Novel variants of recombinant Ganoderma lucidum immunomodulatory proteins and their applications

Abstract

The present invention relates to a recombinant protein, which comprises a spacer peptide and a recombinant Ganoderma lucidum immunomodulatory protein variant (rLZ-8 variant), wherein the amino acid sequence of the rLZ-8 variant comprises at least one amino acid mutation compared with the amino acid sequence shown in SEQ ID NO: 10. The present invention also relates to the application of the recombinant protein in the treatment of diseases.

Description

[Technical Field]

[0001] This application relates to the biomedical field, specifically to a recombinant Ganoderma lucidum immunomodulatory protein variant (rLZ-8 variant) and its application in the treatment of tumors. [Background technology]

[0002] Ganoderma lucidum immunomodulatory protein (LZ-8) was isolated and purified from red Ganoderma lucidum mycelium extract by Kino et al. in 1989. Extracted LZ-8 contains 1.3% polysaccharides and exhibits mitogenic activity in vitro and immunomodulatory activity in vivo. At the same time, LZ-8 has agglutinating activity against sheep red blood cells but not against human red blood cells (types A, B, AB, and O). In vivo studies have shown that repeated administration of LZ-8 prevents systemic allergic reactions in mice.

[0003] Recombinant Ganoderma lucidum immunomodulatory protein (rLZ-8) is obtained through genetic recombination technology. Compared to natural Ganoderma lucidum immunomodulatory protein, it has the same amino acid sequence and similar activity, but does not contain polysaccharides. Research has shown that rLZ-8 can rapidly and efficiently induce apoptosis in various tumor cells in vitro, and in vivo, it can effectively kill tumor cells in mouse tumor models and maintain or increase white blood cell levels. Furthermore, relevant patents have been published and granted for the effects of rLZ-8 in the treatment of tissue fibrosis, focal cerebral ischemia, thrombocytopenia, osteoporosis, and heart failure.

[0004] Recombinant Ganoderma lucidum immunomodulatory protein variants (rLZ-8 variants) were obtained by mutating one or more amino acids of rLZ-8. Mechanistic studies have shown that rLZ-8 variants bind to the epidermal growth factor receptor (EGFR) on the surface of human cells, are internalized, and remain intracellularly without degradation. High-intensity internalization blocks cell membrane circulation, ultimately causing the cells to shrink, burst, and die. Tumor cell killing experiments have shown that rLZ-8 variants have superior tumor-killing effects compared to rLZ-8. Biacore studies have shown that rLZ-8 variants have higher affinity for EGFR. Mouse experiments using orthotopic tumor models of multiple human cancer cells have shown that rLZ-8 variants prolong mouse survival and suppress tumor growth compared to rLZ-8.

[0005] Although both rLZ-8 and its variants have demonstrated tumor-killing activity, they face challenges in protein expression levels and industrialization. Meanwhile, the safety of protein molecules for human use is also an important consideration in drug development. Summary of the Invention

[0006] The present application provides a recombinant protein comprising a spacer peptide and a recombinant Ganoderma lucidum immunomodulatory protein variant (rLZ-8 variant), wherein the amino acid sequence of the rLZ-8 variant comprises at least one amino acid mutation compared to the amino acid sequence set forth in SEQ ID NO: 10. The recombinant protein of the present application has at least one characteristic selected from the following: (1) a relatively high expression and / or secretion amount (e.g., in a yeast expression system), (2) a relatively high level of safety, satisfying formulation safety requirements, e.g., passing preclinical safety evaluations and / or obtaining approval for clinical trials, (3) being easily taken up by cells through internalization, and (4) having high tumor growth inhibition and tumor cell killing ability.

[0007] According to one aspect, the present application provides a recombinant protein comprising a spacer peptide and a recombinant Ganoderma lucidum immunomodulatory protein variant (rLZ-8 variant), wherein the amino acid sequence of the rLZ-8 variant comprises at least one amino acid mutation compared to the amino acid sequence set forth in SEQ ID NO: 10.

[0008] In some embodiments, the rLZ-8 variant comprises the amino acid sequence set forth in any one of SEQ ID NOs: 13 and 16-21.

[0009] In some embodiments, the rLZ-8 variant comprises the amino acid sequence set forth in SEQ ID NO:13.

[0010] In some embodiments, the spacer peptide comprises 1 to 5 EAs.

[0011] In some embodiments, the spacer peptide comprises two EAs.

[0012] In some embodiments, the spacer peptide comprises the amino acid sequence set forth in any one of SEQ ID NOs: 8-9.

[0013] In some embodiments, the spacer peptide comprises the amino acid sequence set forth in SEQ ID NO:8.

[0014] In some embodiments, the spacer peptide is located at the N-terminus of the rLZ-8 or variant thereof.

[0015] In some embodiments, the recombinant protein comprises the amino acid sequence set forth in any one of SEQ ID NOs: 14, 15, 22-33.

[0016] In some embodiments, the recombinant protein comprises the amino acid sequence set forth in SEQ ID NO:14.

[0017] In another aspect, the present application provides an isolated nucleic acid molecule encoding the recombinant protein.

[0018] In another aspect, the present application provides a vector comprising the isolated nucleic acid molecule.

[0019] In another aspect, the present application provides a cell comprising the isolated nucleic acid molecule and / or the vector.

[0020] In some embodiments, the cell is a eukaryotic cell.

[0021] In some embodiments, the cell is a yeast cell.

[0022] In another aspect, the present application provides a polypeptide comprising the recombinant protein.

[0023] In another aspect, the present application provides a method for preparing the recombinant protein, comprising culturing the cells under conditions for expressing the recombinant protein.

[0024] In another aspect, the present application provides a pharmaceutical composition comprising the recombinant protein, the isolated nucleic acid molecule, the vector, the polypeptide and / or the cell, and optionally a pharmaceutically acceptable carrier.

[0025] In another aspect, the present application provides a kit comprising the recombinant protein, the isolated nucleic acid molecule, the vector, the cell, the polypeptide and / or the pharmaceutical composition.

[0026] In another aspect, the present application provides a drug delivery device comprising the recombinant protein, the isolated nucleic acid molecule, the vector, the cell, the polypeptide and / or the pharmaceutical composition.

[0027] In another aspect, the present application provides a method for preventing, alleviating, or treating a tumor, comprising administering the recombinant protein, the isolated nucleic acid molecule, the vector, the cell, the polypeptide, and / or the pharmaceutical composition to a subject in need thereof.

[0028] In another aspect, the present application provides use of the recombinant protein, the isolated nucleic acid molecule, the vector, the cell, the polypeptide and / or the pharmaceutical composition in the preparation of a medicament for preventing, alleviating or treating a tumor.

[0029] In another aspect, the present application provides the recombinant protein, the isolated nucleic acid molecule, the vector, the cell, the polypeptide and / or the pharmaceutical composition for preventing, alleviating or treating a tumor.

[0030] In some embodiments, the tumor comprises a non-solid tumor.

[0031] In some embodiments, the tumor comprises a solid tumor.

[0032] In some embodiments, the tumor comprises a tumor with EGFR expression and / or aberrant EGFR expression.

[0033] In some embodiments, the tumor comprises a tumor associated with an EGFR mutation. In some embodiments, the tumor comprises a tumor associated with a BRAF mutation. In some embodiments, the tumor comprises a tumor associated with a KRAS mutation. In some embodiments, the tumor comprises a tumor associated with a HER2 mutation.

[0034] In some embodiments, the tumor comprises colorectal cancer, lung cancer, liver cancer, breast cancer, gastric cancer, kidney cancer, bladder cancer, neuroblastoma, ovarian cancer, squamous cell carcinoma, and / or pancreatic cancer. Other aspects and advantages of the present application will become apparent to those skilled in the art from the following detailed description. In the following detailed description, only exemplary embodiments of the present application are shown and described. It will be understood by those skilled in the art that the present application may enable those skilled in the art to modify the specific embodiments disclosed without departing from the spirit and scope of the invention covered by the present application. Correspondingly, the drawings and description herein are illustrative only and not restrictive. [Brief explanation of the drawings]

[0035] Particular features of the invention related to this application are set forth in the appended claims. A better understanding of the features and advantages of the invention related to this application can be obtained by reference to the exemplary embodiments described in detail below and the accompanying drawings, a brief description of which follows.

