mg / kg, 4.4 mg / kg, 4.5 mg / kg, 4.6 mg / kg, 4.7 mg / kg, 4.8 mg / kg, 4.9 mg / kg, 5.0 mg / kg, 5.1 mg / kg, 5.2 mg / kg, 5.3 mg / kg, 5.4 mg / kg, 5.5 mg / kg, 5.6 mg / kg, 5.7 mg / kg, 5.8 mg / kg, 5.9 mg / kg, 6.0 mg / kg, 6.1 mg / kg, 6.2 mg / kg, 6.3 mg / kg, 6.4 mg / kg, 6.5 mg / kg, 6.6 mg / kg, 6.7 mg / kg, 6.8 mg / kg, 6.9 ... g, 6.2mg / kg, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg , 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8 .6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / kg, 9. 8mg / kg, 9.9mg / kg, 10mg / kg, 10.1mg / kg, 10.2mg / kg, 10.3mg / kg, 10.4mg / kg, 10.5mg / kg, 10.6mg / kg, 10.7mg / kg, 10.8mg / kg, 10.9 In certain embodiments, the dosage of the telomerase inhibitor administered to the subject is about 9.4 mg / kg.

[0075] Doses of a telomerase inhibitor, such as imetelstat or imetelstat sodium, can be administered to a subject in cycles of once per week, once per 2 weeks (14 days), once per 3 weeks (21 days), once per 4 weeks (28 days), once per 6 weeks, once per 8 weeks, once per 10 weeks, or once per 12 weeks. In certain embodiments of the method, imetelstat is administered in 1, 2, 3, 4, 5, 6, 7, 8, or more than 8 dosage cycles, each cycle comprising intravenous administration of about 4-10 mg / kg of imetelstat once per 3 weeks, intravenous administration of about 4-10 mg / kg of imetelstat once per 4 weeks, intravenous administration of about 4-10 mg / kg of imetelstat once per 2 weeks, or intravenous administration of about 7.5-9.4 mg / kg of imetelstat once per 3 weeks. In certain instances, each dosage cycle comprises intravenous administration of about 7.5-9.4 mg / kg of imetelstat once every four weeks. In some instances, each dosage cycle comprises intravenous administration of about 9.4 mg / kg of imetelstat once every three weeks.

[0076] In some embodiments, the amount of a telomerase inhibitor, such as imetelstat or imetelstat sodium, administered to an individual is about 0.5 to about 5 mg, about 5 to about 10 mg, about 10 to about 15 mg, about 15 to about 20 mg, about 20 to about 25 mg, about 20 to about 50 mg, about 25 to about 50 mg, about 50 to about 75 mg, about 50 to about 100 mg, about 75 to about 100 mg, about 100 to about 125 mg, about 125 to about 150 mg, about 150 to about 175 mg, about 175 to about 200 mg, about 200 to about 225 mg, about 225 to about 250 mg, about 250 to about 300 mg, about 300 to about 350 mg, about 350 to about 400 mg, about 400 to about 450 mg, or about 450 to about 500 mg. In some embodiments, the amount of telomerase inhibitor administered to an individual in an effective amount (e.g., a unit dosage form) ranges from about 5 mg to about 500 mg, e.g., from about 30 mg to about 300 mg, or from about 50 mg to about 200 mg. In some embodiments, the concentration of the telomerase inhibitor administered to an individual is diluted (about 0.1 mg / ml) or concentrated (about 180 mg / ml), e.g., about 0.1 to about 200 mg / ml, about 0.1 to about 180 mg / ml, about 0.1 to about 160 mg / ml, about 0.1 to about 140 mg / ml, about 0.1 to about 120 mg / ml, about 0.1 to about 100 mg / ml, about 0.1 to about 80 mg / ml, about 0.1 to about 60 mg / ml, about 0.1 to about 40 mg / ml, about 0.1 to about 20 mg / ml, about 0.1 to about 10 mg / ml, about 2 to about 40 mg / ml, about 4 to about 35 mg / ml, about 6 to about 30 mg / ml, about 8 to about 25 mg / ml, or the like. ml, about 10 to about 20 mg / ml, about 12 to about 15 mg / ml, or about 0.1 mg / ml, 0.2 mg / ml, 0.3 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.7 mg / ml, 0.8 mg / ml, 0.9 mg / ml, 1 mg / ml, 1.1 mg / ml, 1.2 mg / ml, 1.3 mg / ml, 1.4 mg / ml, 1.5 mg / ml, 1.6 mg / ml, 1.7 mg / ml, 1.8 mg / ml, 1.9 mg / ml, 2 mg / ml, 2.1 mg / ml, 2.2 mg / ml, 2.3 mg / ml, 2.4 mg / ml, or 2.5 mg / ml.In some embodiments, the concentration of the telomerase inhibitor is at least about 0.1 mg / ml, 0.2 mg / ml, 0.3 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 1.3 mg / ml, 1.5 mg / ml, 2 mg / ml, 3 mg / ml, 4 mg / ml, 5 mg / ml, 6 mg / ml, 7 mg / ml, 8 mg / ml, 9 mg / ml, 10 mg / ml, 11 mg / ml, 12 mg / ml, 13 mg / ml, 14 mg / ml, 15 mg / ml, 16 mg / ml, 17 mg / ml, 18 mg / ml, 19 mg / ml, 20 mg / ml, 21 mg / ml, 22 mg / ml, 23 mg / ml, 24 mg / ml, 25 mg / ml, 26 mg / ml, 27 mg / ml, 28 mg / ml, The concentration is any of 29mg / ml, 30mg / ml, 31mg / ml, 32mg / ml, 33mg / ml, 33.3mg / ml, 34mg / ml, 35mg / ml, 36mg / ml, 37mg / ml, 38mg / ml, 39mg / ml, 40mg / ml, 50mg / ml, 60mg / ml, 70mg / ml, 80mg / ml, 90mg / ml, 100mg / ml, 110mg / ml, 120mg / ml, 130mg / ml, 140mg / ml, 150mg / ml, 160mg / ml, 170mg / ml, 180mg / ml, 190mg / ml, 200mg / ml, 210mg / ml, 220mg / ml, 230mg / ml, 240mg / ml, or 250mg / ml.

[0077] In embodiments, each dose of the telomerase inhibitor is administered to the subject once every 7 days or more, including once every 10 days or more, such as once every 14 days or more, such as once every 21 days or more, such as once every 28 days or more, and once every 35 days or more. In some embodiments, the telomerase inhibitor is administered to the subject once every 2 weeks. In other embodiments, the telomerase inhibitor is administered to the subject once every 3 weeks. In still other embodiments, the telomerase inhibitor is administered once every 4 weeks. In some cases, each dose of the telomerase inhibitor is administered to the subject over a period of about 0.1 hours to about 6 hours, such as about 0.5 hours to about 5 hours, including about 1 hour to about 4 hours, and including about 2 hours to about 3 hours. In certain cases, the telomerase inhibitor is administered to the subject over a period of about 2 hours.

[0078] In some embodiments, a method for treating myeloproliferative neoplasms includes administering a JAK inhibitor to a subject for a predetermined period of time, discontinuing administration of the JAK inhibitor, and administering a telomerase inhibitor to the subject within a predetermined period of time after the last dose of the JAK inhibitor. In these embodiments, the JAK inhibitor may be administered for a period of about 0 to about 28 days, such as about 1 to about 21 days, such as about 2 to about 14 days, and including about 2 to about 7 days. The JAK inhibitor may be administered once per day, twice per day, three times per day, or four times per day. The telomerase inhibitor is administered to the subject within 7 days of the last dose of the JAK inhibitor, including within 6 days, within 5 days, within 4 days, and within 3 days after discontinuing administration of the JAK inhibitor.

