Constructs and methods for preparing circular RNA
The method addresses inefficiencies in circRNA production by using linear RNAs with double-stranded regions and RNA ligase to form circRNAs, achieving high-yield and functional circRNAs without splint oligonucleotides.
Patent Information
- Application Number
- JP2024513118
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-08-27
- Filing Date
- 2022-03-22
- Publication Date
- 2025-11-26
- Estimated Expiration
- 2042-03-22
AI Technical Summary
Current methods for generating circular RNAs (circRNAs) are inefficient and introduce unwanted sequences or require splint oligonucleotides, leading to inaccuracies and polymeric by-products.
A method involving linear RNAs with a double-stranded region and a nick that are ligated by RNA ligase to form circRNAs without the need for splint oligonucleotides, using constructs with stable double-stranded regions and specific RNA elements like IRES to facilitate accurate ligation.
Enables high-yield, accurate production of circRNAs without additional sequences, maintaining functional roles like translation promotion and avoiding immunogenicity.
Smart Images

Figure 0007776176000005 
Figure 0007776176000006 
Figure 0007776176000007
Abstract
Description
[Technical Field]
[0001] [CROSS-REFERENCE TO RELATED APPLICATIONS] This application claims priority to International Patent Application No. PCT / CN2021 / 115029, filed on August 27, 2021, the entire contents of which are incorporated herein by reference.
[0002] [ Te Submitting a sequence listing in a text file Te Submitted in text file Amendment is incorporated herein by reference in its entirety. do.
[0003] The present application relates to constructs and methods for preparing circular RNAs (circRNAs) comprising effector RNA (e.g., coding RNA) sequences, the circRNAs prepared thereby, and methods for using the same. [Background technology]
[0004] Although coding-capable circular RNAs (circRNAs) have been discovered in recent years, accurately and efficiently preparing coding-capable circular RNAs in vitro remains a challenge. Current methods for generating circular RNAs fall into two main categories depending on the enzyme used. The first category utilizes the autocatalytic activity of group I introns to generate circular RNAs. The second category uses T4 RNA ligase to generate circular RNAs. T4 RNA ligase 1-mediated ligation is a commonly used method for circularizing RNAs, but it cannot accurately ligate the ends of linear RNAs due to the introduction of insertions and deletions during the ligation process. Furthermore, splint oligonucleotides are typically required to join both ends of linear RNA precursors to ensure efficient ligation to circular RNAs. Splint oligonucleotides must be removed after ligation, and polymeric by-products may be formed.
[0005] There is a need for a method to prepare circular RNAs (circRNAs) in high yields without using splint oligonucleotides or introducing unnecessary sequences at the ends of coding RNAs. Summary of the Invention [Means for solving the problem]
[0006] The present application provides linear RNAs and constructs for preparing circular RNAs (circRNAs) by ligation, as well as methods for preparing circular RNAs (circRNAs).
[0007] One aspect of the present application provides a linear RNA, the linear RNA comprising, from the 5' end to the 3' end: (a) a first portion of an RNA element, (b) an effector RNA sequence, and (c) a second portion of an RNA element, wherein the first portion of the RNA element and the second portion of the RNA element associate with each other to form a double-stranded region at least 4 base pairs (bp) in length, and the 5' end of the first portion of the RNA element and the 3' end of the second portion of the RNA element form a nick in the double-stranded region, which can be ligated by an RNA ligase (e.g., T4 RNA ligase 1 or T4 RNA ligase 2). In some embodiments, the length of the double-stranded region is at least 6 bp, 8 bp, 10 bp, 12 bp, or more. In some embodiments, the double-stranded region is about 6 bp to about 25 bp in length. In some embodiments, the double-stranded region is soluble in 1.0 M NaCl at 37°C and 1.0 M NaCl, as predicted, for example, by RNAfold or Mfold software. + has a minimum free energy of about −8 kcal / mol or less (e.g., −9, −10, −11, −12, −13, −14, −15, −16 kcal / mol or less) at an ionic strength of
[0008] In some embodiments of any one of the above linear RNAs, the length of the RNA element is at least 20 nt, e.g., at least about 50 nt, 100 nt, 200 nt, 300 nt, 500 nt, 600 nt, 700 nt, 800 nt, 900 nt, 1000 nt, or more.
[0009] In some embodiments of any one of the above linear RNAs, the double-stranded region comprises at least 2 bp 3' to the nick, hi some embodiments, the double-stranded region comprises any of about 2, 3, 4, 5, 6, or more base pairs (bp) 3' to the nick.
[0010] In some embodiments of any one of the above linear RNAs, the double-stranded region comprises at least 2 (e.g., at least 4) bp 5' to the nick, hi some embodiments, the double-stranded region comprises any of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more base pairs 5' to the nick.
[0011] In some embodiments of any one of the linear RNAs described above, the first portion of the RNA element and the second portion of the RNA element are derived from a reference RNA element of N nucleotides, where N is an integer greater than 8, the first portion of the RNA element comprises nucleotides X through N of the reference RNA element, where X is an integer greater than 1 and less than N, and the second portion of the RNA element comprises nucleotides 1 through X-1 of the reference RNA element. In some embodiments, the first portion of the RNA element and / or the second portion of the RNA element comprise a sequence exogenous to the reference RNA element. In some embodiments, the second portion of the RNA element comprises a first exogenous sequence at the 3' end, and the first portion of the RNA element comprises a second exogenous sequence complementary to the first exogenous sequence, the first exogenous sequence and the second exogenous sequence forming base pairs adjacent to the 5' end of the nick. In some embodiments, the first exogenous sequence and / or the second exogenous sequence is at least 4 nt in length. In some embodiments, the first exogenous sequence is GUUU.
[0012] In some embodiments of any one of the above linear RNAs, the RNA element is a naturally occurring RNA element or its derivative.In some embodiments, the RNA element is sgRNA.In some embodiments, the RNA element is H / ACA box snoRNA.
[0013] In some embodiments of any one of the above linear RNAs, the effector RNA sequence is a coding RNA sequence. In some embodiments, the coding RNA sequence encodes a therapeutic polypeptide. In some embodiments, the therapeutic polypeptide is selected from the group consisting of an antigenic polypeptide (e.g., an antigenic polypeptide of a pathogen or a tumor antigen peptide), a functional protein (e.g., an enzyme), a receptor protein (e.g., a soluble receptor), and a targeting protein (e.g., an antibody or an antigen-binding fragment thereof).
[0014] In some embodiments of any one of the above linear RNAs, the effector RNA sequence is a coding RNA sequence, and the RNA element promotes translation of the coding RNA. In some embodiments, the RNA element is an internal ribosome entry site (IRES) or a portion thereof. In some embodiments, the IRES is derived from an IRES selected from the group consisting of Coxsackievirus B3 (CVB3) IRES, Enterovirus 71 (EV71) IRES, Encephalomyocarditis virus (EMCV) IRES, Picornavirus (PV) IRES, Hepatitis C virus (HCV) IRES, Adenovirus (AdV) IRES, Human papillomavirus type 31 (HPV31) IRES, Human herpesvirus (HHV) IRES, Rous sarcoma virus (RSV) IRES, Classical swine fever virus (CSFV) IRES, FGF9 IRES, SLC7A1 IRES, and RUNX1 IRES. In some embodiments, the IRES is an IRES from a CVB3 virus or a derivative thereof. In some embodiments, the IRES of the CVB3 virus comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the first portion of the RNA element comprises the nucleotide sequence of SEQ ID NO: 1. 2 ~74 1 the second portion of the RNA element comprises nucleotides 1 to 38 of SEQ ID NO: 1; 1 In some embodiments, a first portion of the RNA element comprises the nucleotide sequence of SEQ ID NO:3 and a second portion of the RNA element comprises the nucleotide sequence of SEQ ID NO:2. In some embodiments, a first portion of the RNA element comprises the 34th nucleotide of SEQ ID NO:1. 3 ~74 1 the second portion of the RNA element comprises nucleotides 1 to 34 of SEQ ID NO: 1; 2 It contains the nucleotide.
[0015] In some embodiments of any one of the above linear RNAs, the effector RNA sequence is a coding RNA sequence, and the linear RNA further comprises an in-frame 2A peptide (e.g., T2A or P2A) coding sequence operably linked to the 3' end of the coding RNA.
[0016] In some embodiments of any one of the above linear RNAs, the effector RNA sequence is a non-coding RNA sequence, wherein said effector RNA sequence is a non-coding RNA sequence selected from the group consisting of guide RNA (gRNA), deaminase recruiting RNA (dRNA), short interfering RNA (siRNA), microRNA (miRNA), short hairpin RNA (shRNA), and long intervening non-coding (linc) RNA.
[0017] In some embodiments of any one of the above linear RNAs, the effector RNA sequence is at least about 50 nucleotides (nt) in length, e.g., at least about any of 60, 90, 120, 150, 200, 300, 400, 500, 600, 800, 1000, 1200, 1500 nt, or more. In some embodiments, the effector RNA sequence is from about 50 nt to about 5000 nt in length.
[0018] In some embodiments, a nucleic acid construct is provided, comprising a nucleic acid sequence encoding a linear RNA according to any one of the linear RNAs described above. In some embodiments, the nucleic acid construct comprises a T7 promoter operably linked to the nucleic acid sequence encoding the linear RNA.
[0019] Another aspect of the present application provides a method for preparing a circRNA, the method comprising: (a) contacting a linear RNA of any one of the above-described linear RNAs with an RNA ligase under conditions that allow ligation of nicks in the linear RNA to provide a circularized RNA product; and (b) isolating the circularized RNA product, thereby providing a circRNA. In some embodiments, the T4 RNA ligase is T4 RNA ligase 1. In some embodiments, the T4 RNA ligase is T4 RNA ligase 2. In some embodiments, the circRNA does not contain nucleotide sequences exogenous to the linear RNA, such as insertions or deletions introduced by ligation. In some embodiments, ligation does not require the presence of a splint oligonucleotide. In some embodiments, the ligation efficiency is at least about 50% (e.g., at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, or more).
[0020] In some embodiments of any one of the above preparation methods, the method further comprises treating the circularized RNA product with RNAse R. In some embodiments, the method further comprises purifying the circularized RNA product. In some embodiments, the method further comprises obtaining the linear RNA by in vitro transcription of a nucleic acid construct comprising a nucleic acid sequence encoding the linear RNA.
[0021] Also provided is a circRNA prepared using any one of the above methods.
[0022] In some embodiments, a circular RNA is provided that is formed by ligating nicks in any one of the linear RNAs described above. In some embodiments, the circRNA is a circRNA vaccine.
[0023] In some embodiments, there is provided a method for treating or preventing a disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of any one of the above-mentioned circRNAs.
[0024] Additionally provided are compositions, kits, and articles of manufacture for use in any of the above methods. [Brief explanation of the drawings]
[0025] [Figure 1] Figure 1 is a schematic diagram showing the generation of a coding circular RNA using T4 RNA ligase to ligate two portions of an IRES element in a linear RNA construct. The EGFP-coding RNA is the arch portion of the RNA transcript after in vitro transcription and ligation with T4 RNA ligase. The nick in the linear RNA construct corresponds to the ligation site in the circular RNA product. Forward (F) and reverse (R) primers surrounding the ligation site were designed to detect ligation by reverse transcription followed by PCR amplification of the sequence containing the ligation site. [Figure 2A] Figure 2A shows the secondary structure of the wild-type CVB3 IRES predicted by RNA folding. Each circle in the structure represents a nucleotide. The boxed region (also referred to herein as the "engineered CVB3 IRES region") represents a region within the CVB3 IRES that has a highly stable double-stranded structure, which may promote intramolecular duplex formation. This region is enlarged on the right side of the figure. A linear RNA construct containing two engineered IRES split segments, each with a split site within site 1 and site 2, was designed to generate a circular RNA via ligation of the engineered IRES split segments with T4 RNA ligase. [Figure 2B]2B shows the predicted secondary structure of the engineered CVB3 IRES region in the first exemplary pair of engineered IRES split portions with a split site at site 1 in the linear RNA transcript. The ligation site is marked with an arrow, and the four nucleotides GUUU and their reverse complement were added to the engineered IRES split portion immediately adjacent to the ligation site. [Figure 2C] Figure 2C shows the predicted secondary structure of the engineered CVB3 IRES region in the first exemplary pair of engineered IRES split portions with a split site at site 2 in the linear RNA transcript. The ligation site is marked with an arrow, and the four nucleotides GUUU and their reverse complement were added to the engineered IRES split portion immediately adjacent to the ligation site. [Figure 3] Figure 3 shows high-performance liquid chromatography (HPLC) analysis of circular RNA samples (i.e., site 1 ligated circular RNAs) generated by ligation of linear RNA transcripts of the CVB3 IRES cleavage-based construct in Figure 2B using T4 RNA ligase 1. In the top chromatograph, the circular RNA sample was not treated with RNAse R. In the bottom chromatograph, the circular RNA sample was treated with RNAse R. [Figure 4A] FIG. 4A shows the expression of EGFP in cells transfected with circular RNA linked to site 1 and site 2. [Figure 4B] FIG. 4B shows the results of Western blots detecting EGFP expression in cells 24 hours after transfection with site 1-ligated circular RNA. [Figure 5A] FIG. 5A shows PCR amplification products across the ligation junction using precursor RNA transcripts and site 1 ligated circular RNA samples. [Figure 5B] FIG. 5B shows Sanger sequencing of the ligation junction in site 1 ligated circular RNA. [Figure 6]Figure 6 shows a linear RNA precursor containing a split IRES portion flanked by effector RNA sequences, which reconstitutes only a portion of a naturally occurring IRES. [Figure 7] Figure 7 shows the secondary structure and potential cleavage sites of an exemplary sgRNA. [Figure 8] FIG. 8 shows the secondary structure and potential cleavage sites of an exemplary H / ACA box snoRNA bound to a target RNA. DETAILED DESCRIPTION OF THE INVENTION
[0026] The present application provides linear RNA precursors and constructs for preparing circular RNAs (circRNAs) containing an effector RNA (e.g., coding RNA) sequence. The linear RNA precursors described herein comprise, from the 5' end to the 3' end, a first split portion of an RNA element, an effector RNA (e.g., coding RNA) sequence, and a second split portion of an RNA element, wherein the RNA element has a stable double-stranded region. The two split portions of the linear RNA precursor can associate with each other to reconstitute the RNA element and form a nick in the stable double-stranded region. Ligation of the nick using an RNA ligase (e.g., T4 RNA ligase 1 or T4 RNA ligase 2) produces a circRNA. In some embodiments, the RNA element is an internal ribosome entry site (IRES), such as the IRES of the CVB3 virus. Also provided are methods for preparing circRNAs using the linear RNA precursors and constructs described herein. This method enables highly efficient and accurate in vitro generation of circRNAs without the use of splint oligonucleotides. Furthermore, in the methods described herein, the split portions of the RNA elements used to facilitate intramolecular ligation can serve a functional role, such as facilitating translation of the coding RNA sequence, thereby avoiding the introduction of additional ligation sequences that may be immunogenic or reduce the cargo size of the circRNA.