[0036] [Figure 1] Results are shown for multiple yeast strains expressing rLZ-8 (SEQ ID NO: 10), where M: marker, S: EAEA + rLZ-8 mutant (SEQ ID NO: 14) working reference (1 mg / ml), 1-11: rLZ-8 (SEQ ID NO: 10) strains No. 1-11. [Figure 2] Results are shown for multiple yeast strains expressing rLZ-8 mutant (SEQ ID NO: 13), where M: marker, S: EAEA + rLZ-8 mutant (SEQ ID NO: 14) working reference (1 mg / ml), 1-11: rLZ-8 mutant (SEQ ID NO: 13) strains No. 1-11. [Figure 3] Results are shown for multiple yeast strains expressing EAEA+rLZ-8 (SEQ ID NO: 11) recombinant protein, where M: marker, S: rLZ-8 (SEQ ID NO: 10) working reference (0.5 mg / ml), 1-6: EAEA+rLZ-8 (SEQ ID NO: 11) strains No. 1-6. [Figure 4]The results for multiple yeast strains expressing EAEA+rLZ-8 mutant (SEQ ID NO: 14) recombinant protein are shown, where M: marker, S: rLZ-8 (SEQ ID NO: 10) standard (250 mg / L), and 1-6: EAEA+rLZ-8 mutant (SEQ ID NO: 14) strains No. 1-6. [Figure 5] Results are shown for multiple yeast strains expressing the EEAEAEAEPK+rLZ-8 (SEQ ID NO: 12) recombinant protein, where M: marker, S: EAEA+rLZ-8 mutant (SEQ ID NO: 14) working reference (1 mg / ml), and 1-11: EEAEAEAEPK+rLZ-8 (SEQ ID NO: 12) strains No. 1-11. [Figure 6] Results are shown for multiple yeast strains expressing the EEAEAEAEPK+rLZ-8 mutant (SEQ ID NO: 15) recombinant protein, where M: marker, S: EAEA+rLZ-8 mutant (SEQ ID NO: 14) working reference (1 mg / ml), and 1-11: EEAEAEAEPK+rLZ-8 mutant (SEQ ID NO: 15) strains No. 1-11. [Figure 7] Figure 1 shows a comparison of the expression results of recombinant proteins of rLZ-8 or its mutants bound to different spacer peptides, where M: marker, S: EAEA+rLZ-8 mutant (sequence number 14) working reference (1 mg / ml), 1: rLZ-8 mutant (sequence number 13), 2: EAEA+rLZ-8 mutant (sequence number 14), 3: EEAEAEAEPK+rLZ-8 mutant (sequence number 15), 4: rLZ-8 (sequence number 10), 5: EAEA+rLZ-8 (sequence number 11), 6: EEAEAEAEPK+rLZ-8 (sequence number 12). [Figure 8] Dose-response curve of the recombinant protein shown in SEQ ID NO: 14 acting on the CR20035B organoid system. [Figure 9] 1 shows a dose-response curve of the recombinant protein shown in SEQ ID NO: 14 acting on the CR5043B organoid system. [Figure 10] 1 shows a dose-response curve of the recombinant protein shown in SEQ ID NO: 14 acting on the CR5082B organoid system. [Figure 11]1 shows a dose-response curve of the recombinant protein shown in SEQ ID NO: 14 acting on the CR3099B organoid system. [Figure 12] 1 shows a dose-response curve of the recombinant protein shown in SEQ ID NO: 14 acting on the LU5162B organoid system. [Figure 13] 1 shows a dose-response curve of the recombinant protein shown in SEQ ID NO: 14 acting on the LU11624B organoid system. [Figure 14] 1 shows a dose-response curve of the recombinant protein shown in SEQ ID NO: 14 acting on the LU1235B organoid system. [Figure 15] 1 shows a dose-response curve of the recombinant protein shown in SEQ ID NO: 14 acting on the LI6677B organoid system. [Figure 16] 1 shows a dose-response curve of the recombinant protein shown in SEQ ID NO: 14 acting on the LI6669B organoid system. [Figure 17] 1 shows a dose-response curve of the recombinant protein shown in SEQ ID NO: 14 acting on the BR9457B organoid system. [Figure 18] 1 shows a dose-response curve of the recombinant protein shown in SEQ ID NO: 14 acting on the BR9466B organoid system. [Figure 19] 1 shows a dose-response curve of the recombinant protein shown in SEQ ID NO: 14 acting on the GA6833B organoid system. [Figure 20] 1 shows a dose-response curve of the recombinant protein shown in SEQ ID NO: 14 acting on the GA2434B organoid system. [Figure 21] 1 shows a dose-response curve of the recombinant protein shown in SEQ ID NO: 14 acting on the PA20078B organoid system. [Figure 22] 1 shows a dose-response curve of the recombinant protein shown in SEQ ID NO: 14 acting on the PA0787B organoid system. [Figure 23] This shows the change in survival rate between mice in each treatment group and the control group in the LI6669 human liver cancer orthotopic transplant tumor model. [Figure 24]This shows the killing effect of the rLZ-8 mutant recombinant protein on the lung cancer cell line A549. [Figure 25] 1 shows a comparison of the expression results of recombinant proteins of rLZ-8 or its mutants bound to different spacer peptides, where M: marker, 1: rLZ-8 mutant 4, 2: EAEA+rLZ-8 mutant 4 (sequence number 25), 3: EEAEAEAEPK+rLZ-8 mutant 4 (sequence number 31), 4: rLZ-8 mutant 5, 5: EAEA+rLZ-8 mutant 5 (sequence number 26), 6: EEAEAEAEPK+rLZ-8 mutant 5 (sequence number 32), 7: rLZ-8 mutant 6, 8: EAEA+rLZ-8 mutant 6 (sequence number 27), 9: EEAEAEAEPK+rLZ-8 mutant 6 (sequence number 33). DETAILED DESCRIPTION OF THE INVENTION

[0037] Hereinafter, embodiments of the present invention will be described with reference to specific examples, and those skilled in the art will easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0038] Definition of Terms

[0039] As used herein, the term "recombinant protein" generally refers to a protein produced using recombinant technology. Recombinant proteins include (1) semisynthetic or synthetic polypeptides produced by the combinatorial expression of DNA molecules of different origins linked using recombinant DNA technology, (2) semisynthetic or synthetically derived polypeptides that are unrelated to the moieties to which they are naturally linked, (3) semisynthetic or synthetically derived polypeptides that are linked to polypeptides other than the polypeptides to which they are naturally linked, or (4) semisynthetic or synthetically derived polypeptides that do not exist in nature. For example, the recombinant protein may refer to a polypeptide formed by linking the spacer peptide of the present application with the recombinant Ganoderma lucidum immunomodulatory protein variant (rLZ-8 variant) of the present application.

[0040] As used herein, the term "spacer peptide" generally refers to any oligopeptide or polypeptide that functions to link any domain. In this application, the spacer peptide is located at the N-terminus of the recombinant Ganoderma lucidum immunomodulatory protein (rLZ-8). For example, the spacer peptide may be located between the leader peptide and the recombinant Ganoderma lucidum immunomodulatory protein (rLZ-8). For example, the spacer peptide may be part of a signal peptide. For example, the spacer peptide may promote the secretion of the protein to which it is linked.

[0041] As used herein, the term "Ganoderma lucidum immunomodulatory protein" is also referred to as LZ-8, LZ8, Ling Zhi-8, or Ganoderma lucidum protein 8, and generally refers to an immunomodulatory protein derived from Ganoderma lucidum. LZ-8 also includes its allelic variants, splice variants, derivative variants, substitution variants, deletion variants, and / or insertion variants (including the addition of an N-terminal methionine), fusion polypeptides, and interspecies homologs. As used herein, LZ-8 may also refer to an immunomodulatory protein derived from Ganoderma lucidum. As used herein, the term "recombinant Ganoderma lucidum immunomodulatory protein (rLZ-8)" generally refers to LZ-8 obtained using recombinant methods. For example, the amino acid sequences of LZ-8 and rLZ-8 can be found in UniProtKB Accession No. P14945. As used herein, LZ-8 and rLZ-8 may include the amino acid sequence set forth in SEQ ID NO: 10.

[0042] As used herein, the term "variant" generally refers to a sequence that differs from a reference sequence by containing one or more differences. The reference sequence may be the amino acid sequence of a recombinant Ganoderma lucidum immunomodulatory protein. The differences may be amino acid deletions, insertions, or preferably substitutions. The variant may have the same or different functional effects as the reference sequence.

[0043] In this application, the term "amino acid mutation" generally includes substitutions, deletions, insertions and modifications of one or more amino acids.

[0044] In this application, the term "EA" generally refers to a peptide fragment in which glutamic acid (E) and alanine (A) are linked by a peptide bond.

[0045] As used herein, the term "isolated" generally refers to biological material (e.g., a virus, nucleic acid, or protein) that is substantially free from components that normally accompany or interact with it in its natural environment.

[0046] As used herein, the term "isolated nucleic acid molecule" generally refers to a combination of DNA or RNA, or portions thereof, of genomic, mRNA, cDNA, or synthetic origin, that is not associated with all or part of a polynucleotide with which it is found in its natural environment, or to a polynucleotide with which it would not be associated in its natural environment.

[0047] As used herein, the term "vector" generally refers to a nucleic acid molecule capable of self-replicating in a suitable host that transfers an inserted nucleic acid molecule into and / or between host cells. Such vectors may include vectors primarily used for inserting DNA or RNA into cells, vectors primarily used for replicating DNA or RNA, and vectors primarily used for transcriptional and / or translational expression of DNA or RNA. Vectors also include vectors with the various functions described above. The vector may be a polynucleotide that can be transcribed and translated into a polypeptide when introduced into a suitable host cell. Generally, the vector can produce a desired expression product by culturing a suitable host cell for the vector.

[0048] As used herein, the term "cell" generally refers to an individual cell, cell line, or cell culture that may contain a nucleic acid molecule described herein, or that can express a plasmid or vector containing the nucleic acid molecule, or an antibody or antigen-binding fragment thereof, described herein. The cell may include the progeny of a single host cell. Due to natural, accidental, or deliberate mutation, the progeny may not necessarily be completely identical in morphology or genome to the original parent cell, but may still express the antibody or antigen-binding fragment thereof described herein. The cell may be obtained by transfecting the cell in vitro with a vector described herein. The cell may be a prokaryotic cell (e.g., Escherichia coli) or a eukaryotic cell (e.g., yeast cell, e.g., COS cell, Chinese hamster ovary (CHO) cell, HeLa cell, HEK293 cell, COS-1 cell, NS0 cell, or myeloma cell). Optionally, the cell may be a mammalian cell. For example, the mammalian cell may be a CHO-K1 cell. As used herein, the term "recombinant cell" generally refers to a cell into which a recombinant expression vector has been introduced. The term recombinant host cell includes not only the particular cell but also the progeny of such a cell.

[0049] As used herein, the term "kit" generally refers to a packaged product containing components for treating EGFR expression and / or a condition associated with aberrant EGFR expression for administration of a recombinant protein of the present application. The components of the kit may be contained in separate vials (i.e., a kit with separate components) or may be provided in a single vial. The kit may also include reagents such as buffers, protein stabilization reagents, signal generating systems (e.g., fluorescent signal generating systems), antibodies, control proteins, and test containers. The kit may also include instructions for carrying out the method.

[0050] As used herein, the term "drug delivery device" includes (i) an injection module for administering a pharmaceutical composition having an active ingredient to a subject, (ii) an injectable pharmaceutical composition containing an active ingredient selected from the group consisting of recombinant proteins, nucleic acid molecules, cells, vectors, or combinations thereof, and (iii) an optional drug efficacy monitoring module.

[0051] As used herein, the term "tumor" generally refers to all neoplastic cell growth and proliferation (whether malignant or benign) and all pre-cancerous and cancerous cells and tissues. Tumors may include solid tumors and / or non-solid tumors (e.g., hematologic tumors, lymphomas).

