Dry powder formulation for messenger RNA

Abstract

To provide stable, dry powder messenger RNA formulations for therapeutic use, and methods of making and using the same.SOLUTION: A dry powder formulation for delivery of cystic fibrosis conductance regulator (CFTR) messenger RNA (mRNA) comprises a plurality of spray-dried particles comprising: mRNA encoding a CFTR protein; one or more lipids; and one or more polymers.SELECTED DRAWING: None

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 62 / 702,193, filed July 23, 2018, which is incorporated herein by reference in its entirety.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on July 19, 2019, is named MRT_2008WO_SeqListing.txt and is 1137 bytes in size. [Background technology]

[0003] Messenger RNA therapy (MRT) has become an increasingly important approach for the treatment of various diseases. Lipid-encapsulated mRNA formulations, such as lipid nanoparticle (LNP) compositions, demonstrate high cellular uptake and protein expression. However, these formulations are currently typically in liquid form and usually require administration via injection or nebulizer. These administration modes are less desirable for patients than some less invasive routes, such as metered-dose inhalers. Lyophilized formulations sometimes do not provide reliable particle uniformity in the dry state or are not easy to handle and distribute. Lyophilized powders must be dissolved in an appropriate solvent before dispensing to patients and can degrade within hours. Repeated freeze-thaw cycles of mRNA preparations are not recommended due to potential mRNA and / or LNP instability. Summary of the Invention [Means for solving the problem]

[0004] The present invention specifically provides dry powder (i.e., spray-dried) formulations of mRNA encapsulated in lipid-based nanoparticles for more efficient mRNA delivery and more effective mRNA therapy. Prior to the present invention, one of the challenges of spray-drying mRNA encapsulated in lipid nanoparticles arose from the fact that both the mRNA and lipid nanoparticle components were structurally unstable at the high temperatures and / or pressures required for proper spray drying. For example, the inlet temperature of a spray dryer ranged from 80°C to 98°C. Lipids tend to melt and / or aggregate at or near the spray nozzle at high inlet temperatures. This impedes the flow of the formulation through the nozzle into the drying chamber, disrupting the uniform dispersion of the spray and resulting in undesirable particle characteristics and poor yield. The present invention unexpectedly solves this problem by adding a polymer to the mRNA and lipid nanoparticle mixture before subjecting the mixture to the spray-drying process. As described herein, the inventors observed that adding a polymer to the mRNA and lipid mixture effectively prevented lipid nanoparticle aggregation and promoted the formation of a dry powder of fine particles containing mRNA-loaded lipid nanoparticles suitable for inhalation.

[0005] Even more surprisingly, despite the highly unstable nature of mRNA, dry powder formulations prepared according to the present invention are stable even under the high temperatures and / or pressures associated with spray drying and are able to maintain a high degree of mRNA integrity even after long-term storage at various temperatures. Furthermore, dry powder formulations prepared according to the present invention are also characterized by high LNP encapsulation efficiency of mRNA, resulting in high cellular delivery of mRNA. Thus, the present invention fulfills a long-standing need in the field of mRNA therapy for mRNA therapeutics in a stable, dry powder form that can be easily stored, transported, and dispensed. Furthermore, dry powder formulations of mRNA according to the present invention eliminate the need to freeze liquid, single-use aliquots. Alternatively, it may be administered to a patient as a dry powder, for example, in a metered or metered single-use dose and reconstituted.

[0006] In one aspect, the present invention provides a dry powder formulation for delivery of messenger RNA (mRNA) comprising a plurality of spray-dried particles comprising mRNA encoding a protein or peptide, one or more lipids, and one or more polymers.

[0007] In another aspect, the present invention provides a dry powder formulation for delivery of messenger RNA (mRNA) comprising a plurality of spray-dried particles comprising one or more lipid nanoparticles (LNPs) encapsulating mRNA encoding a peptide or polypeptide, and one or more polymers.

[0008] In yet another aspect, the present invention provides a dry powder formulation for delivery of messenger RNA (mRNA) comprising one or more nanoparticles encapsulating mRNA encoding a peptide or polypeptide, nanoparticles comprising one or more lipids, and a plurality of spray-dried particles comprising one or more polymers.

[0009] In yet another aspect, the present invention provides a dry powder formulation for delivery of cystic fibrosis conductance regulator (CFTR) messenger RNA (mRNA), comprising a plurality of spray-dried particles comprising mRNA encoding the CFTR protein, one or more lipids, and one or more polymers. In some embodiments, the one or more lipids form one or more nanoparticles (LNPs) that encapsulate the mRNA encoding the CFTR protein. In some embodiments, the one or more lipids and one or more polymers form one or more nanoparticles that encapsulate the mRNA encoding the CFTR protein.