[0079] In some embodiments, a method for treating a myeloproliferative neoplasm includes administering a telomerase inhibitor to a subject for a predetermined period of time, discontinuing administration of the telomerase inhibitor, and administering a JAK inhibitor to the subject within a predetermined period of time after discontinuing administration of the telomerase inhibitor. In these embodiments, the JAK inhibitor may be administered for a period of about 0 to about 28 days, such as about 1 to about 21 days, such as about 2 to about 14 days, and including about 2 to about 7 days. The JAK inhibitor may be administered once per day, twice per day, three times per day, or four times per day. This cycle may be repeated two, three, four, five, six, or more times.

[0080] In certain embodiments, the method comprises administering ruxolitinib or a pharmaceutically acceptable salt thereof to a subject once daily for a period of 0 to 14 days, and administering imetelstat or a pharmaceutically acceptable salt thereof to the subject within 3 days (e.g., 2 days, 1 day, or the same day) of the last administered dose of ruxolitinib or a pharmaceutically acceptable salt thereof. Imetelstat or a pharmaceutically acceptable salt thereof may then be administered, in these embodiments, once every 2 weeks, once every 3 weeks, or once every 4 weeks.

[0081] Administration of each pharmaceutical composition can extend over an extended period (e.g., during maintenance therapy), such as from about 1 month to about 7 years. In some embodiments, one or more of the JAK inhibitor composition and telomerase inhibitor composition can be administered for any of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 24, 30, 36, 48, 60, 72, or 84 months. In other embodiments, one or more of the JAK inhibitor composition and telomerase inhibitor composition are administered for the remainder of the subject's life.

[0082] In embodiments, JAK inhibitor compositions and telomerase inhibitor compositions suitable for carrying out the present methods may be formulated for one or more of oral, intravenous, subcutaneous, intramuscular, topical, intraperitoneal, intranasal, inhaled, or intraocular administration. The desired protocols used to administer the JAK inhibitor compositions and telomerase inhibitor compositions described herein, as well as appropriate dosages, may, in certain embodiments, be determined by a qualified medical professional (e.g., a physician).

[0083] Pharmaceutical compositions can contain one or more pharmaceutically acceptable carriers. Pharmaceutically acceptable excipients are fully described in various publications, including, for example, A. Gennaro (2000) "Remington: The Science and Practice of Pharmacy", 20th edition, Lippincott, Williams, & Wilkins, Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) H.C. Cansel et al., eds. 7th edition, Lippincott, Williams, & Wilkins, and Handbook of Pharmaceutical Excipients (2000) A.H. Kibbe et al., eds., 3rd edition. American Pharmaceutical Assoc. For example, the one or more excipients may be sucrose, starch, mannitol, sorbitol, lactose, glucose, cellulose, talc, calcium phosphate or calcium carbonate, a binder (e.g., cellulose, methylcellulose, hydroxymethylcellulose, polypropylpyrrolidone, polyvinylpyrrolidone, gelatin, gum arabic, poly(ethylene glycol), sucrose, or starch), a disintegrant (e.g., starch, carboxymethylcellulose, hydroxypropyl starch, low-substituted hydroxypropyl cellulose, sodium bicarbonate, calcium phosphate, or calcium citrate), a lubricant (e.g., stearic acid, cellulose acetate, cellulose acetate, cellulose stearate, cellulose acetate ... magnesium phosphate, light anhydrous silicic acid, talc, or sodium lauryl sulfate), flavoring agents (e.g., citric acid, menthol, glycine, or orange powder), preservatives (e.g., sodium benzoate, sodium bisulfite, methylparaben, or propylparaben), stabilizers (e.g., citric acid, sodium citrate, or acetic acid), suspending agents (e.g., methylcellulose, polyvinylpyrrolidone, or aluminum stearate), dispersing agents (e.g., hydroxypropylmethylcellulose), diluents (e.g., water), and base waxes (e.g., cocoa butter, white petrolatum, or polyethylene glycol).

[0084] In some embodiments, the composition of interest comprises an aqueous buffer. Suitable aqueous buffers include, but are not limited to, acetate, succinate, citrate, and phosphate buffers ranging in strength from about 5 mM to about 100 mM. In some embodiments, the aqueous buffer contains a reagent that provides an isotonic solution. Such reagents include, but are not limited to, sodium chloride and a sugar, such as mannitol, dextrose, or sucrose. In some embodiments, the aqueous buffer further comprises a non-ionic surfactant, such as polysorbate 20 or 80. In some cases, the composition of interest further comprises a preservative. Suitable preservatives include, but are not limited to, benzyl alcohol, phenol, chlorobutanol, and benzalkonium chloride. In many cases, the composition is stored at about 4°C. Formulations can also be lyophilized, in which case they generally contain a cryoprotectant, such as sucrose, trehalose, lactose, maltose, or mannitol. Lyophilized formulations can be stored for extended periods, even at ambient temperatures.

[0085] In some embodiments, the compositions contain other additives such as lactose, mannitol, corn starch, or potato starch, binders such as crystalline cellulose, cellulose derivatives, acacia, corn starch, or gelatin, disintegrating agents such as corn starch, potato starch, or sodium carboxymethylcellulose, lubricants such as talc or magnesium stearate, and optionally diluents, buffers, wetting agents, preservatives, and flavorings.

[0086] When the composition is formulated for injection, it can be formulated by dissolving, suspending, or emulsifying the JAK inhibitor or telomerase inhibitor in an aqueous or non-aqueous solvent such as vegetable or other similar oils, synthetic fatty acid glycerides, esters of higher fatty acids, or propylene glycol, along with conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifiers, stabilizers, and preservatives, as needed. [Example]

[0087] The following examples are presented to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent that the following experiments are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, etc.), but some experimental error and deviation must be accounted for. Unless otherwise indicated, parts are parts by weight, molecular weights are weight average molecular weights, temperatures are in degrees Celsius, and pressures are at or near atmospheric. "Average" refers to the arithmetic mean. Standard abbreviations may be used, such as bp, base pairs; kb, kilobases; pl, picoliters; s or sec, seconds; min, minutes; h or hr, hours; aa, amino acids; kb, kilobases; bp, base pairs; nt, nucleotides; im, intramuscular; intraperitoneal; sc, subcutaneous, etc.

[0088] material and method Compounds. Imetelstat sodium (GRN163L) is a 5'-palmitoylated 13-mer thiophosphoramidate oligonucleotide consisting of the sequence 5'-TAGGGTTAGACAA-3'. Mismatch oligonucleotide (MM) is a 5'-palmitoylated 13-mer thiophosphoramidate oligonucleotide consisting of the sequence 5'-TAGGTGTAAGCAA-3'. Both compounds were provided by Janssen Research & Development, LLC (Raritan, NJ, USA). Ruxolitinib ((3R)-3-cyclopentyl-3-[4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)pyrazol-1-yl]propanenitrile) was purchased from Selleck Chemicals LLC (Houston, TX, USA).

[0089] Patient specimens and cell preparation. Single-cell suspensions were prepared from surgically removed spleens of 13 patients with advanced forms of MF requiring therapeutic splenectomy (Table 1). The mutant JAK2, CALR, and MPL genes for each of these patients are shown in Table 1. Umbilical cord blood (CB) collections were provided by the New York Blood Center. CD34 + CD34 cells were isolated using a cell selection kit (StemCell Technologies, Vancouver, BC, Canada). + Cells were selected from mononuclear cells. CD34 with a purity of over 90% analyzed using a FACSCanto flow cytometer. + Cells were used in each experiment. [Table 1] *The JAK2V617F status of each MF patient was determined by analyzing PB granulocytes using a real-time allele-specific polymerase chain reaction (AS-PCR) assay. CALR mutation analysis was performed by sequencing regions of DNA where known CALR mutations have previously been described. MPLW515L / K mutations were detected by AS-PCR. WT: wild type. N / A: not applicable.