[0052] As used herein, the term "pharmaceutically acceptable carrier" generally refers to a pharmaceutically acceptable carrier, excipient, or stabilizer that is non-toxic at the dosages and concentrations used to treat cells or mammals. Typically, a physiologically acceptable carrier is a pH-buffered aqueous solution. Examples of physiologically acceptable carriers may include buffers, antioxidants, low molecular weight (less than about 10 residues) polypeptides, proteins, hydrophilic polymers, amino acids, monosaccharides, disaccharides, and other carbohydrates, chelating agents, sugar alcohols, salt-forming counterions such as sodium, and / or non-ionic surfactants.

[0053] As used herein, the term "treatment" generally refers to a clinical intervention aimed at altering the natural course of a disease in the individual being treated, and may also aim to achieve prevention or treatment during the clinical course of a disease. Therapeutic effects that meet a need include, but are not limited to, preventing the onset or recurrence of a disease, alleviating symptoms, reducing any direct or indirect pathological effects of a disease, preventing metastasis, slowing the rate of disease progression, improving or alleviating the disease state, and improving or alleviating prognosis. In some cases, the recombinant vectors of the present application may be used to delay the onset of a disease or alleviate the progression of a disease.

[0054] As used herein, the term "administration" generally refers to a method of administering a particular dose of a compound (e.g., an anti-cancer therapeutic agent) or pharmaceutical composition (e.g., a pharmaceutical composition comprising an anti-cancer therapeutic agent) to a subject (e.g., a patient). Administration may be by any suitable means, including parenteral, intrapulmonary, intranasal, and (when necessary for localized treatment) intralesional administration. Parenteral infusion includes intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration.

[0055] In addition to the specific proteins and nucleotides referred to herein, the present application may include functional variants, derivatives, analogs, homologs and fragments thereof.

[0056] The term "functional variant" refers to a polypeptide that has an amino acid sequence that is substantially homologous to a naturally occurring sequence, or that is encoded by a substantially homologous nucleotide sequence, and that has one or more activities of the naturally occurring sequence. In the context of this application, a variant of any given sequence refers to a sequence in which the polypeptide or polynucleotide substantially retains at least one intrinsic function due to modification of a specific sequence of residues (whether amino acid or nucleotide residues) therein. A variant sequence can be obtained by addition, deletion, substitution, modification, substitution and / or mutation of at least one amino acid residue and / or nucleotide residue present in the naturally occurring protein and / or polynucleotide, so long as the original functional activity is maintained.

[0057] As used herein, the term "derivative organism" generally refers to a polypeptide or polynucleotide of the present application that contains any substitution, mutation, modification, replacement, deletion, and / or addition of one or more amino acid residues of the self / paired sequence, so long as the resulting polypeptide or polynucleotide substantially maintains at least one endogenous function. As used herein, the term "analog" generally refers to a polypeptide or polynucleotide that contains any mimetic of a polypeptide or polynucleotide, i.e., a chemical compound that retains at least one endogenous function of the polypeptide or polynucleotide it mimics. Generally, the modified sequence may contain at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 20 or more) amino acid substitutions, so long as the required activity or ability is substantially maintained. Non-naturally occurring amino acid analogs may also be used.

[0058] The proteins or polypeptides used herein may have deletions, insertions, or substitutions of amino acid residues that result in silencing changes and result in functionally equivalent proteins. Deliberate amino acid substitutions may be made based on similarities in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic properties of the residues, so long as the intrinsic function is maintained. For example, negatively charged amino acids include aspartic acid and glutamic acid, positively charged amino acids include lysine and arginine, and amino acids containing nonpolar head groups with similar hydrophilicity values ​​include asparagine, glutamine, serine, threonine, and tyrosine.

[0059] As used herein, the term "homolog" generally refers to an amino acid sequence or nucleotide sequence that shares a certain degree of homology with a wild-type amino acid sequence or nucleotide sequence. The term "homology" is equivalent to sequence "identity." Homologous sequences may include amino acid sequences that are at least 80%, 85%, 90%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical to the subject sequence. Typically, a homolog will include an active site, etc., that is identical to the subject amino acid sequence. Homology may be considered in terms of similarity (i.e., amino acid residues with similar chemical properties / functions) or expressed in terms of sequence identity. As used herein, a sequence with a percent identity to any one of the SEQ ID NOs of a referenced amino acid or nucleotide sequence refers to a sequence with that percent identity over the entire length of the referenced SEQ ID NO.

[0060] To determine sequence homology, sequence alignment can be performed, which can be performed by various means known to those skilled in the art, such as using BLAST, BLAST-2, ALIGN, NEEDLE, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for alignment, including any algorithms needed to achieve optimal alignment over the full length of the sequences being compared.

[0061] In this application, the term "and / or" should be understood to mean either one of the options or two of the options.

[0062] In this application, the term "comprising" generally refers to the inclusion of explicitly specified features but not the exclusion of other elements.

[0063] As used herein, the term "about" generally refers to a variation within 0.5% to 10% of a specified value, such as a variation within 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% of a specified value.

[0064] Details of the invention

[0065] Recombinant proteins

[0066] According to one aspect, the present application provides a recombinant protein comprising a spacer peptide and a recombinant Ganoderma lucidum immunomodulatory protein (rLZ-8) variant, wherein the rLZ-8 may comprise the amino acid sequence set forth in SEQ ID NO: 10. In the present application, the rLZ-8 may comprise an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more) homology to the amino acid sequence set forth in SEQ ID NO: 10.

[0067] According to one aspect, the present application provides a recombinant protein comprising a spacer peptide and a recombinant Ganoderma lucidum immunomodulatory protein variant (rLZ-8 variant), wherein the amino acid sequence of the rLZ-8 variant comprises at least one amino acid mutation compared to the amino acid sequence set forth in SEQ ID NO: 10.

[0068] In the present application, the recombinant protein comprises a spacer peptide and a recombinant Ganoderma lucidum immunomodulatory protein variant (rLZ-8 variant), wherein the amino acid sequence of the rLZ-8 variant may contain one amino acid mutation compared to the amino acid sequence shown in SEQ ID NO: 10.

[0069] In the present application, the recombinant protein comprises a spacer peptide and a recombinant Ganoderma lucidum immunomodulatory protein variant (rLZ-8 variant), wherein the amino acid sequence of the rLZ-8 variant may comprise two amino acid mutations compared to the amino acid sequence shown in SEQ ID NO: 10.

[0070] In the present application, the recombinant protein comprises a spacer peptide and a recombinant Ganoderma lucidum immunomodulatory protein variant (rLZ-8 variant), wherein the amino acid sequence of the rLZ-8 variant may comprise one amino acid mutation compared to the amino acid sequence set forth in SEQ ID NO: 10, and the one amino acid mutation may be located at an amino acid position selected from the group consisting of R9, L17, D20, D70, K46, and K74. For example, the one amino acid mutation may be located at an amino acid position selected from the group consisting of D70, L17, K74, and K46.

[0071] In the present application, the amino acid mutation at L17 may be L17K.

[0072] In the present application, the amino acid mutation at D70 may be D70K.

[0073] In the present application, the amino acid mutation at K46 may be K46E.

[0074] In the present application, the amino acid mutation at K74 may be K74E.

[0075] In the present application, the amino acid mutation at D20 may be D20H.

[0076] In the present application, the amino acid mutation at R9 may be R9A.

[0077] In the present application, the recombinant protein comprises a spacer peptide and a recombinant Ganoderma lucidum immunomodulatory protein variant (rLZ-8 variant), wherein the amino acid sequence of the rLZ-8 variant may comprise one amino acid mutation compared to the amino acid sequence set forth in SEQ ID NO: 10, and the one amino acid mutation may be selected from the group consisting of R9A, L17K, D20H, K46E, D70K, and K74E. Also, for example, the one amino acid mutation may be selected from the group consisting of L17K, K46E, D70K, and K74E.

[0078] In the present application, the recombinant protein comprises a spacer peptide and a recombinant Ganoderma lucidum immunomodulatory protein variant (rLZ-8 variant), wherein the amino acid sequence of the rLZ-8 variant may contain one amino acid mutation compared to the amino acid sequence shown in SEQ ID NO: 10, and the one amino acid mutation may be selected from the group consisting of L17K, D70K, and K46E.

[0079] In the present application, the recombinant protein comprises a spacer peptide and a recombinant Ganoderma lucidum immunomodulatory protein variant (rLZ-8 variant), wherein the amino acid sequence of the rLZ-8 variant may comprise two amino acid mutations compared to the amino acid sequence set forth in SEQ ID NO: 10, and the two amino acid mutations may be selected from the group consisting of K46E and K74E. Alternatively, for example, the two amino acid mutations may be selected from the group consisting of L17K and D70K.

[0080] For example, the rLZ-8 mutant may comprise an amino acid sequence set forth in any one of SEQ ID NOs: 13 and 16 to 21. For example, the rLZ-8 mutant may comprise an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more) homology to the amino acid sequence set forth in any one of SEQ ID NOs: 13 and 16 to 21.

[0081] In the present application, the rLZ-8 variant may comprise the amino acid sequence set forth in SEQ ID NO: 13. For example, the rLZ-8 variant may comprise an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more) homology to the amino acid sequence set forth in SEQ ID NO: 13. In the present application, the amino acid sequence of the rLZ-8 variant may be set forth in SEQ ID NO: 13.

[0082] In the present application, the recombinant protein may include a spacer peptide and rLZ-8, and the rLZ-8 may include the amino acid sequence shown in SEQ ID NO: 10, and the spacer peptide may include 1 to 5 EAs. For example, the spacer peptide may include 2 EAs.

[0083] In the present application, the recombinant protein may comprise a spacer peptide and an rLZ-8 variant, and the rLZ-8 variant may comprise the amino acid sequence set forth in any one of SEQ ID NOs: 13 and 16 to 21, and the spacer peptide may comprise 1 to 5 EAs. For example, the spacer peptide may comprise 2 EAs.

[0084] In the present application, the recombinant protein may comprise a spacer peptide and an rLZ-8 variant, and the rLZ-8 variant may comprise the amino acid sequence shown in SEQ ID NO: 13, and the spacer peptide may comprise the amino acid sequence shown in SEQ ID NO: 8. For example, the recombinant protein may comprise the amino acid sequence shown in SEQ ID NO: 14.