[0010] As used herein, lipid nanoparticles (LNPs) encompass nanoparticles formed from lipids as well as nanoparticles formed from both lipids and polymers. In some embodiments, nanoparticles formed from both lipids and polymers are referred to as lipid-polymer nanoparticles.

[0011] In some embodiments, the mRNA (e.g., CFTR mRNA) has 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more integrity. In some embodiments, the mRNA (e.g., CFTR mRNA) has 90% or more integrity. In some embodiments, the mRNA (e.g., CFTR mRNA) has 95% or more integrity. In some embodiments, the mRNA (e.g., CFTR mRNA) has 98% or more integrity.

[0012] In some embodiments, the mRNA maintains 90% or greater integrity when stored at or below room temperature for 6 months or longer. In some embodiments, the mRNA maintains 95% or greater integrity when stored at or below room temperature for 6 months or longer. In some embodiments, the mRNA maintains 98% or greater integrity when stored at or below room temperature for 6 months or longer.

[0013] In some embodiments, the mRNA maintains 90% or greater integrity after spray drying and storage at or below room temperature for 3 months or more. In some embodiments, the mRNA maintains 90% or greater integrity after spray drying and storage at or below room temperature for 6 months or more. In some embodiments, the mRNA maintains 90% or greater integrity after spray drying and storage at or below room temperature for 9 months or more. In some embodiments, the mRNA maintains 90% or greater integrity after spray drying and storage at or below room temperature for 12 months or more. In some embodiments, the mRNA maintains 90% or greater integrity after spray drying and storage at or below 4°C for 3 months or more. In some embodiments, the mRNA maintains 90% or greater integrity after spray drying and storage at or below 4°C for 6 months or more. In some embodiments, the mRNA maintains 90% or greater integrity after spray drying. After spray drying, the mRNA maintains 90% or greater integrity after storage at 4°C or below for 9 months or more. In some embodiments, the mRNA maintains 90% or greater integrity after storage at 4°C or below for 12 months or more. In some embodiments, the mRNA maintains 95% or greater integrity after storage at room temperature or below for 3 months or more, 6 months or more, 9 months or more, or 12 months or more. In some embodiments, the mRNA maintains 95% or greater integrity after storage at 4°C or below for 3 months or more, 6 months or more, 9 months or more, or 12 months or more.

[0014] In some embodiments, at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% of the plurality of spray-dried particles are fine particle fractions, hi some embodiments, at least 20% of the plurality of spray-dried particles are fine particle fractions.

[0015] In some embodiments, the microparticles have a median volume diameter of 5 micrometers or less. In some embodiments, the microparticles have a median volume diameter of 4 micrometers or less. In some embodiments, the microparticles have a median volume diameter of 3 micrometers or less. In some embodiments, the microparticles have a median volume diameter of 2 micrometers or less. In some embodiments, the microparticles have a median volume diameter of 1 micrometer or less.

[0016] In some embodiments, the plurality of spray-dried particles has an average sphericity of greater than 0.6, greater than 0.7, greater than 0.8, or greater than 0.9. In some embodiments, the plurality of spray-dried particles has a Z-average size of less than 3,000 nm, 2,500 nm, 2,000 nm, 1,500 nm, 1,000 nm, or 500 nm.

[0017] In some embodiments, the plurality of spray-dried particles comprise a residual moisture content of less than 20%, less than 18%, less than 16%, less than 14%, less than 12%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.9%, less than 0.8%, less than 0.7%, less than 0.6%, less than 0.5%, less than 0.4%, less than 0.3%, less than 0.2%, or less than 0.1%.

[0018] In some embodiments, the dry powder formulation is inhalable. In some embodiments, the dry powder formulation is inhaled as a dry powder in a metered dose inhaler. In some embodiments, the dry powder formulation is reconstituted with a diluent and administered by nebulization.

[0019] In some embodiments, the one or more polymers comprise at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the combined weight of the lipids and polymers, hi some embodiments, the one or more polymers comprise about 10-90%, 10-80%, 10-70%, 10-60%, 10-50%, 10-40%, 10-30%, 10-20%, 15-20%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, or 15-90% of the combined weight of the lipids and polymers. In some embodiments, the one or more polymers constitute no more than 90%, 80%, 70%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, or 20% of the combined weight of the lipid and polymer.