[0027] Thus, in some embodiments, a linear RNA is provided that includes, from its 5' end to its 3' end: (a) a first portion of an RNA element (such as an IRES), (b) an effector RNA (e.g., a coding RNA) sequence, and (c) a second portion of the RNA element, wherein the first portion of the RNA element and the second portion of the RNA element associate with each other to form a double-stranded region at least 4 base pairs (bp) in length, and the 5' end of the first portion of the RNA element and the 3' end of the second portion of the RNA element form a nick in the double-stranded region, which can be ligated by an RNA ligase (e.g., T4 RNA ligase 2).
[0028] I. Definition Unless otherwise defined below, terms used herein are used as commonly used in the art.
[0029] The term "linear RNA" refers to an RNA molecule having a 5' end and a 3' end. Linear RNA may have secondary structures such as helices or loop regions.
[0030] The term "RNA element" refers to an RNA motif that folds into a secondary structure that includes a double-stranded region.In some embodiments, the RNA element is a cis-regulatory RNA element that regulates a nucleic acid region on the same molecule.The RNA element can be a naturally occurring RNA element (e.g., IRES) or an artificial RNA element (e.g., aptamer).
[0031] The terms "first portion" and "second portion" of an RNA element are used interchangeably herein with the "5'" and "3'" portions of an RNA element, "first split portion" and "second split portion," or "first split" and "second split," and refer to engineered fragments of a reference RNA element that can self-assemble into substantially the same secondary structure as the RNA element. In some embodiments, the reference RNA element is divided or split at an internal position X into two portions: a first portion (i.e., the 3' portion) comprising nucleotides from position X to the end of the reference RNA element, and a second portion (i.e., the 5' portion) comprising nucleotides from position 1 to position X-1 of the reference RNA element. Position X is referred to as the "split site" of the reference RNA element. The first and / or second portions may further comprise extraneous sequences not present in the reference RNA element. The first and / or second portions may have deletions or substitutions relative to the sequence of the reference RNA element. The exogenous sequences, deletions and substitutions do not significantly alter (e.g., do not reduce by more than 10%, 20%, 30%, 40%, or 50%) the function and activity of the reconstituted RNA element through the first and second portions of the RNA element.
[0032] The terms "polynucleotide," "nucleic acid," "nucleotide sequence," and "nucleic acid sequence" are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof.
[0033] The terms "deaminase-recruiting RNA", "dRNA", "ADAR-recruiting RNA" and "arRNA" are used interchangeably herein to refer to engineered RNA that can recruit adenosine deaminase acting on RNA (ADAR) to deaminate target adenosine in RNA. Exemplary dRNAs are described, for example, in WO2021 / 008447, PCT / CN2021 / 071292 and PCT / CN2021 / 113290, the entire contents of which are incorporated herein by reference.
[0034] As used herein, "guide RNA" and "gRNA" are used interchangeably and refer to an RNA capable of forming a complex with a Cas protein and a target nucleic acid (e.g., double-stranded DNA). A guide RNA can comprise a single RNA molecule or two or more RNA molecules associated with each other through hybridization of complementary regions in two or more RNA molecules. For example, the guide RNA for a Cas9 nuclease can comprise a crRNA and a tracrRNA, while the guide RNA for a Cas12a nuclease can comprise only a crRNA. A "crRNA" or "CRISPR RNA" comprises a guide sequence that has sufficient complementarity to the target sequence of a target nucleic acid (e.g., double-stranded DNA), which directs sequence-specific binding of the CRISPR complex to the target nucleic acid. A "tracrRNA" or "trans-activating CRISPR RNA" is partially complementary to the crRNA, base-pairs with the crRNA, and may play a role in crRNA maturation. A "single guide RNA" or "sgRNA" is an engineered guide RNA with a crRNA and a tracrRNA fused to each other within a single molecule.
[0035] The term "therapeutic polypeptide" refers to a polypeptide that has a therapeutic effect. A therapeutic polypeptide can be a naturally occurring protein or an engineered functional variant thereof, including functional fragments and derivatives having one or more mutations (e.g., insertions, deletions, substitutions, etc.) in the amino acid sequence of a naturally occurring protein, as well as a fusion protein comprising a naturally occurring protein or a fragment thereof. A therapeutic polypeptide can also be an engineered protein that has no naturally occurring counterpart. A therapeutic polypeptide can have a single polypeptide chain or multiple polypeptide chains.
[0036] The term "antigenic polypeptide" refers to a polypeptide that can be used to induce the immune system of a mammal to generate antibodies specific to the polypeptide or a portion thereof. Antigenic polypeptides described herein include naturally occurring proteins, protein domains, and short peptide fragments derived from naturally occurring proteins. Antigenic polypeptides may contain one or more known epitopes of a naturally occurring protein. Antigenic polypeptides may also contain carrier proteins or multimerizing proteins to improve immunogenicity.
[0037] The term "functional protein" refers to a naturally occurring protein, a functional variant thereof, or an engineered derivative thereof that is functional in the treatment of a genetic disease or condition that may be caused in whole or in part by an alteration, such as a mutation, in the wild-type, naturally occurring protein that corresponds to the functional protein.
[0038] The term "targeting protein" refers to a polypeptide that specifically binds to a target molecule. Targeting proteins as described herein include antibody-based and non-antibody-based binding proteins or target-binding portions thereof.
[0039] The term "antibody" is used in its broadest sense and encompasses a variety of antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), full-length antibodies, and antigen-binding fragments thereof, so long as they exhibit the desired antigen-binding activity. As used herein, the term "antigen-binding fragment" refers to antibody fragments, including, for example, diabodies, Fab, Fab', F(ab'), Fv fragments, disulfide-stabilized Fv fragments (dsFv), (dsFv)2, bispecific dsFv (dsFv-dsFv'), disulfide-stabilized diabodies (ds diabodies), single-chain Fvs (scFv), scFv dimers (bivalent diabodies), multispecific antibodies formed from portions of antibodies containing one or more CDRs, camelized single-domain antibodies, nanobodies, domain antibodies, bivalent domain antibodies, or other antibody fragments that bind to an antigen but do not comprise the complete antibody structure.
[0040] As used herein, the terms "specifically bind," "specifically recognize," and "specific for" refer to a measurable and reproducible interaction, such as binding between a target and a targeting moiety. For example, a targeting moiety that specifically recognizes a target (which may be an epitope) is a targeting moiety (e.g., an antibody) that binds to this target with greater affinity, avidity, more readily, and / or with a longer duration than it binds to other molecules. In some embodiments, the extent of binding of the targeting moiety to unrelated molecules is less than about 10% of the binding of the targeting moiety to the target, as measured, for example, by radioimmunoassay (RIA). In some embodiments, the dissociation constant (KD) of a targeting moiety that specifically binds to a target is less than 10 -5 M or less, 10 -6 M or less, 10 -7 M or less, 10 -8 M or less, 10 -9 M or less, 10 -10 M or less, 10 -11 M or less, or 10 -12M or less. In some embodiments, specific binding can include, but does not require, exclusive binding. The binding specificity of targeting moiety can be experimentally determined by methods known in the art. Such methods include, but are not limited to, Western blot, ELISA, RIA, ECL, IRMA, EIA, BIACORE™, and peptide scan.
[0041] The term "functional variant" of a reference protein refers to a variant polypeptide or polynucleotide derived from a reference protein or polynucleotide or a portion thereof, which variant has substantially the same activity (e.g., target binding or enzymatic activity) as the reference protein or polynucleotide. "Substantially the same activity" refers to an activity level that is at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more compared to the activity of the reference protein or polynucleotide.
[0042] As used herein, the term "introducing" or "introduction" refers to the delivery of one or more polynucleotides, such as circRNAs, or one or more constructs, including the vectors described herein, or one or more transcripts thereof, to a host cell. The present method can use many delivery systems, including, but not limited to, viruses, liposomes, electroporation, microinjection, and conjugation, to achieve the introduction of the circRNAs or constructs described herein into host cells. Conventional viral and non-viral gene transfer methods can be used to introduce nucleic acids into mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding the present circRNAs into cultured cells or host organisms. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., transcripts of the constructs described herein), naked nucleic acids, and nucleic acids complexed with a delivery vehicle such as a liposome. Viral vector delivery systems include DNA and RNA viruses with episomal or integrated genomes for delivery to host cells.
[0043] As used herein, "operably linked," when referring to a first nucleic acid sequence operably linked to a second nucleic acid sequence, refers to a situation in which the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence if it affects the transcription of the coding sequence. Similarly, a signal peptide coding sequence is operably linked to a polypeptide coding sequence if it affects the extracellular secretion of that polypeptide. Generally, operably linked nucleic acid sequences are contiguous, and, where necessary to link two protein-coding regions, open reading frames are aligned.
[0044] As used herein, "complementarity" refers to the ability of a nucleic acid to form hydrogen bonds with another nucleic acid through traditional Watson-Crick base pairing. The percentage of complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (i.e., Watson-Crick base pairing) with a second nucleic acid (e.g., about 5, 6, 7, 8, 9, 10 out of 10, which are about 50%, 60%, 70%, 80%, 90%, and 100% complementary, respectively). "Fully complementary" means that all consecutive residues of a nucleic acid sequence form hydrogen bonds with the same number of consecutive residues in a second nucleic acid sequence. As used herein, "substantially complementary" refers to a degree of complementarity that is at least about any one of 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of about 40, 50, 60, 70, 80, 100, 150, 200, 250 or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.
[0045] As used herein, "treatment" or "treating" is an approach to obtaining beneficial or desired results, including clinical results. For purposes of this application, beneficial or desired clinical results include, but are not limited to, one or more of the following: alleviation of one or more symptoms attributable to a disease; reduction in the extent of the disease; stabilization of the disease (e.g., preventing or slowing the worsening of the disease); preventing or slowing the spread of the disease; preventing or slowing the onset or recurrence of the disease; slowing or slowing the progression of the disease; amelioration of the condition; remission of the disease (whether partial or complete); reduction in the dose of one or more other medications required to treat the disease; slowing the progression of the disease; improving quality of life; and / or prolonging survival. "Treatment" also includes alleviation of the pathological consequences of a disease. The methods of this application contemplate any one or more of these aspects of treatment.
[0046] The terms "individual," "subject," and "patient" are used interchangeably herein to describe a mammal, including a human. In some embodiments, the individual is a human. In some embodiments, the individual is a rodent, such as a mouse. In some embodiments, the individual is suffering from a genetic disease or condition. In some embodiments, the individual is suffering from a coronavirus infection. In some embodiments, the individual is at risk for contracting a coronavirus infection. In some embodiments, the individual is in need of treatment.
[0047] As understood in the art, an "effective amount" refers to that amount of a composition sufficient to produce a desired therapeutic result (e.g., stimulating the production of antibodies, improving immunity to one or more coronaviruses, reducing the severity or duration of, stabilizing the severity of, or eliminating one or more symptoms of a disease or condition). For therapeutic applications, beneficial or desired results include, for example, alleviating one or more symptoms attributable to the disease (biochemical, histological, and / or behavioral), including complications and intermediate pathological phenotypes exhibited during the progression of the disease; improving the quality of life of a patient suffering from the disease; reducing the dosage of other medications required to treat the disease; enhancing the effectiveness of another medication; delaying disease progression; and / or extending patient survival. In some embodiments, an effective amount of a therapeutic agent may extend survival (including overall survival and progression-free survival), induce an objective response (including a complete or partial response), alleviate to some extent one or more signs or symptoms of a disease or condition, and / or improve the quality of life of a subject. In some embodiments, the effective amount is a prophylactically effective amount, that is, an amount of the composition sufficient to prevent or reduce the severity of one or more future symptoms of the disease or condition when administered to a susceptible individual and / or an individual at risk of developing the disease or condition. For prophylactic use, beneficial or desired results include, for example, elimination or reduction of the risk of future disease, reduction of the severity of future disease, or delay in the onset of disease (e.g., delay in biochemical, histological, and / or behavioral symptoms of the disease, its complications, and intermediate pathological phenotypes that emerge during the future progression of the disease).
[0048] The term "wild-type" as used herein is a term of art understood by those skilled in the art and refers to the typical form of a naturally occurring organism, strain, gene or characteristic, as distinguished from a mutant or variant.
[0049] The present disclosure provides several types of polynucleotide- or polypeptide-based compositions, including variants and derivatives. These include, for example, substitution, insertion, deletion, and covalent variants and derivatives. The term "derivative" is synonymous with the term "variant" and generally refers to a molecule that has been modified and / or changed in some way relative to a reference or starting molecule.
[0050] Therefore, polynucleotides encoding peptides or polypeptides containing substitutions, insertions, and / or additions, deletions, and covalent modifications relative to a reference sequence, particularly a polypeptide sequence disclosed herein, are included within the scope of this disclosure. For example, sequence tags or amino acids can be added to the peptide sequence (e.g., to the N- or C-terminus). Sequence tags can be used for detecting, purifying, or localizing the peptide. Alternatively, amino acid residues located in the carboxy- and amino-terminal regions of the amino acid sequence of a peptide or protein can be optionally deleted to provide a truncated sequence. Alternatively, specific amino acids (e.g., C- or N-terminal residues) can be deleted depending on the use of the sequence, such as, for example, expression of the sequence as part of a larger sequence that is soluble or linked to a solid support.