[0085] In the present application, the recombinant protein may comprise a spacer peptide and an rLZ-8 variant, and the rLZ-8 variant may comprise the amino acid sequence shown in SEQ ID NO: 16, and the spacer peptide may comprise the amino acid sequence shown in SEQ ID NO: 8. For example, the recombinant protein may comprise the amino acid sequence shown in SEQ ID NO: 22.

[0086] In the present application, the recombinant protein may comprise a spacer peptide and an rLZ-8 variant, and the rLZ-8 variant may comprise the amino acid sequence shown in SEQ ID NO: 17, and the spacer peptide may comprise the amino acid sequence shown in SEQ ID NO: 8. For example, the recombinant protein may comprise the amino acid sequence shown in SEQ ID NO: 23.

[0087] In the present application, the recombinant protein may comprise a spacer peptide and an rLZ-8 variant, and the rLZ-8 variant may comprise the amino acid sequence shown in SEQ ID NO: 18, and the spacer peptide may comprise the amino acid sequence shown in SEQ ID NO: 8. For example, the recombinant protein may comprise the amino acid sequence shown in SEQ ID NO: 24.

[0088] In the present application, the recombinant protein may comprise a spacer peptide and an rLZ-8 variant, and the rLZ-8 variant may comprise the amino acid sequence shown in SEQ ID NO: 19, and the spacer peptide may comprise the amino acid sequence shown in SEQ ID NO: 8. For example, the recombinant protein may comprise the amino acid sequence shown in SEQ ID NO: 25.

[0089] In the present application, the recombinant protein may comprise a spacer peptide and an rLZ-8 variant, and the rLZ-8 variant may comprise the amino acid sequence shown in SEQ ID NO: 20, and the spacer peptide may comprise the amino acid sequence shown in SEQ ID NO: 8. For example, the recombinant protein may comprise the amino acid sequence shown in SEQ ID NO: 26.

[0090] In the present application, the recombinant protein may comprise a spacer peptide and an rLZ-8 variant, and the rLZ-8 variant may comprise the amino acid sequence shown in SEQ ID NO: 21, and the spacer peptide may comprise the amino acid sequence shown in SEQ ID NO: 8. For example, the recombinant protein may comprise the amino acid sequence shown in SEQ ID NO: 27.

[0091] In the present application, the recombinant protein may comprise a spacer peptide and an rLZ-8 variant, and the rLZ-8 variant may comprise the amino acid sequence shown in SEQ ID NO: 13, and the spacer peptide may comprise the amino acid sequence shown in SEQ ID NO: 9. For example, the recombinant protein may comprise the amino acid sequence shown in SEQ ID NO: 15.

[0092] In the present application, the recombinant protein may comprise a spacer peptide and an rLZ-8 variant, and the rLZ-8 variant may comprise the amino acid sequence shown in SEQ ID NO: 16, and the spacer peptide may comprise the amino acid sequence shown in SEQ ID NO: 9. For example, the recombinant protein may comprise the amino acid sequence shown in SEQ ID NO: 28.

[0093] In the present application, the recombinant protein may comprise a spacer peptide and an rLZ-8 variant, and the rLZ-8 variant may comprise the amino acid sequence shown in SEQ ID NO: 17, and the spacer peptide may comprise the amino acid sequence shown in SEQ ID NO: 9. For example, the recombinant protein may comprise the amino acid sequence shown in SEQ ID NO: 29.

[0094] In the present application, the recombinant protein may comprise a spacer peptide and an rLZ-8 variant, and the rLZ-8 variant may comprise the amino acid sequence shown in SEQ ID NO: 18, and the spacer peptide may comprise the amino acid sequence shown in SEQ ID NO: 9. For example, the recombinant protein may comprise the amino acid sequence shown in SEQ ID NO: 30.

[0095] In the present application, the recombinant protein may comprise a spacer peptide and an rLZ-8 variant, and the rLZ-8 variant may comprise the amino acid sequence shown in SEQ ID NO: 19, and the spacer peptide may comprise the amino acid sequence shown in SEQ ID NO: 9. For example, the recombinant protein may comprise the amino acid sequence shown in SEQ ID NO: 31.

[0096] In the present application, the recombinant protein may comprise a spacer peptide and an rLZ-8 variant, and the rLZ-8 variant may comprise the amino acid sequence shown in SEQ ID NO: 20, and the spacer peptide may comprise the amino acid sequence shown in SEQ ID NO: 9. For example, the recombinant protein may comprise the amino acid sequence shown in SEQ ID NO: 32.

[0097] In the present application, the recombinant protein may comprise a spacer peptide and an rLZ-8 variant, and the rLZ-8 variant may comprise the amino acid sequence shown in SEQ ID NO: 21, and the spacer peptide may comprise the amino acid sequence shown in SEQ ID NO: 9. For example, the recombinant protein may comprise the amino acid sequence shown in SEQ ID NO: 33.

[0098] In the present application, the spacer peptide may be located at the N-terminus of the rLZ-8 or variant thereof, and the recombinant protein may comprise the spacer peptide and the rLZ-8 variant, in that order from the N-terminus to the C-terminus.

[0099] In the present application, the recombinant protein may comprise a spacer peptide and rLZ-8, and the rLZ-8 may comprise the amino acid sequence shown in SEQ ID NO: 10, and the spacer peptide may comprise the amino acid sequence shown in SEQ ID NO: 8.

[0100] In the present application, the recombinant protein may comprise a spacer peptide and rLZ-8, and the rLZ-8 may comprise the amino acid sequence shown in SEQ ID NO: 10, and the spacer peptide may comprise the amino acid sequence shown in SEQ ID NO: 9.

[0101] In the present application, the spacer peptide may be located at the N-terminus of the rLZ-8. In the present application, the recombinant protein may comprise the spacer peptide and the rLZ-8, in that order from the N-terminus to the C-terminus.

[0102] In the present application, the recombinant protein may comprise an amino acid sequence set forth in any one of SEQ ID NOs: 14, 15, and 22 to 33. In the present application, the recombinant protein may comprise an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more) homology to the amino acid sequence set forth in any one of SEQ ID NOs: 14, 15, and 22 to 33.

[0103] For example, the recombinant protein may comprise the amino acid sequence set forth in SEQ ID NO: 14. For example, the recombinant protein may comprise an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more) homology to the amino acid sequence set forth in SEQ ID NO: 14.

[0104] Nucleic acids, vectors and cells

[0105] In another aspect, the present application provides a polypeptide comprising the recombinant protein, wherein the recombinant protein may be covalently or non-covalently linked to another protein or polypeptide.

[0106] In another aspect, the present application provides one or more nucleic acid molecules capable of encoding the recombinant proteins and / or polypeptides described herein. The nucleic acid molecules described herein may be isolated. For example, they may be produced or synthesized by a method such as (i) generation by in vitro amplification, such as polymerase chain reaction (PCR) amplification; (ii) generation by clonal recombination; (iii) purification, such as by enzymatic cleavage and gel electrophoretic fractionation isolation; or (iv) synthesis, such as by chemical synthesis. In some embodiments, the isolated nucleic acid is a nucleic acid molecule prepared by recombinant DNA technology.

[0107] In another aspect, the present application provides a vector that can contain the nucleic acid molecule described herein. The vector may also contain other genes, such as marker genes, that allow for selection of the vector in an appropriate host cell under appropriate conditions. The vector may also contain expression control elements that allow for the correct expression of the coding region in an appropriate host. Such control elements are well known to those skilled in the art and may include, for example, promoters, ribosome binding sites, enhancers, and other control elements that regulate gene transcription or mRNA translation. The vector may include a plasmid, cosmid, virus, phage, or other vectors commonly used in genetic engineering. For example, the vector is an expression vector. For example, the vector is a vector suitable for expression in eukaryotic cells (e.g., yeast cells).

[0108] In another aspect, the present application provides cells that can include the nucleic acid molecules or vectors described herein. In some embodiments, each or each cell can include one or more nucleic acid molecules or vectors described herein. In some embodiments, each or each cell can include multiple (e.g., two or more) or multiple (e.g., two or more) nucleic acid molecules or vectors described herein. For example, a vector described herein can be introduced into the host cell, e.g., a eukaryotic cell such as a plant-derived cell, a fungus, or a yeast cell. The vector described herein can be introduced into the host cell by methods known in the art, such as electroporation, lipofectine transfection, or lipofectamine transfection.

[0109] In another aspect, the present application provides a method for preparing the recombinant protein, comprising culturing the cells under conditions for expressing the recombinant protein, such as using an appropriate medium, an appropriate temperature, and an appropriate culturing time.

[0110] Pharmaceutical compositions, kits and drug delivery devices

[0111] In another aspect, the present application provides pharmaceutical compositions comprising the recombinant protein, the isolated nucleic acid molecule, the vector, the polypeptide, and / or the cell, and optionally a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier is non-toxic to recipients at the dosages and concentrations used and may include buffers, antioxidants, preservatives, low molecular weight (less than about 10 residues) polypeptides, proteins, hydrophilic polymers, amino acids, carbohydrates, salt-forming counterions, metal complexes, and / or non-ionic surfactants. The pharmaceutical compositions of the present application may contain two or more active compounds, generally compounds with complementary activities that do not adversely affect each other. The type and effective amount of such agents will depend, for example, on the amount and type of antagonist present in the formulation and the clinical parameters of the subject. The pharmaceutical compositions described herein may contain a prophylactically and / or therapeutically effective amount of the recombinant protein and / or polypeptide. The prophylactically and / or therapeutically effective amount is the amount necessary to prevent and / or treat (at least partially treat) a disease or condition and / or any complications thereof in a subject suffering from or at risk of developing the disease or condition.

[0112] In another aspect, the present application provides kits comprising the recombinant proteins, the isolated nucleic acid molecules, the vectors, the cells, the polypeptides, and / or the pharmaceutical compositions described herein, which may contain the antigen-binding proteins, vectors, nucleic acid molecules, cells, immunoconjugates, and / or pharmaceutical compositions described herein in a single, commonly used container, optionally in combination with one or more therapeutic agents, optionally formulated into a kit.

