Creation of a diverse virus library

Abstract

The present invention relates to a process for producing a library of viruses, comprising a first and a second culture step, each of which aims to promote intra- and inter-species recombination between double-stranded DNA viruses belonging to the same virus family.

Description

[Technical Field]

[0001] The present invention relates to a process for producing a library of viruses, comprising a first and a second culture step, each of which aims to promote intra- and inter-species recombination between double-stranded DNA viruses belonging to the same virus family. [Background technology]

[0002] Viruses have great potential for a wide range of applications, including oncolytic viruses, vaccines, antiviral drugs, and gene therapy vectors. To date, the majority of methods for engineering viruses with desired properties rely on a progressive understanding of the details of a particular viral genome. Modifications to the viral genome sequence are then engineered to introduce desired properties into the genome, making the virus suitable for a particular application.

[0003] Novel approaches are needed to accelerate the process of generating viruses with diverse properties, providing highly diverse libraries from which optimal viruses with the most desirable properties for a particular application can be selected.

[0004] As an example, diverse virus libraries are used to develop new oncolytic vectors. The development of cancer treatments poses a significant ongoing challenge due to the ability of tumors to acquire resistance to treatment. Current treatments, including chemotherapy and radiotherapy, often have toxic side effects and limited effectiveness. To overcome these problems, oncolytic viruses are used as a new approach. Natural oncolytic viruses or genetically modified oncolytic viruses have the ability to selectively replicate in tumors, infect cancer cells, kill cancer cells by cytolysis without affecting normal cells, and induce anti-tumor immune responses by releasing tumor antigens. To ensure that oncolytic viruses do not replicate in normal cells, non-pathogenic strains are selected or the viral genome is genetically engineered by either gene insertion or deletion. Examples of engineered oncolytic viruses include Oncorin (H101), an adenovirus with a deletion in E1B55k that has been approved for use in head and neck cancer in China, and T-Vec, a herpesvirus with deletions in the γ34.5 and α47 genes that has been approved by the FDA for use in melanoma. However, engineered oncolytic viruses to date have had limited success in the clinical setting.

[0005] There are over 60 wild-type human adenovirus (Ad) serotypes, but Ad5 and its variants are the predominant Ad types used as oncolytic adenoviruses. The vast majority of other serotypes have not been explored for use as oncolytic viruses.

[0006] One approach to creating additional oncolytic viruses is to create new oncolytic virus serotypes by biological selection or "directed evolution" using virus pools. This involves mimicking natural viral selection by pooling different virus serotypes and / or randomly introducing mutations (see, for example, Bauzon and Hermiston, "Oncolytic viruses: The Power of Directed Evolution"; Advances in Virology, Vol. 2012, citation ID 586389). Kuhn et al. demonstrated the use of directed evolution to generate novel non-Ad5 oncolytic viruses for the treatment of colon cancer ("Directed Evolution generates a novel oncolytic virus for the treatment of colon cancer"; PloS One 3(6):e2409 (2008); and International Publication No. WO 2008 / 080003) and ovarian cancer ("OvAd1, a Novel, Potent, and Selective Chimeric Oncolytic Virus Developed for Ovarian Cancer by 3D-Directed Evolution" Mol. Ther. Oncolytics; 4:55-66). Kuhn and Hermiston et al. pooled different Ad subgroups (Ad3, Ad4, Ad5, Ad9, Ad11p, Ad16, Ad35, and Ad40) in the presence or absence of the chimeric virus ColoAd1. Random mutations were introduced into a subsample of the virus pool, which was then added to the unmutated pool of virus particles. The pooled virus pool was passaged in human tumor cell lines to induce recombination to increase diversity, resulting in the creation of the ColoAd1 (Ad3 / Ad11p) and OvAd1 (Ad3 / ColoAd1) chimeric oncolytic viruses, which have increased efficacy and a broader therapeutic window compared to Ad5. The genome of ColoAd1 was modified as a result of a "directed evolution" approach.The modifications included deletions in the E3 and E4 regions, changes in the E2B region, and deletions located in the E4 or f4 regions of the virus.The increased efficacy associated with chimeric viruses can be explained by changes in the viral genome.Another example described in WO2008 / 080003 describes a method of using nitrous acid to introduce point mutations to obtain approximately 10 mutations per viral genome, followed by recombination of the virus pool.

[0007] There remains a need for improved methods to increase the diversity of viral pools to provide a starting point for screening / biological selection of improved cell-specific oncolytic viruses.

[0008] In Kuhn et al. (2008, supra), three Ad group B serotypes and one Ad group C, D, E, and F serotype were pooled together and passaged in culture on a target tumor cell line under conditions known to induce interserotype recombination. The result was a composite Ad3 / Ad11p chimeric virus, ColoAd1. Both Ad3 and Ad11p are Ad group B serotypes; therefore, recombination in ColoAd1 occurred as a result of intragroup (AdB) recombination; viruses from Ad groups C, D, E, and F were not involved.

[0009] A subsequent publication by Kuhn et al. (Molecular Therapy: Oncolytics, Vol. 4, March 2017, pp. 55-66) produced an additional chimeric Ad virus, OvAd1, which was the result of recombination between Ad3, Ad11, and ColoAd1, all of which were AdB serotypes or chimeras. Summary of the Invention

[0010] However, the inventors now recognize that different adenovirus species grow at different rates in different cell lines, and different cell lines have different propensities for viral recombination, so it may not be possible to promote optimal recombination diversity in a mixed set of adenovirus species in a single step using a single cell line.

[0011] Furthermore, viruses from different species are unlikely to initiate recombination events with each other and therefore unlikely to participate in any way in diversification. However, co-cultivation of multiple serotypes from any given viral species can lead to recombination between serotypes, which may create enough novel regions of homology to allow recombination between species.

[0012] Thus, to maximize the diversity of the library, the process of the present invention provides at least two serotypes of viruses from a first species that are cultured together in one or more suitable cell lines to promote intraspecies recombination, and then simply culture the (recombined) virus from the first species with another virus from a second (different) species to promote different intraspecies recombination events and interspecies recombination. It is particularly advantageous if the at least two viral serotypes from the second species are or have previously been cultured together to promote intraspecies recombination within the second species. During or after this process, the resulting recombinant viruses may be subjected to further diversification (e.g., mutagenesis) processes.

[0013] Thus, the present invention describes a novel approach to maximizing the diversity of viral libraries.

[0014] Diversity in viral genomes will enable the development of new viruses with novel properties that can be used for applications such as highly potent selective oncolytic viruses, vaccines, antiviral therapeutics, and gene therapy vectors.

[0015] In a first aspect, a process for producing a library of viruses is provided, the process comprising: (a) a first culturing step comprising co-culturing in one or more cell lines at least two different serotypes of viruses from a first species of double-stranded DNA virus; (b) (i) the virus obtained in step (a), (ii) combining with at least two different serotypes of viruses of the same species, each from one or more additional species of double-stranded DNA virus; wherein the first species of double-stranded DNA virus and each of the further species of double-stranded DNA virus are all different species within the same family or genus of double-stranded DNA viruses; Additionally, if desired, to produce a library of viruses, (c) a second culturing step in which the viruses combined in step (b) are co-cultured in one or more cell lines; (d) combining and / or isolating a plurality of viruses therefrom the viruses or portions thereof obtained after step (c).

[0016] In some embodiments, in step (b)(ii), for each of the one or more additional species of double-stranded DNA virus, the different serotypes of viruses from that species have previously been cultured together and the different species of viruses have previously been cultured independently.