[0051] The terms "non-natural" and "engineered" are used interchangeably and indicate the involvement of humans. When referring to a nucleic acid molecule or polypeptide, these terms mean that the nucleic acid molecule or polypeptide is at least substantially free from at least one other component with which it is naturally associated and as found in nature.
[0052] As used herein, "expression" refers to the process by which a polynucleotide is transcribed from a DNA template (such as into mRNA or other RNA transcripts) and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. The transcript and encoded polypeptide are sometimes collectively referred to as a "gene product." If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
[0053] The term "polypeptide" or "peptide," as used herein, encompasses all types of natural and synthetic proteins, including protein fragments of any length, fusion proteins, and modified proteins, including, but not limited to, glycoproteins and all other types of modified proteins (e.g., proteins resulting from phosphorylation, acetylation, myristoylation, palmitoylation, glycosylation, oxidation, formylation, amidation, polyglutamylation, ADP-ribosylation, pegylation, biotinylation, etc.).
[0054] A "pharmaceutically acceptable carrier" refers to one or more ingredients, other than the active ingredient(s), in a pharmaceutical formulation that are non-toxic to a subject. Pharmaceutically acceptable carriers include, but are not limited to, buffers, excipients, stabilizers, cryoprotectants, tonicity agents, preservatives, and combinations thereof. Preferably, a pharmaceutically acceptable carrier or excipient has met the required standards of toxicological and manufacturing testing and / or is included in the Inactive Ingredient Guide prepared by the U.S. Food and Drug Administration or other state / federal government, or is listed in the U.S. Pharmacopeia or other generally recognized drug product pharmacopeia intended for use in mammals, particularly humans.
[0055] The term "package insert" is used to refer to instructions customarily included in commercial packaging for therapeutic products, which contain information regarding the indications, usage, dosage, administration, concomitant therapy, contraindications and / or warnings concerning the use of such therapeutic products.
[0056] An "article of manufacture" is any article of manufacture (e.g., package or container) or kit that includes at least one reagent, e.g., an agent for the treatment of a disease or condition (e.g., coronavirus infection), or a probe for specifically detecting a biomarker described herein. In certain embodiments, the article of manufacture or kit is advertised, distributed, or sold as a unit for performing the methods described herein.
[0057] It is understood that embodiments of the invention described herein include "consisting of" and / or "consisting essentially of" embodiments.
[0058] Reference herein to "about" a value or parameter includes (and describes) variations on the value or parameter itself. For example, a statement of "about X" also includes a statement of "X."
[0059] As used herein, a reference to a value or parameter "not" generally means and describes a value or parameter "other than." For example, that the method is not used to treat disease type X means that the method is used to treat a disease other than type X.
[0060] In this specification, "about X to Y" is synonymous with "about X to about Y."
[0061] As used in this specification and the appended claims, the singular forms "a," "an," or "the" include plural referents unless the context clearly dictates otherwise.
[0062] As used herein, the phrase "and / or," such as "A and / or B," is intended to include both A and B; A or B; A alone; and B alone. Similarly, as used herein, the phrase "and / or," such as "A, B, and / or C," is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A alone; B alone; and C alone.
[0063] II. Linear RNA and Constructs The present application provides constructs for preparing linear RNA precursors (also referred to herein as linear RNAs (linear RNAs)) and circular RNAs (circRNAs) encoding polypeptides, such as therapeutic polypeptides. The linear RNA precursors described herein comprise two separate portions of an RNA element flanking an effector RNA (e.g., coding RNA) sequence. CircRNAs can be obtained by joining the ends of the separate portions of the RNA element using an RNA ligase. The linear RNA may comprise any one of the first and second portions of the RNA element described in Section A, "RNA Elements," and any one of the first and second portions of the RNA element described in Section B, "Effector RNA Sequences."
[0064] In some embodiments, a linear RNA is provided, the linear RNA comprising, from its 5' end to its 3' end: (a) a first portion of an RNA element, (b) an effector RNA sequence, and (c) a second portion of an RNA element, wherein the first portion of the RNA element and the second portion of the RNA element associate with each other to form a double-stranded region of at least 4 base pairs (bp) in length (e.g., about 6-25 bp in length), and the 5' end of the first portion of the RNA element and the 3' end of the second portion of the RNA element form a nick in the double-stranded region, which can be ligated by an RNA ligase. In some embodiments, the double-stranded region is ligated at 37°C and 1.0 M NaCl, as predicted, for example, by RNAfold or Mfold software. + In some embodiments, the RNA element has a minimum free energy of about -8 kcal / mol or less at an ionic strength of 100 . In some embodiments, the length of the RNA element is at least 20 nt (e.g., at least about 50 nt, or about 20-1000 nt). In some embodiments, the double-stranded region comprises at least 2 bp on the 3' side of the nick. In some embodiments, the double-stranded region comprises at least 2 (e.g., at least 4) bp on the 5' side of the nick. In some embodiments, the RNA element is a naturally occurring RNA element or a derivative thereof. In some embodiments, the RNA element is an sgRNA. In some embodiments, the RNA element is an H / ACA box snoRNA. In some embodiments, the effector RNA sequence is about 50 nt to about 5000 nt in length. In some embodiments, the effector RNA sequence is a non-coding RNA sequence selected from the group consisting of guide RNA (gRNA), deaminase recruiting RNA (dRNA), siRNA, miRNA, shRNA, and long intergenic non-coding (linc) RNA.
[0065] In some embodiments, a linear RNA is provided, the linear RNA comprising, from its 5' end to its 3' end: (a) a first portion of an RNA element, (b) a coding RNA sequence, and (c) a second portion of an RNA element, wherein the first portion of the RNA element and the second portion of the RNA element associate with each other to form a double-stranded region of at least 4 base pairs (bp) in length (e.g., about 6-25 bp in length), and the 5' end of the first portion of the RNA element and the 3' end of the second portion of the RNA element form a nick in the double-stranded region, which can be ligated by an RNA ligase. In some embodiments, the double-stranded region is ligated at 37°C and 1.0 M NaCl, as predicted, for example, by RNAfold or Mfold software. + In some embodiments, the RNA element has a minimum free energy of about -8 kcal / mol or less at an ionic strength of 100 . In some embodiments, the length of the RNA element is at least 20 nt (e.g., at least about 50 nt, or about 20-1000 nt). In some embodiments, the double-stranded region comprises at least 2 bp on the 3' side of the nick. In some embodiments, the double-stranded region comprises at least 2 (e.g., at least 4) bp on the 5' side of the nick. In some embodiments, the RNA element is a naturally occurring RNA element or a derivative thereof. In some embodiments, the RNA element facilitates translation of the RNA sequence. In some embodiments, the coding RNA sequence is about 50 nt to about 5000 nt in length. In some embodiments, the coding RNA sequence encodes a therapeutic polypeptide, such as, for example, an antigenic polypeptide, a functional protein, a receptor protein, or a targeting protein.
[0066] In some embodiments, a linear RNA is provided, the linear RNA comprising, from its 5' end to its 3' end: (a) a first portion of an RNA element, (b) an effector RNA (e.g., coding RNA) sequence, and (c) a second portion of an RNA element, wherein the first portion of the RNA element and the second portion of the RNA element are derived from a reference RNA element of N nucleotides, where N is an integer greater than 8, the first portion of the RNA element comprises nucleotides X through N of the reference RNA element, where X is an integer greater than 1 and less than N, and the second portion of the RNA element comprises nucleotides 1 through X-1 of the reference RNA element, wherein the first portion of the RNA element and the second portion of the RNA element associate with each other to form a double-stranded region of at least 4 base pairs (bp) in length (e.g., about 6-25 bp in length), wherein the 5' end of the first portion of the RNA element and the 3' end of the second portion of the RNA element form a nick in the double-stranded region, which can be ligated by an RNA ligase. In some embodiments, the double-stranded region is at 37° C. and 1.0 M NaCl, as predicted, for example, by RNAfold or Mfold software. +The RNA element has a minimum free energy of about -8 kcal / mol or less at an ionic strength of 100 . In some embodiments, the length of the RNA element is at least 20 nt (e.g., at least about 50 nt, or about 20-1000 nt). In some embodiments, the double-stranded region comprises at least 2 bp on the 3' side of the nick. In some embodiments, the double-stranded region comprises at least 2 (e.g., at least 4) bp on the 5' side of the nick. In some embodiments, the first portion of the RNA element and / or the second portion of the RNA element comprise a sequence exogenous to the reference RNA element. In some embodiments, the second portion of the RNA element comprises a first exogenous sequence at the 3' end, and the first portion of the RNA element comprises a second exogenous sequence complementary to the first exogenous sequence, the first and second exogenous sequences forming adjacent base pairs at the 5' end of the nick. In some embodiments, the first exogenous sequence is GUUU. In some embodiments, the RNA element is a naturally occurring RNA element or a derivative thereof. In some embodiments, the effector RNA sequence is a coding RNA sequence. In some embodiments, the effector RNA sequence is about 50 nt to about 5000 nt in length. In some embodiments, the RNA element promotes translation of a coding RNA. In some embodiments, the coding RNA sequence encodes a therapeutic polypeptide, such as, for example, an antigenic polypeptide, a functional protein, a receptor protein, or a targeting protein.
[0067] In some embodiments, a linear RNA is provided, the linear RNA comprising, from its 5' end to its 3' end: (a) a first portion of an internal ribosome entry site (IRES), (b) a coding RNA sequence, and (c) a second portion of the IRES, wherein the first portion of the IRES and the second portion of the IRES associate with each other to form a double-stranded region of at least 4 bp in length (e.g., about 6-25 bp in length), and the 5' end of the first portion of the IRES and the 3' end of the second portion of the IRES form a nick in the double-stranded region, which can be ligated by an RNA ligase. In some embodiments, the double-stranded region is ligated at 37°C and 1.0 M NaCl, as predicted, for example, by RNAfold or Mfold software. +The IRES has a minimum free energy of about -8 kcal / mol or less at an ionic strength of 100 . In some embodiments, the double-stranded region comprises at least 2 bp on the 3' side of the nick. In some embodiments, the double-stranded region comprises at least 2 (e.g., at least 4) bp on the 5' side of the nick. In some embodiments, the first portion of the IRES and the second portion of the IRES are derived from a reference IRES of N nucleotides, where N is an integer greater than 8, the first portion of the IRES comprises nucleotides X through N of the reference IRES, where X is an integer greater than 1 and less than N, and the second portion of the IRES comprises nucleotides 1 through X-1 of the reference IRES. In some embodiments, the first portion of the IRES and / or the second portion of the IRES comprise sequence exogenous to the reference IRES. In some embodiments, the second portion of the IRES comprises a first foreign sequence at the 3' end, and the first portion of the IRES comprises a second foreign sequence complementary to the first foreign sequence, and the first and second foreign sequences form adjacent base pairs at the 5' end of the nick. In some embodiments, the first foreign sequence is GUUU. In some embodiments, the IRES is derived from an IRES of a virus selected from the group consisting of CVB3, EV71, EMCV, PV, HCV, AdV, HPV31, HHV, RSV, and CSFV. In some embodiments, the IRES is derived from a human IRES, e.g., FGF9 IRES, SLC7A1 IRES, or RUNX1 IRES. In some embodiments, the coding RNA sequence is about 50 nt to about 5000 nt in length. In some embodiments, the coding RNA sequence encodes a therapeutic polypeptide, such as, for example, an antigenic polypeptide, a functional protein, a receptor protein, or a targeting protein.
[0068] In some embodiments, a linear RNA is provided, the linear RNA comprising, from the 5' end to the 3' end: (a) the 38 amino acid sequence of the CVB3 IRES; 2 ~74 1 (b) a first RNA portion comprising nucleotides 1 to 38 of the CVB3 IRES (nucleotide numbers are according to SEQ ID NO: 1); 1The coding RNA sequence comprises a second RNA portion comprising a nucleotide sequence of SEQ ID NO: 3 and a second RNA portion comprising a nucleotide sequence of SEQ ID NO: 2. The first and second RNA portions associate with each other to form a double-stranded region, the double-stranded region comprising a nick formed from the 5' end of the first RNA portion and the 3' end of the second RNA portion, and the nick can be ligated by an RNA ligase. In some embodiments, the first and / or second RNA portions comprise a sequence exogenous to the CVB3 IRES. In some embodiments, the second RNA portion comprises a first foreign sequence at its 3' end, and the first RNA portion comprises a second foreign sequence complementary to the first foreign sequence, the first and second foreign sequences forming adjacent base pairs at the 5' end of the nick. In some embodiments, the first foreign sequence is GUUU. In some embodiments, the first RNA portion comprises the nucleotide sequence of SEQ ID NO: 3, and the second RNA portion comprises the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the coding RNA sequence is about 50 nt to about 5,000 nt in length. In some embodiments, the coding RNA sequence encodes a therapeutic polypeptide, such as, for example, an antigenic polypeptide, a functional protein, a receptor protein, or a targeting protein.
[0069] In some embodiments, the linear RNA comprises, from the 5' end to the 3' end: a first portion of an IRES, an optional signal peptide, a coding RNA sequence, a sequence encoding a 2A peptide, and a second portion of an IRES. In some embodiments, the linear RNA sequence comprises the nucleotide sequence of SEQ ID NO: 10 or 11. Obtained by transcription .
[0070] In some embodiments, a nucleic acid construct is provided, comprising a nucleic acid sequence encoding any one of the linear RNAs described herein.In some embodiments, a T7 promoter is operably linked to the nucleic acid sequence encoding the linear RNA.In some embodiments, the T7 promoter comprises the sequence shown in SEQ ID NO: 6.In some embodiments, the T7 promoter can drive in vitro transcription.