[0020] In some embodiments, the one or more polymers comprise at least 50% of the total weight of the dry powder. In some embodiments, the one or more polymers comprise at least 40% of the total weight of the dry powder. In some embodiments, the one or more polymers comprise at least 30% of the total weight of the dry powder. ... comprise at least 20% of the total weight of the dry powder. In some embodiments, the one or more polymers comprise at least 15% of the total weight of the dry powder. In some embodiments, the one or more polymers comprise at least 12% of the total weight of the dry powder. In some embodiments, the one or more polymers comprise at least 10% of the total weight of the dry powder. In some embodiments, the one or more polymers comprise at least 9% of the total weight of the dry powder. In some embodiments, the one or more polymers comprise at least 8% of the total weight of the dry powder. In some embodiments, the one or more polymers comprise at least 7% of the total weight of the dry powder. In some embodiments, the one or more polymers comprise at least 6% of the total weight of the dry powder. In some embodiments, the one or more polymers comprise at least 5% of the total weight of the dry powder.

[0021] In some embodiments, the one or more polymers are selected from the group consisting of chitosan, poly(lactic acid) (PLA), poly(lactic-co-glycolic acid) (PLGA), poly(q-caprolactone (PCL), polyamidoamine, polyester, polycarbonate, poly(hydroxyalkyl L-asparagine), poly(hydroxyalkyl L-glutamine), poly(2-alkyloxazoline)acrylate, modified acrylate and polymethacrylate based polymers, poly-N-(2-hydroxyl-propyl)methacrylamide, poly-2-(methacryloyloxy)ethyl phosphorylcholine, poly(2-(methacryloyloxy)ethyl phosphorylcholine), and poly(dimethylaminoethyl methylacrylate) (pDMAEMA).

[0022] In some embodiments, the one or more polymers comprise a polymethacrylate-based polymer, hi some embodiments, the one or more polymers comprise Eudragit EPO.

[0023] In some embodiments, one or more LNPs encapsulating mRNA (also referred to as mRNA-loaded LNPs) have a lipid:mRNA (N / P) ratio ranging from 1 to 20, 1 to 15, 1 to 10, 2 to 8, 2 to 6, or 2 to 4. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 20. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 18. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 16. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 14. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 12. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 10. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 8. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 6. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 2 to 20. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 2 to 16. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 2 to 12. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 2 to 8. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 2 to 6. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 2 to 4. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 4 to 20. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 4 to 16. ) ratio. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 4 to 14. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 4 to 12. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 4 to 10. In some embodiments, one or more mRNA-loaded LNPs have a lipid:mRNA (N / P) ratio of 2 or 4. In some embodiments, one or more mRNA-loaded LNPs have a lipid:mRNA (N / P) ratio of 2. In some embodiments, one or more mRNA-loaded LNPs have a lipid:mRNA (N / P) ratio of 4.

[0024] In some embodiments, the one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 70% or greater. In some embodiments, the one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 75% or greater. In some embodiments, the one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 80% or greater. In some embodiments, the one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 85% or greater. In some embodiments, the one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 90% or greater. In some embodiments, the one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 92% or greater. In some embodiments, the one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 94% or greater. In some embodiments, the one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 95% or greater. In some embodiments, the one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 96% or greater. In some embodiments, the one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 97% or greater. In some embodiments, the one or more mRNA-carrying lipid nanoparticles have an encapsulation efficiency of 98% or greater.

[0025] In some embodiments, one or more lipids comprise a cationic lipid. In some embodiments, the cationic lipid is selected from the group consisting of C12-200, DOTAP (1,2-dioleyl-3-trimethyammoniumpropane), DODAP (1,2-dioleyl-3-dimethylammoniumpropane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammoniumpropane), DLinDMA, DLin-KC2-DMA, HGT4003, cKK-E12, ICE, and combinations thereof.