[0090] NOD / SCID / IL2R null (NSG) mice transplanted with normal or MF splenic CD34+ cells were directly treated with various drugs, either alone or in combination. These drugs were tolerated by NSG mice and were associated with normal CD34+ cells. + To identify the dose of imetelstat alone that had minimal effect on cell behavior, CB CD34 cells from 8–10 donors were cultured. +Cells were pooled (n=3) and transplanted (5x105 / mouse) into 8-9 week-old sublethally irradiated (240cGy) NSG mice via the tail vein. These mice were then injected intraperitoneally (IP) with 5, 15, or 30mg / kg of imetelstat or MM three times weekly for 4-8 weeks, starting 1 week after transplantation. Two to three months after cessation of imetelstat or MM administration, mice were sacrificed, and cells were harvested from the bone marrow (BM) of the femur, tibia, and humerus. Human (h)CD45 + , CD41a + , and CD34 + The presence of cells was determined by mAb staining and flow cytometry analysis.

[0091] To investigate the effect of imetelstat on MF HSCs, we analyzed MF spleen CD34 + cells (3~5×10 5 These recipients (n = 3 / mouse, n = 3) were shown to achieve a significant degree of human cell chimerism 4 months after their transplantation into NSG mice. CD34+ cells from these spleens were transplanted into NSG mice, and 1 week later, they were treated with imetelstat or MM at a dose of 15 mg / kg for 4 weeks. 3 months after cessation of drug treatment, the presence of cells belonging to various human hematopoietic cell lineages in the BM of recipient mice was quantified. In addition, hCD45+ cells in the BM of recipient mice were also quantified. + Cells were selected using a FACSAria cell sorter. Splenic CD34 cells from a patient with a granulocyte JAK2V617F allele burden of 85.1% were selected. + Receive mouse-derived selected hCD45 cells + The percentage of total JAK2V617F / JAK2 present in the genomic DNA of cells was determined using quantitative real-time (RT)-polymerase chain reaction (PCR) with allelic discrimination. + Human engraftment was considered to have occurred in NSG mice if the cells were present at 0.1% or greater of nucleated cells in the mouse BM.

[0092] In vivo studies of Rux and Imetelstat alone and in combination were performed as shown in Figure 1. CB CD34+ cells (n=1) from 12 donors (2.5 x 10 5 / mouse) or MF spleen CD34 from two patients evaluated for the effect of imetelstat monotherapy on MF HSCs + cells (3~5×10 5 Rux (1 / mouse) was transplanted via the tail vein into 8-9 week-old sublethally irradiated (240 cGy) NSG mice. One week after transplantation, transplanted mice were randomized into eight treatment cohorts of 2-3 mice each and treated as follows: Group 1: Rux alone; Group 2: Imetelstat or MM alone; Group 3: Simultaneous Rux and Imetelstat or MM (Rux + Ime); Group 4: Rux followed by Imetelstat or MM (Rux → Ime or MM); Group 5: Vehicle alone. Rux was given once daily by oral gavage at a dose of 45 mg / kg for 1 week, and Imetelstat or MM was given three times a week by IP injection at 10 mg / kg for 4 weeks. Four months after transplantation, mice were sacrificed and analyzed as described above.

[0093] Western blotting. Primary CB and splenic MF CD34 + Cells were lysed. Protein lysates were then analyzed by 4-20% SDS-PAGE as previously described. Rabbit anti-hTERT and the corresponding HRP-conjugated secondary antibody were purchased from Cell Signaling Technology, Inc. (Danvers, MA). Proteins were visualized by enhanced chemiluminescence detection (ECL, Amersham Pharmacia Biotech, Piscataway, NJ).

[0094] Telomerase activity (TA) assay. TA was measured using a quantitative telomerase detection kit. TA was measured in 0.01–0.1 μg of cell lysate by monitoring telomere repeat synthesis in the presence of a telomere-specific sequence oligonucleotide substrate. Newly synthesized DNA was then detected by PCR. Results were reported as the real-time PCR threshold cycle (C) required for detection of SYBR green fluorescence resulting from binding to the resulting PCR product. T ) were plotted as the number of PCR cycles (C). Heat-inactivated telomerase was used as a negative control for cell extracts under each experimental condition. Increased TA resulted in fewer PCR cycles (C T ) and associated with increased double-stranded DNA synthesis (e.g., C T The lower the number, the higher the TA).

[0095] Telomerase Length Analysis. For telomere length analysis, flow fluorescence in situ hybridization (Flow-FISH) was performed using the Telomere PNA Kit / FITC for flow cytometry. Equal numbers of primary MF or normal CB CD34+ cells were resuspended in microcentrifuge tubes in either hybridization solution without or with a FITC-conjugated peptide nucleic acid (PNA) telomere probe. The tubes were placed in a preheated heating block regulated at 82°C for 10 minutes to denature the sample DNA. The tubes were then placed in the dark overnight at room temperature (RT) to allow the probe to hybridize with the TTAGGG telomere repeat. Hybridization was followed by two 10-minute post-hybridization washes using a 40°C wash solution. After the final wash step, cells were stained with CD34 and CD38 mAbs and incubated with the DNA solution for 2–3 hours before flow cytometry analysis. CD34 from each sample was analyzed. + , CD34 + CD38 - , and CD34 + CD38 +The telomere fluorescence intensity (TFI) of the cells was calculated as follows: TFI = mean fluorescence intensity (MFI) of FITC-PNA with probe - MFI of FITC-PNA without probe. The higher the TFI, the longer the telomere.

[0096] MF and normal CD34 with doses of Rux and Imetelstat alone and in combination + Treatment of cells. In vitro testing showed that CB CD34 + Although the number of cells was reduced only to a limited extent after treatment with various doses of Rux (50–500 nM), the absolute number of MF splenic CD34+ cells was reduced in a dose-dependent manner. + A 50% inhibition of cell proliferation and CFU-GM formation was achieved by using 150 nM Rux. Based on these observations and the results from the in vitro study of imetelstat, 50 nM Rux and 1.8 μM imetelstat were selected to determine whether the sequential or simultaneous combination of these two drugs had additive or synergistic effects on MF HSC / HPC. Figure 2 shows a schematic of the in vitro combination study design, and Figure 3 illustrates the drug treatment strategy. Briefly, CB (n=3) or MF (JAK2V617F + , n=3, JAK2V617F - , n = 4) (2.5 × 10 4 / mL)CD34 + Cells were incubated in serum-free growth medium (SFEM, StemCell Technologies) supplemented with 50 ng / ml SCF, 100 ng / ml FLT-3 ligand (FLT-3L), 100 ng / ml TPO, and 50 ng / ml IL-3 (Gemini Bio-Products) in the presence of Rux (50 nM) alone for 3 days, or imetelstat (1.8 μM) alone for 7 days (short-term treatment) or 14 days (long-term treatment). + Cells were exposed to Rux and imetelstat for 3 days and washed. Cells were then exposed again to imetelstat for an additional 4 or 11 days. For sequential combination treatments, CD34 +Cells were incubated in the presence of Rux alone for 3 days, followed by imetelstat alone for 7 or 14 days. For the three imetelstat-containing treatment strategies, cells were administered imetelstat a total of three times. After 3 days of Rux treatment alone and 7 or 14 days of each imetelstat treatment, cells were counted, stained with CD34, lineage cocktail, and CD15 mAb, and analyzed by flow cytometry. Lin generated in the cultures was analyzed. - CD34 + (phenotypically defined HSC / HPC) and CD15 + CD34 - Absolute (bone marrow) cell counts are calculated by dividing the total viable cell count by the CD34 + Lin - and CD15 + CD34 - The percentage of cells was calculated by multiplying the percentage. In addition, parallel cultures were performed in which MM or vehicle alone was added.