[0071] In some embodiments, the nucleic acid construct is a plasmid. In some embodiments, the plasmid is obtained by cloning a sequence encoding a linear RNA into a plasmid vector. The plasmid can be generated by techniques known in the art, such as Gibson cloning or cloning using restriction enzymes. In some embodiments, the plasmid vector contains an antibiotic expression cassette that allows antibiotic selection of bacteria expressing the plasmid. In some embodiments, the provided plasmid can be purified from bacteria and used to generate the linear RNA construct. Any plasmid vector suitable for in vitro transcription of linear RNA can be used. In some embodiments, the plasmid is linearized before in vitro transcription of linear RNA. In some embodiments, the recombinant plasmid is linearized by restriction enzyme digestion. In some embodiments, the recombinant plasmid is linearized by PCR amplification.
[0072] A. RNA elements The linear RNAs described herein include divided portions of an RNA element having extensive secondary structure, including double-stranded helical regions. The divided portions (i.e., first and second portions) can be engineered based on a reference RNA element, i.e., the reference RNA element is divided into a 5' portion (i.e., the second portion in the linear RNA described herein) and a 3' portion (i.e., the first portion in the linear RNA described herein) by a "division site" (i.e., a phosphodiester bond 5' to a nucleotide) within the stable double-stranded region of the reference RNA element. For example, if an RNA element has N nucleotides and the division site is 5' to the Xth nucleotide, where X and N are integers and X is greater than 1 and less than N, the first portion of the RNA element includes the 1st nucleotide through the X-1th nucleotide of the RNA element, and the second portion of the RNA element includes the Xth to Nth nucleotides of the RNA element. The split portions can be further manipulated by introducing one or more foreign sequences into the first and / or second portions of the RNA element, deleting one or more nucleotides in the first and / or second portions of the RNA element, and / or substituting one or more nucleotides in the first and / or second portions of the RNA element. The split portions of the RNA element of the linear RNA can associate with each other to reconstitute a double-stranded region, leaving a nick at the split site at the 5' end of the first portion and the 3' end of the second portion, which can be ligated by an RNA ligase (e.g., T4 RNA ligase 1 or T4 RNA ligase 2).
[0073] The division site of an RNA element can be selected by first identifying stable double-stranded regions in the linear RNA sequence so that they are located at the two ends of the effector RNA (e.g., coding RNA) when the RNA element is divided into two parts, and these two parts can assemble to form a nicked double-stranded region. The low free energy of the double-stranded region promotes intramolecular ligation by RNA ligase. Stable double-stranded regions in an RNA element can be computationally identified using methods known in the art. For example, the software RNAfold (Hofacker, IL Vienna RNA Secondary Structure Server. Nucleic Acids Res. 31, 3429-3431 (2003)) and Mfold (M. Zuker, Nucleic Acids Res., 31(13), 3406-15 (2003)) are web servers that can be used to computer-fold RNA molecules and predict secondary structures, including double-stranded regions, of RNA molecules. For example, Figure 2A shows the secondary structure of the CVB3 IRES predicted by RNAfold software (RNAfold). Regions of low free energy and double-stranded helical regions (such as the boxed regions in Figure 2A) can be selected to engineer a division site within the double-stranded region, such as site 1 or site 2 shown in Figure 2A. The division site should not be adjacent to a nucleotide position known to affect the function of the RNA element. In some embodiments, an easily accessible phosphodiester bond within the RNA element is selected as the division site. In some embodiments, the double-stranded region has a high GC content, e.g., at least about 40%, 50%, 60%, 70%, 80%, or more GC base pairs.
[0074] In some embodiments, the division site is selected near the midpoint of the reference RNA element. In some embodiments, the first portion of the RNA element has substantially the same length as the second portion of the RNA element. For example, the length of the first portion of the RNA element differs from the length of the second portion of the RNA element by no more than about 100, no more than 90, no more than 80, no more than 70, no more than 60, no more than 50, no more than 40, no more than 30, no more than 20, no more than 10, no more than 5, or no more than nucleotides. In some embodiments, the length of the first portion of the RNA element differs from the length of the second portion of the RNA element by no more than about 20%, no more than 15%, no more than 10%, no more than 5%, or no more than nucleotides.
[0075] In some embodiments, the division site is selected within a double-stranded region of at least about 4 bp in length, such as at least about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more bp in length. In some embodiments, the double-stranded region is about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 bp in length. In some embodiments, the double-stranded region is about 25 or less, 24 or less, 23 or less, 22 or less, 21 or less, 20 or less, 19 or less, 18 or less, 17 or less, 16 or less, 15 or less, 14 or less, 13 or less, 12 or less, 11 or less, 10 or less, 9 or less, 8 or less, 7 or less, or 6 or less bp in length. In some embodiments, the double-stranded region is about 4 to 25, 4 to 15, 4 to 10, 6 to 25, 6 to 15, 6 to 10, 10 to 15, 10 to 20, or 10 to 25 bp in length. In some embodiments, the double-stranded region is part of a stem-loop. In some embodiments, the double-stranded region is a helix. In some embodiments, the double-stranded region further comprises a bulge.
[0076] In some embodiments, the minimum free energy of the double-stranded region is about -5 kcal / mol or less, e.g., about any one of -5.5, -6, -6.5, -7, -7.5, -8, -8.5, -9, -9.5, -10, -10.5, -11, -11.5, -12, -12.5, -13, -14, or -15 kcal / mol or less, e.g., as predicted by RNAfold or Mfold software. In some embodiments, the minimum free energy of the double-stranded region is about any one of -15 to -5.5, -10 to -5.5, -8 to -5.5, -15 to -8, -12 to -8, or -10 to -8 kcal / mol. In some embodiments, the minimum free energy of the RNA element is less than or equal to about any one of -50, -100, -150, -200, -250, -300 kcal / mol.
[0077] In some embodiments, the RNA element is at least 20 nt in length, e.g., at least about any one of 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 900 nt or more in length, hi some embodiments, the RNA element is no more than about any one of 1000, 900, 800, 750, 700, 650, 600, 550, 500, 450, 400, 350, 300, 250, 200, 150, 100, 75, 50, or 20 nt in length. In some embodiments, the RNA element is any one of about 20-50, 50-100, 20-200, 20-300, 20-500, 20-1000, 50-200, 50-1000, 100-1000, 100-500, 200-500, 200-1000, 300-1000, 300-800, 400-900, or 500-1000 nt of nucleotides in length.
[0078] As shown in FIG. 1 , in an exemplary linear RNA, a first portion of the RNA element is adjacent to the 5′ end of the effector RNA (e.g., a coding RNA), and a second portion of the RNA element is adjacent to the 3′ end of the coding RNA (e.g., a coding RNA). The first portion of the RNA element self-assembles with the second portion of the RNA element to form a double-stranded region with a nick at the division site, which serves as a substrate for RNA ligase. In some embodiments, base pairs immediately adjacent to the 5′ and / or 3′ sides of the nick facilitate ligation of the nick by RNA ligase. In some embodiments, the double-stranded region comprises at least 2 base pairs, e.g., 2, 3, 4, 5, 6, or more base pairs, on the 3′ side of the nick. In some embodiments, the double-stranded region comprises at least 2 base pairs, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more base pairs, on the 5′ side of the nick.
[0079] In some embodiments, the first portion of the RNA element and the second portion of the RNA element are derived from a reference RNA element having N nucleotides, where N is an integer greater than 8, the first portion of the RNA element comprises nucleotides X through N of the reference RNA element, where X is an integer greater than 1 and less than N, and the second portion of the RNA element comprises nucleotides 1 through X-1 of the reference RNA element. In some embodiments, the first portion of the RNA element consists of, or consists essentially of, nucleotides X through N of the reference RNA element, and the second portion of the RNA element consists of, or consists essentially of nucleotides 1 through X-1 of the reference RNA element.
[0080] In some embodiments, the RNA element does not have an exogenous sequence compared to the reference RNA element. In some embodiments, the reconstituted RNA element by linking the 5' end of the first portion of the RNA element and the 3' end of the second portion of the RNA element is identical to the reference RNA element.
[0081] In some embodiments, the RNA element after ligation of the nick is a portion of a reference RNA element, which portion includes a stable double-stranded region, which may or may not have the function of a reference RNA element.
[0082] In some embodiments, the RNA element after ligation of the nick comprises all nucleotides of the reference RNA element. In some embodiments, the RNA element after ligation of the nick is a reference RNA element.
[0083] In some embodiments, the RNA element comprises one or more exogenous sequences compared to the reference RNA element. In some embodiments, a first portion of the RNA element comprises a sequence exogenous to the reference RNA element. In some embodiments, a second portion of the RNA element comprises a sequence exogenous to the reference RNA element. In some embodiments, the first portion of the RNA element comprises a first sequence exogenous to the reference RNA element, and the second portion of the RNA element comprises a second sequence exogenous to the reference RNA element.
[0084] For example, an exogenous sequence can be introduced into the first portion of the RNA element or the second portion of the RNA element to further stabilize the double-stranded region containing the nick, thereby facilitating ligation of the nick by RNA ligase. In some embodiments, the first portion of the RNA element comprises a first exogenous sequence at the 3' end, and the second portion of the RNA element comprises a second exogenous sequence complementary to the first exogenous sequence, wherein the first and second exogenous sequences form adjacent base pairs at the 5' end of the nick. In some embodiments, the first and second exogenous sequences are each at least 4 nt in length, e.g., about 4, 5, 6, 7, 8, or more nucleotides in length. In some embodiments, the first exogenous sequence is GUUU, and the second exogenous sequence is AAAC.
[0085] The RNA element can be a naturally occurring RNA element, such as a regulatory RNA element, a derivative thereof, or an artificial RNA element. In some embodiments, the RNA element is a cis-regulatory RNA element.
[0086] In some embodiments, the RNA element is a regulatory RNA element that promotes translation of a coding RNA sequence. In some embodiments, the RNA element is an internal ribosome entry site (IRES). In some embodiments, the RNA element is a full-length IRES. In some embodiments, the RNA element is a portion of an IRES that includes a stable double-stranded region. The portion of the IRES may not function to promote protein translation.
[0087] For example, as shown in Figure 6, in an exemplary linear RNA, the first and second portions are derived from the stem-loop portion of the CVB3 IRES, which contains a highly stable double-stranded region. The first and second portions are adjacent to an effector RNA sequence, which may be a coding or non-coding RNA (e.g., gRNA, dRNA, miRNA, siRNA, shRNA, or lincRNA).
[0088] In some embodiments, the IRES is a viral IRES sequence. In a non-limiting example, the IRES sequence can be an IRES from a virus selected from the group consisting of CVB3, EV71, EMCV, PV, HCV, AdV, HPV31, HHV, RSV, and CSFV. See, e.g., "Searching for IRES," RNA. 2006 Oct;12(10):1755-1785, the entire contents of which are incorporated herein by reference. In some embodiments, the IRES sequence is a cellular IRES sequence. In some embodiments, the IRES is derived from a human IRES, such as the FGF9 IRES, SLC7A1 IRES, or RUNX1 IRES. Exemplary IRES sequences can be found in databases such as reprod.njmu.edu.cn / cgi-bin / iresbase / view_eukaryote.php and cobishss0.im.nuk.edu.tw / Human_IRES_Atlas / , the entire contents of which are incorporated herein by reference.
[0089] In some embodiments, the RNA element is the IRES of the CVB3 virus or a derivative thereof. An exemplary sequence of the CVB3 IRES is SEQ ID NO: 1. The secondary structure of the CVB3 IRES predicted by RNAfold is shown in Figure 2. The CVB3 IRES can be split at two different split sites within the stable double-stranded region. Split site 1 is 38 2 In some embodiments, the first portion of the RNA element is at the 5' end of the 38th nucleotide of SEQ ID NO:1. 2 ~74 1 the second portion of the RNA element comprises nucleotides 1 to 38 of SEQ ID NO: 1; 1 In some embodiments, the first portion of the RNA element comprises the nucleotide sequence of SEQ ID NO: 3 and the second portion of the RNA element comprises the nucleotide sequence of SEQ ID NO: 2. Division site 2 comprises the 34th nucleotide. 3In some embodiments, the first portion of the RNA element is at the 5' end of the 34th nucleotide of SEQ ID NO:1. 3 ~74 1 the second portion of the RNA element comprises nucleotides 1 to 34 of SEQ ID NO: 1; 2 In some embodiments, the first portion of the RNA element comprises the nucleotide sequence of SEQ ID NO:5 and the second portion of the RNA element comprises the nucleotide sequence of SEQ ID NO:4.
[0090] In some embodiments, the RNA element is a guide RNA, such as a single guide RNA (sgRNA) operable with a Cas nuclease. In some embodiments, the gRNA or sgRNA is used for gene editing. Exemplary Cas nucleases include, but are not limited to, Cas9, Cas12a, Cas12b, Cas12c, Cas12d, Cas12f, Cas12g, Cas12h, Cms1, Cas12i, Cas12j, Cas12k, and CasX. Figure 7 shows potential division sites within the sgRNA. In some embodiments, the RNA element is a gRNA (e.g., sgRNA), and the effector RNA encodes a Cas nuclease (e.g., Cas9).
[0091] In some embodiments, the RNA element is a small nucleolar RNA (snoRNA) or a portion thereof. In some embodiments, the RNA element is the H / ACA box of a snoRNA. H / ACA box snoRNAs have a common secondary structure containing two hairpins and two single-stranded regions. Figure 8 shows potential division sites in H / ACA snoRNAs. Exemplary H / ACA snoRNA sequences can be found on the snoStrip web server at snostrip.bioinf.uni-leipzig.de. H / ACA snoRNAs can be used to convert uridine to pseudouridine in target RNAs. H / ACA snoRNA sequences can be used for mRNA editing. See, e.g., US8603457B2.
[0092] The first part of the RNA element and the second part of the RNA element function as ligation sequences for the linear RNA. In addition to the first and second parts of the RNA element, the linear RNA described herein does not have any additional ligation sequences. In some embodiments, the linear RNA does not include a 5' ligation sequence at the 5' end and a 3' ligation sequence at the 3' end, where the 5' ligation sequence and the 3' ligation sequence can be ligated to each other via a ligase (e.g., T4 RNA ligase) in the presence of a splint oligonucleotide that hybridizes with the 5' ligation sequence and the 3' ligation sequence.
