Method for producing nucleic acid oligomers

By employing an iodine-based oxidizing solution with controlled molar ratios, the synthesis of nucleic acid oligomers achieves enhanced purity and efficiency, addressing inefficiencies in conventional methods.

JP7777452B2Active Publication Date: 2025-11-28SUMITOMO CHEM CO LTD
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
JP2021574515
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-01-29
Filing Date
2020-12-14
Publication Date
2025-11-28
Estimated Expiration
2040-12-14

AI Technical Summary

Technical Problem

Existing methods for synthesizing nucleic acid oligomers, such as DNA and RNA, suffer from inefficiencies and unsatisfactory purity due to the use of conventional oxidizing solutions in solid-phase synthesis.

Method used

A method involving an oxidizing solution containing iodine, pyridine, and water with a controlled molar ratio of iodic acid to iodine is used to oxidize phosphite esters during nucleic acid oligomer synthesis, followed by specific deprotection steps to enhance purity and efficiency.

Benefits of technology

This approach significantly improves the purity and efficiency of nucleic acid oligomer production, allowing for higher quality nucleic acid compounds to be produced.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007777452000049
    Figure 0007777452000049
  • Figure 0007777452000001
    Figure 0007777452000001
  • Figure 0007777452000002
    Figure 0007777452000002
Patent Text Reader

Abstract

The purpose of the present invention is to provide a method for producing a nucleic acid oligomer efficiently, particularly a method for producing a nucleic acid molecule having a phosphoric acid triester bond efficiently by oxidizing a nucleic acid precursor having a phosphonic acid triester bond. The present invention also provides a method for producing a nucleic acid compound having a nucleotide represented by formula (I) at the 5'-terminal thereof by a phosphoramidite method, the method comprising a step of reacting a precursor having a phosphonic acid triester bond represented by formula (II) at the 5'-terminal thereof with an oxidization solution comprising iodine, pyridine and water in which the molar ratio of iodic acid to iodine (iodic acid (mol) / iodine (mol)) is 30×10-3 or less (wherein the definitions for substituents in formulae (I) and (II) are as described in the description).
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This patent application claims priority under the Paris Convention to and the benefit of Japanese Patent Application No. 2020-012787 (filed January 29, 2020), the entire contents of which are incorporated herein by reference. The present invention relates to a method for producing a nucleic acid oligomer.

[0002] Nucleic acid oligomers such as DNA and RNA are useful materials that can be used as DNA probes, RNA probes, antisense molecules, ribozymes, siRNAs, aptamers, and the like.

[0003] Nucleic acid oligomers can be synthesized by solid-phase synthesis, which uses nucleoside phosphoramidites (hereinafter referred to as "amidites") as starting materials. Nucleic acid oligomers synthesized on a solid support by extending the nucleic acid through coupling, oxidation, and deprotection steps are then cleaved from the solid support, and the protecting groups are then removed to produce the desired nucleic acid oligomer. The purity of nucleic acid oligomers synthesized in this manner is not always satisfactory, and synthesis is inefficient (Non-Patent Document 1). [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Tetrahedron 69 (2013) 3615―3637 Summary of the Invention [Problem to be solved by the invention]

[0005] An object of the present invention is to provide a method for efficiently producing a nucleic acid oligomer. [Means for solving the problem]

[0006] As a result of extensive research conducted by the present inventors to achieve the above-mentioned object, they have provided an efficient method for producing a nucleic acid oligomer, which is characterized by using an oxidizing solution containing iodine, water, and pyridine, in which the ratio of iodic acid to iodine is below a certain level, as an oxidizing solution used in oxidizing a phosphite ester produced by a coupling reaction using a phosphoramidite in the synthesis of a nucleic acid oligomer.

[0007] The present invention includes, but is not limited to, the following aspects. Item 1. Formula (I): [ka] (In the formula, G 1 and G 2 each independently represents a protecting group for a hydroxyl group, B a represents a nucleobase which may be protected with a protecting group, R represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ′ group; Q' represents a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom, or an ethylidene group bonded to the 4' carbon atom, and The bond marked with * indicates a bond to the 3' end of the nucleic acid.) The present invention relates to a method for producing a nucleic acid compound having a nucleotide represented by formula (II) at the 5'-end by a phosphoramidite method, the method comprising the steps of: [ka] (In the formula, G 1 , G 2 , B a , R and * are as defined above.) The precursor having a phosphite triester bond represented by the formula (I) contains iodine, pyridine, and water, and the molar ratio of iodic acid to iodine (mol iodic acid / mol iodine) is 30 × 10 -3A manufacturing method comprising the step of reacting an oxidizing solution (hereinafter referred to as "the oxidizing solution of the present invention") as follows:

[0008] Item 2. A precursor having a phosphite triester bond is represented by the formula (4): [ka] (In the formula, G 1 represents a protecting group for a hydroxyl group, G 2 are each independently the same or different hydroxyl-protecting groups, B a are each independently the same or different and represent a nucleobase which may be protected with a protecting group; R's may be the same or different and each independently represent a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; each Q' is independently the same or different and represents a methylene group bonded to the carbon atom at 4' position of ribose, an ethylene group bonded to the carbon atom at 4' position, or an ethylidene group bonded to the carbon atom at 4' position of ribose; Y's are independently the same or different and represent an oxygen atom or a sulfur atom; n represents an integer between 1 and 200, When X represents OZ, W represents an OV group, and V represents a protecting group for a hydroxyl group; When X represents an R group, W represents a group represented by OZ; Z is a group having a structure consisting of a solid phase carrier and a linking group. When n is an integer of 2 or greater, the nucleic acid compound represented by formula (4) may incorporate a non-nucleotide linker in place of at least one nucleotide between the 5'-terminal and 3'-terminal nucleotides. and the compound having a phosphate triester bond is represented by formula (5): [ka] (In the formula, G 1 , G 2 , B a , R, n, W, X, and Y are as defined above, and As defined in formula (4), a non-nucleotide linker may be incorporated in place of the nucleotide. 2. The method for producing a nucleic acid compound according to the preceding item 1, wherein the nucleic acid compound is represented by the formula:

[0009] Item 3. The nucleic acid compound of formula (5) is optionally extended in chain length by the amidite method to give formula (5'): [ka] (In the formula, G 2 , B a , R, X and W are as defined for equation (5); G 5 represents a protecting group for a hydroxyl group or a hydrogen atom, m is an integer satisfying m≧n, and Each Y independently represents oxygen or sulfur. However, at least one Y is an oxygen atom. obtaining a nucleic acid compound represented by From the compound of formula (5'), the compound of formula (6): [ka] (In the formula, G 5 , R and m are as defined above; B c each independently represents the same or different nucleobase, G 4 represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion; Y's each independently represent oxygen or sulfur, and at least one is an oxygen atom; and X1 represents a hydroxyl group and W1 represents an OV group, where V represents a protecting group for the hydroxyl group, or X1 represents an R group, and W1 represents a hydroxyl group. The compound represented by The compound of formula (6) is further deprotected to give the compound of formula (7): [ka] (In the formula, m, Y, G 4 and B c is as defined above, R' are independently the same or different and represent a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; each Q' is independently the same or different and represents a methylene group bonded to the carbon atom at 4' position of ribose, an ethylene group bonded to the carbon atom at 4' position, or an ethylidene group bonded to the carbon atom at 4' position of ribose; and, X 10 and W 10 each independently represents a hydroxyl group, or X 10 represents an R' group, and W 10 represents a hydroxyl group.) 3. The method for producing a nucleic acid oligomer according to item 2 above, further comprising the step of producing a deprotected nucleic acid oligomer represented by the formula:

[0010] Item 4. The production method according to either item 2 or 3 above, wherein the non-nucleotide linker is a linker consisting of an amino acid backbone.