[0097] HPC assay. Cell fractions harvested from the above cultures were also analyzed in methylcellulose supplemented with a cytokine cocktail according to the manufacturer's instructions (StemCell Technologies). Colony numbers were counted after 12–14 days of incubation. Individual CFU-GM colonies (20–38 colonies / treatment group / patient) were picked and analyzed for the presence of JAK2V617F using nested allele-specific PCR. The percentage of JAK2V617F+ CFU-GM was then determined.

[0098] Statistical Analysis. Results are reported as mean ± SD. Statistical significance was determined using a two-tailed Student's t-test. All P values ​​were two-sided, and a P value of less than 0.05 was considered significant.

[0099] Results and Discussion Sequential treatment with imetelstat in combination with Rux has additive inhibitory activity on MF HSCs and HPCs. As shown in Figures 4-5, neither Rux alone (50 nM), imetelstat alone (1.8 µM), nor the simultaneous or sequential short-term (Figure 4) or long-term (Figure 5) doses of these drug combinations affected the number of normal phenotypically defined CB HSCs, as well as functionally defined HPC production and normal myeloid cell generation. The effects of these two drugs alone and in combination were evaluated on MF HSCs / HPCs. As shown in Figures 6-7, Rux alone significantly reduced the number of splenic MF CD34 cells. + Rux reduced the number of assayable HPCs (CFU-GM + BFU-E + CFU-GEMM, P = 9.69E-06, Figures 6-7, Panel B) and the number of mature myeloid cells (Figures 6-7, Panel C, P = 0.001) generated in cultures of cells. However, neither short-term imetelstat alone nor short-term simultaneous or sequential drug combination treatment affected the number of phenotypically defined MF HSCs, functionally defined HPC production, and myeloid cell generation in splenic MF CD34 cells using a 50 nM dose of Rux followed by a 1.8 µM dose of imetelstat. + Sequential long-term treatment of cells, in contrast, - CD34 + Such sequential combination treatment resulted in a significant reduction in the number of MF Lin cells, assayable HPCs, and mature myeloid cells (Figure 7). - CD34 + Rux alone suppressed the production of CD15 cells (P = 0.001 vs. Rux alone, P = 0.059 vs. Imetelstat alone, Figure 7, Panel A) and assayable HPCs (P = 0.02 vs. Rux alone, P = 0.05 vs. Imetelstat alone, Figure 7, Panel B) to a greater extent than either drug treatment alone. + CD34 - The number of cells was reduced to a similar extent to those produced in cultures in the presence of Rux alone or imetelstat alone (Figure 6, Panel C; Figure 7, Panel C). - CD34 +Such inhibitory effects on cells and assayable HPCs were not observed in cultures that received long-term co-treatment with the same drug combination (Figure 7). These findings indicate that sequential treatment with Rux followed by imetelstat results in additive inhibitory effects on phenotypically defined MF HSCs and functionally defined MF HPCs, but does not affect their normal counterparts. To determine whether such combined treatment selectively affected mutant MF HPCs, individual CFU-GM colonies generated were selected and genotyped for the presence of JAK2V617F. As shown in Figure 8, SP7 CD34 expression with Rux and imetelstat was significantly increased. + Sequential long-term combination treatment of cells JAK2V617F + This resulted in a reduction in both the percentage (vehicle alone: ​​94.2%, Rux→MM: 88.9%, Rux→Imetelstat: 75%; Figure 8, Panel A) and absolute number (vehicle alone: ​​Rux→MM: 50.3%, Rux→Imetelstat: 22.7%; Figure 8, Panel B) of myeloid precursors, which was even lower than imetelstat alone (vs. vehicle alone: ​​72.4%, Figure 8, Panel B) or concurrent combination treatment (vs. vehicle alone: ​​60.3%, Figure 8, Panel B). + Reductions in absolute numbers of myeloid precursors were also seen in another patient's cells (Pt13, absolute numbers compared to vehicle alone: ​​Rux → MM: 97.5%, Rux → Imetelstat: 44.1%; Figure 8, Panel C). These findings indicate that sequential treatment with Rux followed by Imetelstat can achieve additive inhibitory activity against malignant MF HPCs.

[0100] Sequential combination treatment with imetelstat and Rux has additive inhibitory activity against MF SRC. Combination treatment with imetelstat (10 mg / kg) and Rux (45 mg / kg) inhibited CB or MF CD34 +Direct treatment of cell-transplanted NSG mice with these two drugs was used to assess whether they had an additive effect on normal or MF HSCs. Figure 9, panels A and D, shows the CB CD34 HSCs after treatment with these drugs alone or in combination. + hCD45 present in the bone marrow of transplanted mice + (Figure 9, Panel A) and hCD34 + These treatments significantly reduced hCD45 expression in the bone marrow (Figure 9, Panels B, E) and spleen (Figure 9, Panels C, F) of recipient mice that received normal CB grafts. + Rux and imetelstat did not reduce or only mildly reduced the degree of cell chimerism and hCD34+ cell generation. In contrast, splenic CD34+ cells from Pt5 were significantly reduced with comparable doses of Rux and imetelstat. + Simultaneous and sequential combination treatment of cell-transplanted mice significantly increased hCD45 expression in the bone marrow (Figure 10, Panel B) and spleen (Figure 10, Panel C) compared with treatment with either drug alone. + Sequential combination treatment resulted in a greater reduction in the absolute number of hCD45 cells than simultaneous combination treatment. + This resulted in a reduction in the number of Pt5 CD34 cells (Figure 10, panels B-C). + In the bone marrow of transplanted mice, sequential but not simultaneous combination treatments significantly increased hCD34 expression compared with either drug alone. + A greater reduction in the absolute number of hCD34 cells was observed in the spleens of mice transplanted with grafts from Pt5 (Figure 10, panel E). + hCD34 cells were not detected in the spleens of transplanted mice. + We were unable to assess the effect of these treatments on MF SRCs. Depletion of MF SRCs by sequential combination treatments was also observed in splenic CD34 cells from another patient, Pt10 (Figure 11). +Although this was also achieved in mice receiving Rux followed by imetelstat, treatment with either drug alone had limited inhibitory effects on MF SRCs from this patient. These findings indicate that sequential treatment with Rux followed by imetelstat has at least additive activity in depleting MF long-term HSCs. This same sequential drug scheme did not affect normal HSC function. In addition, as shown in Figures 12A-12B, sequential combination treatment with each drug resulted in a similar reduction in body weight in mice receiving either normal (Figure 12A) or MF splenic CD34+ cells (Figure 12B) compared to mice receiving the same dose (10 mg / kg) of imetelstat alone. Collectively, these observations indicate that sequential treatment with Rux followed by imetelstat represents an effective therapeutic strategy capable of eliminating MF stem cells with an acceptable toxicity profile.

[0101] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those skilled in the art in light of the teachings of the invention that certain changes and modifications can be made therein without departing from the spirit or scope of the appended claims.

[0102] Thus, the foregoing merely illustrates the principles of the invention. It will be understood that those skilled in the art will be able to devise various configurations, not explicitly described or shown herein, which embody the principles of the invention and are within its spirit and scope. Furthermore, all examples and conditional language recited herein are intended primarily to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to further the art, and should be construed as including no limitations to such specifically recited examples and conditions. Furthermore, all statements herein reciting principles, aspects, and embodiments of the invention, as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, such equivalents are intended to include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. Furthermore, nothing disclosed herein is intended to be offered to the public, regardless of whether such disclosure is expressly recited in the claims.