[0017] In some preferred embodiments, the process of the present invention comprises: (a)(i) co-culturing in one or more cell lines at least two different serotypes of viruses from a first species of double-stranded DNA virus; (ii) culturing in one or more cell lines at least two different serotypes of viruses from each of one or more additional species of double-stranded DNA virus of the same species, a first culturing step, for each species of double-stranded DNA virus, in which viruses of different serotypes of the same species are cultured together and viruses of different species are cultured independently; and (b)(i) the virus derived from step (a)(i); and (ii) the virus derived from step (a)(ii), It is a process that includes the steps:

[0018] In some embodiments, step (b) further comprises: (iii) a first species of the double-stranded DNA virus; (iv) one or more wild-type viruses that are in the same family, genus, or species as the first species of double-stranded DNA virus; (v) one or more of the additional species of double-stranded DNA viruses; and / or (vi) one or more wild-type viruses that are in the same family, genus, or species as one of the additional species of double-stranded DNA virus; and combining it with a virus derived from

[0019] In some embodiments, step (d) further comprises subjecting the virus or portion thereof obtained after step (c) to: (i) a first species of said double-stranded DNA virus; (ii) one or more of the additional species of double-stranded DNA viruses; (iii) one or more viruses obtained after culturing step (a); (iv) one or more wild-type viruses from the same family, genus, or species as one of the first species of double-stranded DNA viruses; and / or (v) one or more wild-type viruses from the same family, genus, or species as one of the additional species of double-stranded DNA virus; This includes doing things together.

[0020] In some embodiments, the virus is subjected to mutagenesis before, during, or after one or more of steps (a), (b), and / or (c).

[0021] Preferably, said double-stranded DNA virus is an adenovirus (ie, from the Adenoviridae family).

[0022] The present invention relates to a process for producing a library of viruses, e.g., a mixture of wild-type and chimeric viruses, the process comprising steps (a) and (b), and optionally steps (c) and (d), as defined herein.

[0023] The process of the present invention uses a double-stranded DNA virus. Preferably, the double-stranded DNA virus is one selected from the group consisting of Adenoviridae, Asfarviridae, Polyomaviridae, Herpesviridae, Poxviridae, and Papillomaviridae. More preferably, the double-stranded DNA virus is selected from Adenoviridae, Herpesviridae, and Poxviridae. Most preferably, the virus is derived from the Adenoviridae family.

[0024] The first double-stranded DNA virus and the additional double-stranded DNA virus are all from the same family or genus. In some embodiments, the first double-stranded DNA virus and the additional double-stranded DNA virus are all from the same genus within the same family. In other embodiments, the first double-stranded DNA virus and the additional double-stranded DNA virus are from one or more different genera within the same family.

[0025] As used herein, "adenovirus" (also abbreviated as "Ad" herein) refers to a virus belonging to the family Adenoviridae, and is included in any one of the five currently known genera: Mastadenovirus, Aviadenovirus, Atadenovirus, Siadenovirus, and Ictoadenovirus. Preferably, the adenovirus is derived from the Mastadenovirus genus. This genus includes all human serotypes. In one embodiment, the adenovirus is a human adenovirus.

[0026] Currently, over 60 antigenic types, or "serotypes," of human adenoviruses have been described, and these serotypes are classified into seven species, Ad species A to G, based on their physical, chemical, and biological properties (see, e.g., Wold et al., Current gene therapy 13:6 (2013):421-33).

[0027] Therefore, the adenovirus species in this specification refers not only to the currently known Ad species A to G, but also to those that will be identified in the future.

[0028] Thus, in one embodiment, the adenovirus species is a human adenovirus species selected from the group consisting of AdA, AdB, AdC, AdD, AdE, AdF, and AdG. In some embodiments, the human adenovirus species is selected from the group consisting of AdB, AdC, AdD, AdE, AdF, and AdG.

[0029] The serotypes included within each of these adenovirus species are as follows: AdA includes Ad12, Ad18, and Ad31; AdB includes Ad3, Ad7, Ad11, Ad14, Ad16, Ad21, Ad34, Ad35, Ad50, and Ad55; AdC includes Ad1, Ad2, AD5, Ad6, and Ad57.

[0030] AdD includes Ad8, Ad9, Ad10, Ad13, Ad15, Ad17, Ad19, Ad20, Ad22, Ad23, Ad24, Ad25, Ad26, Ad27, Ad28, Ad29, Ad30, Ad32, Ad33, Ad36, Ad37, Ad38, Ad39, Ad42, Ad43, Ad44, Ad45, Ad46, Ad47, Ad48, Ad49, Ad51, Ad53, Ad54, and Ad56. AdE includes Ad4. AdF includes Ad40 and Ad41. AdG includes Ad52. Reference herein to different Ad serotypes includes all different strains or variants of those serotypes.

[0031] In another embodiment, the double-stranded DNA virus is from the Herpesviridae or Poxviridae family. Preferably, the Herpesviridae family is the Alphaherpesvirinae, Betaherpesvirinae, or Gammaherpesvirinae subfamily. Preferably, the Herpesvirinae family is from the Alphaherpesvirinae subfamily. Preferably, the Alphaherpesvirinae subfamily is the Irtovirus, Mardivirus, Simplexvirus, Scutavirus, or Varicellovirus genera.

[0032] Preferably, the herpesvirus is from the genus Herpes Simplex. There are two main species of herpes simplex virus: herpes simplex virus type 1 (HSV-1) and herpes simplex virus type 2 (HSV-2). Different types of herpesvirus are generally referred to in the art as "strains" rather than "serotypes." However, in the context of the present invention, when applied to herpesviruses, the terms "serotype" and "serotypes" will be understood to encompass "strain" and "strains," respectively.

[0033] For the purposes of the present invention, HSV strains are considered to be different strains if their viral genomes differ by more than 0.5% (see Overview of classification by Davison AJ, in Chapter 1 of Arvin A, Campadelli-Fiume G, Mocarski E et al., eds. Human Herpesviruses: Biology, Therapy, and Immunoprophylaxis. Cambridge: Cambridge University Press; 2007).

[0034] Herpesvirus strains include, but are not limited to, HF10, F, E06, H129, 17, KOS, KOS63, KOS79, and JS-1.

[0035] Preferably, the Poxviridae family is selected from one of the following subfamilies or genera: Chordopoxvirinae, Avipoxvirus, Capripoxvirus, Centapoxvirus, Cerbidopoxvirus, Crocodiiridopoxvirus, Leporipoxvirus, Macropopoxvirus, Molluscipoxvirus, Musterupoxvirus, Orthopoxvirus, Oryzopoxvirus, Parapoxvirus, Pteropopoxvirus, Salmonpoxvirus, Schiuripoxvirus, Suipoxvirus, Vespertilionpoxvirus, Yatapoxvirus, Entomopoxvirinae, Alphaentomopoxvirus, Betaentomopoxvirus, and Gammaentomopoxvirus.

[0036] More preferably, the Poxviridae family is from the genus Orthopoxvirus, preferably from the species Avatinomacacapoxvirus, Afmetavirvirus, Camelpoxvirus, Cowpoxvirus, Ectromeliavirus, Monkeypoxvirus, Raccoonpoxvirus, Skunkpoxvirus, Taterapoxvirus, Vacciniavirus, Variolavirus, or Borepoxvirus, more preferably from Vacciniavirus.

[0037] Different types of vaccinia virus are generally referred to in the art as "strains" rather than "serotypes." However, in the context of the present invention, the terms "serotype" and "serotypes," as applied to vaccinia virus, will be understood to encompass "strain" and "strains," respectively. For purposes of the present invention, vaccinia strains are considered to be different strains if the viral genome differs by more than 0.5%.

[0038] Vaccinia virus strains include, but are not limited to, Lister, Modified Vaccinia Ankara, Western Reserve, Dryvac ("Wyeth"), Copenhagen, LC16m8, CV-1, and Tiantang (see Sanchez-Sampedro L, Perdiguero B, Mejias-Perez E, Garcia-Arriaza J, Di Pilato M, Esteban M. The evolution of poxvirus vaccines. Viruses. 2015;7(4):1726-1803. Published 2015 Apr 7. doi:10.3390 / v7041726).

[0039] The first culturing step involves co-culturing at least two different serotypes of viruses derived from a first species of double-stranded DNA virus. In this first culturing step, all serotypes co-cultivated are derived from the same virus species. The purpose of this step is to promote inter-serotype recombination between viruses of the same species.

[0040] In a first culture step, viruses from different species are cultured independently, for example in different / separate culture vessels.

[0041] The number of serotypes from each species cultured together may be two, three, four, five, six, seven, eight, nine, ten or more, preferably at least three, at least four or at least five serotypes.

[0042] In one embodiment, the at least two serotypes are present in approximately equal proportions in the sample (i.e., equal numbers of infectious particles or genome copies), which may be such that the serotypes are equally represented within a subset of viruses used as starting material for propagation in a cell line.