[0011] Item 5. The production method according to item 4 above, wherein the linker comprising an amino acid skeleton has a structure selected from the group consisting of the following formulae (A14-1), (A14-2) and (A14-3): [ka]

[0012] Item 6. The method according to any one of Items 1 to 5 above, wherein the iodine concentration in the oxidizing solution is 0.005 to 2M. Item 7. The method according to any one of items 1 to 5 above, wherein the iodine concentration in the oxidizing solution is 0.005 to 0.2 M. Item 8. The method according to any one of items 1 to 5 above, wherein the iodine concentration in the oxidizing solution is 0.007 to 0.1 M. Item 9. The method according to any one of items 1 to 5 above, wherein the iodine concentration in the oxidizing solution is 0.008 to 0.07M. Item 10. The method according to any one of Items 1 to 9 above, wherein the oxidizing solution is prepared by mixing iodine, pyridine, and water. Item 11. The production method according to item 10, wherein the oxidation solution further contains at least one solvent selected from the group consisting of acetonitrile and tetrahydrofuran. Item 12. The method according to item 10 or 11, wherein the oxidation solution further contains an acetonitrile solvent. Item 13. The method according to item 11, wherein the solvent of the oxidation solution is a mixed solvent of pyridine, water, acetonitrile, and tetrahydrofuran in a volume ratio of 1-90:1-50:0-90:0-90. Item 14. The method according to item 11 or 12, wherein the solvent of the oxidation solution is a mixed solvent of pyridine, water, and acetonitrile in a volume ratio of 1-90:1-50:0-90. Item 15. The molar ratio of iodic acid to iodine (mol iodic acid / mol iodine) is 25 x 10 -3 15. A manufacturing method according to any one of items 1 to 14, which is as follows: Item 16. The molar ratio of iodic acid to iodine (mol iodic acid / mol iodine) is 20 × 10 -3 15. A manufacturing method according to any one of items 1 to 14, which is as follows: Item 17. The molar ratio of iodic acid to iodine (mol iodic acid / mol iodine) is 15 x 10 -3 15. The production method according to any one of items 1 to 14, wherein: Item 18. The molar ratio of iodic acid to iodine (mol iodic acid / mol iodine) is 10 × 10-3 15. The production method according to any one of items 1 to 14, wherein: Item 19. The molar ratio of iodic acid to iodine (mol iodic acid / mol iodine) is 5 × 10 -3 15. The production method according to any one of items 1 to 14, wherein: Item 20. The molar ratio of iodic acid to iodine (mol iodic acid / mol iodine) is 3 x 10 -3 15. The production method according to any one of items 1 to 14, wherein: Item 21. The production method according to any one of Items 1 to 20, wherein the oxidizing solution is an oxidizing solution that has been prepared for one week or more before being used in the oxidation reaction. Item 22. The production method according to any one of Items 1 to 20, wherein the oxidation solution is an oxidation solution that has been prepared for at least two weeks before being used in the oxidation reaction. Item 23. The method according to any one of Items 1 to 22, wherein the nucleic acid is a ribonucleoside (RNA). Item 24. The method according to any one of Items 2 to 23, wherein the nucleic acid is a ribonucleoside (RNA) and the 2'-protecting group is a protecting group represented by formula (12). Formula (12): [ka] (In the formula, q represents an integer of 1 to 5; R a and R b are the same or different and each represents a methyl group, an ethyl group, or a hydrogen atom; The bond marked * is attached to the oxygen of the OQ group, and E W represents an electron-withdrawing group.) Section 25.R a and R b are simultaneously hydrogen atoms, and E W Item 25. The method according to Item 24, wherein is a cyano group. Item 26. The method according to any one of Items 1 to 25, wherein the nucleic acid is a ribonucleoside (RNA) having a chain length of 40 or more. Item 27. The method according to any one of Items 1 to 26, further comprising the step of preparing the oxidizing solution according to Item 1. [Effects of the Invention]

[0013] The present invention provides an efficient method for producing nucleic acid oligomers, which is expected to improve the purity of the produced nucleic acid oligomers. [Brief explanation of the drawings]

[0014] [Figure 1] 1 is a diagram showing a scheme of steps (1) to (6) of the production method of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0015] A method for producing a nucleic acid compound having a nucleotide represented by formula (I) at its 5'-end by a phosphoramidite method, comprising: adding iodine, pyridine, and water to a precursor having a phosphite triester bond represented by formula (II) at its 5'-end; and a molar ratio of iodic acid to iodine (mol iodic acid / mol iodine) of 30×10 -3 A production method including a step of reacting the following oxidizing solution (oxidizing solution of the present invention) will be described.

[0016] A method for producing a nucleic acid compound, comprising the step of reacting a nucleic acid precursor having a phosphite triester bond with an oxidation solution containing iodine, pyridine, and water to oxidize the precursor to a phosphate triester bond, wherein the molar ratio of iodic acid to iodine in the oxidation solution (mol iodic acid / mol iodine) is 30×10 -3 The manufacturing method will be described below.

[0017] The molar ratio of iodic acid to iodine (mol iodic acid / mol iodine) in the oxidizing solution of the present invention containing iodine, pyridine, and water is typically 30×10 -3 The molar ratio of iodic acid to iodine (mol iodic acid / mol iodine) is preferably 25×10 -3 More preferably, 20 × 10 -3or less, and even more preferably 15 x 10 -3 or less, even more preferably 10 x 10 -3 or less, even more preferably 5 x 10 -3 Even more preferably, 3×10 -3 The amounts of iodine and iodic acid were measured by ion chromatography, which will be described later.

[0018] The oxidizing solution is typically prepared from iodine, water, and pyridine, and the prepared solution is used so as to satisfy the above-mentioned molar ratio of iodic acid to iodine.

[0019] During the period from preparation of the oxidizing solution to nucleic acid synthesis, for example, the solution is stored at 25 to 60°C for at least one day, preferably at least one week, more preferably at least two weeks, and even more preferably at least one month after preparation, and a solution having a molar ratio of iodic acid to iodine not greater than the above-mentioned specified range can be used. The storage temperature of the oxidizing solution after preparation is not limited to the above-mentioned range, and it is sufficient that the solution is stored at 0 to 80°C and satisfies the above-mentioned specified conditions.