[0026] In some embodiments, the one or more mRNA-carrying lipid nanoparticles comprise one or more cationic lipids. In some embodiments, the one or more cationic lipids comprise an ionizable cationic lipid. In some embodiments, the one or more cationic lipids comprise the cationic lipid C12-200. In some embodiments, the one or more cationic lipids comprise the cationic lipid DOTAP (1,2-dioleyl-3-trimethytamonium propane). In some embodiments, the one or more cationic lipids comprise the cationic lipid DODAP (1,2-dioleyl-3-dimethylammonium propane). In some embodiments, the one or more cationic lipids comprise the cationic lipid DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane). In some embodiments, the one or more cationic lipids comprise the cationic lipid DLinDMA. In some embodiments, the one or more cationic lipids comprise the cationic lipid DLin-KC2-DMA. In some embodiments, the one or more cationic lipids comprise the cationic lipid HGT-5000. In some embodiments, the one or more cationic lipids comprise the cationic lipid HGT-5001. In some embodiments, the one or more cationic lipids comprise the cationic lipid HGT-5002. In some embodiments, the one or more cationic lipids comprise the cationic lipid cKK-E12. In some embodiments, the one or more cationic lipids comprise the cationic lipid OF-02. In some embodiments, the one or more cationic lipids comprise the cationic lipid Target 23. In some embodiments, the one or more cationic lipids comprise the cationic lipid Compound 1. In some embodiments, The one or more cationic lipids comprise cationic lipid compound 2. In some embodiments, the one or more cationic lipids comprise cationic lipid compound 3. In some embodiments, the one or more cationic lipids comprise cationic lipid HGT4001. In some embodiments, the one or more cationic lipids comprise cationic lipid HGT4002. In some embodiments, the one or more cationic lipids comprise cationic lipid HGT4003. In some embodiments, the one or more cationic lipids comprise cationic lipid HGT4004. In some embodiments, the one or more cationic lipids comprise cationic lipid HGT4005. In some embodiments, the one or more cationic lipids comprise cationic lipid 18:1 carbon tail ribose lipid. In some embodiments, the one or more cationic lipids comprise cationic lipid ICE.

[0027] In some embodiments, the cationic lipids comprise about 25-50% by molar of the total lipids in the LNP.

[0028] In some embodiments, one or more lipids comprise a PEG-modified lipid. In some embodiments, one or more mRNA-loaded lipid nanoparticles comprise one or more PEG-modified lipids. In some embodiments, the one or more PEG-modified lipids comprise a poly(ethylene)glycol chain up to 5 kDa in length covalently attached to a lipid comprising one or more alkyl chains C6-C20 in length. In some embodiments, the one or more PEG-modified lipids comprise up to 20%, 15%, 12%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% by mole of the total lipids in the LNP. In some embodiments, the PEG-modified lipids comprise about 1-15% by mole of the total lipids in the LNP. In some embodiments, the PEG-modified lipids comprise at least 1%, 2%, 3%, 4%, 5%, 6%, 8%, 10%, or 12% by mole of the total lipids in the LNP.

[0029] In some embodiments, suitable LNPs according to the present invention are two-lipid component LNPs.

[0030] In some embodiments, the one or more lipids do not include neutral lipids or cholesterol-based lipids.

[0031] In some embodiments, the one or more lipids further comprise a neutral lipid and / or a cholesterol-based lipid. In some embodiments, the one or more lipids further comprise a neutral lipid.

[0032] In some embodiments, a suitable LNP according to the present invention is a three lipid component LNP.

[0033] In some embodiments, the dry powder formulation according to the present invention further comprises at least one sugar. In some embodiments, the sugar is selected from the group consisting of monosaccharides, disaccharides, polysaccharides, glucose, fructose, galactose, mannose, sorbose, lactose, sucrose, cellobiose, trehalose, raffinose, starch, dextran, maltodextrin, cyclodextrin, inulin, xylitol, sorbitol, lactitol, mannitol, and combinations thereof. In some embodiments, the sugar is mannitol. In some embodiments, the sugar comprises less than 30%, 25%, 20%, 15%, 10%, or 5% of the total weight.

[0034] In some embodiments, the dry powder formulation according to the present invention further comprises a pharmaceutically acceptable excipient selected from the group consisting of an ester, a urethane, a phosphoester, a phosphazene, an amino acid, a collagen, a chitosan, a polysaccharide, an albumin, a surfactant, a buffer, a salt, and combinations thereof.

[0035] In some embodiments, a suitable surfactant is selected from the group consisting of CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate), phospholipids, phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, octaethylene glycol monododecyl ether, pentaethylene glycol monododecyl ether, Triton X-100, cocamide monoethanolamine, cocamide diethanolamine, glycerol monostearate, glycerol monolaurate, sorbitan moonolaureate, sorbitan monostearate, Tween 20, Tween 40, Tween 60, Tween 80, alkyl polyglucosides, and poloxamers (e.g., Poloxamer 407). In some embodiments, a suitable surfactant is a poloxamer.

[0036] In some embodiments, the dry powder formulation according to the present invention further comprises a pharmaceutically acceptable excipient, hi some embodiments, the pharmaceutically acceptable excipient is selected from the group consisting of esters, urethanes, phosphoesters, phosphazenes, amino acids, collagen, chitosan, polysaccharides, albumin, surfactants, buffers, salts, and combinations thereof.