[0113] In another aspect, the present application provides a drug delivery device comprising the recombinant protein, the isolated nucleic acid molecule, the vector, the cell, the polypeptide and / or the pharmaceutical composition.

[0114] Treatment method

[0115] In another aspect, the present application provides a method for preventing, alleviating, or treating a tumor, comprising administering the recombinant protein, the isolated nucleic acid molecule, the vector, the cell, the polypeptide, and / or the pharmaceutical composition to a subject in need thereof.

[0116] In another aspect, the present application provides use of the recombinant protein, the isolated nucleic acid molecule, the vector, the cell, the polypeptide and / or the pharmaceutical composition in the preparation of a medicament for preventing, alleviating or treating a tumor.

[0117] In another aspect, the present application provides the recombinant protein, the isolated nucleic acid molecule, the vector, the cell, the polypeptide and / or the pharmaceutical composition for preventing, alleviating or treating tumors.

[0118] For example, the tumor may include a solid tumor and / or a non-solid tumor (eg, a hematoma).

[0119] For example, the tumor may be a tumor with EGFR expression. For example, the tumor may be a tumor associated with aberrant EGFR expression. For example, the tumor may be a tumor with overexpression of EGFR.

[0120] For example, the tumor may include a tumor associated with an EGFR mutation. For example, the tumor may include a tumor associated with a BRAF mutation. For example, the tumor may include a tumor associated with a KRAS mutation. For example, the tumor may include a tumor associated with a HER2 mutation.

[0121] For example, the tumor may be one or more types selected from the group consisting of colorectal cancer, lung cancer, liver cancer, breast cancer, stomach cancer, kidney cancer, bladder cancer, neuroblastoma, ovarian cancer, squamous cell carcinoma, and pancreatic cancer.

[0122] Without intending to be limited by any theory, the following examples are merely to illustrate the respective technical solutions of the present invention, and are not intended to limit the scope of the present invention.

[0123] Example

[0124] Example 1 Construction of expression vectors for rLZ-8 and rLZ-8 mutants

[0125] (1) Using rLZ-8 (amino acid sequence shown in SEQ ID NO: 10) DNA and rLZ-8 mutant (amino acid sequence shown in SEQ ID NO: 13) DNA as templates, respectively, rLZ-8 and rLZ-8 mutant gene fragments were amplified by PCR using forward primer F and reverse primer R. The obtained gene fragments do not contain the EAEA DNA sequence, but contain XhoI and XbaI enzyme cleavage sites at the 5' and 3' ends, respectively.

[0126] The information for forward primer F and reverse primer R is as follows:

[0127] Forward primer F: CCGCTCGAGAAAAGAATGTCTGATACTGCTTTGATCTTCA (SEQ ID NO: 1)

[0128] Reverse primer R: GCTCTAGACTAGTTCCATTGAGCGATA (SEQ ID NO: 2)

[0129] (2) The rLZ-8 (amino acid sequence shown in SEQ ID NO: 10) and rLZ-8 mutant (amino acid sequence shown in SEQ ID NO: 13) gene fragments were cleaved with XhoI / XbaI double enzymes and ligated to an empty expression vector using T4 DNA ligase to obtain recombinant expression vectors.

[0130] Example 2 Construction of expression vectors for rLZ-8 and rLZ-8 mutants containing the EAEA sequence

[0131] (1) Based on Pichia codon preference, and taking into consideration the effects of codon adaptation index and RNA secondary structure analysis, codon optimization was performed on EAEA+rLZ-8 (amino acid sequence shown in SEQ ID NO: 11) and the EAEA+rLZ-8 mutant (amino acid sequence shown in SEQ ID NO: 14). To facilitate the construction of expression vectors, XhoI and XbaI restriction enzyme cleavage sites were added to the 5'- and 3'-ends of the optimized DNA sequence, respectively, and the DNA sequence was artificially synthesized and then loaded into pUC57 cloning vectors, i.e., pUC57-EAEA+rLZ-8 and pUC57-EAEA+rLZ-8 mutant.

[0132] (2) Using EAEA + rLZ-8 (amino acid sequence shown in SEQ ID NO: 11) DNA as a template, the rLZ-8 gene fragment was amplified by PCR using forward primers F3 and R3. The resulting gene fragment contained the EAEA DNA sequence and contained XhoI and XbaI enzyme cleavage sites at the 5' and 3' ends, respectively.

[0133] The information of forward primer F3 and forward primer R3 is as follows:

[0134] Forward primer F3: CCGCTCGAGAAAAGAGAGGCTGAAGCT (SEQ ID NO: 3)

[0135] Reverse primer R3: GCTCTAGATCACTAGTTCCATTG (SEQ ID NO: 4)

[0136] (3) Using EAEA + rLZ-8 mutant (amino acid sequence shown in SEQ ID NO: 14) DNA as a template, the rLZ-8 mutant gene fragment was amplified by PCR using the forward primer M13F and reverse primer M13R. The obtained gene fragment contained the EAEA DNA sequence and contained XhoI and XbaI enzyme cleavage sites at the 5' and 3' ends, respectively.

[0137] The information for the forward primer M13F and the reverse primer M13R is as follows:

[0138] Forward primer M13F: CCCAGTCACGACGTTGTAAAACG (SEQ ID NO: 5)

[0139] Reverse primer M13R:AGCGGATAACAATTTCACACAGG (SEQ ID NO: 6)

[0140] (4) The EAEA+rLZ-8 and EAEA+rLZ-8 mutant gene fragments were digested with Xho I / Xba I double enzymes and ligated into an empty expression vector using T4 DNA ligase to obtain recombinant expression vectors.

[0141] Using a similar method, recombinant proteins of rLZ-8 variant 1 (amino acid sequence shown in SEQ ID NO: 16), rLZ-8 variant 2 (amino acid sequence shown in SEQ ID NO: 17), rLZ-8 variant 3 (amino acid sequence shown in SEQ ID NO: 18), rLZ-8 variant 4 (amino acid sequence shown in SEQ ID NO: 19), rLZ-8 variant 5 (amino acid sequence shown in SEQ ID NO: 20), and rLZ-8 variant 6 (amino acid sequence shown in SEQ ID NO: 21) were each constructed, with the N-terminus linked to the amino acid sequence "EAEA."

[0142] Example 3 Construction of expression vectors for rLZ-8 and rLZ-8 mutants containing the EEAEAEAEPK sequence

[0143] (1) Using EEAEAEAEPK+rLZ-8 DNA (amino acid sequence shown in SEQ ID NO: 12) and EEAEAEAEPK+rLZ-8 mutant (amino acid sequence shown in SEQ ID NO: 15) DNA as templates, EEAEAEAEPK+rLZ-8 and EEAEAEAEPK+rLZ-8 mutant gene fragments were amplified by PCR using forward primer F2 and reverse primer R. The obtained gene fragments contained the EEAEAEAEPK DNA sequence and contained XhoI and XbaI enzyme cleavage sites at the 5' and 3' ends, respectively.

[0144] The information for the forward primer F2 and reverse primer R is as follows:

[0145] Forward primer F2: CCGCTCGAGAAAAGAGAAGAGGCCGAAGCCGAAGCAGAACCTAAAATGTCTGATACTGCTTTGATCTTCA (SEQ ID NO: 7)

[0146] Reverse primer R: GCTCTAGACTAGTTCCATTGAGCGATA (SEQ ID NO: 2)

[0147] (2) The EEAEAEAEPK+rLZ-8 (amino acid sequence shown in SEQ ID NO: 12) and EEAEAEAEPK+rLZ-8 mutant (amino acid sequence shown in SEQ ID NO: 15) gene fragments were cleaved with XhoI / XbaI double enzymes and ligated into an empty expression vector using T4 DNA ligase to obtain recombinant expression vectors.

[0148] Using a similar method, recombinant proteins of rLZ-8 variant 1 (amino acid sequence shown in SEQ ID NO: 16), rLZ-8 variant 2 (amino acid sequence shown in SEQ ID NO: 17), rLZ-8 variant 3 (amino acid sequence shown in SEQ ID NO: 18), rLZ-8 variant 4 (amino acid sequence shown in SEQ ID NO: 19), rLZ-8 variant 5 (amino acid sequence shown in SEQ ID NO: 20), and rLZ-8 variant 6 (amino acid sequence shown in SEQ ID NO: 21) were constructed, each with the N-terminus linked to the amino acid sequence "EEAEAEAEPK."

[0149] Example 4 Construction of Pichia expression strains

[0150] (1) Preparation of competent cells:

[0151] Competent Pichia strains were inoculated into YPD liquid medium and cultured at 28.5°C for 16–18 h until the OD600 reached 1.3–1.5. The culture was then placed in an ice bath for 30 min, then placed on a sterile clean bench and dispensed into four 50 mL centrifuge tubes (40 mL each). The tubes were centrifuged at 1500 g for 5 min at 4°C. The supernatant was discarded, the cells were collected, and thoroughly resuspended in 160 mL of pre-chilled sterile double-distilled water. The tubes were then centrifuged at 1500 g for 5 min at 4°C. The supernatant was discarded again, the cells were collected, thoroughly resuspended in 80 mL of pre-chilled sterile double-distilled water, and centrifuged at 1500 g for 5 min at 4°C. The cells were collected, thoroughly resuspended in 10 mL of pre-chilled sterile 1 M sorbitol solution, and centrifuged at 1500 g for 5 min at 4°C. The bacterial cell pellet was collected and resuspended in 500 μL of pre-chilled sterile 1 M sorbitol solution for use.

[0152] (2) Linearization of recombinant plasmids

[0153] The recombinant plasmid was linearized with BspHI for transfection into yeast cells.

[0154] (3) Electrotransfection

[0155] 80 μL of yeast competent cells were placed in a 2 mm electric cup, and 5–10 μg of linearized recombinant plasmid was added. The mixture was mixed thoroughly and placed on ice for 5 min. The electrotransfection parameters were: V = 1.5 kV, u = 25 μF, R = 200 Ω, and the discharge time was between 4.5 and 4.9 ms. Immediately after electrotransfection, 1 mL of 1 M sorbitol was added and the mixture was incubated at 28.5°C for 1 h. 50–200 μL of the bacterial suspension was plated onto a YPDS solid medium plate containing 100 μg / mL Zeocin antibiotic. The plate was then incubated at 28.5°C for 2–3 days in an incubator.