[0103] Accordingly, the scope of the present invention is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of the present invention is embodied by the appended claims. In the claims, 35 U.S.C. §112(f) or 35 U.S.C. §112(6) is expressly defined to be invoked for a feature in a claim only if the precise phrase "means for" or the precise phrase "step for" is recited at the beginning of such feature in the claim; if such precise phrase is not used for a feature in the claim, 35 U.S.C. §112(f) or 35 U.S.C. §112(6) is not invoked. In certain embodiments, for example, the following are provided: (Item 1) A method for treating a subject having a myeloproliferative neoplasm, the method comprising co-administering to the subject a Janus kinase (JAK) inhibitor and a telomerase inhibitor comprising an oligonucleotide and a lipid moiety attached to the 5' and / or 3' end of the oligonucleotide. (Item 2) 2. The method of claim 1, wherein the JAK inhibitor and the telomerase inhibitor are administered simultaneously. (Item 3) 2. The method of claim 1, wherein the JAK inhibitor and the telomerase inhibitor are administered sequentially. (Item 4) 4. The method of claim 3, wherein the telomerase inhibitor is administered after the JAK inhibitor is administered. (Item 5) 4. The method of claim 3, wherein the JAK inhibitor is administered after the telomerase inhibitor. (Item 6) 6. The method of any one of items 3 to 5, wherein the telomerase inhibitor is administered to the subject on the same day that the JAK inhibitor is administered to the subject. (Item 7) 5. The method of claim 3 or 4, wherein the telomerase inhibitor is administered to the subject about 0 to about 13 days after the JAK inhibitor is administered to the subject. (Item 8) The method comprises: administering a dose of a JAK inhibitor or a pharmaceutically acceptable salt thereof and a dose of a telomerase inhibitor or a pharmaceutically acceptable salt thereof on day 1; 4. The method of claim 3, comprising administering the dose of the JAK inhibitor or a pharmaceutically acceptable salt thereof once or twice per day for a period of about 20 to about 27 days after the first day. (Item 9) Item 9. The method of item 8, wherein the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered once per day for a period of about 20 to about 27 days after the first day. (Item 10) 9. The method of claim 8, wherein the dose of the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered twice on day 1. (Item 11) Item 11. The method of item 10, wherein the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered twice per day for a period of about 20 to about 27 days after the first day. (Item 12) 12. The method according to any one of items 8 to 11, wherein the method comprises 21 days. (Item 13) 12. The method according to any one of items 8 to 11, wherein the method comprises 28 days. (Item 14) 14. The method according to any one of items 8 to 13, wherein the method is repeated one or more times. (Item 15) 14. The method according to any one of items 8 to 13, wherein the method is repeated five or more times. (Item 16) The method comprises: administering to the subject a JAK inhibitor, or a pharmaceutically acceptable salt thereof, once or twice per day for a period of about 14 to 21 days; and administering to the subject one or more doses of a telomerase inhibitor or a pharmaceutically acceptable salt thereof during a period of about 1 to about 7 days after the last administered dose of ruxolitinib or a pharmaceutically acceptable salt thereof. (Item 17) 17. The method of claim 16, wherein the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered to the subject once per day. (Item 18) 17. The method of claim 16, wherein the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered to the subject twice per day. (Item 19) 19. The method of any one of items 16 to 18, wherein the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered to the subject for 14 days. (Item 20) 19. The method of any one of items 16 to 18, wherein the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered to the subject for 21 days. (Item 21) 21. The method according to any one of items 16 to 20, wherein the method is repeated one or more times. (Item 22) 21. The method according to any one of items 16 to 20, wherein the method is repeated five or more times. (Item 23) The method comprises: administering a dose of a telomerase inhibitor or a pharmaceutically acceptable salt thereof on day 1; 4. The method of claim 3, comprising administering a dose of the JAK inhibitor or a pharmaceutically acceptable salt thereof once or twice per day for a period of about 20 to about 27 days after the first day. (Item 24) Item 24. The method of item 23, wherein the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered once per day for a period of about 20 to about 27 days after the first day. (Item 25) Item 24. The method of item 23, wherein the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered twice per day for a period of about 20 to about 27 days after the first day. (Item 26) 26. The method according to any one of items 23 to 25, wherein the method comprises 21 days. (Item 27) 26. The method according to any one of items 23 to 25, wherein the method comprises 28 days. (Item 28) 28. The method according to any one of items 23 to 27, wherein the method is repeated one or more times. (Item 29) 28. The method according to any one of items 23 to 27, wherein the method is repeated five or more times. (Item 30) 30. The method of any one of items 1 to 29, wherein the JAK inhibitor is administered to the subject at a dosage of about 5 mg / day to about 600 mg / day. (Item 31) 31. The method of claim 30, wherein the JAK inhibitor is administered to the subject at a dosage of about 10 mg / day to about 400 mg / day. (Item 32) 32. The method of any one of items 1 to 31, wherein the telomerase inhibitor is administered to the subject at a dosage of about 4 mg / kg to 10 mg / kg. (Item 33) 33. The method of claim 32, wherein the telomerase inhibitor is administered to the subject at a dose of about 7.5 mg / kg to about 9.4 mg / kg. (Item 34) 34. The method of claim 33, wherein the telomerase inhibitor is administered to the subject at a dosage of about 9.4 mg / kg. (Item 35) 35. The method of any one of items 32 to 34, wherein the telomerase inhibitor is administered to the subject by intravenous infusion over a period of about 1 hour to about 3 hours. (Item 36) 36. The method of claim 35, wherein the telomerase inhibitor is administered to the subject by intravenous infusion over a period of about 2 hours. (Item 37) 37. The method of any one of items 1 to 36, wherein the JAK inhibitor is administered to the subject once per day. (Item 38) 38. The method of claim 37, wherein the JAK inhibitor is administered to the subject once per day for a period of about 1 day to about 21 days. (Item 39) 39. The method of claim 38, wherein the JAK inhibitor is administered to the subject once per day for a period of about 7 to about 14 days. (Item 40) 8. The method of any one of items 1 to 7, wherein the JAK inhibitor is administered to the subject twice per day. (Item 41) 41. The method of claim 40, wherein the JAK inhibitor is administered to the subject twice per day for a period of about 1 day to about 21 days. (Item 42) 42. The method of claim 41, wherein the JAK inhibitor is administered to the subject twice per day for a period of about 7 to about 14 days. (Item 43) 43. The method of any one of items 1 to 42, wherein the JAK inhibitor is selected from the group consisting of ruxolitinib, fedratinib, momelotinib, pacritinib, or a pharmaceutically acceptable salt thereof. (Item 44) 44. The method of item 43, wherein the JAK inhibitor is ruxolitinib or a pharmaceutically acceptable salt thereof. (Item 45) The ruxolitinib or a pharmaceutically acceptable salt thereof is administered to a subject: The target is approximately 100 x 10 9 5 mg twice daily if the patient has a baseline platelet count less than 1 / L platelets The target is approximately 100 x 10 9 / L platelets ~ approx. 200×10 9 15 mg twice daily if the patient has a baseline platelet count of 1 / L platelets, and The target is approximately 200 × 10 9 45. The method of any one of items 44, wherein the patient has a baseline platelet count of more than 1 / L platelets and the patient is administered at a dose of 20 mg twice per day. (Item 46) 8. The method of any one of items 1 to 7, wherein the telomerase inhibitor is administered to the subject once every three weeks. (Item 47) 8. The method of any one of items 1 to 7, wherein the telomerase inhibitor is administered to the subject once every four weeks. (Item 48) 48. The method of any one of items 1 to 47, wherein the oligonucleotide of the telomerase inhibitor comprises at least one N3'→P5' thiophosphoramidate internucleoside linkage. (Item 49) 49. The method of any one of items 1 to 48, wherein the lipid moiety of the telomerase inhibitor is attached to the 5' and / or 3' end of the oligonucleotide via a linker. (Item 50) 50. The method of claim 49, wherein the linker is a glycerol or aminoglycerol linker. (Item 51) 51. The method of any one of items 1 to 50, wherein the lipid moiety of the telomerase inhibitor is a palmitoyl (C16) moiety. (Item 52) 52. The method according to any one of items 1 to 51, wherein the telomerase inhibitor is imetelstat or a pharmaceutically acceptable salt thereof. (Item 53) 53. The method of claim 52, wherein the telomerase inhibitor is imetelstat sodium. (Item 54) The method comprises: administering ruxolitinib or a pharmaceutically acceptable salt thereof to the subject once or twice per day for a period of 0 to 21 days; administering to the subject one or more doses of imetelstat or a pharmaceutically acceptable salt thereof within 7 days of the last administered dose of ruxolitinib or a pharmaceutically acceptable salt thereof. (Item 55) 55. The method of item 54, wherein ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject once per day. (Item 56) 55. The method of item 54, wherein ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject twice per day. (Item 57) 57. The method of any one of items 54 to 56, wherein imetelstat or a pharmaceutically acceptable salt thereof is administered once every three weeks. (Item 58) 57. The method of any one of items 54 to 56, wherein imetelstat or a pharmaceutically acceptable salt thereof is administered once every four weeks. (Item 59) 59. The method of any one of items 1 to 58, wherein the myeloproliferative neoplasm is selected from myelofibrosis (MF), myelodysplastic syndrome (MDS), essential thrombocythemia (ET), polycythemia vera (PV), chronic myeloid leukemia (CML), chronic neutrophilic leukemia, chronic eosinophilic leukemia, and acute myeloid leukemia (AML). (Item 60) 60. The method of item 59, wherein the myeloproliferative neoplasm is myelofibrosis. (Item 61) Item 61. The method of item 60, wherein the myeloproliferative neoplasm is primary myelofibrosis. (Item 62) 62. The method of any one of items 1 to 61, further comprising diagnosing the subject as having a myeloproliferative