[0037] In some embodiments, the dry powder formulation according to the present invention comprises a surfactant. In some embodiments, the surfactant is selected from the group consisting of CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate), phospholipids, phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, octaethylene glycol monododecyl ether, pentaethylene glycol monododecyl ether, Triton X-100, cocamide monoethanolamine, cocamide diethanolamine, glycerol monostearate, glycerol monolaurate, sorbitan moonolaureate, sorbitan monostearate, Tween 20, Tween 40, Tween 60, Tween 80, alkyl polyglucosides, and copolymers. In some embodiments, the surfactant is a poloxamer. In some embodiments, the surfactant is a poloxamer, a triblock copolymer consisting of a central hydrophobic block of polypropylene glycol flanked by two hydrophilic blocks of polyethylene glycol (PEG). In some embodiments, the surfactant is poloxamer 407.

[0038] In some embodiments, the mRNA comprises up to 10% by weight of the total dry powder. In some embodiments, the mRNA comprises up to 9% by weight of the total dry powder. In some embodiments, the mRNA comprises up to 8% by weight of the total dry powder. In some embodiments, the mRNA comprises up to 7% by weight of the total dry powder. In some embodiments, the mRNA comprises up to 6% by weight of the total dry powder. In some embodiments, the mRNA comprises up to 5% by weight of the total dry powder. In some embodiments, the mRNA comprises up to 4% by weight of the total dry powder. In some embodiments, the mRNA comprises up to 3% by weight of the total dry powder. In some embodiments, the mRNA comprises up to 2% by weight of the total dry powder. In some embodiments, the mRNA comprises 1-10% by weight of the total dry powder. In some embodiments, the mRNA comprises 1-6% by weight of the total dry powder. In some embodiments, the mRNA comprises 1-5% by weight of the total dry powder. In some embodiments, the mRNA comprises 1-4% by weight of the total dry powder. In some embodiments, the mRNA comprises 1-3% by weight of the total dry powder. In some embodiments, the mRNA comprises 2-10% by weight of the total dry powder. In some embodiments, the mRNA comprises 2-9% by weight of the total dry powder. In some embodiments, the mRNA comprises 2-8% by weight of the total dry powder. In some embodiments, the mRNA comprises 2-7% by weight of the total dry powder. In some embodiments, the mRNA comprises 2-6% by weight of the total dry powder. In some embodiments, the mRNA comprises 2-5% of the total weight of the dry powder. In some embodiments, the mRNA is unmodified. In some embodiments, the mRNA comprises one or more modified nucleotides.

[0039] In some embodiments, the mRNA encodes a peptide. In some embodiments, the mRNA encodes a therapeutic protein. In some embodiments, the therapeutic protein is CFTR.

[0040] In some embodiments, the CFTR mRNA comprises about 1-20%, 1-15%, 1-10%, 1-8%, 1-6%, 1-5%, 5-15%, or 5-10% of the total weight of the spray-dried particle. In some embodiments, the CFTR mRNA comprises about 1%, 2%, 3%, 4%, 5%, 7.5%, 10%, 12.5%, or 15% of the total weight of the spray-dried particle.

[0041] In another aspect, the present invention provides a method for delivering cystic fibrosis conductance regulator (CFTR) messenger RNA (mRNA) for in vivo expression, comprising administering to a subject in need thereof a dry powder formulation described herein. In some embodiments, the dry powder formulation described herein is administered by pulmonary delivery. In some embodiments, the dry powder formulation is administered by inhalation.

[0042] In a further aspect, the present invention provides a method for delivering cystic fibrosis conductance regulator (CFTR) messenger RNA (mRNA) for in vivo expression, comprising reconstituting a dry powder formulation described herein into a liquid solution and administering the reconstituted liquid solution to a subject in need thereof. In some embodiments, the reconstituted liquid solution is administered by nebulization. In some embodiments, the subject is suffering from cystic fibrosis.

[0043] In another aspect, the present invention provides a method of producing a dry powder formulation, comprising providing a mixture comprising mRNA, one or more lipids, and a polymer, and spray-drying the mixture to form a plurality of particles.

[0044] In some embodiments, one or more lipids are first mixed with the mRNA to form mRNA-loaded lipid nanoparticles before adding the polymer.

[0045] In some embodiments, the method according to the present invention further comprises adding one or more excipients to the mixture prior to spray drying.

[0046] In some embodiments, the plurality of spray-dried particles are characterized by one or more of the following: a) moisture content less than 10%, b) a fine particle fraction having a volume median diameter less than 5 micrometers, c) a Z-average size range of 10 to 3000 nm, d) an N / P ratio range of 1 to 20, e) an mRNA encapsulation efficiency of greater than 80%, and f) an mRNA integrity of greater than 95%.