[0043] Viruses from each different species are cultured independently in one or more appropriate cell lines that allow for the growth and replication (preferably optimal growth and / or replication) of that species of virus. In some embodiments, each virus species is grown independently (i.e., individually) in a single cell line. In other embodiments, each virus species is grown independently (i.e., individually) in multiple cell lines. In some embodiments, the multiple cell lines are grown together (e.g., in the same culture vessel). In other embodiments, the multiple cell lines are grown independently (e.g., in different culture vessels).

[0044] At the end of the first culture step, the viruses cultured in one cell line or in several cell lines may be combined (pooled), in either case viruses from different species being cultured separately.

[0045] Suitable cell lines for propagating viruses include immortalized cell lines, such as cell lines isolated from spontaneous cancers. In one embodiment, preferred cell lines are cancer cell lines. Suitable cancer cell lines include A549, HT29, HEK293, HCT116, MM1S, SKOV3, MMR, JJN3, RPMI-8226, and U266. Suitable cancer cell lines for propagating adenovirus serotypes include, for example, A549 cells, HT29 cells, HEK293 cells, HCT116 cells, SKOV3 cells, and MM1S cells. Other suitable cell lines for propagating specific virus subgroups will be known to those skilled in the art. In some embodiments, cell lines are grown to subconfluence before being infected with the virus.

[0046] In one embodiment, the cell line is a DNA repair deficient cell line, suitably a cell line that is deficient in DNA repair enzymes or does not sense DNA damage, for example HCT116 cells.

[0047] For each virus serotype, there will be a preferred cell line that maximizes viral growth and / or recombination for that particular serotype. Preferred cell lines are those that express the cell entry receptor for that particular serotype and / or support high levels of viral genome replication (defined as a greater than 200-fold increase in viral genome compared to the input on day 0) within 7 days. Such viruses that invade cells and replicate with similar kinetics within the cells will have a greater opportunity for recombination. Methods for measuring maximum viral growth are known in the art, some of which are described herein.

[0048] In another embodiment, the species is AdB and the preferred cell line is A549 or HCT116, most preferably A549. In one embodiment, the species is AdC and the preferred cell line is MM1S, HEK293, or A549, most preferably A549. In another embodiment, the species is AdD and the preferred cell line is HT29 or A549, most preferably HT29.

[0049] In the first culture step, viruses from each of the different species are cultured independently in one or more suitable cell lines that allow replication of the virus. Methods for infecting cell lines with viruses and propagating viruses in cell lines are well known in the art (e.g., Shashkova EV, May SM, Barry MA. Characterization of human adenovirus serotypes 5, 6, 11, and 35 as anticancer agents. Virology. 2009:394(2):311-320. doi:10.1016 / j.virol.2009.08.038; and Freedman JD, Hagel J, Scott EM et al. Oncolytic adenovirus expressing bispecific antibody targets T-cell cytotoxicity in cancer biopsies. EMBO Mol Med. 2017;9(8):1067-1087. doi:10.15252 / emmm.201707567).

[0050] "Propagating" a virus or "growing" a virus means amplifying the number of virus particles. "Propagating" a virus involves infecting a suitable cell line and culturing the infected cells under conditions that allow viral replication. Viral growth may be quantified by measuring the number of viral genomes using techniques such as qPCR. Suitably, "growing" includes "passaging" the virus. "Pooling" refers to mixing samples obtained from separate reactions. In this example, "pooling" refers to mixing the resulting amplified virus samples.

[0051] By "independently grown" is meant that each virus group is grown in only one cell line, for example, AdC viruses are grown in only one cell line, separate from AdD viruses.

[0052] Before infecting the cell line with the virus, the cell line may be grown to subconfluence. In some embodiments, the cells are grown to approximately 70% confluence. For example, about 1 x 10 cells are grown in a T25 culture flask. 6 The cells may be grown at a cell density of 0.1% to 1%.

[0053] Infection is preferably carried out at a viral particle / cell ratio of 50-1000 vp / cell, more preferably at a maximum of 500 vp / cell. Optimizing this particle / cell ratio advantageously promotes recombination between serotypes. These ratios are described herein, particularly for AdB, AdC, AdD, AdE, AdF, or AdG viral libraries.

[0054] Alternatively, the infection of cells is carried out at an MOI (multiplicity of infection) of 1 to 100, preferably at an MOI of greater than 10.

[0055] Preferably, in a first culture step, the virus is cultured in a suitable cell line under conditions that promote recombination between serotypes, and preferably, such conditions include allowing the virus to replicate multiple times, with multiple viruses being generated during each viral replication.

[0056] In some preferred embodiments, the virus is allowed to replicate up to 30 times in the first or second culture in step (a) or step (c), and preferably replicates at least 1, 2, 3, 4, 5, or at least 6 times in each passage, e.g., 5 times over a 5-7 day period.

[0057] In one embodiment, the virus propagated in a cell line (preferably a cancer cell line) is harvested after 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or 10 days, preferably 3 to 7 days.

[0058] In some embodiments, the virus is passaged 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times, preferably 4 to 6 times, during the first or second culture step.

[0059] For example, "passaging" a virus multiple times can be included to "propagate" it and increase the number of viral genomes. Suitably, one "passage" includes infecting cells with the virus at an appropriate ratio of viral particles to cells, growing the cells under appropriate conditions to allow the virus to exert its full cytopathic effect (i.e., in the case of adenovirus, lysing the host cells to release viral particles), and harvesting the cells and / or supernatant containing the viral particles for use in another "passage." In some embodiments, the cells and / or supernatant can be subjected to "freeze-thawing."

[0060] "Freeze-thawing" as used herein refers to the process of freezing cells and / or supernatants harvested from viral infection and thawing them before culturing them to subconfluence and using them as starting material for the next passage. The "freeze-thawing" process results in optimal release of viral particles from virally infected cells. Suitably, the number of freeze-thaw cycles according to the present invention is preferably at least one, or two or three.

[0061] In some preferred embodiments, cells of the cell line are grown to subconfluence and then infected with 50-1000 vp / cell, preferably 100-500 vp / cell or an MOI of 1-100.

[0062] In some preferred embodiments, the virus is passaged about 5 times with an interval of 3 to 7 days between each passage. In other embodiments, the virus is passaged 2 to 6 times with an interval of 2 to 6 days between each passage in the first culture step and / or the second culture step.

[0063] In some preferred embodiments of the present invention, step (a) comprises: (a)(i) co-culturing in one or more cell lines at least two different serotypes of viruses from a first species of double-stranded DNA virus; (ii) culturing in one or more cell lines at least two different serotypes of viruses of the same species from each of one or more additional species of double-stranded DNA virus, For each species of double-stranded DNA virus, a first culturing step is included in which viruses of different serotypes of the same species are cultured together and viruses of different species are cultured independently.

[0064] In this embodiment, for each species, at least two different serotypes of viruses from the same species are cultured together, thereby promoting intraspecies recombination. Viruses from several different species of double-stranded DNA viruses are cultured independently (i.e., individually) or substantially independently in one or more cell lines (and then pooled, if necessary). Preferably, one or more cell lines are selected for each virus species so that the virus species grows optimally in the one or more cell lines.

[0065] Each cell line culture may contain only or essentially only one type of virus, may contain a majority of one type of virus, or may contain a virus that grows optimally in that cell line, and may contain trace or minor amounts of other types of viruses.

[0066] In this embodiment, at least two different serotypes of viruses from the same species of one or more additional species of double-stranded DNA virus are cultured. The term "one or more additional species" may include one, two, three, four, five, six, seven, eight, nine, ten, or more species of double-stranded DNA virus, preferably one to five additional species, and more preferably three to five additional species.

[0067] Step (a) is performed before step (b).

[0068] Step (b) (b) (i) the virus obtained in step (a), (ii) at least two different serotypes of viruses of the same species, each derived from one or more additional species of double-stranded DNA virus; This includes combining The first species of double-stranded DNA virus and each of the further species of double-stranded DNA virus are all different species within the same family or genus of double-stranded DNA virus.

[0069] The virus obtained in step (a) and used in step (b) is generally all or substantially all of the virus obtained in step (a) or a sample thereof.