[0020] The concentration of iodine in the oxidation solution containing iodine, pyridine, and water is usually adjusted to 0.005 to 2M, preferably 0.005 to 0.2M, more preferably 0.007 to 0.1M, and even more preferably 0.008 to 0.07M.

[0021] The oxidizing solution is typically prepared from iodine, water, and pyridine, but the oxidizing solution may be mixed with at least one solvent selected from the group consisting of acetonitrile and tetrahydrofuran (THF).

[0022] The solvent for the oxidation solution is obtained by mixing, for example, 1 to 90 parts pyridine, 1 to 50 parts water, 0 to 90 parts acetonitrile, and 0 to 90 parts tetrahydrofuran in a volume ratio relative to the total volume of the solution, and preferably a mixed solvent obtained by mixing 5 to 90 parts pyridine, 2 to 30 parts water, 0 to 80 parts acetonitrile, and 0 to 80 parts tetrahydrofuran in a volume ratio relative to the total volume of the solution. Stirring of the reaction system is not essential when preparing the oxidation solution, but stirring is usually performed with a stirring power Pv of 0.0 to 0.5 kW / m 3 Stirring is performed within the range of Pv 0.1 to 0.3kW / m 3 It is preferable to stir the mixture.

[0023] The oxidizing solution prepared as described above may be stored with an iodine concentration higher than that used in the oxidation reaction. Such a high-concentration oxidizing solution may be diluted with the solvent to a final desired concentration before use. In the oxidation reaction of the phosphite triester bond, at least one compound selected from the group consisting of N-methylimidazole (NMI), N-methylmorpholine, lutidine, and triethylamine may be further added to the oxidation solution, or an iodide such as potassium iodide may be added.

[0024] The oxidizing solution can be stored in a glass, plastic, or metal container. As a plastic container, a container made of polyethylene or polypropylene can be used, and as a metal container, a container made of SUS or Hastelloy can be used. The oxidizing solution can be stored under an air atmosphere or an inert gas atmosphere, and the inert gas can be argon, nitrogen, carbon dioxide, helium, or the like.

[0025] An example of a compound containing a phosphite triester bond is the compound of the above formula (4). An example of a nucleic acid compound produced by the action of an oxidizing solution is the nucleic acid compound of the above formula (5). In formulas (4) and (5), Q' may be the same or different and represent a methylene group bonded to the carbon atom at 4' position of ribose, an ethylene group bonded to the carbon atom at 4' position, or an ethylidene group bonded to the carbon atom at 4' position, specifically, the structure of formula (8) below.

[0026] [ka] (In the formula, B a represents an optionally protected nucleobase.

[0027] More specifically, Z represents a structure represented by the following formula (9): [ka] In formula (9), Sp represents a spacer. An example of the spacer (Sp) is one having the structural formula shown in formula (10) below.

[0028] [ka]

[0029] Linker may be, for example, a structure shown in the following formula (11), or a structure in which the structure of formula (11) does not have a hexamethyleneamino group portion and an aminopropyl group is bonded to Si. Alternatively, Linker may be a structure shown in the following formula (15). [ka] (In the formula, A may be any of a hydroxyl group, an alkoxy group, or an alkyl group. Examples of alkoxy groups include methoxy and ethoxy groups. Examples of alkyl groups include methyl, ethyl, isopropyl, and n-propyl groups. Si indicates that it is bonded to the oxygen of a hydroxyl group on the surface of the support. Examples of solid supports include inorganic porous supports and organic resin supports. Examples of inorganic porous supports include controlled pore glass (CPG). Examples of organic resin supports include supports made of polystyrene.

[0030] Nucleosides (ribose and deoxyribose) contained in the nucleic acid oligomer used in the present invention include, but are not limited to, DNA, RNA, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-Me, 2'-F RNA, and the above-mentioned LNA.

[0031] The method for synthesizing a nucleic acid oligomer by solid phase synthesis, which includes the oxidation step using the oxidizing solution, typically includes the following steps: (1) deprotecting the 5'-hydroxyl group of a nucleoside whose hydroxyl group is protected and which is bound to a solid phase support via a linker; (2) a step of coupling the 5'-hydroxyl group generated in the above step with a phosphoramidite compound to obtain a phosphite triester compound; (3) oxidizing the phosphite triester produced in the previous step to convert it to a phosphate triester bond to produce an extended nucleic acid molecule, or optionally converting it to a thiophosphate triester; (4) The steps (1) to (3), i.e., the step of deprotecting the 5'-hydroxyl group of the produced nucleic acid molecule, and Phosphoro a step of synthesizing a nucleic acid molecule on a solid support by repeating a series of reaction cycles consisting of a coupling step with an amidite compound and a step of oxidizing the generated phosphite triester any number of times; (5) A step of subjecting the nucleic acid molecule on the solid phase carrier produced in step (4) to a step of excision and deprotection to release it from the solid phase carrier, thereby producing a nucleic acid oligomer from which the protecting groups have been removed. However, the method for synthesizing the nucleic acid oligomer may include, following step (2) or (3), a step of capping the 5'-position hydroxyl group that did not undergo the coupling reaction with the phosphoramidite compound, or a capping step may be added between any of the steps in the series of reaction cycles that make up step (4).

[0032] More specifically, step (5) is carried out by subjecting the nucleic acid molecules on the solid support produced in step (4) to the following reactions in steps (5-1) and (5-2) in that order, followed by the reaction in step (5-3). The reaction in step (5-1) may be carried out arbitrarily, and the reaction in step (5-2) may be carried out using the method described in Japanese Patent No. 4705716. As a result, a nucleic acid oligomer in which the protecting group has been removed from the nucleic acid molecule released from the solid support, or a nucleic acid oligomer in which the 5'-terminal hydroxyl group has been protected, can be produced. (5-1) a reaction for deprotecting the protecting group of the hydroxyl group at the 5' end of a nucleic acid molecule; (5-2) a reaction to cleave and release the nucleic acid molecule from the solid support; and (5-3) A reaction for deprotecting the protecting group at the 2'-position or 3'-terminal hydroxyl group of ribose constituting a nucleic acid molecule.

[0033] The scheme of steps (1) to (6) is shown in Figure 1. The oxidation reaction in step (3) or step (4) shown in Figure 1 is carried out using the above-mentioned oxidizing solution. The definitions of the substituents in the chemical formula in Scheme A are as defined above.

[0034] The nucleic acid compound of formula (5) can be further extended to any desired chain length using a nucleotide or non-nucleotide linker by the amidite method and used to produce the nucleic acid compound of formula (5'). The nucleic acid compound alone can be excised from the nucleic acid compound of formula (5') bound to a solid support to obtain the nucleic acid oligomer of formula (6), which can then be further deprotected to obtain the nucleic acid oligomer of formula (7). The substituents in each formula are explained in more detail below.