[0047] In yet another aspect, the present invention provides a method of delivering mRNA in vivo, comprising administering to a subject in need thereof a dry powder formulation described herein. In some embodiments, the dry powder formulation is administered via oral, nasal, tracheal, pulmonary, or rectal routes. In some embodiments, the dry powder formulation is administered by inhalation. In some embodiments, the dry powder formulation is administered by nasal spray. In some embodiments, the formulation is administered by a metered dose inhaler. In some embodiments, the formulation is administered by a nebulizer.

[0048] In yet another aspect, the present invention provides a method of delivering cystic fibrosis conductance regulator (CFTR) messenger RNA (mRNA) for in vivo expression, comprising administering to a subject in need thereof a dry powder formulation described herein.

[0049] In yet another aspect, the present invention provides methods for treating a disease or disorder in a patient by administering to the patient an effective dose of mRNA in a dry powder formulation described herein. In some embodiments, the disease or disorder is selected from cystic fibrosis, asthma, COPD, emphysema, primary ciliary dyskinesia with or without situs inversus (CILD1) or Kartagener syndrome, pulmonary fibrosis, Birt-Hogg-Dube syndrome, hereditary hemorrhagic telangiectasia, alpha-1 antitrypsin deficiency, cytochrome b-positive granulomatous disease (CGD, radiographic), autosomal recessive cytochrome b-positive granulomatous disease, surfactant deficiency, pulmonary surfactant dysbolism 1, pulmonary surfactant dysbolism type 2, pulmonary surfactant dysbolism type 3, respiratory distress syndrome of prematurity, pulmonary viral diseases including tuberculosis, influenza, and respiratory syncytial virus (RSV).

[0050] Additional objects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by the practice of the invention. The objects and advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims.

[0051] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.

[0052] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the invention and, together with the description, serve to explain the principles of the invention.

[0053] The drawings are for purposes of illustration only and are not intended to be limiting. [Brief explanation of the drawings]

[0054] [Figure 1] 1 shows an exemplary illustration of the spray drying technique for mRNA formulations. [Figure 2]Figure 1 shows the percent recovery of LNP-encapsulated mRNA material after spray drying without and with polymer in the formulation. [Figure 3] 1 shows spectrophotometric analysis of mRNA references for integrity assessment. [Figure 4] 1 shows exemplary data demonstrating the integrity of mRNA upon extraction from lipid nanoparticles. [Figure 5] 1 shows exemplary data demonstrating the integrity of LNP-encapsulated mRNA in a polymer-containing formulation after spray drying and storage at 4° C. for two weeks. [Figure 6] 1 shows exemplary data demonstrating the integrity of LNP-encapsulated mRNA in a polymer-containing formulation after spray drying and storage at −20° C. for two weeks. [Figure 7] 1 shows exemplary data demonstrating that storage temperature has no effect on the integrity of mRNA encapsulated in LNPs in a polymer-containing formulation and stored for 2 weeks after spray drying. [Figure 8] 1 shows exemplary data demonstrating the integrity of mRNA encapsulated in LNPs in a polymer-containing formulation after spray drying and storage at 4° C. for 4 weeks. [Figure 9] 1 shows exemplary data demonstrating the integrity of LNP-encapsulated mRNA in a polymer-containing formulation after spray drying and storage at −20° C. for 4 weeks. [Figure 10] 1 shows exemplary data showing mRNA integrity in formulations containing polymer (no LNP) 3 weeks after spray drying stored at 4° C. [Figure 11] 1 shows exemplary data showing mRNA integrity in formulations containing polymer (no LNP) stored at −20° C. 3 weeks after spray drying. [Figure 12] 1 shows exemplary data demonstrating no effect of storage temperature on the integrity of mRNA formulated with polymer (no LNP) and stored for 3 weeks after spray drying. [Figure 13] 1 shows exemplary data showing mRNA integrity in formulations containing polymer (no LNP) stored at 4° C. 5 weeks after spray drying. [Figure 14]1 shows exemplary data showing mRNA integrity in formulations containing polymer (no LNP) stored at −20° C. 5 weeks after spray drying. [Figure 15] Figures 15A and 15B show exemplary in vivo mRNA expression as measured by bioluminescence after administration of mRNA spray-dried preparations to mice. Luciferase mRNA was administered using 1 mg. For Figure 15A, the mRNA was administered as a dry powder. For Figure 15B, the mRNA was administered as a liquid after dissolving the dry powder in water. [Figure 16] (Figures 16A1-A6) Exemplary capillary electrophoresis chromatographs showing the integrity of CFTR mRNA after spray drying. (Figures 16A1-A3) Control CFTR mRNA that was not spray dried or encapsulated is shown, while Figures 16A4-A6 show CFTR mRNA extracted from the spray-dried formulation. DETAILED DESCRIPTION OF THE INVENTION

[0055] definition In order that the present invention may be more readily understood, certain terms are first defined below. Additional definitions of the following terms, and other terms, are set forth throughout the specification.