[0093] B. Effector RNA sequence The linear RNA precursors and circRNAs described herein include effector RNA sequences, which can be coding or non-coding RNA sequences. Exemplary non-coding RNAs include, but are not limited to, guide RNAs (gRNAs, including single guide RNAs or sgRNAs), deaminase recruiting RNAs (dRNAs), small RNAs (e.g., microRNAs, short hairpin RNAs, small interfering RNAs), or long intergenic non-coding RNAs (lincRNAs).
[0094] In some embodiments, the effector RNA sequence is at least about 50 nt in length, e.g., at least about any one of 100, 150, 200, 300, 600, 900, 1200, 1500, 2000, 3000, 4000, 5000 nt, or more. In some embodiments, the effector RNA sequence is no more than about any one of 5000, 4000, 3000, 2000, 1500, 1200, 900, 600, 300, 200, 150, or 100 nt in length. In some embodiments, the effector RNA sequence is any one of about 50-100, 100-500, 500-1000, 1000-2000, 2000-5000, 50-5000, 100-5000, 100-3000, 500-5000, 500-2500, 2500-5000, or 1000-5000 nt in length.
[0095] In some embodiments, the effector RNA sequence is a coding RNA sequence that encodes any polypeptide of interest. In some embodiments, the polypeptide is at least about 15 amino acids long, for example, at least about 20, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more amino acids long. In some embodiments, the polypeptide is no longer than about 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100, 50, or 20 amino acids long. In some embodiments, the polypeptide is any one of about 20-50, 50-100, 20-200, 20-500, 20-1000, 50-500, 50-1000, 100-500, 100-1000, 200-1000, or 500-1000 amino acids in length.
[0096] In some embodiments, the coding RNA sequence encodes a therapeutic polypeptide, hi some embodiments, the therapeutic polypeptide is an antigenic polypeptide, a functional protein, a receptor protein, or a targeting protein (e.g., an antibody).
[0097] In some embodiments, the coding RNA sequence encodes an antigenic polypeptide. CircRNA vaccines can be prepared using linear RNAs containing coding RNA sequences encoding antigenic polypeptides. The antigenic polypeptide comprises at least one epitope recognizable by a T cell receptor (TCR). In some embodiments, the antigenic polypeptide is a full-length protein or a fragment thereof, or an antigenic fusion protein capable of eliciting an immune response in a subject. In some embodiments, the antigenic polypeptide is a short peptide of 100 amino acids or less in length. The antigenic polypeptide can be a naturally occurring peptide fragment from a protein antigen containing one or more epitopes, or an artificially designed peptide having one or more naturally occurring epitope sequences, optionally with a peptide linker positioned between adjacent epitope sequences. In some embodiments, the antigenic polypeptide comprises a single epitope of an antigenic protein. In some embodiments, the antigenic polypeptide comprises any one of about 1, 2, 3, 4, 5, 10, or more epitopes derived from a single antigenic protein. In some embodiments, the antigenic polypeptide comprises epitopes from multiple (e.g., 2, 3, 4, 5, 10, or more) different antigenic proteins. In some embodiments, the antigenic polypeptide comprises a major histocompatibility complex (MHC) class I-restricted epitope. In some embodiments, the antigenic polypeptide comprises an MHC class II-restricted epitope. In some embodiments, the antigenic polypeptide comprises both an MHC class I-restricted epitope and an MHC class II-restricted epitope.
[0098] In some embodiments, the antigenic polypeptide is an antigenic protein or fragment thereof or variant thereof derived from a pathogen such as a bacterium or virus. In some embodiments, the antigenic polypeptide is an antigenic protein or fragment thereof of a coronavirus such as SARS-CoV2, including variants thereof. In some embodiments, the antigenic polypeptide comprises the spike (S) protein or fragment thereof or variant thereof of a coronavirus such as SARS-CoV, MERS-COV, or SARS-CoV-2. CircRNA vaccines are described, for example, in PCT / CN2021 / 074998, the entire contents of which are incorporated herein by reference. The linear RNAs and constructs described herein can be used to prepare any of the circRNA vaccines known in the art.
[0099] In some embodiments, the antigenic polypeptide is an antigenic protein or fragment thereof or a variant thereof of an autoantigen, such as an antigen involved in a disease or condition. In some embodiments, the antigenic polypeptide is a tumor antigen peptide. Tumor antigen peptide sequences are known in the art and can be found in public databases such as the Cancer Antigen Peptide Database (van der Bruggen P et al. (2013) "Peptide database: T cell-defined tumor antigens." Cancer Immunity. URL: caped.icp.ucl.ac.be). The coding RNA sequence in the linear RNA or circRNA described herein can encode any known tumor antigen peptide or a combination thereof. In some embodiments, the antigenic polypeptide comprises an epitope of a tumor-associated antigen (TAA). In some embodiments, the antigenic polypeptide comprises an epitope of a tumor-specific antigen. In some embodiments, the antigenic polypeptide comprises an epitope of a neoantigen, i.e., a newly acquired and expressed antigen present in an individual's tumor cells.
[0100] In some embodiments, the amino acid sequences of one or more epitope peptides are predicted based on the sequence of an antigen protein (including a neoantigen) using a bioinformatics tool for T cell epitope prediction. Exemplary bioinformatics tools for T cell epitope prediction are known in the art; see, e.g., Yang X. and Yu X. (2009) "An introduction to epitope prediction methods and software" Rev. Med. Virol. 19(2):77-96. In some embodiments, the sequence of the antigen protein is known in the art or available in a public database. In some embodiments, the sequence of the antigen protein (including a neoantigen) is determined by sequencing a sample (such as a tumor sample) from the individual to be treated.
[0101] In some embodiments, the antigenic polypeptide comprises a multimerization domain, such as a dimerization domain, a trimerization domain, or a domain that mediates the formation of higher-order multimers. In some embodiments, the multimerization domain is a trimerization domain. In a non-limiting example, the multimerization domain comprises the C-terminal Foldon (Fd) domain of the T4 fibritin protein, and the C-terminal Foldon domain is a domain that mediates the trimerization of the T4 fibritin protein. In another example, the multimerization domain comprises a GCN4-based isoleucine zipper (IZ) domain based on the trimerization domain of the GCN4 transcription activator from Saccharomyces cerevisiae. In some embodiments, the GCN4 IZ domain or the T4 fibritin Fd domain can be modified to reduce their immunogenicity according to techniques known in the art. For example, the GCN4 IZ domain can be modified with N-linked glycosylation sites to reduce its immunogenicity (Sliepen et al. Immunosilencing a Highly Immunogenic Protein Trimerization Domain. The Journal of Biol. Chem. Vol. 290, No. 12, pp. 7436-7442).
[0102] In some embodiments, the antigenic polypeptide further comprises an immunogenic carrier protein. In some embodiments, the antigenic polypeptide comprises an epitope peptide conjugated to an immunogenic carrier protein. Exemplary immunogenic carrier proteins include, but are not limited to, tetanus toxoid (TT), diphtheria toxoid (DT), modified diphtheria toxin cross-reactant (CRM197), meningococcal outer membrane protein complex (OMPC), and Haemophilus influenzae protein D (HiD).
[0103] In some embodiments, the coding RNA sequence encodes a targeting protein, hi some embodiments, the targeting protein is an antibody or antigen-binding fragment thereof.
[0104] In some embodiments, the coding RNA sequence encodes an antibody. In some embodiments, the therapeutic polypeptide is a neutralizing antibody, i.e., an antibody that blocks the interaction between a protein and its binding partner. In some embodiments, the antibody inhibits the activity of a protein, for example, by blocking binding of the protein to its binding partner. In some embodiments, the targeting protein is a therapeutic antibody. In some embodiments, the antibody is a checkpoint inhibitor, e.g., an antibody inhibitor of CTLA-4, PD-1, or PD-L1. In some embodiments, the antibody specifically binds to a cell surface antigen, such as a tumor antigen. Exemplary tumor antigens include, but are not limited to, glioma-associated antigen, carcinoembryonic antigen (CEA), β-human chorionic gonadotropin, alpha-fetoprotein (AFP), lectin-reactive AFP, thyroglobulin, RAGE-1, MN-CAIX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestinal carboxylesterase, mut hsp70-2, M-CSF, prostase, prostate-specific antigen (PSA), PAP, NY-ESO-1, LAGE-1a, p53, prostein, PSMA, HER2 / neu, survivin and telomerase, prostate cancer tumor antigen-1 (PCTA-1), MAGE, ELF2M, neutrophil elastase, ephrin B2, CD22, insulin growth factor (IGF)-I, IGF-II, IGF-I receptor, and mesothelin. In some embodiments, the antibody specifically binds to a target antigen on a pathogen, such as a bacterium or virus.
[0105] An antibody can be an antigen-binding fragment of an antibody, e.g., a portion or fragment of an intact or whole antibody having fewer amino acid residues than the intact or whole antibody that is capable of binding to antigen or capable of binding to antigen in competition with the intact antibody (i.e., the intact antibody from which the antigen-binding fragment is derived). Antigen-binding fragments can be prepared by recombinant DNA techniques or by enzymatic or chemical cleavage of intact antibodies. Antigen-binding fragments include, but are not limited to, Fab', F(ab')2Fv, single-chain Fv (scFv), single-chain Fab, diabody, single-domain antibody (sdAb, nanobody), camelid Ig, Ig NAR, F(ab)'3 fragment, bis-scFv, (scFv)2 minibody, diabody, triabody, tetradiabody, and disulfide-stabilized Fv protein ("dsFv"). In some embodiments, the neutralizing antibody may be a genetically engineered antibody, such as a chimeric antibody (e.g., a humanized murine antibody), a heteroconjugate antibody (e.g., a bispecific antibody), or an antigen-binding fragment thereof.
[0106] In some embodiments, the antibody is a neutralizing antibody that binds to a viral protein. In some embodiments, the antibody is a neutralizing antibody that binds to a receptor for a viral protein. In some embodiments, the antibody binds to a receptor required for viral entry into cells (e.g., the ACE2 receptor). In some embodiments, the antibody is a neutralizing antibody (nAb) that binds to the S protein of a coronavirus and blocks or reduces its ability to infect cells. In some embodiments, the coronavirus is SARS-CoV-2. In some embodiments, the nAb binds to an S protein containing one or more mutations. In some embodiments, the nAb binds to an S protein or fragment thereof containing at least one point mutation in the S2 region, e.g., K986P, V987P, F817P, A892P, A899P, or A942P mutation, or a combination thereof. In some embodiments, the nAb binds to an S protein or a fragment thereof containing at least one point mutation selected from A222V, E406W, K417N, K417T, N439K, L455N, E484K, Q493F, N501Y, A570D, D614G, P681H, A701V, T716I, S982A, or a combination thereof. In some embodiments, the nAb is a monoclonal antibody (mAb), a functional antigen-binding fragment (Fab), a single-chain variable region fragment (scFv), or a single domain antibody (VHH or nanobody).
[0107] Exemplary nAbs for binding and neutralizing the S protein of SARS-CoV-2 are described, for example, in Barnes, CO et al. SARS-CoV-2 neutralizing antibody structures inform therapeutic strategies. Nature 588, 682-687 (2020), and Chinese patent application CN111690058A, the entire contents of which are incorporated herein by reference.
[0108] In some embodiments, the coding RNA sequence encodes a targeting protein that is not an antibody. Examples of non-antibody-based targeting proteins include, but are not limited to, lipocalins, anticalins (artificial antibody-mimetic proteins derived from human lipocalins), "T-bodies," peptides (e.g., BICYCLE™ peptides), affibodies (antibody mimics composed of alpha helices, e.g., three-helix bundles), peptibodies (peptide-Fc fusions), DARPins (designed ankyrin repeat proteins, engineered antibody-mimetic proteins composed of repeat motifs), affimers, avimers, knottins (protein structural motifs containing three disulfide bridges), monobodies, affinity clamps, ectodomains, receptor ectodomains, receptors, cytokines, ligands, immunocytokines, and centriins. See, for example, Vazquez-Lombardi, Rodrigo, et al. Drug discovery today 20.10(2015):1271-1283.
[0109] In some embodiments, the coding RNA sequence encodes a soluble receptor. The soluble receptor (sometimes called a soluble receptor decoy or "trap") can comprise all or part of the extracellular domain of a receptor protein. In some embodiments, the nucleotide sequence encoding all or part of the extracellular domain of a receptor protein is operably linked to a signal peptide for secretion from the cell.
[0110] In some embodiments, the soluble receptor comprises the extracellular domain of a naturally occurring receptor. In some embodiments, the soluble receptor variant comprises an engineered variant of the extracellular domain of a naturally occurring receptor, such as a variant comprising one or more mutations in the extracellular domain. In some embodiments, the soluble receptor comprises one or more mutations that increase the affinity of the soluble receptor for its ligand compared to the affinity of the native receptor for that ligand.
[0111] In some embodiments, the soluble receptor is a fusion protein comprising one or more additional protein domains operably linked to the extracellular domain of the receptor or a variant thereof. In some embodiments, the soluble receptor comprises the Fc domain of an immunoglobulin (Ig), such as a human immunoglobulin. In some embodiments, the soluble receptor comprises the Fc domain of a human IgG1.
[0112] In some embodiments, the soluble receptor comprises the extracellular domain of a signaling receptor, and the soluble receptor can reduce or inhibit the activity of a signaling pathway by blocking the binding between the endogenous receptor and its ligand.