[0035] B a The nucleic acid base that may be protected with a protecting group represented by the formula (I) is not particularly limited. Examples of the nucleic acid base include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudouracil. The nucleic acid base may also be substituted with a substituent. Examples of such substituents include halogen atoms such as fluoro, chloro, bromo, and iodo groups, acyl groups such as acetyl groups, alkyl groups such as methyl and ethyl groups, arylalkyl groups such as benzyl groups, alkoxy groups such as methoxy groups, alkoxyalkyl groups such as methoxyethyl groups, cyanoalkyl groups such as cyanoethyl groups, hydroxy groups, hydroxyalkyl groups, acyloxymethyl groups, amino groups, monoalkylamino groups, dialkylamino groups, carboxy groups, cyano groups, and nitro groups, as well as combinations of two or more of these substituents.

[0036] When a nucleic acid base has an amino group outside the ring, the protecting group for the amino group is not particularly limited, and any protecting group known in nucleic acid chemistry can be used. Examples of such protecting groups include a benzoyl group, a 4-methoxybenzoyl group, an acetyl group, a propionyl group, a butyryl group, an isobutyryl group, a phenylacetyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, and a (dimethylamino)methylene group, as well as combinations of two or more of these protecting groups.

[0037] Ba More specifically, [ka]

[0038] (In the above formula, R 4 represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or a benzoyl group, R 5 represents a hydrogen atom, an acetyl group, an isobutyryl group, or a benzoyl group, R 6 represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or an isobutyryl group; R 7 represents a 2-cyanoethyl group, R 8 represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group, or a 4-methylbenzoyl group, and R 9 represents a dimethylaminomethylene group. represents a group represented by any one of the following:

[0039] G 1 There are no particular limitations on the protecting group, so long as it can function as a protecting group, and a wide range of known protecting groups used in amidite compounds can be used.

[0040] G 1 is preferably the following group: [ka] (In the formula, R 1 , R 2 and R 3 are each independently the same or different and represent hydrogen or an alkoxy group.

[0041] R 1 , R 2 and R 3 Preferably, one of the groups is hydrogen and the remaining two are the same or different (preferably the same) alkoxy groups, and a methoxy group is particularly preferred as the alkoxy group.

[0042] G 2 There are no particular limitations on the protecting group G as long as it can function as a protecting group, and a wide range of known protecting groups used in amidite compounds can be used. 2 Examples of the alkyl group include an alkyl group, an alkenyl group, an alkynyl group, a cycloalkyl group, a haloalkyl group, an aryl group, a heteroaryl group, an arylalkyl group, a cycloalkenyl group, a cycloalkylalkyl group, a cyclylalkyl group, a hydroxyalkyl group, an aminoalkyl group, an alkoxyalkyl group, a heterocyclylalkenyl group, a heterocyclylalkyl group, a heteroarylalkyl group, a silyl group, a silyloxyalkyl group, a mono-, di-, or trialkylsilyl group, and a mono-, di-, or trialkylsilyloxyalkyl group, which may be substituted with one or more electron-withdrawing groups.

[0043] G 2 is preferably an alkyl group substituted with an electron-withdrawing group. Examples of the electron-withdrawing group include a cyano group, a nitro group, an alkylsulfonyl group, a halogen atom, an arylsulfonyl group, a trihalomethyl group, and a trialkylamino group, and is preferably a cyano group.

[0044] G 2 Particularly preferred as are the following groups: [ka]

[0045] G 3 is two G 3 may be bonded to each other to form a ring structure. 3 Preferably, both of the groups are isopropyl groups.

[0046] R 1 , R 2 , R 3 and G 2 The alkyl group in the definition may be either linear or branched, and is preferably an alkyl group having 1 to 12 carbon atoms, more preferably an alkyl group having 1 to 6 carbon atoms. Specific examples of the alkyl group include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl. The alkyl group moiety constituting the alkoxy group in the definition of the substituent has the same definition as the alkyl group here.

[0047] In the method of the present invention, the amidite compound can be used in its free state or in its salt form. Examples of salts of the amidite compound include, but are not limited to, base addition salts and acid addition salts. Specific examples of base addition salts include salts with inorganic bases such as sodium salts, magnesium salts, potassium salts, calcium salts, and aluminum salts; salts with organic bases such as methylamine, ethylamine, and ethanolamine; salts with basic amino acids such as lysine, ornithine, and arginine; and ammonium salts. Specific examples of acid addition salts include salts with mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, trifluoromethanesulfonic acid, and ethanesulfonic acid; and acidic amino acids such as aspartic acid and glutamic acid. The amidite compounds also include salts, hydrates, solvates, crystalline polymorphs, and other forms.

[0048] When R represents a protected hydroxyl group, the protecting group may be any group that can be used in the amidite method, such as a 2'-tert-butyldimethylsilyl (TBDMS) group, a 2'-bis(2-acetoxy) group, or the like. EthoxyIn addition to the 2'-protecting groups described in International Publication No. 2006 / 022323, those described in International Publication No. 2013 / 027843 and International Publication No. 2019 / 208571 can also be used. Among these 2'-protecting groups for ribonucleosides (RNA), the protecting group represented by the formula (12) is exemplified as a preferred protecting group. More preferably, E W An example of such a protecting group is a protecting group represented by formula (13) having a cyano group as the electron-withdrawing group. [ka] (In the formula, q, R a and R b is the same as defined in the formula (12). a and R b does not simultaneously represent a hydrogen atom.)

[0049] The protecting group represented by formula (13) can be synthesized, for example, according to the description in WO 2013 / 027843 and WO 2019 / 208571, and an amidite compound having such a protecting group can be used in the production of a nucleic acid compound. For the nucleic acid extension reaction, an amidite compound of formula (3) shown in Scheme A of FIG. 1 is used. Examples of non-nucleotide linkers include linkers consisting of an amino acid backbone (for example, linkers consisting of an amino acid backbone described in Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Specific, non-limiting examples include linkers represented by formula (A14-1), (A14-2), or (A14-3) (for example, described in WO2019 / 074110). In addition to these linkers, examples include linkers described in WO2012 / 005368, WO2018 / 182008, or WO2019 / 074110. [ka]

[0050] Nucleotides and amidites in which the R group in formula (3) and the R′ group in formula (4) are substituents other than a hydroxyl group can be produced from nucleosides synthesized by known methods described in Japanese Patent No. 3745226, WO2001 / 053528, or JP-A-2014-221817 and known methods cited therein, or can be produced using commercially available products in accordance with the methods described in the Examples below or by methods with appropriate modifications to these methods.

[0051] In the synthesis of nucleic acid compounds by the amidite method in steps (1) to (6), except for the oxidation reaction step related to the present invention in step (3) in the scheme of Figure 1, the nucleic acid extension reaction can be carried out by repeating each of the steps of deprotection and condensation according to a generally known method (for example, the method described in the aforementioned Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Each step will be described below.