[0056] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In some embodiments, "animal" refers to non-human animals at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, and / or pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or parasites. In some embodiments, the animal may be a transgenic animal, a genetically engineered animal, and / or a clone.

[0057] Approximately or about: As used herein, the term "approximately" or "about" as applied to one or more values ​​of interest refers to a value similar to the reference value provided. In certain embodiments, the term "approximately" or "about" refers to a range of values ​​of 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater or less than) the stated reference value, unless otherwise stated or apparent from the context (except when such number exceeds 100% of possible values).

[0058] Delivery: As used herein, the term "delivery" encompasses both local delivery and systemic delivery. For example, the delivery of mRNA encompasses the situation where mRNA is delivered to a target tissue, its encoded protein is expressed, and is retained in the target tissue (also referred to as "local distribution" or "local delivery"); the situation where mRNA is delivered to a target tissue, its encoded protein is expressed, and is secreted into the patient's circulatory system (e.g., serum), and is distributed throughout the body and taken up by other tissues (also referred to as "systemic distribution" or "systemic delivery").

[0059] Encapsulation: As used herein, the term "encapsulation" or grammatical equivalents refers to the process of confining individual mRNA molecules within nanoparticles.

[0060] Expression: As used herein, "expression" of a nucleic acid sequence refers to the translation of mRNA into polypeptides, the assembly of multiple polypeptides into an intact protein (e.g., an enzyme), and / or the post-translational modification of the polypeptides or fully assembled protein (e.g., an enzyme). In this application, the terms "expression" and "production," and grammatical equivalents, are used interchangeably.

[0061] Improve, increase, or decrease: As used herein, "improve," "increase," or "decrease," or grammatical equivalents, refer to a value compared to a baseline measurement, e.g., a measurement in the same individual before initiation of a treatment described herein, or a measurement in a control subject (or control subjects) in the absence of a treatment described herein. A "control subject" is a subject suffering from the same form of disease as the subject being treated and who is approximately the same age as the subject being treated.

[0062] In vitro: As used herein, the term "in vitro" refers to events that take place not within a multicellular organism but in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc.

[0063] In vivo: As used herein, the term "in vivo" refers to events that occur within multicellular organisms, such as humans and non-human animals. In the context of cell-type systems, the term can be used to refer to events that occur within living cells (e.g., as opposed to in vitro systems).

[0064] Local distribution or local delivery: As used herein, the terms "local distribution," "local delivery," or grammatical equivalents refer to tissue-specific delivery or distribution. Typically, local distribution or local delivery requires an mRNA-encoded protein (e.g., an enzyme) that is translated and expressed intracellularly or that is secreted only to avoid it entering the patient's circulatory system.

[0065] Messenger RNA (mRNA): As used herein, the term "messenger RNA (mRNA)" refers to a polynucleotide that encodes at least one polypeptide. As used herein, mRNA encompasses both modified and unmodified RNA. mRNA can contain one or more coding and non-coding regions. mRNA can be purified from natural sources, produced using recombinant expression systems, or optionally purified, chemically synthesized, etc. Optionally, for example, in the case of chemically synthesized molecules, mRNA can contain nucleoside analogs, such as analogs with chemically modified bases or sugars, backbone modifications, etc. The mRNA sequence is presented in the 5' to 3' direction unless otherwise indicated. In some embodiments, the mRNA is selected from natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine), nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-amino- ... The base may be or contain a base selected from the group consisting of C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, 2-thiocytidine, chemically modified bases, biologically modified bases (e.g., methylated bases), intercalated bases, modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose), and / or modified phosphate groups (e.g., phosphorothioate and 5'-N-phosphoramidite linkages).

[0066] N / P ratio: As used herein, the term "N / P ratio" refers to the lipid nanoparticles N / P ratio refers to the molar ratio of the positively charged molecular units in the cationic lipids in the lipid nanoparticles to the negatively charged molecular units in the mRNA encapsulated within the lipid nanoparticles.Thus, N / P ratio is typically calculated as the ratio of the moles of amine groups in the cationic lipids in the lipid nanoparticles to the moles of phosphate groups in the mRNA encapsulated within the lipid nanoparticles.