[0070] The term "one or more additional species" may include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more species of double-stranded DNA viruses, preferably 1 to 5 additional species, more preferably 3 to 5 additional species.

[0071] In some embodiments, in step (b)(ii), for each of the one or more additional species of double-stranded DNA virus, the different serotypes of viruses from that species have previously been cultured together and the different species of viruses have previously been cultured independently.

[0072] In this embodiment, viruses of different serotypes of the same species have previously been cultured together (e.g., in one or more cell lines) to promote intraspecies recombination. Viruses of different species preferably have previously been cultured independently (i.e., individually) or substantially independently. For example, each culture contained only one or substantially only one virus, each culture contained a majority of one virus, or each culture contained a virus that grows optimally in that cell line.

[0073] In some embodiments, step (b) further comprises: (iii) a first species of the double-stranded DNA virus; (iv) one or more wild-type viruses that are in the same family, genus, or species as the first species of double-stranded DNA virus; (v) one or more of the additional species of double-stranded DNA viruses; and / or (vi) one or more wild-type viruses that are in the same family, genus, or species as one of the additional species of double-stranded DNA virus; This includes combining it with a virus derived from

[0074] In particular, step (b) further comprises combining viruses derived from (i) and (ii) with other viruses derived from species in the same genus as the first species of double-stranded DNA virus (including viruses of a single serotype of that species in the same genus).

[0075] Preferably, at least 1% (eg, 1-5% or 5-10%) of such additional viruses is included.

[0076] Optionally, step (c) includes: (c) a second culturing step in which the viruses combined in step (b) are co-cultured in one or more cell lines.

[0077] While the purpose of the first culture step was to promote intraspecies recombination, the purpose of the second culture step is to promote interspecies recombination. The cell line used in the second culture step may be one or more of the cell lines described above in the context of the first culture step. The infection and cell culture parameters (e.g., MOI, viral replication number, culture and passaging duration) in the second culture step are, mutatis mutandis, the same as those described above for the first culture step.

[0078] In particular, viruses from each of the first and additional species are cultured together in one or more suitable cell lines that allow for the growth and replication (preferably optimal growth and / or replication) of the viruses of those species. In some embodiments, the viruses are cultured together in a single cell line. In other embodiments, the viruses are cultured together in multiple cell lines. In some embodiments, the multiple cell lines are grown together (e.g., in the same culture vessel). In other embodiments, the multiple cell lines are grown independently (e.g., in different culture vessels).

[0079] Optionally, the process of the invention, to produce a library of viruses, further comprises: (d) combining the viruses or portions thereof obtained after step (c) and / or isolating multiple viruses therefrom.

[0080] In some embodiments, step (d) further comprises subjecting the virus or portion thereof obtained after step (c) to: (i) a first species of said double-stranded DNA virus; (ii) one or more of the additional species of double-stranded DNA viruses; (iii) one or more viruses obtained after culturing step (a); (iv) one or more wild-type viruses from the same family, genus, or species as the first species of double-stranded DNA virus; and / or (v) one or more wild-type viruses from the same family, genus, or species as one of the additional species of double-stranded DNA virus; and combining it with a virus derived from

[0081] Methods for isolating viruses are well known in the art (see Cromeans TL, Lu X, Erdman DD, Humphrey CD, Hill VR. Development of plaque assays for adenoviruses 40 and 41. J. Virol. Methods. 2008;151(1):140-145. doi:10.1016 / j.jviromet.2008.03.007).

[0082] Preferably, at least 1% (eg, 1-5% or 5-10%) of such additional viruses is included.

[0083] In some embodiments, the viruses are subjected to mutagenesis before, during, or after performing one or more steps of the invention, which further enhances diversity within the viral library.

[0084] Such further diversification processes are well known in the art (e.g., Wechman SL et al. "Development of an Oncolytic Adenovirus with Enhanced Spread Ability through Repeated UV Irradiation and Cancer Selection". Viruses. 2016;8:6. doi:10.3390 / v8060167).

[0085] Preferably, mutagenesis is by UV irradiation. UV irradiation can be used to induce mutations in the viral genome and / or to induce DNA breaks that may facilitate recombination between viruses.

[0086] The term "viral library" as used herein refers to a collection or mixture of viruses with different genomic sequences. In some embodiments, a "library" may include viruses with wild-type viral genomic sequences, including genomic sequences of different wild-type subgroups or serotypes. For example, a library may include viral genomes composed of one or more combinations of nucleic acid sequences from different viral genomes.

[0087] The viral genomic sequence may be a nucleic acid sequence.

[0088] A "library" may also include wild-type genomic sequences in combination with modified, recombinant, or mutant viral genomic sequences that differ from the naturally occurring, i.e., "wild-type," genomic sequences.

[0089] Preferably, the process of the present invention generates a diverse library containing at least one novel recombinant viral genome (containing at least one novel recombination event), and preferably more than one novel recombinant viral genome, compared to the virus used as the starting point in the process described herein. Bioinformatics analysis can be performed to measure novel recombination events and align the sequenced viral library output to publicly available (GenBank) wild-type human virus serotypes. The greater the number of mutations / DNA shuffling or recombination events, the greater the diversity in the library.

[0090] As used herein, a "novel recombination event" refers to the recombination of nucleic acid from one viral serotype to another viral serotype, where the resulting viral genome differs from the naturally occurring, or "wild-type," genomic sequence by at least one nucleotide.

[0091] In another aspect, the invention provides a library obtained or obtainable by a process according to any of the aspects or embodiments of the invention.

[0092] The present invention also provides a chimeric virus, preferably a chimeric adenovirus, obtained or obtainable by a process according to any of the aspects or embodiments of the present invention.

[0093] Various further aspects and embodiments of the present invention will be apparent to those skilled in the art in view of the present disclosure.All documents mentioned in this disclosure are incorporated herein by reference in their entirety.

[0094] As used herein, "and / or" should be considered a specific disclosure of each of the two specified features or components, with or without the other. For example, "A and / or B" should be considered a specific disclosure of (i) A, (ii) B, and (iii) A and B, respectively, as if each were individually described herein.

[0095] Unless the context requires otherwise, the above feature descriptions and definitions are not limited to any particular aspect or embodiment of the present invention, but apply equally to all aspects and embodiments described.

[0096] While the present invention has been described by way of example with reference to certain embodiments, those skilled in the art will further appreciate that the invention is not limited to the disclosed embodiments, and that other embodiments may be constructed without departing from the scope of the invention, as defined in the appended claims.

[0097] The term "comprising" encompasses not only "including" but also "consisting," e.g., a composition "comprising" X may consist of only X, or it may include something more, such as X+Y.

[0098] All of the numbers and ranges disclosed above are subject to some degree of variation. Whenever a numerical range is disclosed with a lower and upper limit, any number within that range and any range subsumed within that range is specifically disclosed. In particular, all numerical ranges disclosed herein (expressed in the format "about A to about B," or, in other words, "approximately A to B," or, in other words, "approximately A to B") should be understood to describe all numerical values ​​and ranges encompassed within the broader numerical range.