[0052] G 4represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion. Examples of alkali metal ions include sodium ions and lithium ions. Specific examples of alkyl groups in alkylammonium ions include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl, with more specific examples including diethylammonium ion, triethylammonium ion, tetrabutylammonium ion, hexylammonium ion, and dibutylammonium ion. Specific examples of hydroxyalkyl moieties in hydroxyalkylammonium ions include hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxyisopropyl, hydroxy-n-butyl, and trishydroxymethyl, with more specific examples of hydroxyalkylammonium ions including trishydroxymethylammonium ions.

[0053] G 5 represents a hydrogen atom or a protecting group, and when representing a protecting group, it is G 1 represents the same protecting group as G 5 is a hydrogen atom when deprotected, and the nucleotide compound in this state is also subjected to a series of steps in a nucleic acid extension reaction.

[0054] (Nucleic acid extension reaction) As used herein, the term "nucleic acid extension reaction" refers to a reaction in which nucleotides are sequentially linked via phosphodiester bonds to extend an oligonucleotide. The nucleic acid extension reaction can be carried out according to the general procedure of the phosphoramidite method. The nucleic acid extension reaction may also be carried out using an automatic nucleic acid synthesizer that employs the phosphoramidite method.

[0055] The chain length of the nucleic acid oligomer may be, for example, 2 to 200 mer, 10 to 150 mer, or 15 to 110 mer.

[0056] The 5'-deprotection step in step (1) is a step of deprotecting the protecting group of the 5' hydroxyl group at the end of the RNA strand supported on the solid phase support. Common protecting groups include the 4,4'-dimethoxytrityl group (DMTr group), the 4-monomethoxytrityl group, and the 4,4',4"-trimethoxytrityl group. Deprotection can be carried out using an acid. Examples of acids used for deprotection include trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid.

[0057] The condensation step of step (2) is a reaction in which a nucleoside phosphoramidite represented by the following formula (3) shown in Scheme A of Figure 1 is bonded to the 5' hydroxyl group at the end of the oligonucleotide chain deprotected in the deprotection step. The phosphoramidite used for nucleic acid elongation is an amidite compound represented by formula (3) or (A12). Other usable phosphoramidites include 2'-OMe, 2'-F, 2'-O-tert-butyldimethylsilyl, 2'-O-methoxyethyl, 2'-H, 2'-fluoro-2'-deoxy-β-D-arabinofuranosyl, etc. The nucleoside phosphoramidite used has its 5' hydroxyl group protected with a protecting group (e.g., DMTr). The condensation step can be carried out using an activator that activates the nucleoside phosphoramidite. Examples of the activator include 5-benzylthio-1H-tetrazole (BTT), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole.

[0058] The nucleoside phosphoramidite (hereinafter referred to as amidite) represented by formula (3) in Scheme A of FIG. 1 is as follows: formula: [ka] (In the formula, G 1 , G 2 , G 3 , B a and R is as defined above.

[0059] After the condensation step, any unreacted 5' hydroxyl groups may be capped, if desired, using a known capping solution such as an acetic anhydride-tetrahydrofuran solution or a phenoxyacetic anhydride / N-methylimidazole solution.

[0060] The oxidation step (3) is a step of converting the phosphite group formed in the condensation step into a phosphate group or a thiophosphate group. This step is a reaction of converting trivalent phosphorus to pentavalent phosphorus using an oxidizing agent, and can be carried out by reacting the oxidizing agent with an oligonucleic acid derivative supported on a solid phase carrier. When converting a phosphorous group to a phosphate group, for example, iodine can be used as an "oxidizing agent." The oxidizing agent can be prepared to a concentration of 0.005 to 2 M. Water can be used as the oxygen source for oxidation, and pyridine, N-methylimidazole (NMI), N-methylmorpholine, or triethylamine can be used as the base to promote the reaction. Furthermore, the solvent is not particularly limited as long as it is not involved in the reaction, and acetonitrile, tetrahydrofuran (THF), or a mixture of these in any ratio can also be used. For example, iodine / water / pyridine / acetonitrile, iodine / water / pyridine, iodine / water / pyridine / NMI, or iodine / water / pyridine / THF can be used. The reaction temperature is preferably 5°C to 50°C. The reaction time is usually 1 to 30 minutes. The amount of reagent used is preferably 1 to 100 mol, more preferably 1 to 10 mol, per 1 mol of the compound supported on the solid phase support.

[0061] When converting a phosphite triester group to a thiophosphate group, examples of the "oxidizing agent" that can be used include sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS). The oxidizing agent can be diluted with an appropriate solvent to a concentration of 0.001 to 2 M before use. The solvent used in the reaction is not particularly limited as long as it is inert to the reaction, and examples include dichloromethane, acetonitrile, pyridine, and any mixture thereof. The oxidation step may be performed after the capping step, or conversely, the capping step may be performed after the oxidation step; the order is not limited.

[0062] In step (5), after the synthesis of a nucleic acid having a desired sequence is completed, the phosphate protecting group is deprotected by reacting an amine compound to deprotect the protecting group of the phosphate moiety. Examples of the amine compound include diethylamine, which is described in Japanese Patent No. 4705716.

[0063] The protecting group for the 5' hydroxyl group of the nucleoside introduced at the end of elongation may be used for column purification using the 5' protecting group as a tag after cleavage from the solid phase support and deprotection of the protecting group as described below, and the protecting group for the 5' hydroxyl group may be deprotected after column purification.

[0064] In step (5), the nucleic acid oligomer elongated to a desired chain length on the solid phase support is cleaved from the solid phase support usually using concentrated aqueous ammonia as a cleavage agent.

[0065] Furthermore, the oligonucleotide chain is cleaved from the solid support and recovered using ammonia or an amine compound, etc. Examples of the amine compound include methylamine, ethylamine, isopropylamine, ethylenediamine, and diethylamine.

[0066] In step (6), the protecting group on the hydroxyl group at the 2nd or 3rd position of the ribose of the nucleic acid compound (6) cleaved from the solid support in step (5) can be removed according to the method described in WO 2006 / 022323, WO 2013 / 027843, or WO 2019 / 208571, to obtain a deprotected nucleic acid oligomer (7).

[0067] Nucleic acid oligomers that can be produced using the production method of the present invention include, but are not limited to, nucleic acid oligomers in which the nucleosides contained therein are RNA, DNA, RNA having 2'-O-MOE, 2'-O-Me, or 2'-F, and LNA. For example, examples of various nucleosides include those described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558.