neoplasm. (Item 63) 63. The method of claim 62, wherein the method comprises diagnosing the subject as having myelofibrosis. (Item 64) 64. The method of claim 63, wherein the method comprises diagnosing the subject as having primary myelofibrosis. (Item 65) A method for inducing apoptosis of a myeloproliferative tumor cell, the method comprising contacting the cell with a Janus kinase (JAK) inhibitor in an amount sufficient to induce apoptosis, and a telomerase inhibitor comprising an oligonucleotide and a lipid moiety attached to the 5' and / or 3' end of the oligonucleotide. (Item 66) 66. The method of item 65, wherein the myeloproliferative tumor cells are myelofibrotic hematopoietic stem cells (HSCs) or malignant hematopoietic progenitor cells (HPCs). (Item 67) 67. The method of claim 65 or 66, wherein the Janus kinase (JAK) inhibitor and the telomerase inhibitor are contacted with the myeloproliferative tumor cells in vitro. (Item 68) 67. The method of claim 65 or 66, wherein the Janus kinase (JAK) inhibitor and the telomerase inhibitor contact the myeloproliferative tumor cells in the subject, and the method comprises co-administering the Janus kinase (JAK) inhibitor and the telomerase inhibitor to the subject. (Item 69) 69. The method of claim 68, wherein the JAK inhibitor and the telomerase inhibitor are administered simultaneously. (Item 70) 69. The method of claim 68, wherein the JAK inhibitor and the telomerase inhibitor are administered sequentially. (Item 71) 71. The method of claim 70, wherein the telomerase inhibitor is administered after the JAK inhibitor is administered. (Item 72) 71. The method of claim 70, wherein the JAK inhibitor is administered after the telomerase inhibitor. (Item 73) 73. The method of any one of items 70 to 72, wherein the telomerase inhibitor is administered to the subject on the same day that the JAK inhibitor is administered to the subject. (Item 74) 73. The method of any one of items 70 to 72, wherein the telomerase inhibitor is administered to the subject about 0 to about 13 days after the JAK inhibitor is administered to the subject. (Item 75) The method comprises: administering a dose of a JAK inhibitor or a pharmaceutically acceptable salt thereof and a dose of a telomerase inhibitor or a pharmaceutically acceptable salt thereof on day 1; 71. The method of item 70, comprising administering the dose of the JAK inhibitor or a pharmaceutically acceptable salt thereof once or twice per day for a period of about 20 to about 27 days after the first day. (Item 76) Item 76. The method of item 75, wherein the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered once per day for a period of about 20 to about 27 days after the first day. (Item 77) 76. The method of item 75, wherein the dosage of the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered twice on day 1. (Item 78) Item 78. The method of item 77, wherein the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered twice per day for a period of about 20 to about 27 days after the first day. (Item 79) 79. The method according to any one of items 75 to 78, wherein the method comprises 21 days. (Item 80) 79. The method according to any one of items 75 to 78, wherein the method comprises 28 days. (Item 81) 81. The method according to any one of items 75 to 80, wherein the method is repeated one or more times. (Item 82) 81. The method according to any one of items 75 to 80, wherein the method is repeated five or more times. (Item 83) The method comprises: administering to the subject a JAK inhibitor, or a pharmaceutically acceptable salt thereof, once or twice per day for a period of about 14 to 21 days; 71. The method of item 70, comprising administering to the subject one or more doses of a telomerase inhibitor or a pharmaceutically acceptable salt thereof within a period of about 1 to about 7 days after the last administered dose of ruxolitinib or a pharmaceutically acceptable salt thereof. (Item 84) 84. The method of item 83, wherein the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered to the subject once per day. (Item 85) 84. The method of item 83, wherein the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered to the subject twice per day. (Item 86) 86. The method of any one of items 83 to 85, wherein the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered to the subject for 14 days. (Item 87) 86. The method of any one of items 83 to 85, wherein the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered to the subject for 21 days. (Item 88) 88. The method according to any one of items 83 to 87, wherein the method is repeated one or more times. (Item 89) 88. The method according to any one of items 83 to 87, wherein the method is repeated five or more times. (Item 90) The method comprises: administering a dose of a telomerase inhibitor or a pharmaceutically acceptable salt thereof on day 1; 71. The method of item 70, comprising administering a dose of the JAK inhibitor or a pharmaceutically acceptable salt thereof once or twice per day for a period of about 20 to about 27 days after the first day. (Item 91) Item 91. The method of item 90, wherein the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered once per day for a period of about 20 to about 27 days after the first day. (Item 92) Item 91. The method of item 90, wherein the JAK inhibitor or a pharmaceutically acceptable salt thereof is administered twice per day for a period of about 20 to about 27 days after the first day. (Item 93) 93. The method according to any one of items 90 to 92, wherein the method comprises 21 days. (Item 94) 93. The method according to any one of items 90 to 92, wherein the method comprises 28 days. (Item 95) 95. The method according to any one of items 90 to 94, wherein the method is repeated one or more times. (Item 96) 95. The method according to any one of items 90 to 94, wherein the method is repeated five or more times. (Item 97) 97. The method of any one of items 65 to 96, wherein the JAK inhibitor is administered to the subject at a dosage of about 5 mg / day to about 600 mg / day. (Item 98) Item 98. The method of item 97, wherein the JAK inhibitor is administered to the subject at a dosage of about 10 mg / day to about 400 mg / day. (Item 99) 97. The method of any one of items 65 to 96, wherein the telomerase inhibitor is administered to the subject at a dosage of about 4 mg / kg to 15 mg / kg. (Item 100) Item 99. The method of item 99, wherein the telomerase inhibitor is administered to the subject at a dosage of about 7.5 mg / kg to about 9.4 mg / kg. (Item 101) 101. The method of claim 100, wherein the telomerase inhibitor is administered to the subject at a dosage of about 9.4 mg / kg. (Item 102) 102. The method of any one of items 99-101, wherein the telomerase inhibitor is administered to the subject by intravenous infusion over a period of about 1 hour to about 3 hours. (Item 103) 103. The method of claim 102, wherein the telomerase inhibitor is administered to the subject by intravenous infusion over a period of about 2 hours. (Item 104) 75. The method of any one of items 65 to 74, wherein the JAK inhibitor is administered to the subject once per day. (Item 105) Item 105. The method of item 104, wherein the JAK inhibitor is administered to the subject once per day for a period of about 1 day to about 21 days. (Item 106) Item 106. The method of item 105, wherein the JAK inhibitor is administered to the subject once per day for a period of about 7 to about 14 days. (Item 107) 75. The method of any one of items 65 to 74, wherein the JAK inhibitor is administered to the subject twice per day. (Item 108) 108. The method of claim 107, wherein the JAK inhibitor is administered to the subject twice per day for a period of about 1 day to about 21 days. (Item 109) 109. The method of claim 108, wherein the JAK inhibitor is administered to the subject twice per day for a period of about 7 to about 14 days. (Item 110) The ruxolitinib is administered to a subject: The target is approximately 100 x 10 9 5 mg twice daily if the patient has a baseline platelet count less than 1 / L platelets The target is approximately 100 x 10 9 / L platelets ~ approx. 200×10 9 15 mg twice daily if the patient has a baseline platelet count of 1 / L platelets, and The target is approximately 200 × 10 9 75. The method of any one of items 65-74, wherein the patient has a baseline platelet count of more than 100 mg / L platelets, and the patient is administered at a dose of 20 mg twice per day. (Item 111) 75. The method of any one of items 65 to 74, wherein the telomerase inhibitor is administered to the subject once every three weeks. (Item 112) 75. The method of any one of items 65 to 74, wherein the telomerase inhibitor is administered to the subject once every four weeks. (Item 113) 113. The method of any one of items 65 to 112, wherein the oligonucleotide of the telomerase inhibitor comprises at least one N3'→P5' thiophosphoramidate internucleoside linkage. (Item 114) 114. The method of any one of items 65 to 113, wherein the lipid moiety of the telomerase inhibitor is attached to the 5' and / or 3' end of the oligonucleotide via a linker. (Item 115) 115. The method of claim 114, wherein the linker is a glycerol or aminoglycerol linker. (Item 116) 116. The method of any one of items 65 to 115, wherein the lipid moiety of the telomerase inhibitor is a palmitoyl (C16) moiety. (Item 117) 117. The method of any one of items 65 to 116, wherein the telomerase inhibitor is imetelstat or a pharmaceutically acceptable salt thereof. (Item 118) Item 118. The method of item 117, wherein the telomerase inhibitor is imetelstat sodium. (Item 119) The method comprises: administering ruxolitinib or a pharmaceutically acceptable salt thereof to the subject once or twice per day for a period of 0 to 21 days; Administering imetelstat or a pharmaceutically acceptable salt thereof to the subject within 7 days of the last administered dose of ruxolitinib or a pharmaceutically acceptable salt thereof. (Item 120) 120. The method of claim 119, wherein ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject once per day. (Item 121) 120. The method of claim 119, wherein ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject twice per day. (Item 122) 122. The method of any one of items 119 to 121, wherein imetelstat or a pharmaceutically acceptable salt thereof is administered once every three weeks. (Item 123) 122. The method of any one of items 119 to 121, wherein imetelstat or a pharmaceutically acceptable salt thereof is administered once every four weeks. (Item 124) 124. A composition for use in the method according to any one of items 1 to 123, wherein the composition comprises a JAK inhibitor and a telomerase inhibitor. (Item 125) 125. The composition of claim 124, wherein the JAK inhibitor is ruxolitinib or a pharmaceutically acceptable salt thereof. (Item 126) 126. The composition of claim 124 or 125, wherein the telomerase inhibitor is imetelstat or a pharmaceutically acceptable salt thereof. (Item 127) 127. The composition of claim 126, wherein the telomerase inhibitor is imetelstat sodium.