[0099] The disclosure of each reference set forth herein is specifically incorporated herein by reference in its entirety. [Brief explanation of the drawings]

[0100] [Figure 1.1] A549, HT29, HEK293, HCT116, SKOV3, and MM1S cells were infected with the AdB, AdC, or AdD viral libraries at 200 vp / cell, and viral genome replication measured by QPCR (n = 4) on days 0, 1, 3, and 6 was shown. [Figure 1.2] FIG. 1 shows that loss of viral diversity when Ad species are co-passaged with A549 cells is demonstrated by the changing ratio of Ad species over multiple passages. [Figure 1.3] We show that pooling cell lines can enhance diversification. [Figure 2.1]Viral genomes were quantified by QPCR after three rounds of infection. HT29 cells were infected three times with the AdC and AdD viral libraries at 200 vp / cell. Alternatively, HT29 cells were co-infected three times with the AdC or AdD viral libraries at 200 vp / cell. [Figure 2.2] We show that virus competition in different cell lines results in unique species distributions. [Figure 2.3] 1 shows that prior art methods for creating viral libraries result in a loss of diversity. [Figure 3.1] This shows that a higher proportion of interspecies chimeras are detected after a stepwise diversification process (Stage 1) than after single-stage diversification (prior art). Stage 1 of the stepwise diversification process is the sum of all Ad-B, C, and D chimeric viruses derived from the output of each cell line combined. Chimeric reads (%) are the percentage of all next-generation sequencing (NGS, Illumina) reads that exhibit recombination breakpoints. [Figure 3.2] We show that the stepwise diversification process facilitates the involvement of a wider range of parental pairs in adenovirus chimeras compared to single-stage diversification (prior art). [Figure 3.3] We show that the stepwise diversification process generates chimeras with recombination sites across the genome. The recombination sites of AdC chimeras are distributed across the genome in the stepwise diversification process, but are not detected at all in the single-stage diversification (prior art) process. [Figure 3.4]The amount of sequencing reads showing recombination sites of AdB chimeras across the adenovirus genome is shown. The level of diversity generated using each approach is highlighted by analysis of two representative Ad-B serotypes (labeled AdB.1 and AdB.2 in the figure below) and their chimeras. Evidence is provided that the rate and type of AdB.1 / AdB.2 recombination events occurring across the viral genome during stages 1 and 2 of the diversification process differ. A greater degree of Ad genome loss was detected during stage 1 than stage 2. (i) Data were generated using a synthetic long-read sequencing approach (reassembly of Illumina reads derived from the same viral genome informed by barcode tagging). (ii) Data were generated using short Illumina reads. [Figure 4.1] Figure 1 shows a plot of the percentage of AdD chimeras detected after passaging an AdD library in HT29 or HCT116 cells. Chimeras were detected by synthetic long-read sequencing. [Figure 4.2] 1 shows plots of the percentage of AdB and AdC chimeras detected after passaging AdB or AdC libraries in A549 or HCT116 cells. Chimeras were detected by short-read sequencing. [Figure 4.3] 1 shows the amount of sequencing reads indicating AdB chimeric breakpoints present across the adenoviral genome after infection of A549 and HCT116 cells with the Ad-B library. [Figure 5.1] Sequence similarities between Ad serotypes across the genome are shown. [Figure 5.2] Sequence similarity between HSV1 isolates is shown. Horizontal dashed lines represent 0.5% sequence divergence (0.25% along each branch from the common ancestor), and boxes indicate isolates that were assigned to the same viral strain. [Figure 5.3] Genome-wide sequence similarity compared to HSV-1 strain 17 is shown. [Figure 5.4]Sequence similarity between vaccinia strains and other Orthopoxvirus species is shown. Horizontal dashed lines represent 0.5% sequence divergence (0.25% along each branch from the common ancestor), and boxes indicate clones assigned to the same virus strain. (WR = Western Reserve, Cop = Copenhagen). [Figure 5.5] Sequence similarity across the genome compared to Vaccinia Western Reserve is shown. [Example]

[0101] The present invention will be further illustrated by the following examples. In the examples, unless otherwise specified, "parts" and "percentages" are by weight and "degrees" are degrees Celsius. It should be understood that these examples, while illustrating preferred embodiments of the present invention, are given for illustrative purposes only. From the above description and these examples, one skilled in the art will be able to grasp the essential nature of the present invention, and can make various changes and modifications to the present invention to adapt it to various applications and conditions without departing from the spirit and scope of the present invention. Therefore, various modifications of the present invention, in addition to those shown and described herein, will be apparent to those skilled in the art from the above description. Such modifications are intended to fall within the scope of the appended claims.

[0102] Example 1: Preferential growth of viruses in different cell lines (Virus preparation) Wild-type human adenovirus (Ad) serotypes derived from Ad species B (AdB), AdC, AdD, AdE, AdF, and AdG were included in this study (Robinson CM et al., Molecular evolution of human adenoviruses. Sci. Rep. 2013;3:1812). Each Ad serotype was plaque-purified, and individual isolates were verified by whole-genome sequencing or Sanger sequencing of the 1-kb E2B region to confirm consistency with the corresponding GenBank ID entry. Viruses were amplified and titered to HEK293 cells by TCID50. Equal amounts of infectious particles of each serotype were pooled according to their Ad species (e.g., Ad1, Ad2, Ad5, and Ad6 = AdC virus library) and purified by double-banding on a CsCl gradient to generate species-specific Ad libraries (e.g., AdB library, AdC library, and AdD library).

[0103] (Understanding viral replication dynamics) A panel of human cancer cell lines (A549, HT29, HEK293, HCT116, SKOV3, and MM1S cells obtained from ATCC) was infected with AdB, AdC, and AdD viral libraries over a time course. A549, HT29, SKOV3, and HEK293 cells were cultured in DMEM containing 10% FBS at 37°C and 5% CO2. HCT116 and MM1S cells were cultured in RPMI-1640 containing 10% FBS at 37°C and 5% CO2. Cells were seeded 24 hours before infection with the AdB, AdC, or AdD viral libraries and incubated at 37°C and 5% CO2. Samples (a mixture of virus-infected cells and supernatant) were harvested on days 0, 1, 3, and 6–7 postinfection for analysis of viral genome replication. Viral genomes were quantified by qPCR using Ad species-specific primers (Life Technologies) as follows:

[0104] AdB forward GAGTTGGCTTTAAGTTTAATGAGC (SEQ ID NO: 1) AdB reverse TGAGGCCTGATAAACAGTAT (SEQ ID NO: 2) AdC forward GCTTAATGACCAGACACCGT (SEQ ID NO: 3) AdC reverse GGTATATGCAAAGGTGGCA (SEQ ID NO: 4) AdD forward GGGATGATGACCGAGCTG (SEQ ID NO: 5) AdD reverse CAGACATGCCTGCTACAT (SEQ ID NO: 6) Data shown as whole viral genomes per Ad species over time (Fig. 1)

[0105] The data in Figure 1.1 show that adenoviruses derived from different species (e.g., AdB, AdC, AdD) tend to exhibit favorable infection and / or replication efficiencies in different cell lines. For example, AdC viruses replicated significantly faster than AdD viruses in MM1S and HEK293 cells. AdC viruses reached maximum genome abundance on day 3, while AdD viruses remained less than 10-fold lower. This indicates that AdD recombination events were dramatically reduced in these cell lines during this period compared to AdC viruses.

[0106] Among the cell lines tested, HEK293 cells preferentially supported replication of AdC, AdB, and AdD in this order; at day 6, MM1S supported replication of AdC, AdD, and AdB in this order; A549 supported replication of AdC / B and AdD in this order; HCT116 supported replication of AdB, AdC, and AdD in this order; SKOV3 supported replication of AdB and AdC / D in this order; and HT29 supported replication of AdD and AdB / C in this order. Overall, A549 cells showed the highest level of viral replication, while HT29 / SKOV3 cells showed the lowest level of support.

[0107] The species distribution of an input virus library consisting of a pool of wild-type (WT) adenoviruses from three species was assessed over multiple passages. Equal titers of each WT adenovirus were added to the input library (effectively resulting in more Ad-D viruses than Ad-B or Ad-C viruses), resulting in the species distribution shown in Figure 1.2. This library was infected into A549 cells at a high MOI and passaged up to four times. Each passage was performed at a high MOI in a fresh cell monolayer. At each stage, the output was analyzed by qPCR for titers of AdB, AdC, and AdD species, and the relative proportions of each species to the combined titer of the three species were plotted for each passage. Despite the rapid increase in the input WT virus library with each passage, the adenovirus species distribution shifted dramatically toward AdB by the second passage.

[0108] To address the dominance of a single Ad species and loss of viral diversity seen in Figure 1.3, multiple different cell lines were seeded in the same culture vessel and infected with a WT pool of AdB, AdC, and AdD. After one passage, the distribution of viral species released into the supernatant was analyzed by qPCR and plotted for each experimental condition. Unlike with A549 cells, the output of the pooled cells had a relatively equal distribution across the number of constituent species, demonstrating the importance of using the output of different cell lines to generate viral diversity.