[0156] Example 5 Screening of high-expression strains

[0157] Zeocin-positive clone colonies were selected, inoculated into 10 mL of YPD liquid medium, and cultured. The OD value was measured at 600 nm using a spectrophotometer until the OD value reached approximately 6. 40 μl of the activated bacterial solution was inoculated into 25 mL of fresh YPD liquid medium and cultured at 28.5°C and 225 rpm for 72 hours. 1 mL of the bacterial solution was centrifuged at 13,000 g and 4°C, and the supernatant was subjected to SDS-PAGE electrophoresis to detect the expression of multiple clones of target proteins in the six expression vectors constructed in Examples 1 to 3.

[0158] The screening results for high-expression yeast strains are shown in Figures 1 to 6. The expression levels of rLZ-8 (SEQ ID NO: 10) and clone No. 3 were relatively high (Figure 1), the expression levels of the rLZ-8 mutant (SEQ ID NO: 13) and clone No. 10 were relatively high (Figure 2), the expression levels of EAEA+rLZ-8 (SEQ ID NO: 11) and clone No. 6 were relatively high (Figure 3), the expression levels of the EAEA+rLZ-8 mutant (SEQ ID NO: 14) and clone No. 7 were relatively high (Figure 4), the expression levels of EEAEAEAEPK+rLZ-8 (SEQ ID NO: 12) and clone No. 7 were relatively high (Figure 5), and the expression levels of EEAEAEAEPK+rLZ-8 mutant (SEQ ID NO: 15) and clone No. 2 were relatively high (Figure 6).

[0159] Example 6 Effect of different spacer sequences on rLZ-8 and rLZ-8 mutant protein expression

[0160] (1)

[0161] According to the method of Example 5, the expression of the target protein in the multiple expression vectors constructed in Examples 1 to 3 was compared, and the results are shown in FIG.

[0162] EAEA has a stimulatory effect on the expression and secretion of both rLZ-8 (sequence number 10) and rLZ-8 mutant (sequence number 13), and its stimulatory effect on rLZ-8 mutant (sequence number 13) is superior to that on rLZ-8 (sequence number 10) (lanes 1, 2, 4, and 5 in Figure 7).

[0163] EEAEAEAEPK has a promoting effect on the expression and secretion of both rLZ-8 (sequence number 10) and the rLZ-8 mutant (sequence number 13), and the promoting effect of EEAEAEAEPK on rLZ-8 (sequence number 10) is superior to that of the rLZ-8 mutant (sequence number 13) (lanes 1, 3, 4, and 6 in Figure 7).

[0164] Both EAEA and EEAEAEAEPK have the effect of improving protein expression and secretion, but their promoting effects on the expression and secretion of different proteins differ, with EAEA having the optimal promoting effect on the rLZ-8 mutant (sequence number 13) (lanes 1, 2, and 3 in Figure 7), while EEAEAEAEPK has the optimal promoting effect on rLZ-8 (sequence number 10) (lanes 4, 5, and 6 in Figure 7).

[0165] (2)

[0166] According to the method of Example 5, the expression of target proteins (based on rLZ-8 mutant 4 to rLZ-8 mutant 6) in the nine expression vectors constructed in Examples 1 to 3 was compared, and the results are shown in Figure 25.

[0167] The results showed that EAEA had the effect of improving protein expression and secretion, and had the optimal promoting effect on rLZ-8 mutant 4 (sequence number 19), rLZ-8 mutant 5 (sequence number 20) and rLZ-8 mutant 6 (sequence number 21).

[0168] Example 7 Structural identification of recombinant proteins

[0169] In this example, the N-terminal amino acid sequences of EAEA+rLZ-8 (SEQ ID NO: 11), EAEA+rLZ-8 mutant (SEQ ID NO: 14), EEAEAEAEPK+rLZ-8 (SEQ ID NO: 12), EEAEAEAEPK+rLZ-8 mutant (SEQ ID NO: 15), rLZ-8 (SEQ ID NO: 10), and rLZ-8 mutant (SEQ ID NO: 13) proteins were measured. The recombinant proteins were hydrolyzed with trypsin, and the peptide segments produced by hydrolysis were separated by reverse-phase chromatography. The amino acids of each peptide segment were analyzed by mass spectrometry to obtain the N-terminal amino acid sequences. The specific steps are as follows:

[0170] (1) Preparation of sample solution 250 μg of recombinant protein was added to 200 μl of 10 M urea solution, and the total volume was increased to 250 μl with water. After uniform mixing, the mixture was placed in a thermostatic mixer and incubated at 65°C for 30 min. After incubation, the sample was cooled to room temperature, and the buffer solution was replaced with 0.1 M ammonium bicarbonate solution using an SEC column. The final protein concentration was measured using a microspectrophotometer.

[0171] (2) Enzymatic Decomposition

[0172] 50 μg of sample protein was diluted to 0.5 μg / μl with 0.1 M ammonium bicarbonate solution, 0.5 μg of trypsin was added, and the mixture was mixed uniformly and incubated at 37°C for 20 hours. After incubation, the enzymatic degradation reaction was stopped by adding an equal volume of 0.1% formic acid solution or by heating at 4°C. The solution was centrifuged at 12,000 rpm at 4°C for 2 minutes, and the supernatant was sampled and analyzed for detection.

[0173] (3) Chromatography conditions and elution procedures

[0174] 3.1 Chromatography conditions [Table 1]

[0175] 3.2 Elution procedure [Table 2]

[0176] The results showed that the N-terminal amino acid sequences of the above recombinant proteins all matched the theoretical sequences.

[0177] Example 8 Detection of tumor cell-killing effects of EAEA+rLZ-8 mutant and EEAEAEAEPK+rLZ-8 mutant

[0178] The in vitro tumor cell killing activity of the EAEA + rLZ-8 mutant (SEQ ID NO: 14) and the EEAEAEAEPK + rLZ-8 mutant (SEQ ID NO: 15) against human non-small cell lung cancer (A549) cells was measured using the CellTiter™-Flour Cell Viability Assay Reagent Kit. The recombinant proteins were diluted with 2% fetal bovine serum medium to prepare 11 test solutions: 100 μg / mL, 50 μg / mL, 25 μg / mL, 12.5 μg / mL, 6.25 μg / mL, 3.125 μg / mL, 1.5625 μg / mL, 0.78125 μg / mL, 0.390625 μg / mL, 0.1953125 μg / mL, and 0.09765625 μg / mL.

[0179] The dilutions were added at 100 μL per well to a 96-well plate containing A549 cells. Three parallel wells were prepared for each concentration group and marked with a symbol. A cell control group (i.e., containing cells only) was prepared at 100 μL per well and consisted of six parallel wells. These were then cultured in a CO2 incubator at 5% CO2 and 37°C for 48 hours.

[0180] 100 μL of the prepared CellTiter™-Flour Cell Viability Assay Reagent (1 ml Assay Buffer, 1 μL GF-AFC Substrate) was added to each well, and the wells were shaken to mix evenly. The wells were then incubated in a CO2 incubator at 5% CO2 and 37°C for at least 30 minutes. Fluorescence was detected at wavelengths of 400EX / 505EM using a microplate reader, and the IC50 value was calculated.

[0181] The results are shown in Figure 24 (wherein Group 1 and Group 2 correspond to the results for EAEA + rLZ-8 mutant (SEQ ID NO: 14) and EEAEAEAEPK + rLZ-8 mutant (SEQ ID NO: 15), respectively). The IC50 of EAEA + rLZ-8 mutant (SEQ ID NO: 14) was 1.21 μg / ml, and the IC50 of EEAEAEAEPK + rLZ-8 mutant (SEQ ID NO: 15) was 1.91 μg / ml. The results showed that both EAEA + rLZ-8 mutant (SEQ ID NO: 14) and EEAEAEAEPK + rLZ-8 mutant (SEQ ID NO: 15) had killing effects on the lung cancer cell line A549, but the killing effect of EAEA + rLZ-8 mutant (SEQ ID NO: 14) was superior to that of EEAEAEAEPK + rLZ-8 mutant (SEQ ID NO: 15).

[0182] Example 9 Inhibition of tumor growth in vitro by recombinant proteins (PDXO model)

[0183] The day before the experiment (day 1), the required number of organoids were treated at a 1:1 ratio with 50% Matrigel to define the correct size of organoids for performing the screening.

[0184] Day 0: Organoid inoculation

[0185] a) 20 μl of 100x Dispase solution was added to a 6-well plate (containing 2 mL of organoid culture medium) and organoids were collected from each well. b) The 6-well plate was returned to the incubator and cultured at 37°C for 30 minutes. c) Organoids were collected from the 6-well plate and transferred to a 50 mL plastic tube using a pre-wetted 100 μm filter. d) After all wells had been filtered through the 100 μm filter, the stream was filtered through a pre-wetted 20 μm filter. e) The 20 μm filter was inverted and the organoids were collected into a new 50 mL tube. f) The organoids were collected and resuspended in the corresponding culture medium. The organoid concentration was calculated and the concentration was obtained. g) The cell concentration was adjusted to the appropriate concentration with culture medium. h) Matrigel was added to a final concentration of 5% v / v and the organoids were resuspended on ice. i) 40 μL of the cell suspension was added to a 384-well plate using a Multidrop dispenser. The inoculation density is shown in Table 1 below, and was related to the organoid morphology and growth conditions. j) The screening plate was returned to the incubator before adding the recombinant protein. The organoids were treated by adding the recombinant protein solution 2 to 4 hours after inoculation. The amino acid sequence of the spacer sequence of the recombinant protein used in the examples is shown in SEQ ID NO: 8, the amino acid sequence of the rLZ-8 mutant is shown in SEQ ID NO: 13, and the amino acid sequence of the recombinant protein is shown in SEQ ID NO: 14. [Table 3]

[0186] Day 5: At the end of the detection period, the luminescent CTG signal of the detection plate was read. 40 μL of CTG 3D was added to each well using a Multidrop dispenser, and the contents were mixed in a plate oscillator for 5 minutes, then incubated at room temperature in the dark for 30 minutes. The luminescent signal was read using an Envision plate reader.