[0068] Typical examples of nucleic acid oligomers that can be used in the production method of the present invention are shown below in addition to the examples described in the Examples, but are not limited to these. In the following explanation of the sequences, U represents uridine, C represents cytidine, A represents adenosine, and G represents guanosine. Examples include nucleic acid oligomers having the following sequences (B) and (C), which are described in International Publication No. 2019 / 060442. Sequence (B): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (Antisense) (SEQ ID NO: 3) 21mer Sequence (C): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3' (Sense) (SEQ ID NO: 4) 21mer In sequences (B) and (C), Um represents 2'-O-methyluridine, Cm represents 2'-O-methylcytidine, and dT represents thymidine. Examples include the nucleic acid oligomer described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 (see page 553). A typical example is a nucleic acid oligomer having the following sequence (D): Sequence (D): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3' (SEQ ID NO: 5) 36mer Examples include the nucleic acid oligomers described in JP 4965745. A typical example is a nucleic acid oligomer having the following sequence (E): Sequence (E): 5'-CCAUGAGAAGUAUGACAACAGCC-P-GGCUGUUGUCAUACUUCUCAUGGUU-3' 49mer. CCAUGAGAAGUAUGACAACAGCC (SEQ ID NO: 6), GGCUGUUGUCAUACUUCUCAUGGUU (SEQ ID NO: 7). In sequence (E), "P" is represented by the partial structure separated by a wavy line in formula (A5) below. An example is a nucleic acid oligomer having the following sequence (F), which is described in Nucleic Acids Research, 2019, Vol. 47, No. 2: 547. Sequence (F): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3' (SEQ ID NO: 8) 67mer An example is a nucleic acid oligomer having the following sequence (G), which is described in JP 2015-523856, 173. Sequence (E): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3' (SEQ ID NO: 9) 94mer Examples include the nucleic acid oligomers described in JP 2017-537626. Typical examples include nucleic acid oligomers having the following sequences (F)(G)(H)(J). Sequence (F): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 10) 100mer Sequence (G): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (SEQ ID NO: 11) 113mer Sequence (H): 5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU -3' (SEQ ID NO: 12) 113mer In sequence (H), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine. Sequence (J): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsU-3' (SEQ ID NO: 13) 113mer In sequence (J), Um represents 2'-O-methyluridine, Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents a phosphorothioate modification. [Example]

[0069] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0070] <Measurement method> First, the various measurement methods used in the following tests are shown below.

[0071] Oligonucleotide purity was determined using HPLC. The HPLC measurement conditions are shown in Table 1 below. (Measurement Method 1: Measurement of Oligonucleotide Purity) [Table 1]

[0072] (Measurement Method 2: Measurement of Oligonucleotide Yield) The OD of the crude product 260 The OD was measured. 260 represents the absorbance of UV260nm per 10mm path length in 1mL solution (pH=7.5). It is generally known that 1OD = 40μg for RNA. 260 The yield was calculated based on the measured values.

[0073] (Measurement method 3: Measurement of iodic acid concentration) Iodic acid was measured by ion chromatography. The concentration was calculated by comparison with a standard (NaIO3). The measurement conditions for ion chromatography are shown in Table 2 below. [Table 2]

[0074] (Measurement method 4: Measurement of iodine concentration) Iodine was measured by ion chromatography. The concentration was calculated by comparison with a standard sample (I2). The measurement conditions for ion chromatography are shown in Table 3 below. [Table 3]

[0075] <Solid-phase synthesis of oligonucleotides> Sequence (I): 5'-AGCAGAGUACACACAGCAUAUACC-P-GGUAUAUGCUGUGUGUACUCUGCUUC-PG-3' (SEQ ID NOs: 1 and 2) 53mer In the sequence (I), "A" is represented by the partial structure delimited by a wavy line in the following formula (A1). "C" is represented by the partial structure delimited by a wavy line in the following formula (A2). "G" is represented by the partial structure delimited by a wavy line in the following formula (A3). U is represented by the partial structure delimited by a wavy line in the following formula (A4). "P" is represented by the partial structure delimited by a wavy line in the following formula (A5). "A" at the 5'-end is represented by the partial structure delimited by a wavy line in the following formula (A6). Furthermore, "G" at the 3'-end is represented by the partial structure delimited by a wavy line in the following formula (A7). AGCAGAGUAC ACACAGCAUA UACC (SEQ ID NO: 1) GGUAUAUGCU GUGUGUACUC UGCUUC (SEQ ID NO: 2)

[0076] [ka]

[0077] [ka]

[0078] [ka]

[0079] [ka]

[0080] [ka]

[0081] [ka]

[0082] [ka]

[0083] Controlled Pore Glass (CPG) was used as the solid support, and an NTS M-4MX-E (Nihon Techno Service) or AKTA oligopilot plus100 (GE Healthcare) nucleic acid synthesizer was used to synthesize the oligonucleotide (I) from the 3' to the 5' end by phosphoramidite solid-phase synthesis. Synthesis was carried out on an approximately 1 μmol scale when using NTS M-4MX-E (Nihon Techno Service), and on an approximately 80 μmol scale when using AKTA oligopilot plus100 (GE Healthcare). The synthesis used the uridine EMM amidite described in Example 2 of US2012 / 0035246, the cytidine EMM amidite described in Example 3, the adenosine EMM amidite described in Example 4, the guanosine EMM amidite described in Example 5, and compound (3) described in WO2017 / 188042. A high-purity trichloroacetic acid toluene solution was used as the deblocking solution, 5-benzylmercapto-1H-tetrazole was used as the condensing agent, an iodine solution was used as the oxidizing agent, and a phenoxyacetic anhydride solution and N-methylimidazole solution were used as the capping solution.

[0084] [ka]

[0085] [ka]

[0086] [ka]

[0087] [ka]

[0088] [ka]

[0089] Next, specific examples of the production of nucleic acid oligomers produced by the method of the present invention are shown below. Here, in the following examples, the oligonucleotides produced by the method of the present invention are nucleic acid oligomers having the sequence (I) shown in SEQ ID NOs: 1 and 2. Furthermore, the guanosine derivatives described in the following examples and comparative examples refer to compounds represented by the following structural formula: The circle illustrated in the following structural formula is a schematic representation of CPG. [ka]

[0090] Example 1 The nucleic acid oligomer shown in sequence (I) was synthesized automatically from the 3' to 5' end using controlled pore glass (CPG) loaded with 1.08 μmol of a guanosine derivative and the amidites shown in formula (A8), (A9), (A10), (A11), or (A12) on an NTS M-4MX-E (Nihon Techno Service Co., Ltd.). The automated synthesis procedure consisted of first loading 1.4 mL of 3% trichloroacetic acid in toluene into the CPG to deprotect the trityl protecting group at the 5' position. Subsequently, 0.3 mL of each amidite and 0.4 mL of 5-benzylmercapto-1H-tetrazole as a condensation agent were loaded into the CPG, allowing the coupling reaction to proceed with the hydroxyl group at the 5' position. Next, a solution containing 11 mM iodine in acetonitrile:water:pyridine = 58.2:34.4:7.2 (wt%) was prepared and stored at 25 °C for 2 years. 0.7 mL of this solution was then transferred to convert the phosphite groups to phosphate groups. The molar concentration of iodine in the oxidation solution used for nucleic acid synthesis was measured using Measurement Method 4 and was found to be 11 mM, and the iodic acid concentration was measured using Measurement Method 3 and was found to be 0.029 mM. In other words, the ratio of the molar concentration of iodic acid to the molar concentration of iodine in the oxidation solution used for synthesis was 2.6 x 10 -3 Subsequently, 0.5 mL of 0.1 M phenoxyacetic anhydride acetonitrile solution and 0.5 mL of 10% N-methylimidazole / 10% 2,6-lutidine acetonitrile solution were used as capping solutions to cap the reaction sites where coupling did not proceed. Furthermore, these steps were repeated a total of 52 times to obtain the nucleic acid oligonucleotide of the sequence shown in sequence (I). MarAfter synthesis on a CPG support, the trityl protecting group at the 5' position was deprotected with a 3% trichloroacetic acid solution in toluene. The entire amount of oligonucleotide was then released from the solid support using 752 μL of aqueous ammonia and 252 μL of ethanol. The aqueous ammonia and ethanol were then removed by nitrogen spraying. The free oligonucleotide was then dissolved in 400 μL of dimethyl sulfoxide, 5.3 μL of nitromethane and a stir bar were added, and 530 μL of a 1 M tetra-n-butylammonium fluoride (TBAF) dimethyl sulfoxide solution (10.2 mol TBAF per mol of protecting group) that had been dehydrated using 4A molecular sieves was added at 30°C under stirring. The mixture was then incubated for 4 hours to deprotect the 2'-EMM protecting group. The nucleic acid oligomer was obtained by precipitation. As a result of measurement by Measurement Method 2, the yield was 9.1 mg, and as a result of measurement by Measurement Method 1, the purity was 61%.