[0113] In some embodiments, the soluble receptor is a receptor that binds to a viral protein and / or mediates viral entry. In some embodiments, the soluble receptor is a soluble ACE2 receptor. In some embodiments, the therapeutic polypeptide is a soluble ACE2 receptor variant capable of binding to the S protein of a coronavirus. In some embodiments, the soluble ACE2 receptor variant binds to the receptor binding domain (RBD) of the S protein. In some embodiments, the ACE2 receptor variant is enzymatically active. In other embodiments, the ACE2 receptor variant is enzymatically inactive. In some embodiments, the soluble ACE2 receptor variant comprises the soluble extracellular domain of wild-type (WT) human recombinant ACE2 (APN01). In some embodiments, the soluble ACE2 receptor variant comprises one or more mutations in the extracellular domain of human ACE2. In some embodiments, the soluble ACE2 receptor variant is engineered via affinity maturation to increase its binding affinity for the RBD of the S protein. Soluble ACE2 receptor variants are described, for example, in Haschke M et al., Clin Pharmacokinet. 2013 Sep;52(9):783-92; Glasgow A et al., Proceedings of the National Academy of Sciences Nov 2020,117(45)28046-28055; and Higuchi Y. et al., bioRxiv 2020.09.16.299891, the entire contents of which are incorporated herein by reference. In some embodiments, the soluble ACE2 receptor variant is a fusion protein, for example, a fusion of the extracellular ACE2 receptor domain with the Fc region of human IgG1.
[0114] In some embodiments, the coding RNA sequence encodes a functional protein. In some embodiments, the coding RNA sequence can be expressed by a target cell (e.g., a human or mouse cell) for the production (and in certain cases, secretion) of a functional enzyme or protein, for example, as disclosed in International Applications PCT / US2010 / 058457 and WO2020237227 (the entire contents of which are incorporated herein by reference). In some embodiments, a therapeutic polypeptide can be engineered for secretion by operably linking a signal peptide to the amino terminus of the therapeutic polypeptide. For example, in some embodiments, expression of one or more therapeutic polynucleotides by a target cell may be observed to produce a functional enzyme or protein (e.g., a urea cycle enzyme or an enzyme associated with a lysosomal storage disorder) that is deficient in the subject.
[0115] In some embodiments, the coding RNA sequence encodes a protein such as IDUA, OTC, FAH, miniDMD, DMD, p53, PTEN, COL3A1, BMPR2, AHI1, FANCC, MYBPC3, ILRG2, or ARG1, where a deficiency of the functional protein is associated with a disease or disorder. In some embodiments, the coding RNA sequence is a protein (e.g., a lysosomal enzyme), where a deficiency of the protein is associated with a lysosomal storage disorder.
[0116] In some embodiments, the coding RNA sequence encodes a protein (e.g., an enzyme) and a deficiency of this protein is associated with a metabolic disorder. In some embodiments, the therapeutic polypeptide comprises a urea cycle enzyme (e.g., ARG1).
[0117] In some embodiments, the coding RNA sequence encodes a protein (e.g., p53 or PTEN) whose deficiency is associated with cancer. In some embodiments, the therapeutic polypeptide comprises a tumor suppressor.
[0118] In some embodiments, the coding RNA sequence encodes a reporter protein, such as a fluorescent protein.Fluorescent proteins are well known to those skilled in the art, and include but are not limited to green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), red fluorescent protein (RFP) and blue fluorescent protein (BFP).
[0119] In some embodiments, the coding RNA sequence encodes more than one polypeptide, for example more than one therapeutic polypeptide, hi some embodiments, the coding RNA sequence encodes a therapeutic polypeptide and a reporter protein.
[0120] In some embodiments, various domains or fragments within the polypeptide encoded by the coding RNA sequence can be fused to each other via peptide linkers. Flexible peptide linkers, such as glycine linkers, glycine-serine linkers, and linkers containing other amino acids, are known in the art (e.g., suitable peptide linkers are described in Chen et al. in Fusion Protein Linkers: Property, Design and Functionality. Adv. Drug Deli Rev. 2013 October 15;65(10):1357-1369). Peptide linkers can also be designed by computational methods. Peptide linkers can be any length, from 1 to 10, 10 to 20, 20 to 30, 30 to 40, 40 to 50, or more than 50 amino acids.
[0121] In some embodiments, the coding RNA sequence is codon-optimized. A codon-optimized sequence may be one in which codons in a polynucleotide encoding a polypeptide are substituted to increase the expression, stability, and / or activity of the polypeptide. Factors that influence codon optimization include, but are not limited to, one or more of the following: (i) variation in codon bias between two or more organisms or genes, or between synthetically constructed bias tables; (ii) variation in the degree of codon bias within an organism, gene, or set of genes; (iii) systematic variation of codons with context; (iv) variation of codons depending on the decoding tRNA; (v) variation of codons depending on GC% overall or at a position in a triplet; (vi) variation in similarity to a reference sequence, e.g., a naturally occurring sequence; (vii) variation in codon frequency cutoff; (viii) structural properties of mRNA transcribed from a DNA sequence; (ix) prior knowledge of the function of the DNA sequence underlying the design of the codon substitution set; and / or (x) systematic variation of the codon set for each amino acid. In some embodiments, the codon-optimized polynucleotide can minimize ribozyme conflicts and / or limit structural interference between the expression sequence and the IRES.
[0122] In some embodiments, the coding RNA sequence may encode or be operably linked to one or more additional elements that facilitate translation of the coding RNA sequence into a functional polypeptide. In some embodiments, the one or more additional elements are useful for monitoring translation of the coding RNA sequence.
[0123] In some embodiments, the coding RNA sequence encodes a polypeptide that includes a signal peptide (SP). In non-limiting examples, the signal peptide is the signal sequence and propeptide from human tissue plasminogen activator (tPA), the signal sequence from human IgE immunoglobulin, or the signal peptide sequence of MHC I. In some embodiments, the signal peptide can facilitate secretion of the polypeptide encoded by the coding RNA sequence.
[0124] In some embodiments, the 3' end of the coding RNA sequence is operably linked to an in-frame 2A peptide coding sequence. In some embodiments, the coding RNA sequence does not contain a stop codon at the 3' end. In some embodiments, the in-frame 2A peptide coding sequence replaces the stop codon. In some embodiments, the coding RNA sequence does not contain a stop codon, and the number of nucleotides comprising the coding RNA is a multiple of three. In some embodiments, a coding RNA sequence without a stop codon and with a number of nucleotides comprising the RNA is a multiple of three enables rolling circle translation of circRNAs prepared using linear RNA precursors. In some embodiments, the 2A peptide coding sequence enables rolling circle translation of circRNAs prepared using linear RNA precursors. In some embodiments, the 2A peptide enables cleavage of polypeptides generated by rolling circle translation into monomeric polypeptide sequences. In a non-limiting example, the 2A peptide coding sequence encodes a P2A or T2A peptide, such as the sequence set forth in SEQ ID NO: 9 or 12.
[0125] In some embodiments, the coding RNA sequence comprises a nucleotide sequence encoding an affinity tag or identification tag. Exemplary tags include, but are not limited to, His tag, FLAG tag, SUMO tag, GST tag, and MBP tag.
[0126] In some embodiments, the 5' end of the coding RNA sequence is operably linked to a Kozak sequence. In some embodiments, the Kozak sequence functions as a protein translation initiation site. In some embodiments, the linear RNA comprises, from the 5' end to the 3' end, a first portion of an RNA element (e.g., an IRES), a Kozak sequence, the coding RNA sequence, and a second portion of an RNA element (e.g., an IRES).
[0127] In some embodiments, the linear RNA further comprises a polyA or polyAC sequence located at the 3' end of the coding RNA sequence and the 5' end of the second portion of the RNA element (e.g., IRES). The internal polyA or polyAC spacer may be in the range of 1 to 500 nucleotides in length (e.g., at least 20, 30, 40, 50, 60, 70, 80, 90, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, or 500 nucleotides). In some embodiments, the polyA or polyAC sequence may be in the range of 10 to 70, 20 to 60, or 30 to 60 nucleotides in length. In some embodiments, the linear RNA does not comprise a polyA or polyAC sequence. Without wishing to be bound by theory or hypothesis, the internal polyA or polyAC spacer added before the IRES sequence of the circRNA helps maintain a functional secondary structure of the IRES element for efficient IRES-initiated protein translation. In some embodiments, a polyA sequence or a polyAC spacer increases expression of the coding RNA.
[0128] III. circRNA preparation method The present application further provides a method for preparing circRNA using any one of the linear RNAs or constructs described in Section II above. Intramolecular ligation of the linear RNA described herein by RNA ligase provides a circRNA comprising an RNA element and an effector RNA (e.g., coding RNA) sequence. In some embodiments, the circRNA is prepared by circularizing the linear RNA in vitro.
[0129] In some embodiments, circRNAs can be obtained by circularizing linear RNAs using a ligase such as an RNA ligase. In some embodiments, the linear RNAs are circularized in vitro. In some embodiments, the linear RNAs can be circularized using T4 RNA ligase. In a non-limiting example, the linear RNAs can be circularized using a ligase such as T4 RNA ligase 1 (T4 Rnl1) and T4 RNA ligase 2 (T4 Rnl2). The linear RNAs described herein are circularized without the presence of a single-stranded nucleic acid adapter, such as a splint oligonucleotide.
[0130] In some embodiments, a method for preparing a circRNA is provided, comprising: (a) contacting any one of the linear RNAs described herein with an RNA ligase under conditions that allow ligation of nicks in the linear RNA to provide a circularized RNA product; and (b) isolating the circularized RNA product, thereby providing a circRNA. In some embodiments, the ligation does not require the presence of a splint oligonucleotide.
[0131] In some embodiments, the methods described herein include circularizing a linear RNA in vitro, comprising (a) contacting any one of the linear RNAs described herein with an RNA ligase under conditions that allow ligation of nicks in the linear RNA to provide a circularized RNA product, and (b) isolating the circularized RNA product, thereby providing a circRNA. In some embodiments, the ligation does not require the presence of a splint oligonucleotide.
[0132] In some embodiments, a method of preparing a circRNA is provided, comprising: (a) contacting any one of the linear RNAs described herein with T4 RNA ligase 2 under conditions that allow ligation of nicks in the linear RNA to provide a circularized RNA product; and (b) isolating the circularized RNA product, thereby providing a circRNA. In some embodiments, the ligation does not require the presence of a splint oligonucleotide.
[0133] RNA ligase may be used to enzymatically join the 5'-phosphorylated end of the linear RNA described herein to the 3'-hydroxyl group of the linear RNA, forming a new phosphodiester bond. In an exemplary reaction, linear circular RNA is incubated with 1-10 units of T4 RNA ligase (New England Biolabs, Ipswich, Mass.) for 8 hours at 25°C according to the manufacturer's protocol. The ligation reaction occurs without the need for a linear nucleic acid capable of base-pairing with both the juxtaposed 5' and 3' regions to support the enzymatic ligation reaction; i.e., the ligation is not a splint ligation.
[0134] Ligation with T4 RNA ligase 1 can result in the insertion or deletion of nucleotides at the ligation site. In some embodiments, T4 RNA ligase 2 is used to ligate the linear RNAs described herein so that no additional sequences are introduced into the circRNA.
[0135] The methods described herein have high intramolecular ligation efficiency. Ligation efficiency can be assessed using methods known in the art, such as HPLC or agarose gel electrophoresis. In some embodiments, the ligation efficiency is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or more. In some embodiments, the method results in less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, or even less of polymeric circRNA product, i.e., ligation of multiple copies of linear RNA to a single circRNA.
[0136] In some embodiments, the method further comprises in vitro transcription of a nucleic acid construct encoding the linear RNA to obtain the linear RNA.
[0137] In some embodiments, the method further comprises treating the circularized RNA product with RNase R to digest linear RNA transcripts.
[0138] In some embodiments, the method further comprises purifying the circRNA from the circRNA product. In a non-limiting example, the circRNA is purified by gel purification or high-performance liquid chromatography (HPLC). In some embodiments, agarose gel electrophoresis can easily and effectively separate the circular RNA product from linear RNA precursor molecules and nicked circles. In some embodiments, the method comprises purifying the circular RNA by chromatography, such as HPLC. In some embodiments, the purified circular RNA can be stored at -80°C. In some embodiments, the step of isolating the circRNA comprises gel-purifying the circRNA. In some embodiments, the purified circRNA can be stored at -80°C.
[0139] III. Circular RNA and Methods of Use Thereof The present application further provides circRNAs and compositions prepared using any one of the preparation methods or any one of the linear RNAs or constructs described herein.
[0140] In some embodiments, the circRNA comprises an RNA element and an effector RNA sequence. In some embodiments, the effector RNA sequence is a sequence of an RNA molecule selected from the group consisting of gRNA, dRNA, siRNA, miRNA, shRNA, lincRNA, and coding RNA.
[0141] In some embodiments, a circRNA comprises an RNA element (e.g., an IRES) and a coding RNA sequence that encodes a therapeutic polypeptide, such as an antigenic polypeptide, a functional protein, a receptor protein, or a targeting protein.
[0142] In some embodiments, the circRNA is a circRNA vaccine comprising an RNA element (e.g., an IRES) and a coding RNA sequence encoding an antigenic polypeptide. In some embodiments, the circRNA vaccine is a coronavirus vaccine or a cancer vaccine.
[0143] In some embodiments, a cocktail composition comprising multiple circRNAs is provided, each circRNA comprising a coding RNA sequence encoding an antigenic polypeptide, a receptor protein of an infectious agent, or a targeting protein (e.g., an antibody such as a neutralizing antibody). In some embodiments, the multiple circRNAs encode different antigenic polypeptides, such as different variants of an antigenic polypeptide (e.g., S protein or a fragment thereof). In some embodiments, the multiple circRNAs encode different receptor proteins, such as different variants of a receptor protein (e.g., ACE2). In some embodiments, the multiple circRNAs encode different targeting proteins, such as different antibodies (e.g., neutralizing antibodies).
[0144] The circRNAs described herein can be used to treat or prevent diseases or conditions in individuals, including, but not limited to, genetic diseases (e.g., inherited genetic diseases, metabolic diseases, and cancers) and infectious diseases (e.g., viral infections such as coronaviruses). In some embodiments, the circRNAs undergo rolling circle translation by ribosomes within the individual.
[0145] In some embodiments, a method for treating or preventing a disease or condition in an individual is provided, comprising administering to the individual an effective amount of a circRNA comprising a coding RNA sequence encoding a functional protein. In some embodiments, the functional protein is an enzyme, receptor, ligand, signaling molecule, or transcription factor. In some embodiments, the disease or condition is a metabolic disease. In some embodiments, the disease or condition is a lysosomal storage disorder. In some embodiments, the disease or condition is cancer.