[0187] Data Analysis:

[0188] The data were displayed graphically using GraphPad Prism 5.0. The formula for calculating survival rate is shown below.

[0189] Viability (%) = (LumTest article - LumMedium control) / (LumNone treated - LumMedium control) × 100%. Because the positive control (staurosporine, 5 μM) was designed to kill all or nearly all organoids, the medium was also controlled as a positive control (staurosporine, 5 μM).

[0190] (1) Colorectal cancer [Table 4]

[0191] The results, as shown in Table 2 and Figures 8 to 11, indicated that the recombinant protein shown in sequence number 14 had inhibitory effects on colorectal cancer cells with EGFR wild-type (CR20035B, Figure 8), KRAS mutation (CR5043B, Figure 9), BRAF mutation (CR5082B, Figure 10), and EGFR and KRAS co-mutation (CR3099B, Figure 11).

[0192] (2) Lung cancer [Table 5]

[0193] The results, as shown in Table 3 and Figures 12 to 14, indicated that the recombinant protein shown in sequence number 14 has an inhibitory effect on EGFR wild-type (LU1235B, Figure 14), KRAS mutated (LU5162B, Figure 12), and BRAF mutated (LU11624B, Figure 13) lung cancer cells.

[0194] (3) Liver cancer [Table 6]

[0195] The results, as shown in Table 4 and Figures 15 and 16, indicated that the recombinant protein shown in SEQ ID NO: 14 had an inhibitory effect on EGFR wild-type liver cancer cells (LI6677B, Figure 15 and LI6669B, Figure 16).

[0196] (4) Breast cancer [Table 7]

[0197] The results, as shown in Table 5 and Figures 17 and 18, indicated that the recombinant protein shown in Sequence No. 14 has an inhibitory effect on HER2-mutated breast cancer cells (BR9457B, Figure 17 and BR9466B, Figure 18).

[0198] (5) Gastric cancer [Table 8]

[0199] The results, as shown in Table 6 and Figures 19 and 20, indicated that the recombinant protein shown in sequence number 14 has an inhibitory effect on EGFR wild-type (GA6833B, Figure 19) and BRAF-mutated (GA2434B, Figure 20) gastric cancer cells.

[0200] (6) Pancreatic cancer [Table 9]

[0201] The results, as shown in Table 7 and Figures 21 and 22, indicated that the recombinant protein shown in sequence number 14 has an inhibitory effect on both EGFR wild-type (PA20078B, Figure 21) and pancreatic cancer cells with simultaneous mutations in KRAS and BRAF (PA0787B, Figure 22).

[0202] Example 10: Inhibition of tumor growth in vivo by recombinant proteins (PDX model)

[0203] In this example, the efficacy of the test substance, the recombinant protein shown in SEQ ID NO: 14, was evaluated in a BALB / c male nude mouse model orthotopically transplanted with liver cancer LI6669.

[0204] Experimental design:

[0205] The number of animals in each group and the detailed route of administration, dose and administration schedule are shown in Table 8 below. [Table 10]

[0206] Here, ip stands for intraperitoneal injection, iv stands for tail vein injection, and po stands for oral gavage.

[0207] The main observations of this experiment are as follows:

[0208] Relative tumor growth rate T / C (%), i.e., the relative tumor volume or tumor weight percentage between the treatment and control groups at a given time point, is calculated as follows:

[0209] T / C% = TRTV / CRTV x 100% (TRTV: average RTV of the treatment group, CRTV: average RTV of the control group, RTV = Vt / V0, where V0 is the tumor volume of the animal at the time of grouping, and Vt is the tumor volume of the animal after treatment).

[0210] Alternatively, T / C% = TTW / CTW x 100% (TTW: mean tumor weight in the treatment group at the end of the experiment, CTW: mean tumor weight in the control group at the end of the experiment).

[0211] The relative tumor inhibition rate (TGI) (%) is calculated using the following formula:

[0212] TGI% = (1 - T / C) x 100% (T and C are the relative tumor volume (RTV) or tumor weight (TW) of the treatment and control groups, respectively, at a particular time point).

[0213] Experimental animals: [Table 11]

[0214] Environmental conditions for the animal care room: [Table 12]

[0215] Experimental Method:

[0216] LI6669 is a HuPrime® orthotopic transplant model established from a liver cancer lesion in an Asian patient, which has a particular tendency for tumors to rupture.

[0217] Tumor tissue was collected from mice bearing the HuPrime® liver cancer orthotopic transplant model LI6669, cut into tumor pieces 2-3 mm in diameter, and inoculated into the left upper lobe of the liver of Balb / c nude mice.

[0218] When the average tumor volume of tumor-bearing mice reached approximately 50–150 mm, the mice were randomly assigned to groups based on their body weight according to Table 3 in "3. Experimental Design." The day of group assignment was defined as Day 0, and administration began on Day 1.

[0219] Mice were grouped based on their body weight using StudyDirector™ (version number 3.1.399.19, supplier Studylog System, Inc., San Francisco, CA, USA).

[0220] The "Matched distribution" random grouping method was selected for grouping, and the algorithm matched the weight measurements of all selected individual animals with the average value of all selected animals. First, pairs of average values ​​of all selected animals were selected, and then animals were assigned to groups so that the average value of the group matched (or was as close as possible to) the average value of all selected animals. The final average value of the measurement results of each group was as close as possible to the final average value of the other groups.

[0221] Experimental Observations and Data Collection:

[0222] Regular monitoring after tumor cell inoculation included tumor growth and the effects of treatment on the animals' normal behavior, including activity, food and water intake, weight gain / loss, and eye, fur, and other abnormalities. All clinical symptoms observed during the study were recorded in the raw data. After the start of treatment, mice were weighed twice a week. Based on observations, mice requiring euthanasia and the corresponding survival times were recorded.

[0223] Tumor volume was measured at the end of the experiment when the mice were dissected. The formula for tumor volume calculation was: tumor volume (mm3) = 1 / 2 × (a × b2), where a represents the major axis and b represents the minor axis. Data collection during the experiment included measurements of the major and minor axes of the tumor and animal weights using StudyDirector™ (version 3.1.399.19, provided by Studylog Systems, Inc.). Raw data were measured using a balance and calipers and then directly imported into the software. Any changes in data were also recorded in the software. All processes, including administration, tumor measurement, and weight measurement, were performed in a biological safety cabinet or clean bench.

[0224] Statistical analysis:

[0225] To compare tumor volumes on specific days between different treatment groups, we first used Bartlett's test to verify the assumption of homogeneity of variance across all groups. If the p-value of Bartlett's test was 0.05 or greater, one-way analysis of variance was used to test for equality of means across all groups. If the p-value of one-way analysis of variance was less than 0.05, pairwise comparisons were made across all groups using Tukey's honest significant difference test, or pairwise comparisons were made between each treatment group and the control group using Dunnett's t test. If the p-value of Bartlett's test was less than 0.05, Kruskal Wallis test was used to test for equality of medians across all groups. If the p-value of Kruskal Wallis test was less than 0.05, pairwise comparisons were made across all groups using Conover's test, or pairwise comparisons were made between each treatment group and the control group, with the corresponding p-value corrected based on the number of groups for multiple tests.

[0226] For exploratory data analysis, pairwise comparisons were also performed between all groups at any given time point. Such comparisons did not require correction for multiple detection, as they only used tumor volume data from the two groups being compared at a given time point. First, the assumption of homogeneity of variance between the two groups was verified using Bartlett's test. If the p-value of Bartlett's test was 0.05 or greater, the mean values ​​of the two groups were compared using Welch's t test. If the p-value of Bartlett's test was less than 0.05, the median values ​​of the two groups were compared using Mann-Whitney U test.

[0227] All statistical analyses and graphic plots were performed in the R language environment (version 3.3.1). Unless otherwise stated, all findings were two-sided, and a p-value of less than 0.05 was considered statistically significant.

[0228] Test Results:

[0229] The results are shown in Table 9 and Figure 23. The median survival time of the recombinant protein of SEQ ID NO: 14 5 mg / kg (ivQ3D) group (greater than 28 days) was longer than that of the control group (17 days), which was statistically significant (p<0.05). Furthermore, none of the recombinant protein of SEQ ID NO: 14 groups showed any obvious toxic effects on mice. It was demonstrated that the recombinant protein of the present application can effectively extend the survival time of mice with liver cancer. [Table 13]

[0230] Notes: a. Mean ± SEM, b. Compared to Group 1.

[0231] Example 11 In vitro efficacy experiments with recombinant proteins

[0232] In this experiment, the inhibitory effect of Erbitux on the proliferation of the A431 cell line was used as a positive control to examine the inhibitory effect of the recombinant protein shown in SEQ ID NO: 14 on the proliferation of multiple cancer cell lines. In this experiment, cell viability was detected using the Promega Cell Titer-Glo kit. The reagent contained recombinant luciferase and luciferin, and luciferase catalyzed the oxidation of the substrate, emitting a luminescent signal. The oxidation reaction depended on the ATP released after lysis of viable cells, and the luminescent signal generated by the reaction could indirectly reflect the number of viable cells.

[0233] The specific steps are as follows:

[0234] 1) Target cells were collected and counted, and the cells were seeded into 96-well plates.

[0235] 2) The 96-well plate was placed in a cell incubator at 37°C and incubated for approximately 16 to 20 hours.

[0236] 3) Pre-prepared ready-to-measure sample working solutions and positive controls were added to the corresponding wells.

[0237] 4) The cells were cultured in a cell incubator at 37°C for 72 hours.

[0238] 5) After incubation, the Cell TiterGlo detection reagent working solution was added to the corresponding wells and left at room temperature to allow the signal to stabilize.

[0239] 6) Read and detected using PHERAStar FSX.

[0240] The results are shown in Table 10. At a concentration of 0.1 mg / mL, the recombinant protein shown in SEQ ID NO: 14 had a certain growth inhibitory effect on 5637, hCI-H292, Calu-1, ACHN, AsPC-1, OVCAR8, SK-N-AS, Bel-7402, SK-HEP-1, MDA-MB-468, A431, HEP G2, MDA-MB-453, HLE, A549, and SNU-398. [Table 14]

[0241] Example 12 Preclinical safety evaluation of recombinant proteins

[0242] (1) In vitro hemolysis experiment of human red blood cells

[0243] In this example, it was investigated whether the recombinant protein shown in SEQ ID NO: 14 causes lysis or agglutination of human erythrocytes in vitro.