[0091] Example 2 The experiment of Example 1 was carried out in a similar manner to that of Example 1, except that the scale was changed to use Controlled Pore Glass (CPG) carrying 78.20 μmol of guanosine derivative, the AKTA oligopilot plus 100 (manufactured by GE Healthcare) and the solution listed in Table 2 was used as the iodine-containing oxidizing solution. After completion of the nucleic acid synthesis procedure, the CPG carrier carrying 20.13 μmol of oligonucleotide was collected and the nucleic acid oligomer was liberated from the solid phase carrier using 7.5 mL of aqueous ammonia and 2.5 mL of ethanol. The aqueous ammonia and ethanol were then removed by concentration using an evaporator. The liberated oligonucleotide was then dissolved in 8.0 mL of dimethyl sulfoxide, and 106 μL of nitromethane and a stir bar were added. After dehydration using molecular sieves 4A, 10.6 mL of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (the amount of TBAF was 10.2 mol per mole of protecting group) was used. The yield was 170.5 mg and the purity was 60%.

[0092] Example 3 The nucleic acid oligomer of sequence (I) was obtained in the same manner as in Example 1, except that controlled pore glass (CPG) carrying 1.10 μmol of a guanosine derivative was used and the iodine-containing oxidizing solution shown in Table 2 was used instead. The yield was 8.4 mg, and the purity was 60%.

[0093] Example 4 The same procedure was used as in Example 2, except that the oxidizing solution shown in the table below was used, the scale was changed to a controlled pore glass (CPG) carrying 78.20 μmol of guanosine derivative, the oxidizing solution containing iodine shown in Table 2 was used, and after completion of the nucleic acid synthesis procedure, the CPG carrier carrying 20.16 μmol of oligonucleotide was collected. The nucleic acid oligomer of sequence (I) was obtained in a yield of 180.0 mg with a purity of 59%.

[0094] Example 5 The nucleic acid oligomer of sequence (I) was obtained in the same manner as in Example 1, except that Controlled Pore Glass (CPG) carrying 1.06 μmol of a guanosine derivative and an oxidizing solution containing iodine shown in Table 2 were used. The yield was 9.1 mg, and the purity was 56%.

[0095] Example 6 The nucleic acid oligomer of sequence (I) was obtained in the same manner as in Example 2, except that the iodine-containing oxidizing solution shown in Table 2 was used instead, and 20.20 μmol of oligonucleotide-supported CPG carrier was collected after completion of the nucleic acid synthesis procedure. The yield was 154.8 mg, and the purity was 57%.

[0096] Example 7 The nucleic acid oligomer of sequence (I) was obtained in the same manner as in Example 1, except that controlled pore glass (CPG) carrying 1.09 μmol of a guanosine derivative and the oxidizing solution shown in Table 2 were used. The crude product was obtained by precipitation. The yield was 9.2 mg, and the purity was 49%.

[0097] Example 8 The nucleic acid oligonucleotide of sequence (I) was prepared in the same manner as in Example 1, except that 1.04 μmol of a guanosine derivative-supported Controlled Pore Glass (CPG) and the oxidizing solution shown in Table 2 were used. Mar The yield was 7.7 mg with a purity of 46%.

[0098] Example 9 The nucleic acid oligomer of sequence (I) was obtained in the same manner as in Example 1, except that Controlled Pore Glass (CPG) carrying 1.00 μmol of a guanosine derivative and the oxidizing solution shown in Table 2 were used. The yield was 7.9 mg, and the purity was 42%.

[0099] Reference example 1 The nucleic acid oligomer of sequence (I) was obtained in the same manner as in Example 1, except that Controlled Pore Glass (CPG) carrying 1.04 μmol of a guanosine derivative and the oxidizing solution shown in Table 2 were used. The yield was 7.8 mg, and the purity was 35%.

[0100] The results of Examples 1 to 9 and Reference Example 1 are shown in Table 4. [Table 4]

[0101] From the results in the table above, the molar ratio of iodic acid to iodine is 30 x 10 -3 When the oxidizing solution of the present invention described below was used, a nucleic acid oligomer of higher purity was obtained compared to when the oxidizing solution of Reference Example 1 was used. [Industrial Applicability]

[0102] The present invention provides an efficient method for producing a nucleic acid oligomer, and is expected to improve the purity of the nucleic acid oligomer produced by the method. [Sequence List Free Text]

[0103] SEQ ID NOs: 1 to 13 in the sequence listing represent the base sequences of oligonucleotides produced according to the production method of the present invention.

Claims

1. Formula (I): 【Chemistry 1】 (In the formula, G 1 and G 2 each independently represents a protecting group for a hydroxyl group, B a represents a nucleobase which may be protected with a protecting group, Here, G 1 is the following group: 【Chemistry 2】 (In the formula, R 1 , R 2 and R 3 are each independently the same or different and represent hydrogen or an alkoxy group. and R represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ′ group; Q' represents a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom, or an ethylidene group bonded to the 4' carbon atom, and The bond marked with * indicates a bond to the 3' end of the nucleic acid.) The present invention relates to a method for producing a nucleic acid compound having a nucleotide represented by formula (II): at the 5'-end by a phosphoramidite method. 【Transformation 3】 (In the formula, G 1 , G 2 , B a , R and * are as defined above.) The precursor having a phosphite triester bond represented by the formula (I) contains iodine, pyridine, and water, and the molar ratio of iodic acid to iodine (mol iodic acid / mol iodine) is 10 × 10 -3 1. A method of manufacturing a silicon dioxide film, comprising the step of reacting an oxidizing solution comprising: The oxidation solution is an oxidation solution further comprising acetonitrile. The manufacturing method.