Claims

1. A combination for use in a method for treating a subject having a myeloproliferative neoplasm, said combination comprising ruxolitinib or a pharmaceutically acceptable salt thereof, and imetelstat or a pharmaceutically acceptable salt thereof, said method comprising co-administering said ruxolitinib or a pharmaceutically acceptable salt thereof and said imetelstat or a pharmaceutically acceptable salt thereof to a subject.

2. A combination for use in a method for inducing apoptosis of a myeloproliferative tumor cell, said combination comprising ruxolitinib or a pharmaceutically acceptable salt thereof, and imetelstat or a pharmaceutically acceptable salt thereof, said method comprising contacting said cell with said ruxolitinib or a pharmaceutically acceptable salt thereof and said imetelstat or a pharmaceutically acceptable salt thereof in amounts sufficient to induce apoptosis.

3. The combination of claim 2, wherein the myeloproliferative tumor cells are myelofibrotic hematopoietic stem cells (HSCs) or malignant hematopoietic progenitor cells (HPCs).

4. The combination according to claim 2 or 3, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof and the imetelstat or a pharmaceutically acceptable salt thereof are contacted with the myeloproliferative tumor cells in vitro.

5. 4. The combination of claim 2 or 3, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof and imetelstat or a pharmaceutically acceptable salt thereof are contacted with the myeloproliferative tumor cells in the subject, and the method comprises co-administering the ruxolitinib or a pharmaceutically acceptable salt thereof and the imetelstat or a pharmaceutically acceptable salt thereof to the subject.

6. The combination according to claim 1 or 5, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof and the imetelstat or a pharmaceutically acceptable salt thereof are administered simultaneously.

7. The combination according to claim 1 or 5, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof and the imetelstat or a pharmaceutically acceptable salt thereof are administered sequentially.

8. The combination according to claim 7, wherein the imetelstat or a pharmaceutically acceptable salt thereof is administered after the ruxolitinib or a pharmaceutically acceptable salt thereof is administered.

9. The combination according to claim 7, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof is administered after the imetelstat or a pharmaceutically acceptable salt thereof.

10. The combination according to any one of claims 7 to 9, wherein the imetelstat or a pharmaceutically acceptable salt thereof is administered to the subject on the same day that the ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject.

11. The combination according to claim 7 or 8, wherein the imetelstat or a pharmaceutically acceptable salt thereof is administered to the subject about 0 to about 13 days after the ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject.

12. The method comprises: administering a dose of ruxolitinib or a pharmaceutically acceptable salt thereof and a dose of imetelstat or a pharmaceutically acceptable salt thereof on day 1; and administering the dose of ruxolitinib or a pharmaceutically acceptable salt thereof once or twice per day for a period of about 20 to about 27 days after said first day.

13. 13. The combination of claim 12, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof is administered once per day for a period of about 20 to about 27 days after said first day.

14. 13. The combination of claim 12, wherein the dose of ruxolitinib or a pharmaceutically acceptable salt thereof is administered twice on day 1.

15. 15. The combination of claim 14, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof is administered twice per day for a period of about 20 to about 27 days after said first day.