[0244] An in vitro test tube method was used to observe the effect of the test product (i.e., the recombinant protein shown in SEQ ID NO: 14) on the lysis and aggregation of human red blood cells, and the concentration of the preparation used was 2.5 mg / mL.

[0245] Red blood cells were collected from healthy individuals and suspended in sodium chloride injection to a 2% (v / v) concentration. Different volumes (2.5 mL-2.9 mL) of sodium chloride injection and different volumes (0.5 mL-0.1 mL) of the test sample were added to glass test tubes containing 2.0 mL of a 2% human red blood cell suspension. At the same time, 3.0 mL of sodium chloride injection and 3.0 mL of sterile water for injection were added to glass test tubes containing 2.0 mL of a 2% human red blood cell suspension as negative and positive controls, respectively. The total volume of each test tube was 5.0 mL. The tubes were then placed in an electric incubator and incubated for 3 hours to observe the lysis and aggregation of red blood cells.

[0246] As a result, in the test tube and the negative control sodium chloride injection tube, red blood cells were confirmed to have settled to the bottom of the tube, the upper layer solution was colorless and transparent, and after shaking, the red blood cells at the bottom of the tube were evenly dispersed, with no hemolysis or aggregation. In contrast, the solution in the positive control sterile injection tube was clear red with no stratification and no cells remaining at the bottom of the tube, indicating complete hemolysis in the positive control sterile injection tube.

[0247] As can be seen from the above, the test product with a formulation concentration of 2.5 mg / mL did not have a hemolytic effect on human red blood cells in vitro and did not cause red blood cell aggregation.

[0248] (2) Toxicity test on Bama miniature pigs

[0249] In this example, the toxic reactions and in vivo metabolic status after intravenous injection of the recombinant protein shown in sequence number 14 into Bama minipigs were studied, as well as the recovery status of the toxic reactions 4 weeks after the end of the administration period.

[0250] Forty Bama minipigs (20 males and 20 females) were randomly assigned to four groups, with five males and five females in each group. Group 1 received a placebo as an adjuvant control, while Groups 2, 3, and 4 received the test product (i.e., the recombinant protein set forth in SEQ ID NO: 14) at 0.5 mg / kg, 1.5 mg / kg, and 5.0 mg / kg, respectively. The test product was administered intravenously once daily for 28 consecutive days. The administration volume was 2 mL / kg, and the infusion rate was 30 mL / kg / h. The first three animals per sex per group were euthanized four weeks after administration (D29). The remaining two animals per sex per group were euthanized four weeks after the final administration (D57).

[0251] During the study, animals were subjected to clinical observations, body weight, temperature, electrocardiogram, ophthalmological examination, blood counts, coagulation function, blood biochemistry, urinalysis, T lymphocyte subsets, antibody detection, toxicokinetics, organ weights, gross observations and histopathological examinations.

[0252] As a result, when Bama minipigs were repeatedly intravenously injected with doses of 0.5mg / kg, 1.5mg / kg, and 5mg / kg once daily for 28 consecutive days, none of the animals in each group died or became moribund, and no serious clinical toxicity or side effects were observed. No toxicologically significant changes were observed in the body weight and weight gain, ophthalmological examination, urinalysis, or T lymphocyte subsets of the animals in each dose group. No statistically significant changes were observed in the organ weight and organ weight / brain weight ratio of each dose group on D29 or D57. No abnormal changes related to the test product were observed in either macroscopic or microscopic observations at the end of the administration period (D29) or the end of the recovery period (D57).

[0253] (3) Safety pharmacology studies on the effects on respiratory system function

[0254] In this example, the effect of intravenous administration of the recombinant protein shown in SEQ ID NO: 14 on respiratory system function in rats was studied.

[0255] Forty SD rats (20 males and 20 females, SPF grade) were randomly divided into four groups, with 10 rats (5 males and 5 females) in each group. The control supplement and the test product (i.e., the recombinant protein shown in SEQ ID NO: 14) were administered at 0.5, 2, and 8 mg / kg, respectively, via a single intravenous injection. The administration volume was 10 mL / kg. The animals were placed in a recording box on the day before administration, and 10 minutes and 24 hours after administration to detect the animal's respiratory function index.

[0256] The results showed that compared with the adjuvant control group, the animals in the test product group showed no statistically significant difference (P>0.05) or trend of change in tidal volume, minute ventilation, and respiratory frequency on the day before administration, 10 minutes, and 24 hours after administration.

[0257] Therefore, a single intravenous injection of the test substance at doses of 0.5, 2, and 8 mg / kg did not have any obvious effect on the respiratory system function of SD rats.

[0258] (4) Safety pharmacology studies on the effects on central nervous system function

[0259] In this example, the effect of intravenous administration of the recombinant protein shown in SEQ ID NO: 14 on central nervous system function in rats was studied.

[0260] Forty SD rats (20 males and 20 females, SPF grade) were randomly divided into four groups, with 10 rats per group (5 males and 5 females). The control supplement and the test product (i.e., the recombinant protein shown in SEQ ID NO: 14) were administered at 0.5, 2, or 8 mg / kg intravenously. The administration volume was 10 mL / kg. In a blinded design, administration information was kept confidential by the experimental observer. The animals were observed using functional observation (FOB) on the day before administration, 10 minutes, and 24 hours after administration by the same experimental observer, and the results were recorded. The functional observation included cage observation, manual grasping observation, open-air observation, stimulus response observation, forelimb claw grip strength, hind limb open area, and body temperature measurement. Pre-administration data were subtracted from post-administration data for statistical analysis.

[0261] As a result, compared to the control group, the animals in each test product group showed no abnormalities in cage observation, hand-grasping observation, open environment observation, stimulus response, forelimb claw grip strength, hind limb open range, or body temperature 10 minutes and 24 hours after administration.

[0262] A single intravenous injection of the test substance at doses of 0.5, 2, and 8 mg / kg had no obvious effect on the central nervous system function of SD rats.

[0263] (5) Safety pharmacology studies on the effects on cardiovascular function

[0264] In this example, the effect of intravenous administration of the recombinant protein set forth in SEQ ID NO: 14 on cardiovascular function in conscious Bama minipigs was studied.

[0265] Eight Bama minipigs (four males and four females, normal grade) were used, and the test product (i.e., the recombinant protein shown in SEQ ID NO: 14) and supplemental control were administered intravenously in a crossover design at doses of 0.5 and 3 mg / kg (the doses of 0.5 mg / kg and 3 mg / kg of the test product are approximately 8.4 and 50.6 times the effective dose, respectively), with an administration volume of 2 mL / kg and an administration rate of 30 mL / kg / h. Data on various indicators such as animal electrocardiograms, blood pressure, and body temperature were collected from at least 2 hours before administration to approximately 48 hours after administration, and statistical analysis and evaluation of each indicator data such as electrocardiograms, blood pressure, and body temperature was performed at the following detection points: 1.5 hours before administration, and 0.25 hours (±5 min), 0.5 hours (±5 min), 1 hour (±10 min), 1.5 hours (±10 min), 2 hours (±10 min), 3 hours (±15 min), 4 hours (±20 min), 6 hours (±30 min), 8 hours (±45 min), 12 hours (±45 min), 24 hours (±1 hour), and 48 hours (±1 hour) after administration.

[0266] The results showed that, compared with the adjuvant control, after administration of 3 mg / kg of the test product, heart rate increased from 0.5 to 6 hours, QTcB interval shortened from 2 to 4 hours, and T-wave voltage increased from 0.5 to 6 hours.

[0267] Heart rate related changes occurred in the RR, PR and QT intervals after administration of 3 mg / kg test article compared to adjuvant control.

[0268] At each dose of the test substance, the animals' other electrocardiogram indices (QRS duration, QRS voltage, ST segment voltage, Tp-e interval, P wave width), blood pressure indices (systolic blood pressure, diastolic blood pressure, mean arterial pressure, pulse pressure difference) and body temperature were not statistically different (P>0.05) from the adjuvant control at the same time points, and no trend for change was observed.

[0269] It was found that intravenous administration of the test product within the effective dose range had no significant effect on cardiovascular function and body temperature in conscious Bama minipigs.

[0270] As can be seen from the above, the test product showed no potential toxic target organs within the effective dose range, no irreversible toxicity, and no obvious effects on the central nervous system, respiratory system, and cardiovascular system functions.

[0271] The foregoing detailed description has been provided by way of illustration and example, and is not intended to limit the scope of the appended claims. Various modifications to the presently recited embodiments will be apparent to those skilled in the art and are intended to remain within the scope of the appended claims and their equivalents.

Claims

1. A recombinant protein comprising a spacer peptide and a recombinant Ganoderma lucidum immunomodulatory protein variant (rLZ-8 variant), The recombinant protein comprises an amino acid sequence set forth in any one of SEQ ID NOs: 14, and 22 to 27. Recombinant proteins.

2. Comprising the amino acid sequence set forth in SEQ ID NO: 14, The recombinant protein of claim 1.

3. Encoding the recombinant protein of claim 1 Isolated nucleic acid molecule.

4. The isolated nucleic acid molecule of claim 3, vector.

5. The isolated nucleic acid molecule of claim 3, cell.

6. It is a eukaryotic cell, The cell of claim 5.

7. The yeast cells The cell of claim 5.

8. 10. The recombinant protein of claim 1, Polypeptide.

9. 10. A method for preparing the recombinant protein of claim 1, comprising: Culturing the cell of claim 5 under conditions to express the recombinant protein of claim 1. method.

10. 10. A method for producing a recombinant protein comprising the recombinant protein of claim 1 and optionally a pharmaceutically acceptable carrier. Pharmaceutical compositions.

11. 10. The recombinant protein of claim 1, kit.

12. 10. The recombinant protein of claim 1, Drug delivery devices.

13. The pharmaceutical composition according to claim 10 for preventing, alleviating or treating tumors.

Images