2. The precursor having a phosphite triester bond is represented by formula (4): 【Chemistry 4】 (In the formula, G 1 represents a protecting group for a hydroxyl group, Here, G 1 is the following group: 【Transformation 5】 (In the formula, R 1 , R 2 and R 3 are each independently the same or different and represent hydrogen or an alkoxy group. and G 2 are each independently the same or different hydroxyl-protecting groups, B a are each independently the same or different and represent a nucleobase which may be protected with a protecting group; R's may be the same or different and each independently represent a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; each Q' is independently the same or different and represents a methylene group bonded to the carbon atom at 4' position of ribose, an ethylene group bonded to the carbon atom at 4' position, or an ethylidene group bonded to the carbon atom at 4' position of ribose; each Y is independently the same or different and represents an oxygen atom or a sulfur atom; n represents an integer of 1 to 200, When X represents OZ, W represents an OV group, and V represents a protecting group for a hydroxyl group; When X represents an R group, W represents a group represented by OZ; Z is a group having a structure consisting of a solid phase carrier and a linking group. When n is an integer of 2 or greater, the nucleic acid compound represented by formula (4) may incorporate a non-nucleotide linker in place of at least one nucleotide between the 5'-terminal and 3'-terminal nucleotides. and the nucleic acid compound obtained by the step of reacting the oxidizing solution is Formula (5): 【Transformation 6】 (In the formula, G 1 , G 2 , B a , R, n, W, X, and Y are as defined above, and As defined in formula (4), a non-nucleotide linker may be incorporated in place of the nucleotide. The method according to claim 1, wherein the nucleic acid compound is represented by the formula:

3. The nucleic acid compound of formula (5) is optionally extended in chain length by the amidite method to give the compound of formula (5'): 【Transformation 7】 (In the formula, G 2 , B a , R, X and W are as defined for formula (5); G 5 represents a protecting group for a hydroxyl group or a hydrogen atom, Here, G 5 is the following group: 【Transformation 8】 (In the formula, R 1 , R 2 and R 3 are each independently the same or different and represent hydrogen or an alkoxy group. and m is an integer satisfying m≧n, and Each Y independently represents oxygen or sulfur. However, at least one Y is an oxygen atom. obtaining a nucleic acid compound represented by From the compound of formula (5'), a compound of formula (6): 【Chemistry 9】 (In the formula, G 5 , R and m are as defined above; B c each independently represents the same or different nucleobase, G 4 represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion; Y's each independently represent oxygen or sulfur, and at least one is an oxygen atom; and X 1 represents a hydroxyl group, and W 1 represents an OV group, where V represents a protecting group for a hydroxyl group, or X 1 represents an R group, and W 1 represents a hydroxyl group.) The compound represented by The compound of formula (6) is further deprotected to give a compound of formula (7): 【Chemistry 10】 (In the formula, m, Y, G 4 and B c is as defined above, R' are each independently the same or different and represent a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; each Q' is independently the same or different and represents a methylene group bonded to the carbon atom at 4' position of ribose, an ethylene group bonded to the carbon atom at 4' position, or an ethylidene group bonded to the carbon atom at 4' position of ribose; and, X 10 and W 10 each independently represents a hydroxyl group, or X 10 represents an R' group, and W 10 represents a hydroxyl group.) The method for producing a nucleic acid oligomer according to claim 2, further comprising the step of producing a deprotected nucleic acid oligomer represented by the formula:

4. The method according to claim 2 or 3, wherein the non-nucleotide linker is a linker consisting of an amino acid backbone.

5. The method according to claim 4, wherein the linker comprising an amino acid skeleton has a structure selected from the group consisting of the following formulae (A14-1), (A14-2), and (A14-3): 【Chemistry 11】

6. The method according to any one of claims 1 to 5, wherein the iodine concentration of the oxidizing solution is 0.005 to 2M.

7. The method according to any one of claims 1 to 5, wherein the iodine concentration of the oxidizing solution is 0.005 to 0.2M.

8. The method according to any one of claims 1 to 5, wherein the iodine concentration of the oxidizing solution is 0.007 to 0.1 M.

9. The method according to any one of claims 1 to 5, wherein the iodine concentration of the oxidizing solution is 0.008 to 0.07M.

10. The method according to any one of claims 1 to 9, wherein the oxidizing solution is prepared by mixing iodine, pyridine, acetonitrile and water.

11. The method according to claim 10, wherein the oxidation solution further contains tetrahydrofuran.

12. The method according to claim 11, wherein the solvent of the oxidation solution is a mixed solvent of pyridine, water, acetonitrile, and tetrahydrofuran in a volume ratio of 1-90:1-50:1-90:0-90.

13. The method according to claim 10, wherein the solvent of the oxidation solution is a mixed solvent of pyridine, water, and acetonitrile in a volume ratio of 1 to 90:1 to 50:1 to 90.

14. The molar ratio of iodic acid to iodine (mol iodic acid / mol iodine) is 5 × 10 -3 The method according to any one of claims 1 to 13, wherein:

15. The molar ratio of iodic acid to iodine (mol iodic acid / mol iodine) is 3 × 10 -3 The method according to any one of claims 1 to 13, wherein:

16. The method according to any one of claims 1 to 15, wherein the nucleic acid is a ribonucleoside (RNA).

17. The method according to any one of claims 2 to 16, wherein the nucleic acid is a ribonucleoside (RNA) and the 2'-protecting group is a protecting group represented by formula (12): Formula (12): 【Chemistry 12】 (In the formula, q represents an integer of 1 to 5; R a and R b are the same or different and each represents a methyl group, an ethyl group, or a hydrogen atom; The bond marked * is attached to the oxygen of the OQ group, and E W represents an electron-withdrawing group.)

18. R a and R b are simultaneously hydrogen atoms, and E W The method according to claim 17, wherein is a cyano group.

19. The method according to any one of claims 1 to 16, wherein when R is a protected hydroxyl group, the protecting group is selected from the group consisting of a 2'-tert-butyldimethylsilyl (TBDMS) group, a 2'-bis(2-acetoxyethoxy)methyl (ACE) group, a 2'-(triisopropylsilyloxy)methyl (TOM) group, a 2'-(2-cyanoethoxy)ethyl (CEE) group, a 2'-(2-cyanoethoxy)methyl (CEM) group, and a 2'-para-tolylsulfonylethoxymethyl (TEM) group.

20. The method according to any one of claims 1 to 19, wherein the nucleic acid is a ribonucleoside (RNA) having a chain length of 40 or more.

21. The method of any one of claims 1 to 20, further comprising the step of preparing the oxidizing solution of claim 1.

Citation Information

Patent Citations

  • Oligonucleotide derivative, its production synthetic intermediate therefor and use thereof

    JP1995112997A

  • Nucleoside phosphoroamidite compound

    JP2002371095A

  • Oligonucleotide-ligand conjugates and methods for their preparation

    JP2016529230A

  • Glucoside compound, method for producing thioether, ether, method for producing ether, method for producing glucoside compound, method for producing nucleic acid

    WO2013027843A1

  • Method for producing single-strand RNA

    WO2019189591A1