[0146] The circRNAs described herein can be used to treat genetic diseases or conditions associated with mutations or deficiencies in the naturally occurring protein corresponding to the therapeutic polypeptide encoded by the circRNA. In some embodiments, the disease or condition is a disease or condition associated with insufficient levels and / or activity of the naturally occurring protein corresponding to the therapeutic polypeptide. In some embodiments, the disease or condition is an inherited genetic disease associated with one or more mutations in the naturally occurring protein corresponding to the therapeutic polypeptide. In some embodiments, the therapeutic polypeptide is a wild-type protein or a functional variant thereof (e.g., a functional fragment, fusion protein, or mutant).
[0147] In some embodiments, a therapeutic polypeptide can be any polypeptide that can be expressed by a target cell (e.g., a human or mouse cell) for the production (and, in certain cases, secretion) of a functional enzyme or protein, e.g., as disclosed in International Application No. PCT / US2010 / 058457. In some embodiments, a therapeutic polypeptide can be engineered to be secreted by operably linking a signal peptide to the amino terminus of the therapeutic polypeptide. For example, in some embodiments, expression of one or more therapeutic polynucleotides by a target cell can be observed to produce a functional enzyme or protein in which the subject is deficient (e.g., a urea cycle enzyme or an enzyme associated with a lysosomal storage disorder).
[0148] Examples of disease-associated mutations that can be treated by the methods of the present application include TP53, which is associated with cancer, W53X (e.g., 158G>A), IDUA associated with mucopolysaccharidosis type I (MPSI) W402X (e.g., TGG>TAG mutation in exon 9), COL3A1 associated with Ehlers-Danlos syndrome W1278X (e.g., 3833G>A mutation), BMPR2 associated with primary pulmonary hypertension W298X (e.g., 893G>A), AHI1 associated with Joubert syndrome W725X (e.g., 2174G>A), FANCC associated with Fanconi anemia W506X (e.g., 1517G>A), MYBPC3 associated with primary familial hypertrophic cardiomyopathy W1098X (e.g., 3293G>A), and IL2RG, which is associated with X-linked severe combined immunodeficiency. W237X (e.g., 710G>A). In some embodiments, the disease or condition is cancer. In some embodiments, the disease or condition is a monogenic disease. In some embodiments, the disease or condition is a polygenic disease.
[0149] In some embodiments, the circRNA has a functional half-life of at least about 20 hours, 24 hours, 30 hours, or 36 hours. In some embodiments, the circRNA has a duration of therapeutic effect in human cells of at least about 20 hours, 24 hours, 30 hours, or 36 hours. In some embodiments, the circRNA has a duration of therapeutic effect in human cells that is equal to or longer than the therapeutic effect of an equivalent linear RNA containing the same expression sequence. In some embodiments, the circRNA has a functional half-life in human cells that is equal to or longer than the functional half-life of an equivalent linear RNA containing the same expression sequence.
[0150] In some embodiments, a method for treating or preventing a disease or condition in an individual is provided, comprising administering to the individual an effective amount of a circRNA vaccine comprising a coding RNA sequence encoding an antigenic polypeptide, or a cocktail composition comprising multiple circRNAs. In some embodiments, the antigenic polypeptide is a protein or fragment thereof of an infectious agent such as a virus, e.g., a coronavirus. In some embodiments, the infectious agent is SARS-CoV-2.
[0151] In some embodiments, a method for treating or preventing a disease or symptom in an individual is provided, comprising administering to the individual an effective amount of circRNA comprising a coding RNA sequence encoding a receptor protein. In some embodiments, the receptor protein is a receptor for an infectious agent such as a virus, for example, a coronavirus. In some embodiments, the receptor protein is a soluble receptor, such as a soluble ACE2 receptor.
[0152] In some embodiments, a method for treating or preventing a disease or condition in an individual is provided, comprising administering to the individual an effective amount of a circRNA comprising a coding RNA sequence encoding a targeting protein such as an antibody. In some embodiments, the targeting protein is a neutralizing antibody. In some embodiments, the targeting protein is a therapeutic antibody. In some embodiments, the targeting protein specifically binds to an infectious agent such as a virus, for example, a coronavirus.
[0153] In some embodiments, the present application provides circRNAs for the treatment or prevention of a disease or condition in an individual.
[0154] In some embodiments, the present application provides the use of a circRNA comprising a nucleic acid sequence encoding a therapeutic polypeptide in the manufacture of a medicament for treating or preventing a disease or condition in an individual.
[0155] In some embodiments, circRNAs are administered as naked circRNAs or as pharmaceutical compositions containing transfection agents. In non-limiting examples, the transfection agent is polyethyleneimine (PEI) or lipid nanoparticles (LNPs). Other examples of lipidosomes that can be used to administer circRNA compositions (e.g., circRNA vaccines or pharmaceutical compositions) include protamine, cationic nanoemulsions, modified dendrimer nanoparticles, protamine liposomes, cationic polymers, cationic polymer liposomes, polysaccharide particles, cationic lipid nanoparticles, cationic lipid-cholesterol nanoparticles, cationic lipid-cholesterol PEG nanoparticles, cationic lipid transfection reagents sold under the trademark LIPOFECTAMINE, nonliposomal transfection reagents sold under the trademark FUGENE, or any combination thereof can be used as transfection agents.
[0156] In some embodiments, liposome formulations can be influenced by biophysical parameters such as, but not limited to, the choice of cationic lipid component, the degree of saturation of the cationic lipid, the nature of PEGylation, the ratio of all components, and size. In some embodiments, the liposome formulation comprises a cationic lipid, cholesterol, and a PEGylated lipid. For example, the liposome formulation may comprise a cationic lipid, dipalmitoylphosphatidylcholine, cholesterol, and PEG-c-DMA. See, for example, Semple et al. Nature Biotech. 2010 28:172-176, the entire contents of which are incorporated herein by reference. In some embodiments, the liposome formulation may comprise about 35% to about 45% cationic lipid, about 40% to about 50% cationic lipid, about 50% to about 60% cationic lipid, and / or about 55% to about 65% cationic lipid. In some embodiments, the lipid to RNA ratio in the liposomes may be from about 5:1 to about 20:1, from about 10:1 to about 25:1, from about 15:1 to about 30:1, and / or at least 30:1. Suitable liposome formulations are described, for example, in WO2020237227, the entire contents of which are incorporated herein by reference.
[0157] In some embodiments, the circRNA is not formulated with a transfection reagent. In some embodiments, the circRNA is delivered as naked RNA. In some embodiments, the circRNA is delivered by a gene gun or electroporation.
[0158] The circRNA composition for administration (e.g., a circRNA vaccine or pharmaceutical composition) can be administered to a subject by systemic injection into the vascular system, systemic injection into lymph nodes, subcutaneous injection or depot, or local injection.
[0159] In some embodiments, circRNAs can be formulated in lipid nanoparticles such as those described in International Publication No. WO2012170930, which is incorporated herein by reference in its entirety.
[0160] In some embodiments, synthetic nanocarriers can be formulated for controlled and / or sustained release of the circRNAs described herein. By way of non-limiting example, synthetic nanocarriers for sustained release can be formulated by methods known in the art, as described herein and / or in International Publication WO2010138192 and U.S. Publication US20100303850, each of which is incorporated herein by reference in its entirety.
[0161] In some embodiments, circRNAs can be formulated for controlled and / or sustained release, wherein the formulation comprises at least one polymer that is a crystalline side chain (CYSC) polymer. CYSC polymers are described in U.S. Patent No. 8,399,007, the entire contents of which are incorporated herein by reference.
[0162] In some embodiments, synthetic nanocarriers can be formulated for use as vaccines. In some embodiments, synthetic nanocarriers can encapsulate at least one circRNA encoding at least one antigen. As a non-limiting example, a synthetic nanocarrier can include at least one antigen and an excipient for a vaccine formulation (see International Publication WO2011150264 and US Publication US20110293723, each of which is incorporated herein by reference in its entirety). As another non-limiting example, a vaccine formulation can include at least two synthetic nanocarriers with the same or different antigens and an excipient (see International Publication WO2011150249 and US Patent Publication US20110293701, each of which is incorporated herein by reference in its entirety). Vaccine formulations can be selected by methods described herein, methods known in the art, and / or methods described in International Publication No. WO2011150258 and US Publication No. US20120027806, each of which is incorporated herein by reference in its entirety.
[0163] In some embodiments, synthetic nanocarriers may contain at least one circRNA encoding at least one adjuvant. As a non-limiting example, the adjuvant may include dimethyldioctadecylammonium bromide, dimethyldioctadecylammonium chloride, dimethyldioctadecylammonium phosphate, or dimethyldioctadecylammonium acetate (DDA), and the apolar fraction of a total lipid extract of mycobacteria or a portion of the apolar fraction (see, e.g., U.S. Patent No. 8,241,610, the entire contents of which are incorporated herein by reference). In another embodiment, synthetic nanocarriers may contain at least one circRNA and an adjuvant. As a non-limiting example, synthetic nanocarriers containing adjuvants can be formulated by the methods described in International Publication No. WO2011150240 and U.S. Publication No. US20110293700, each of which is incorporated herein by reference in its entirety.
[0164] In some embodiments, circRNAs are used as adjuvants. For example, RNA sensing in the cytoplasm can trigger innate immunity, and innate immune signaling is known to contribute to adaptive immunity through various pathways. Therefore, a circRNA encoding an antigenic polypeptide or a second circRNA (e.g., a circRNA that does not encode a polypeptide) can be used as an adjuvant to enhance adaptive immune responses to antigenic polypeptides.
[0165] In some embodiments, the circRNA compositions of the present application can be administered together with other prophylactic or therapeutic compounds. As a non-limiting example, the prophylactic or therapeutic compound can be an adjuvant or booster. As used herein, when referring to a prophylactic composition such as a vaccine, the term "booster" refers to an additional administration of the prophylactic composition. A booster (or booster vaccine) can be administered after the initial administration of the prophylactic composition. The time between the first dose of the prophylactic composition and the booster dose can be 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes, 20 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 36 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 10 days, 2 weeks, 3 weeks, 1 The term may be, but is not limited to, months, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 18 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12 years, 13 years, 14 years, 15 years, 16 years, 17 years, 18 years, 19 years, 20 years, 25 years, 30 years, 35 years, 40 years, 45 years, 50 years, 55 years, 60 years, 65 years, 70 years, 75 years, 80 years, 85 years, 90 years, 95 years or 99 years or more.
[0166] In some embodiments, the circRNA composition (e.g., circRNA vaccine or pharmaceutical composition) for administration can be administered intranasally. For example, the circRNA vaccine can be administered intranasally, similar to the administration of a live vaccine. In some embodiments, the circRNA can be administered intramuscularly or intradermally, similar to the administration of an inactivated vaccine known in the art.
[0167] In some embodiments, the circRNA vaccine comprises an adjuvant that can enable the vaccine to induce a stronger immune response. As a non-limiting example, the adjuvant can be a submicron oil-in-water emulsion that can induce a stronger immune response in human pediatric populations (see, for example, the adjuvant-containing vaccines described in US Patent Publication No. US20120027813 and US Patent No. US8506966, the entire contents of each of which are incorporated herein by reference).
[0168] V. Compositions, Kits and Articles of Manufacture Additionally, the present application provides compositions comprising any one of the linear RNAs, constructs, or circRNAs described herein. In some embodiments, pharmaceutical compositions are provided comprising any one or more circRNAs described herein and a pharmaceutically acceptable carrier. Pharmaceutical compositions can be prepared by mixing a therapeutic agent described herein having the desired purity, in the form of a lyophilized formulation or aqueous solution, with any pharmaceutically acceptable carrier, excipient, or stabilizer (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)). Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations used and include buffers; antioxidants such as ascorbic acid, methionine, vitamin E, and sodium metabisulfite; preservatives, isotonicity agents (e.g., sodium chloride), stabilizers, metal complexes (e.g., zinc-protein complexes); and chelating agents such as EDTA and / or nonionic surfactants.
[0169] In some embodiments, the pharmaceutical composition is contained in a single-use vial, such as a single-use sealed vial. In some embodiments, the pharmaceutical composition is contained in a multi-use vial. In some embodiments, the pharmaceutical composition is contained as a whole within a container. In some embodiments, the pharmaceutical composition is stored frozen.
[0170] The present application further provides kits and products for use in any one of the methods for preparing circRNA described herein. In some embodiments, the kit comprises a linear RNA or a construct encoding a linear RNA described herein and instructions for preparing circRNA. In some embodiments, the kit further comprises an RNA ligase, such as T4 RNA ligase 1 or T4 RNA ligase 2. In some embodiments, the kit further comprises a reverse transcriptase.
[0171] In some embodiments, a kit is provided comprising any one of the circRNAs described herein and instructions for treating or preventing a disease or condition (e.g., coronavirus infection or cancer). In some embodiments, the kit comprises instructions for administering the circRNA.
[0172] The kits of the present invention are in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. The kits may optionally provide additional components, such as buffers and interpretive information. Thus, the present application also provides articles of manufacture that include vials (e.g., sealed vials), bottles, jars, flexible packaging, and the like.
[0173] The instructions for use of the composition generally include information regarding the dosage, administration schedule, and administration route for the intended treatment. The container may be a unit dose, bulk package (e.g., a multi-dose package), or subunit dose. For example, a kit may be provided that contains a sufficient dose of the circRNA disclosed herein to provide effective treatment for an individual or many individuals. Furthermore, a kit may be provided that contains a sufficient dose of the circRNA to allow multiple administrations to an individual (e.g., in the case of a circRNA vaccine, an initial vaccine administration and subsequent booster administrations). The kit may also include multiple unit doses of the pharmaceutical composition and instructions for use, packaged in a quantity sufficient for storage and use in pharmacies (e.g., hospital pharmacies and compounding pharmacies).