16. Combination according to any one of claims 12 to 15, characterized in that the method comprises 21 days.

17. Combination according to any one of claims 12 to 15, characterized in that the method comprises 28 days.

18. A combination according to any one of claims 12 to 17, characterized in that the method is repeated one or more times.

19. A combination according to any one of claims 12 to 17, characterized in that the method is repeated five or more times.

20. The method comprises: administering ruxolitinib or a pharmaceutically acceptable salt thereof to the subject once or twice per day for a period of about 14 to 21 days; and administering to the subject one or more doses of imetelstat or a pharmaceutically acceptable salt thereof during a period of about 1 day to about 7 days after the last administered dose of ruxolitinib or a pharmaceutically acceptable salt thereof.

21. 21. The combination according to claim 20, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject once per day.

22. 21. The combination according to claim 20, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject twice per day.

23. The combination according to any one of claims 20 to 22, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject for 14 days.

24. The combination according to any one of claims 20 to 22, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject for 21 days.

25. A combination according to any one of claims 20 to 24, characterized in that the method is repeated one or more times.

26. A combination according to any one of claims 20 to 24, characterized in that the method is repeated five or more times.

27. The method comprises: administering a dose of imetelstat or a pharmaceutically acceptable salt thereof on day 1; and administering a dose of ruxolitinib or a pharmaceutically acceptable salt thereof once or twice per day for a period of about 20 to about 27 days after said first day.

28. 28. The combination of claim 27, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof is administered once per day for a period of about 20 to about 27 days after said first day.

29. 28. The combination of claim 27, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof is administered twice per day for a period of about 20 to about 27 days after said first day.

30. Combination according to any one of claims 27 to 29, characterized in that the method comprises 21 days.

31. Combination according to any one of claims 27 to 29, characterized in that the method comprises 28 days.

32. A combination according to any one of claims 27 to 31, characterized in that the method is repeated one or more times.

33. A combination according to any one of claims 27 to 31, characterized in that the method is repeated five or more times.

34. The combination according to any one of claims 1 to 33, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject at a dosage of about 5 mg / day to about 600 mg / day.

35. 35. The combination according to claim 34, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject at a dosage of about 10 mg / day to about 400 mg / day.

36. The combination according to any one of claims 1 to 35, wherein the imetelstat or a pharmaceutically acceptable salt thereof is administered to the subject at a dosage of about 4 mg / kg to 10 mg / kg.

37. 37. The combination of claim 36, wherein the imetelstat or a pharmaceutically acceptable salt thereof is administered to the subject at a dosage of about 7.5 mg / kg to about 9.4 mg / kg.

38. 38. The combination of claim 37, wherein the imetelstat or a pharmaceutically acceptable salt thereof is administered to the subject at a dosage of about 9.4 mg / kg.

39. The combination according to any one of claims 36 to 38, wherein the imetelstat or a pharmaceutically acceptable salt thereof is administered to the subject by intravenous infusion over a period of about 1 hour to about 3 hours.

40. 40. The combination of claim 39, wherein the imetelstat or a pharmaceutically acceptable salt thereof is administered to the subject by intravenous infusion over a period of about 2 hours.

41. The combination according to any one of claims 1 to 40, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject once per day.

42. 42. The combination of claim 41, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject once per day for a period of about 1 day to about 21 days.

43. 43. The combination of claim 42, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject once per day for a period of about 7 to about 14 days.

44. The combination according to any one of claims 1, 5 to 20, 22 to 27 and 29 to 40, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject twice per day.

45. 45. The combination of claim 44, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject twice per day for a period of about 1 day to about 21 days.

46. 46. ​​The combination of claim 45, wherein the ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject twice per day for a period of about 7 days to about 14 days.

47. The ruxolitinib or a pharmaceutically acceptable salt thereof is administered to a subject: The object is about 100×10 9 5 mg twice daily if the patient has a baseline platelet count less than 1 / L platelets The object is about 100×10 9 / L platelets ~ approx. 200 x 10 9 15 mg twice daily if the patient has a baseline platelet count of 1 / L platelets, and The target is about 200×10 9 47. The combination according to any one of claims 2 to 5 and 46, characterized in that it is administered at a dose of 20 mg twice per day when the patient has a baseline platelet count above 1 / L platelets.

48. The combination according to any one of claims 1 to 11, wherein the imetelstat or a pharmaceutically acceptable salt thereof is administered to the subject once every three weeks.

49. The combination according to any one of claims 1 to 11, wherein the imetelstat or a pharmaceutically acceptable salt thereof is administered to the subject once every four weeks.

50. The method comprises: administering ruxolitinib or a pharmaceutically acceptable salt thereof to the subject once or twice per day for a period of 0 to 21 days; 6. The combination of claim 1 or 5, comprising administering to the subject one or more doses of imetelstat or a pharmaceutically acceptable salt thereof within 7 days of the last administered dose of ruxolitinib or a pharmaceutically acceptable salt thereof.

51. 51. The combination described in claim 50, wherein ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject once per day.

52. 51. The combination described in claim 50, wherein ruxolitinib or a pharmaceutically acceptable salt thereof is administered to the subject twice per day.

53. 53. The combination according to any one of claims 50 to 52, wherein imetelstat or a pharmaceutically acceptable salt thereof is administered once every three weeks.

54. 53. The combination according to any one of claims 50 to 52, wherein imetelstat or a pharmaceutically acceptable salt thereof is administered once every four weeks.

55. 55. The combination of any one of claims 1 and 6 to 54, wherein the myeloproliferative neoplasm is selected from myelofibrosis (MF), myelodysplastic syndrome (MDS), essential thrombocythemia (ET), polycythemia vera (PV), chronic myeloid leukemia (CML), chronic neutrophilic leukemia, chronic eosinophilic leukemia, and acute myeloid leukemia (AML).

56. 56. The combination of claim 55, wherein the myeloproliferative neoplasm is myelofibrosis.

57. 57. The combination of claim 56, wherein the myeloproliferative neoplasm is primary myelofibrosis.

58. 58. The combination of any one of claims 1 and 6 to 57, wherein the method further comprises diagnosing the subject as having a myeloproliferative neoplasm.

59. 59. The combination of claim 58, wherein the method comprises diagnosing the subject as having myelofibrosis.

60. 60. The combination of claim 59, wherein the method comprises diagnosing the subject as having primary myelofibrosis.

61. 1. A composition for use in a method for treating a subject having a myeloproliferative neoplasm, the composition comprising ruxolitinib or a pharmaceutically acceptable salt thereof, the method comprising co-administering the composition and imetelstat or a pharmaceutically acceptable salt thereof to the subject.

62. 1. A composition for use in a method of treating a subject having a myeloproliferative neoplasm, the composition comprising imetelstat or a pharmaceutically acceptable salt thereof, the method comprising co-administering the composition and ruxolitinib or a pharmaceutically acceptable salt thereof to the subject.

63. 1. A composition for use in a method for inducing apoptosis of a myeloproliferative neoplastic cell, the composition comprising ruxolitinib or a pharmaceutically acceptable salt thereof, the method comprising contacting the cell with ruxolitinib or a pharmaceutically acceptable salt thereof and imetelstat or a pharmaceutically acceptable salt thereof in amounts sufficient to induce apoptosis.

64. 1. A composition for use in a method of inducing apoptosis of a myeloproliferative tumor cell, said composition comprising imetelstat or a pharmaceutically acceptable salt thereof, said method comprising contacting said cell with ruxolitinib or a pharmaceutically acceptable salt thereof and said imetelstat or a pharmaceutically acceptable salt thereof in an amount sufficient to induce apoptosis.