[0109] Example 2: Viral competition in HT29 cell lines HT29 cells were seeded at 70% confluence in T25 flasks in 10% medium and incubated at 37°C and 5% CO2. The next day, cells were infected with the AdC or AdD viral library at 200 vp / cell. Alternatively, cells were co-infected with the AdC and AdD viral libraries at 200 vp / cell. After infection, upon signs of CPE, infected cells and supernatants were harvested, subjected to one freeze-thaw cycle, and then used as inoculum for the next round of infection of HT29 cells. This process was repeated three times. The viral genomes present in the supernatant from the third round of infection were quantified by qPCR using Ad species-specific primers.

[0110] AdC forward GCTTAATGACCAGACACCGT (SEQ ID NO: 3) AdC reverse GGTATATGCAAAGGTGGCA (SEQ ID NO: 4) AdD forward GGGATGATGACCGAGCTG; (SEQ ID NO: 5) AdD reverse CAGACATGCCTGCTACAT (SEQ ID NO: 6)

[0111] The data, presented in Figure 2, demonstrate that coinfection of cells with different Ad species results in the proliferation of one virus species over the other during repeated infections, and that the amount of viral genome in independently infected cells is significantly greater than when cells are coinfected with AdC and AdD libraries; i.e., more AdC virus was recovered in each round in the absence of the other species. Figures 1 and 2 demonstrate that, because only viruses that enter and co-replicate cells have the opportunity to recombine, each adenovirus species should be propagated independently in a preferred cell line (i.e., one that maximizes viral genome amplification for a given Ad species) to generate a diverse library containing viruses representing as many serotypes and species as possible. These propagated virus species can then be pooled to provide a library containing all wild-type and its recombinant and mutant forms.

[0112] To investigate the kinetics of transcription and viral release of AdB, AdC, and AdD species, a time course study was set up using three cell lines (A549, HCT, and HT29). Cells were seeded and infected at a high MOI with an equally serotype-weighted virus pool (similar to Figure 1.2) composed of WT AdB, WT AdC, and WT AdD species, referred to as WT Pool Input. Infections were set up at the appropriate vg / cell to infect the cell line. At multiple time points postinfection (14, 24, 38, 48, 96, and 144 hours), wells from each cell line were harvested, and a sample of the original infected material served as a 0-hour control. At each time point, titers of each species were determined in the harvested supernatant by qPCR, as shown in Figure 2.2.

[0113] The top panel of Figure 2.2 shows the titers of supernatants after infection with equally serotype-weighted pools containing AdB, AdC, and AdD viral libraries. In the top panel, A, B, and C represent viral titers after infection in A549, HCT116, and HT29 cells, respectively. Because infection and replication efficiencies across different cell lines vary by species, the data support the use of multiple cell lines to promote recombination events in different Ad species. The bottom panel shows the distribution of species calculated by the ratio of AdB, AdC, or AdD total genomes to total genomes across all three species. Because the relative proportions vary significantly across cell lines, the data support the use of different cell lines.

[0114] As a comparison with prior art methods for generating viral libraries by recombination, our input pool of WT virus (a combination of AdB, AdC, and AdD libraries) was passaged according to the method detailed in the prior art (Kuhn et al., 2008, supra). Briefly, HT29 cells were infected with the virus pool at 200 vg / cell. The output virus was titered by qPCR, and a second round of infection was established under the same conditions. Mapping the distribution of Ad species in the input, passage 1, and passage 2 revealed a near-complete disappearance of AdC abundance, excluding this group from the pool of available recombination targets. Therefore, to expose most targets to recombination and thereby maximize diversity, it is necessary to use multiple cell lines in which AdC can compete.

[0115] Example 3: Comparison of single-stage and stepwise viral diversification techniques (Single-stage viral diversification) Three serotypes derived from AdB and one serotype each derived from AdC, AdD, AdE, and AdF (i.e., using a method similar to Kuhn et al., 2008, supra, which served as a comparison) were pooled and passaged in HT29 cells grown to subconfluence in T175 flasks. Cells were infected with the pooled Ad at 200 vp / cell in 2% medium at 37°C and 5% CO2. At 48–96 h postinfection, viral lysates were harvested from these infected cultures and frozen at -80°C. Virus-infected cells were subjected to three freeze-thaw cycles, and the released virus was used as an inoculum for subsequent passage in subconfluent cultures. At 48–72 h postinfection, viral lysates were harvested from these cultures and subjected to three freeze-thaw cycles before purification on a CsCl density gradient. The purified viruses were considered the output of this method, a "diversified library."

[0116] (Stepwise viral diversification) (Stage 1 - Further promote intraspecific recombination events) AdB (more than six AdB serotypes), AdC (four AdC), or AdD (more than 29 AdD serotypes) virus libraries were independently passaged in cancer cell lines (A549, HT29, HCT116) grown to subconfluence in 10% medium at 37°C and 5% CO2. 24 h prior to infection, cells were seeded into T25 culture flasks to reach 60-70% confluence. Cells were infected with the appropriate AdB, AdC, or AdD library vp / cell. Released virus for a specific Ad species was harvested upon cytopathic effect (CPE). After one freeze-thaw cycle, clarified supernatant from the first viral infection was added to a layer of subconfluent cancer cells in 10% medium in a T75 flask, and each Ad species was passaged independently again. The volume at which signs of CPE appeared between 2 and 5 days in the next infection was selected as the supernatant volume.

[0117] This infection cycle in T75 flasks was repeated up to five times to introduce recombination events into Ad species. At each round of infection, the output viral genome was quantified by qPCR using species-specific primers. The output from each cell line was pooled based on Ad species specificity and purified by CsCl density gradient as needed. The purified viruses together constituted the "diversified library" output from Stage 1.

[0118] Stage 2 - Provides opportunities for novel intra- and inter-species recombination events Equal amounts of viral genomes derived from Stage 1 (i.e., wild-type and mutant versions of AdB, AdC, and AdD) were pooled. The viral seed libraries were co-passaged in cancer cell lines (A549, HT29, and HCT116) cultured to subconfluence in 10% medium. 24 h prior to infection, cells were split into T75 culture flasks at 60–70% confluence. Cells were infected with the pooled Stage 1 viral library at the appropriate vp / cell. Released virus was harvested upon CPE. After one freeze-thaw cycle, the clarified supernatant from the first viral infection was added to a layer of subconfluent cancer cells in 10% medium in a T75 flask. The supernatant volume at which signs of CPE appeared within 2–5 days of infection was selected. This infection cycle in T75 flasks was repeated up to five times to promote intra- and inter-Ad species recombination events. The output from each cell line was pooled and purified by CsCl density gradient as needed. The purified viruses were considered the Stage 2 output "diversified library."

[0119] The virus pool used in "single-stage virus diversification" contained three serotypes derived from AdB and one serotype each derived from AdC, AdD, AdE, and AdF, whereas "stepwise library diversification" contained multiple serotypes derived from AdB, AdC, and AdD.

[0120] The diversity of the viral libraries with respect to viral recombination was determined by high-throughput next-generation sequencing (NGS) of the viral genomes in the libraries. Sequences were aligned against a reference set containing the sequences of each known wild-type virus. Using a BLAST search, reads mapping to multiple references were recognized as chimeras.

[0121] The stepwise diversification process was found to be superior to prior art methods both in expanding the number and types of viral variants, allowing more variants to participate, and in preventing one particular group of viruses from dominating (Figures 3.1 and 3.2).

[0122] Intraspecies Ad chimeras were detected at a higher rate (higher total % chimeric sequence reads, and therefore higher recombination rates) after Stage 1 of the diversification process than when detected using the prior art process or the corresponding Ad-B, Ad-C, or Ad-D WT pool input (no diversification process applied) (Figure 3.1). Stage 1 of the diversification process involves independently passaging Ad species in different cell lines before combining all outputs (i.e., the sum of AdB, AdC, and AdD chimeras generated in A549, HCT116, and HT29). This increases the number of recombinants within each Ad species by coinfecting them with viruses (i.e., Ads within each species) that share more extensive sequence homology and have similar infection kinetics to synchronize infection in the preferred cell type before combining the outputs with the Stage 2 process and WT pool input. This approach also allows more Ad serotypes to contribute to recombination events, thereby increasing the overall library diversity. This is in contrast to previous techniques where different Ad species are pooled and used to infect a single cell line, resulting in a loss of viral diversity in favor of Ad-B viruses (Figures 3.1 and 3.2). Note that the percentage of chimeric sequence reads shown is likely an underestimate of the total % due to limitations of short-read sequencing methods in homologous viruses, especially in the case of AdD.