[0174] In some embodiments, the kit includes a delivery system. The delivery system may be a unit-dose delivery system. The volume of the solution or suspension delivered per dose may be about 5 to about 2000 μl, about 10 to about 1000 μl, or about 50 to about 500 μl. These various dosage forms of the delivery system may be a unit-dose or multi-dose packaged syringe, dropper bottle, plastic squeeze unit, atomizer, nebulizer, or pharmaceutical aerosol. In some embodiments, a delivery system for any one of the circRNAs described herein is provided, including the circRNA and a device for delivering the circRNA.
[0175] All features disclosed herein can be combined in any combination. Each feature disclosed herein can be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features. [Example]
[0176] The present invention will be more fully understood by reference to the following examples, which should not, however, be construed as limiting the scope of the present invention. It is understood that the examples and embodiments described herein are for illustrative purposes only, and that various modifications or changes will be suggested to those skilled in the art in light thereof, and are intended to be included within the spirit and scope of this application and the appended claims of the present invention.
[0177] Example 1. In vitro circRNA generation by ligation Because circRNAs lack caps or poly(A) tails, an internal ribosome entry site (IRES) is required to initiate the translation process of circRNAs. Here, we use a rationally designed split IRES element (also referred to herein as an "IRES split" or "split IRES portion") to efficiently and precisely generate coding circular RNAs using T4 RNA ligase. Figure 1 shows an overview of the method for generating circRNAs using constructs containing split IRESs. First, an RNA transcript (also referred to as a "precursor" or "linear RNA precursor") is obtained by in vitro transcription of a construct containing two IRES splits that associate with each other to form a stable intramolecular secondary structure with nicks at both ends of the RNA transcript. The nicks are then ligated with T4 RNA ligase to generate circular RNAs.
[0178] We analyzed the secondary structure of wild-type CVB3 IRES (SEQ ID NO: 1) using RNAfold software. We found that the wild-type CVB3 IRES contains a highly stable double-stranded RNA structure, which may promote the formation of an intramolecular duplex. See the boxed region in Figure 2A. Therefore, we selected two sites within the double-stranded RNA region to engineer split pairs of the CVB3 IRES segments. In the first pair of CVB3 IRES splits (also referred to herein as "site 1 CVB3 IRES split"), the 5' portion of the CVB3 IRES split was located at the 5' end of the CVB3 IRES split. (SEQ ID NO: 2) is the wild-type CVB3 IRES (SEQ ID NO: 1 ) 1 to 38 1th nucleotide and the first exogenous sequence GUUU Contains the 3' portion of the CVB3 IRES split (SEQ ID NO: 3) is the wild-type CVB3 IRES (SEQ ID NO: 1 ) 38 2 From 74 1 th nucleotide and a second exogenous sequence, AAAC See Figure 2B. In the second pair of CVB3 IRES splits (also referred to herein as "site 2 CVB3 IRES splits"), the 5' portion of the CVB3 IRES split (SEQ ID NO: 4) is the wild-type CVB3 IRES (SEQ ID NO: 1 ) 1 to 34 2 th nucleotide and the first exogenous sequence GUUU Contains the 3' portion of the CVB3 IRES split (SEQ ID NO: 5) is the wild-type CVB3 IRES (SEQ ID NO: 1 ) 34 3 From 74 1 th nucleotide and a second exogenous sequence, AAAC See Figure 2C. To maintain the stability of the double-stranded structure, we have GUUU and its reverse complement ( AAAC ) was inserted immediately adjacent to the division site (the boxed sequence in Figures 2B-2C).
[0179] Two constructs for generating circular RNA encoding EGFP were designed using the first and second pairs of CVB3 IRES splits. Each construct contains, from 5' to 3', a T7 promoter (SEQ ID NO: 6), the 3' portion of the CVB3 IRES split, an EGFP coding sequence (SEQ ID NO: 7), a FLAG-tag coding sequence (SEQ ID NO: 8), a P2A sequence (SEQ ID NO: 9), and the 5' portion of the CVB3 IRES split. The construct based on the site 1 CVB3 IRES split (also referred to herein as the "site 1 construct") has the DNA sequence of SEQ ID NO: 10. The construct based on the site 2 CVB3 IRES split (also referred to herein as the "site 2 construct") has the DNA sequence of SEQ ID NO: 11.
[0180] The two constructs were each transcribed in vitro to yield linear RNA precursors, which were then ligated with T4 RNA ligase 1 or T4 RNA ligase 2 at 25°C for 8 hours. The circular RNA product from the site 1 construct is referred to herein as site 1-ligated circular RNA. The circular RNA product from the site 2 construct is referred to herein as site 2-ligated circular RNA. The ligation products were treated with RNase R to remove the linear RNA precursors. Figure 3 shows HPLC chromatograms of the site 1-ligated circular RNA ligated with T4 RNA ligase 1 before and after RNAse R treatment. The circularization efficiency was approximately 70%, and much of the linear RNA product was degraded by RNase R treatment.
[0181] Next, we transfected each circular RNA product into HEK293T cells in 12-well plates at 4 μg per well. As shown in Figure 4A, EGFP expression was detected in cells transfected with site 1-ligated circular RNA, but not in cells transfected with site 2-ligated circular RNA. We reasoned that the lack of EGFP expression might be due to disruption of the functional structure of the ligated IRES in site 2-ligated circular RNA. Western blot analysis showed that the EGFP expression level in cells transfected with site 1-ligated circular RNA was much higher than the expression level of β-tubulin in the same cells (Figure 4B).
[0182] Finally, we tested the accuracy of the ligation site, i.e., the absence of insertions or deletions at the ligation site. We reverse-transcribed the site 1 ligated circular RNA and PCR-amplified the ligation site junction using forward and reverse primers, as shown in Figure 1. As shown in Figure 5A, the PCR results confirmed that circular RNA was formed after ligation of the RNA precursor with T4 RNA ligase, but no circular RNA was found in the RNA precursor that had not been treated with T4 RNA ligase. Using Sanger sequencing, we determined the sequence of the circular RNA around the ligation junction in samples ligated with T4 RNA ligase 1 or T4 RNA ligase 2. As shown in Figure 5B, T4 RNA ligase 2 accurately ligated nicks in the linear RNA precursor, while T4 RNA ligase 1 treatment resulted in a small number of insertions and deletions. Without being bound by theory, this may be due to the substrate requirement of T4 RNA ligase 2, which requires a double-stranded RNA substrate.
[0183] Sequence Listing SEQ ID NO: 1 Wild-type CVB3-IRES RNA sequence UUAAAACAGCCUGUGGGUUGAUCCCACCCACAGGCCCAUUGGGCGCUAGCACUCUGGUAUCACGGUACCUUUGUGGCCUGUUUUUACCCCCUCCCCCAACUGUAACUUAGAAGUAACACACACCGAUCAACAGUUCAGCGUGGCACACCAGCCACGUUUUGAUCAAGCACUUCUGUUACCCCGG ACUGAGUAUCAAUAGACUGCUCACGCGGUUGAAGGAGAAAGCGUUCGUUAUCCGGCCAACUACUUCGAAAAACCUAGUAACACCGUGGAAGUUGCAGAGUGUUUCGCUCAGCACUACCCCAGUGUAGAUCAGGUCGAUGAGUCACCGCAUUCCCCACGGGCGACCGUGGCGGUGGCUGCGUUGGC GGCCUGCCCAUGGGGAAACCCAUGGGACGCUCUAAUACAGACAUGGUGCGAAGAGUCUAUUGAGCUAGUUGGUAGUCCUCCGGCCCCUGAAUGCGGCUAAUCCUAACUGCGGAGCACACACCCUCAAGCCAGAGGGCAGUGUGUCGUAACGGGCAACUCUGCAGCGGAACCGACUACUUUGGGUG UCCGUGUUUCAUUUUAUUCCUAUACUGGCUGCUUAUGGUGACAAUGAGAGAUCGUUACCAUAUAGCUAUUGGAUUGGCCAUCCGGUGACUAAUAGAGCUAUUAUAUAUCCCUUUGUUGGGUUUAUACCACUUAGCUUGAAAGAGGUUAAAACAUUACAAUUCAUUGUUAAGUUGAAUACAGCAAA
[0184] SEQ ID NO: 2 Site 1 5' part of CVB3-IRES split (1 to 38 of wild-type CVB3-IRES) 1 th nucleotide and the first exogenous sequence GUUU. )
[0185] [ka]
[0186] SEQ ID NO: 3 Site 1 3' part of CVB3-IRES split (38 of wild-type CVB3-IRES) 2 ~74 1 th nucleotide and a second exogenous sequence, AAAC. )
[0187] [ka]
[0188] SEQ ID NO: 4 Site 2 5' part of CVB3-IRES split (1-34 of wild-type CVB3-IRES) 2 th nucleotide and the first exogenous sequence GUUU. )
[0189] [ka]
[0190] SEQ ID NO: 5 Site 2 3' part of CVB3-IRES split (34 of wild-type CVB3-IRES) 3 ~74 1 th nucleotide and a second exogenous sequence, AAAC. )
[0191] [ka]
[0192] SEQ ID NO: 6 T7 promoter sequence TAATACGACTCACTAT A
[0193] SEQ ID NO: 7 DNA sequence encoding EGFP ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG
[0194] DNA sequence encoding the FLAG tag of SEQ ID NO: 8 GATTACAAGGATGACGACGATAAG
[0195] P2A sequence of SEQ ID NO: 9 GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT
[0196] SEQ ID NO: 10 Site 1 construct (Site 1 CVB3-IRES split adjacent to the RNA encoding EGFP)
[0197] SEQ ID NO: 11 Site 1 construct (Site 2 CVB3-IRES split adjacent to the RNA encoding EGFP)
[0198] SEQ ID NO: 12 T2A peptide coding sequence GAGGGCAGAGGAAGUCUUCUAACAUGCGGUGACGUGGAGGAGAAUCCCGGCCCU
[0199] SEQ ID NO: 13 CACCGACGCAACCGCCGGACGGGTACAAACCCCTTTGGGTTTGTACCCTGCGAGATTATGTCTGTAC
[0200] SEQ ID NO: 14 GTGGCTGCGTTGGCGGCCTGCCCATGTTTG
[0201] SEQ ID NO: 15 GTGGCTGCGTTGGCGGCCTGCCCATGTTTGGGGGGAAACCCAAACATGGGACGCTCTAATACAGACATG
Claims
1. From the 5' end to the 3' end: (a) a first portion of an RNA element; (b) an effector RNA sequence, and (c) a second portion of the RNA element A linear RNA comprising: the RNA element is an internal ribosome entry site (IRES) or part thereof; the first portion of the RNA element and the second portion of the RNA element associate with each other to form a double-stranded region at least 4 base pairs (bp) in length; the 5' end of the first portion of the RNA element and the 3' end of the second portion of the RNA element are nicked in the double-stranded region; A linear RNA, wherein the nicks can be ligated by an RNA ligase.
2. The linear RNA of claim 1 , wherein the double-stranded region is 6 bp to 25 bp in length.
3. The linear RNA of claim 1 or 2, wherein the RNA element is at least 20 nt in length.
4. The linear RNA of any one of claims 1 to 3, wherein the double-stranded region comprises at least 2 bp on the 3' side of the nick and / or the double-stranded region comprises at least 2 bp on the 5' side of the nick.
5. the first portion of the RNA element and / or the second portion of the RNA element comprises a sequence exogenous to a reference RNA element; 2. The linear RNA of claim 1, wherein optionally, the second portion of the RNA element comprises a first foreign sequence at its 3' end, and the first portion of the RNA element comprises a second foreign sequence that is complementary to the first foreign sequence, and the first and second foreign sequences are base-paired adjacent to the 5' end of the nick.
6. The linear RNA of any one of claims 1 to 5, wherein the effector RNA sequence is a coding RNA sequence, optionally wherein the coding RNA sequence encodes a therapeutic polypeptide.
7. the RNA element promotes translation of the coding RNA; 7. The linear RNA of claim 6, wherein the IRES is derived from an IRES selected from the group consisting of Coxsackievirus B3 (CVB3) IRES, Enterovirus 71 (EV71) IRES, Encephalomyocarditis virus (EMCV) IRES, Picornavirus (PV) IRES, Hepatitis C virus (HCV) IRES, Adenovirus (AdV) IRES, Human papillomavirus type 31 (HPV31) IRES, Human herpesvirus (HHV) IRES, Rous sarcoma virus (RSV) IRES, Classical swine fever virus (CSFV) IRES, FGF9 IRES, SLC7A1 IRES, and RUNX1 IRES.
8. The linear RNA of claim 7, wherein the IRES is an IRES of the CVB3 virus or a derivative thereof, and optionally, the IRES of the CVB3 virus comprises the nucleotide sequence of SEQ ID NO:
1.
9. a first portion of the RNA element comprising nucleotides 382 to 741 of SEQ ID NO:1 and a second portion of the RNA element comprising nucleotides 1 to 381 of SEQ ID NO:1; or 9. The linear RNA of claim 8, wherein a first portion of the RNA element comprises nucleotides 343 to 741 of SEQ ID NO:1, and a second portion of the RNA element comprises nucleotides 1 to 342 of SEQ ID NO:
1.
10. The linear RNA of any one of claims 6 to 9, further comprising an in-frame 2A peptide coding sequence operably linked to the 3' end of the coding RNA.
11. 6. The linear RNA of any one of claims 1 to 5, wherein the effector RNA sequence is a non-coding RNA sequence selected from the group consisting of guide RNA (gRNA), deaminase recruiting RNA (dRNA), siRNA, miRNA, shRNA, and long intergenic non-coding (linc) RNA.
12. (a) contacting the linear RNA of any one of claims 1 to 11 with an RNA ligase under conditions that allow ligation of nicks in the linear RNA to provide a circularized RNA product; (b) isolating the circularized RNA product to provide circRNA. A method for preparing circRNA, comprising:
13. A nucleic acid construct comprising a nucleic acid sequence encoding the linear RNA of any one of claims 1 to 11.
Citation Information
Patent Citations
Methods and compositions for circular RNA molecules
JP2021502086A
Compositions and methods for transient gene therapy with enhanced stability
WO2016197121A1
Circular RNA for translation in eukaryotic cells
WO2019236673A1