[0123] The stepwise diversification process was found to be superior to prior art methods because it allowed for the distribution of viral recombination events across the genome.

[0124] The stepwise diversification process (Stage 1) involves the inclusion of at least two distinct adenovirus serotypes from each species, providing viruses (i.e., Ads within each species) with broader sequence homology and similar infection kinetics that synchronize infection in the preferred cell type before combining the output with the Stage 2 process and WT pool input. This approach creates recombination sites spread throughout the viral genome, ensuring the generation of diverse functional variants (Figure 3.3). This more open viral genome may reveal previously unexplored viral functional traits that expand the search space for identifying the best therapeutic viruses. In contrast, using only one adenovirus serotype from each species, as is the case with all Ad species other than Ad-B in the prior art, leaves little opportunity for recombination events. Consequently, Ad-C chimeras were not detected using the prior art approach.

[0125] Different types of viral recombination events and adenovirus variants may be produced during Stage 1 and Stage 2 of the stepwise diversification process. Therefore, combining the outputs of both Stage 1 and Stage 2 with the input viruses can further improve the diversity of the viral library.

[0126] Example 4: Some cell types are more prone to permitting viral recombination events Viral output from up to five serial passages of the AdB / AdC / AdD library in HCT116 and HT29 cells was prepared similarly to Stage 1 of the stepwise diversification process. Sequencing and bioinformatics analysis of viral recombination were performed to analyze the percentage of viral reads representing novel recombinants and recombination events. Figures 4.1 and 4.2 show that for the AdD species, HT29 cells produced significantly more viral variants, and A549 cells produced more AdB and AdC variants than HCT116 cells. This data highlights the importance of incorporating multiple cell types as part of the viral diversification process, as different Ad species have preferred cell lines and recombination rates correlate with the rate of viral genome amplification.

[0127] Example 5: Application of the stepwise diversification process to other double-stranded DNA viruses Recombination is frequently observed within adenovirus species, but less so between serotypes or species with different infection kinetics and lower levels of homology (Figure 5.1). Figure 5.1 shows that the Ad-B1 serotype shares an overall homology of over 98% with other viruses in the AdB-1 family, 80-90% with AdB2, and 50-70% with AdC and AdD. Significant levels of homologous recombination are observed within species, including AdB1 and AdB2, but less so between species. This indicates that greater than 80% sequence similarity is advantageous for efficient production of recombinant adenoviruses. Therefore, the process described above (stepwise diversification), in which cells are co-infected with at least two viruses from the same species in a preferred cell line to maximize recombination events before combining with a genetically more diverse virus or a different species, results in greater viral diversity than prior art methods.

[0128] Other double-stranded DNA viruses have also been reported to recombine through coinfection and homologous recombination events (Ricordel et al., “Vaccinia Virus Shuffling: deVV5, a Novel Chimeric Poxvirus with Improved Oncolytic Potency”, 2018, Cancers (Basel); 10(7): 231). Combining such viruses in a stepwise fashion similar to that of adenovirus, i.e., first combining at least two viruses from the same species in a preferred cell line before combining with viruses from other species, increases the number and diversity of recombinant viruses.Like adenovirus, herpes simplex viruses (HSV) or vaccinia viruses (VV) from the same species share extensive regions of homologous DNA (Figures 5.2 and 5.3) and similar infection kinetics and tropism.

[0129] Different HSV species and different VV species share less sequence homology, have different cell tropisms or infection kinetics, and are more diverse at the DNA level (Figures 5.2 and 5.4) (Gerber et al., "Differences in the Role of Glycoprotein C of HSV-1 and HSV-2 in Viral Binding May Contribute to Serotype Differences in Cell Tropism," Virology, 214, 29–39 (1995); Herold et al., "Differences in the Susceptibility of Herpes Simplex Virus Types 1 and 2 to Modified Heparin Compounds Suggest Serotype Differences in Viral Entry," Journal of Virology, Vol. 70, No. 6, 1996; McClain et al., "Cell-Specific Kinetics and Efficiency of Herpes Simplex Virus Type 1 Entry Are Determined by Two Distinct Phases of (See, e.g., "High-Content Orthopoxvirus Attachment," Virology, Vol. 198, No. 2, February 1, 1994, pp. 690-702; Gates et al., "Development of a High-Content Orthopoxvirus Infectivity and Neutralization Assays," PLoS ONE 10(10):e0138836, 2015). Consequently, because HSV and VV serotypes / strains from the same species are more prone to recombination, a stepwise diversification process in which viruses from the same species are co-infected in preferred cell lines before combining with other species will increase the chances of recombination events and increase overall viral diversity, allowing more virus types to participate in recombination and improving the diversity of the viral library.

[0130] This stepwise diversification process is applied to generate diverse HSV and VV libraries, which are then used to identify cancer therapeutics, vaccines, or gene therapy applications.

[0131] (Herpes simplex virus) Within the HSV1 species, DNA sequence similarity is high (Figure 5.2), with significantly extensive DNA homology (Figure 5.3 comparing 17 strains of HSV1 with the H12 strain), indicating ample opportunity for recombination events to occur, similar to those observed within adenovirus species in Examples 1 to 4. Figures 5.2 and 5.3 show that the sequence similarity between different HSV species is significantly lower than the sequence similarity within a species, suggesting fewer opportunities for recombination events to occur.

[0132] (Stepwise viral diversification using HSV) Wild-type HSV strains derived from HSV-1 and HSV-2 species are obtained from ATCC or other commercial sources, and single virus plaques are purified and propagated as previously described (e.g., Grosche et al., Herpes Simplex Virus Type 1 Propagation, Titration and Single-Step Growth Curves, BioProtoc. 2019 Dec 5;9(23):e3441.). Each single isolate is verified by whole genome sequencing and matching to the corresponding GenBank ID entry.

[0133] (Stage 1 - Further promote intraspecific recombination events) The HSV-1 strain library (including HSV1 strains named KOS, E06, F, H129, McKrae, and HF10; Figure 5.2) or the HSV-2 strain library (including Seattle, HG52, 186, UL39, and UL29) is independently passaged in an immortalized cell line (BHK (baby hamster kidney), VERO cells (African green monkey kidney), HeLa (human cervical carcinoma), or your preferred cell line) in medium containing 10% FCS. Cells are seeded 24 hours prior to infection to reach 70-90% confluence at the time of inoculation. The HSV-1 or HSV-2 strain library is independently inoculated at a high MOI in RPMI 1640 containing 20 mM HEPES for 1 hour at room temperature, after which the medium is replaced and the cells are incubated at 37°C and 5% CO2. Viruses are harvested upon signs of CPE. After one freeze-thaw cycle, the clarified supernatant from the first viral infection was added to a subconfluent layer of cells in medium in a T75 flask, and each HSV species was passaged independently again. The volume of supernatant selected for the next infection was the volume at which signs of CPE appeared within 2-5 days.

[0134] This cycle of infection in T75 flasks is repeated up to five times to introduce recombination events into the HSV species, and the output of the final infection is considered the Stage 1 output "diversified library."

[0135] Stage 2 - Provides opportunities for novel intra- and inter-species recombination events The Stage 1 diversified HSV-1 output library was pooled with a wild-type HSV-1 strain, a library of HSV-2 strains, and / or a Stage 1 diversified HSV-2 output library and co-passaged in BHK-21 cells, VERO cells, HELA cells, and the preferred cell line. Cells were seeded 24 h prior to infection to reach 70-95% confluence at the time of inoculation. Cells were inoculated with the HSV-1 and HSV-2 pooled libraries at a high MOI in RPMI 1640 containing 20 mM HEPES for 1 h at room temperature, after which the medium was replaced and incubated at 37°C, 5% CO2. Virus was harvested upon CPE. After one freeze-thaw cycle, the clarified supernatant from the first viral infection was added to a subconfluent layer of cells in medium in a T75 flask. The supernatant volume at which signs of CPE appear within 2-5 days of the next infection is selected. This infection cycle in T75 flasks is repeated up to five times to introduce recombination events into the HSV species.

[0136] The diversity of the viral library with respect to viral recombination is determined by high-throughput next-generation sequencing (NGS) of the viral genomes in the library. Sequences are aligned against a reference set containing the sequences of each known wild-type virus. Using BLAST searches, reads that map to multiple references are recognized as chimeras.

[0137] (vaccinia virus) DNA sequence similarity within vaccinia species is high (Figure 5.4), with significantly extensive DNA homology (Figure 5.5 comparing Vaccinia Western Reserve with Dryvax®). This indicates ample opportunity for recombination events to occur, similar to what was observed within adenovirus species in the previous examples. Between different orthopoxvirus species, sequence similarity is lower, suggesting that recombination events occur less efficiently.

[0138] (Stepwise viral diversification using vaccinia virus) Orthopoxviruses, including vaccinia strains, are obtained from ATCC, and single virus plaques are purified and propagated as described (e.g., Cotter et al., "Preparation of Cell Cultures and Vaccinia Virus Stocks," Curr. Protoc. Microbiol. 2015 Nov 3;39:14A.3.1-14A.3.18 3). Each isolate is verified by whole genome sequencing and matching to the corresponding Genbank ID entry.

[0139] (Stage 1 - Further promote intraspecific recombination events) A vaccinia strain virus library (Figure 5.4) or a strain virus library derived from another orthopoxvirus species (Figures 5.4 and 5.5) is passaged independently in multiple immortalized cell lines (e.g., BS-C-1 cells, HeLa cells, LoVo cells, or a preferred cell line) in medium containing 10% FCS. Cells are inoculated with the vaccinia strain library or other orthopoxvirus library at a high MOI in medium containing 2.5% FBS for 2 hours at 37°C and 5% CO2. Upon signs of CPE, the virus is harvested by three freeze-thaw cycles to lyse the cells. The virus harvested from the first infection is sonicated on ice and used to inoculate HeLa cells in a second infection at an MOI that produces signs of CPE within three days. The supernatant volume that produces signs of CPE within three days of the next infection is selected. This cycle of infection in culture flasks is repeated up to five times to introduce recombination events into vaccinia and other orthopoxvirus species.

[0140] Stage 2 - Provides opportunities for novel intra- and inter-species recombination events The Stage 1 diversified vaccinia output library is pooled with a wild-type vaccinia strain, a library of other orthopoxvirus strains, and / or a Stage 1 diversified orthopoxvirus output library in equal genomic amounts and passaged together in multiple cell lines.

[0141] Once signs of CPE appear, cells are lysed by three freeze-thaw cycles and the virus is harvested. The virus harvested from the first infection is sonicated on ice and used to inoculate cells in a second infection at an MOI that results in signs of CPE within 3 days. The volume of supernatant that results in signs of CPE within 3 days of the next infection is selected.

[0142] This cycle of infection in culture flasks is repeated up to five times to introduce recombination events within and between vaccinia and other orthopoxvirus species.

[0143] The diversity of the viral library with respect to viral recombination is determined by high-throughput next-generation sequencing (NGS) of the viral genomes in the library. Sequences are aligned against a reference set containing the sequences of each known wild-type virus. Using BLAST searches, reads that map to multiple references are recognized as chimeras. [Sequence List Free Text]

[0144] <210> 1 <223> AdB forward primer <210> 2 <223> AdB reverse primer <210> 3 <223> AdC forward primer <210> 4 <223> AdC reverse primer <210> 5 <223> AdD forward primer <210> 6 <223> AdD reverse primer

Claims

1. 1. A process for producing a library of adenoviruses, the process comprising: (a) (i) co-culturing in one or more cell lines at least two different serotypes of adenovirus derived from a first species of adenovirus; (ii) a first culturing step comprising culturing in one or more cell lines at least two different serotypes of adenoviruses of the same species derived from each of one or more additional species of adenovirus, wherein, for each species of adenovirus, adenoviruses of different serotypes of the same species are cultured together and adenoviruses of different species are cultured independently; and (b)(i) the adenovirus derived from step (a)(i); (ii) the adenovirus derived from step (a)(ii), Furthermore, if necessary, (c) a second culturing step in which the adenoviruses combined in step (b) are co-cultured in one or more cell lines; (d) combining the adenoviruses or portions thereof cultured in one or more cell lines obtained after step (c) and / or isolating a plurality of adenoviruses therefrom.

2. In step (a), the adenoviruses of at least two different serotypes derived from a first species of adenovirus are (i) a single cell line; (ii) multiple cell lines cultured separately; or (iii) multiple cell lines cultured together; The process of claim 1, wherein the cells are cultured together in a

3. Step (b) further comprises: (iii) the first species of adenovirus; (iv) one or more wild-type adenoviruses that are of the same family, genus, or species as the first species of adenovirus; (v) one or more of the additional species of adenovirus; and / or (vi) one or more wild-type adenoviruses that are of the same family, genus, or species as one of said additional species of adenovirus; 3. The process of claim 1 or 2, comprising combining the adenovirus derived from

4. In step (c), the first species of adenovirus and each of the further species of adenovirus are (i) a single cell line; (ii) multiple cell lines cultured separately; or (iii) multiple cell lines cultured together; The process according to claim 1 or 2, wherein the cells are cultured together in a

5. Step (d) further comprises subjecting the adenovirus or part thereof obtained after step (c) to: (i) a first species of said adenovirus; (ii) one or more of the additional species of adenovirus; (iii) one or more adenoviruses obtained after the culturing step (a); (iv) one or more wild-type adenoviruses from the same family, genus, or species as the first species of adenovirus, and / or (v) one or more wild-type adenoviruses from the same family, genus, or species as one of said additional species of adenovirus; 3. The process according to claim 1 or 2, comprising combining an adenovirus derived from

6. 3. The process of claim 1 or 2, wherein the adenovirus is subjected to mutagenesis before, during, or after one or more of steps (a), (b), and / or (c).

7. 3. The process of claim 1 or 2, wherein the adenovirus is a species of human adenovirus selected from the group consisting of AdB, AdC, AdD, AdE, AdF, and AdG.

8. (i) the species is AdB and the serotype is selected from the group consisting of Ad3, Ad7, Ad11, Ad14, Ad16, Ad21, Ad34, Ad35, Ad50, and Ad55; (ii) the species is AdC, and the serotype is selected from the group consisting of Ad1, Ad2, Ad5, Ad6, and Ad57; (iii) the species is AdD and the serotype is selected from the group consisting of Ad8, Ad9, Ad10, Ad13, Ad15, Ad17, Ad19, Ad20, Ad22, Ad23, Ad24, Ad25, Ad26, Ad27, Ad28, Ad29, Ad30, Ad32, Ad33, Ad36, Ad37, Ad38, Ad39, Ad42, Ad43, Ad44, Ad45, Ad46, Ad47, Ad48, Ad49, Ad51, Ad53, Ad54, and Ad56; and / or (iv) the species is AdF, and the serotype is selected from the group consisting of Ad40 and Ad41; The process of claim 7.

9. 3. The process of claim 1 or 2, wherein in step (a) at least three, four, five, six, seven, eight, nine, ten or more different serotypes from a first species are cultured together, and / or in step (b) at least three, four, five, six, seven, eight, nine, ten or more different serotypes from one or more further species are cultured together.

10. 3. The process of claim 1 or 2, wherein the number of the one or more additional species of adenovirus is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more.

11. 3. The process of claim 1 or 2, wherein the one or more cell lines are cancer cell lines selected from the group consisting of A549 cell line, HT29 cell line, HEK293 cell line, HCT116 cell line, MM1S cell line, SKOV3 cell line, MMR cell line, JJN3 cell line, RPMI-8226 cell line, and U266 cell line.

12. (i) the species is AdB and the cell line is A549 or HCT116; (ii) the species is AdC and the cell line is MM1S, HEK293, or A549; and / or (iii) the species is AdD and the cell line is HT29 or A549; The process of claim 11.

13. 3. The process according to claim 1 or 2, wherein in the first culture step and / or the second culture step, the adenovirus is passaged 4 to 6 times, with an interval of 3 to 7 days between each passage.

14. 3. The process according to claim 1 or 2, wherein in the first culture step and / or the second culture step, the adenovirus is passaged 2 to 6 times, with an interval of 2 to 6 days between each passage.

Images