[0067] Patient: As used herein, the term "patient" or "subject" refers to any organism to which provided compositions can be administered, e.g., for experimental, diagnostic, prophylactic, cosmetic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is a human. Humans include prenatal and postnatal forms.

[0068] Pharmaceutically acceptable: As used herein, the term "pharmaceutically acceptable" refers to a material that is, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without undue toxicity, irritation, allergic response, or other problem or complication, at a reasonable benefit / risk ratio.

[0069] Subcutaneous administration: As used herein, the term "subcutaneous administration" or "subcutaneous injection" refers to a bolus injection into the subcutaneous tissue, which is the layer of tissue between the skin and muscle.

[0070] Subject: As used herein, the term "subject" refers to a human or any non-human animal (e.g., a mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Human includes prenatal and postnatal forms. In many embodiments, a subject is a human. A subject can be a patient. It refers to a person who sees a healthcare provider for diagnosis or treatment of a disease. The term "subject" is used interchangeably herein with "individual" or "patient." A subject may be suffering from or susceptible to a disease or disorder, but may or may not exhibit symptoms of the disease or disorder.

[0071] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" of a therapeutic agent means an amount sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and / or condition, to treat, diagnose, prevent, and / or delay the onset of a symptom(s) of the disease, disorder, and / or condition. Those skilled in the art will understand that a therapeutically effective amount is typically administered in a dosing regimen comprising at least one unit dose.

[0072] Treating: As used herein, the terms "treat," "treatment," or "treating" refer to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a particular disease, disorder, and / or condition. Treatment may be administered to subjects who do not show signs of disease and / or who show only early signs of disease, with the goal of reducing the risk of developing conditions associated with the disease.

[0073] The present invention provides stable dry powder formulations containing mRNA-loaded lipid nanoparticles (mRNA-LNPs) for therapeutic use. In particular, the present invention provides dry powder formulations for delivering mRNA that contain a plurality of spray-dried particles, each of which contains one or more mRNA-loaded lipid nanoparticles and a polymer, as well as methods for making and using the same.

[0074] Various aspects of the present invention are described in detail in the following sections. The use of sections is not meant to limit the invention. Each section may be applied to any aspect of the present invention. In this application, the use of "or" means "and / or" unless otherwise stated. or'.

[0075] Spray Drying Process Various spray drying processes can be used to practice the present invention. The process generally involves removing moisture from a composition by passing the liquid form through an apparatus, a simplified schematic of which is provided in Figure 1. Briefly, a liquid formulation containing the composition of interest is passed through a narrow-inlet atomizing "atomizer" nozzle into a first chamber, the drying chamber. Typically, the liquid formulation is passed through in a steady stream. The liquid formulation is sprayed into the drying chamber as small droplets. A stream of heated air or gas is also introduced into the drying chamber to form an airflow. Passing the formulation through this heated stream disperses the incoming droplets and dries them into solid particle form. This product is then introduced into a second chamber by flowing through a connector or pipe. The second chamber is a cyclone powder collector. Here, air circulation creates a cyclone, and the powder particles are collected via a vortex flow into a collection vessel attached to the outlet end. The cyclone chamber is attached to an exhaust fan, which helps cool the components. The inlet and outlet temperatures are operator adjustable. The respective inlet and outlet temperatures, chamber temperature, liquid feed flow rate (aspirator %), pressure, heated airflow properties, and most importantly, the composition of the liquid feed are suitably adjusted for optimal drying of any particulate material.

[0076] In some embodiments, the inlet temperature is adjustable within a range of 40°C to 200°C. In some embodiments, the outlet temperature is in a range of 20 to 70°C. The relative pressure of the pump and aspirator is also adjustable by the operator. In some embodiments, to spray-dry the mRNA-lipid nanoparticles, the inlet temperature is adjusted between 70°C to 200°C. In some embodiments, the inlet temperature is adjusted between 80°C to 200°C. In some embodiments, the inlet temperature is adjusted between 90°C to 200°C. In some embodiments, the inlet temperature is adjusted between 95°C to 180°C. In some embodiments, the inlet temperature is adjusted between 95°C to 160°C. In some embodiments, the inlet temperature is adjusted between 90°C to 150°C. In some embodiments, the inlet temperature is adjusted between 90°C to 120°C. In some embodiments, the inlet temperature is adjusted between 90°C to 100°C. In some embodiments, the inlet temperature is 70°C, 75°C, 80°C, 85°C, 90°C, 95°C, or 100°C.

[0077] The ratio of the aspirator to the drying chamber is typically adjusted between 50% and 100%. In some embodiments, the ratio of the aspirator to the drying chamber is adjusted between 50% and 100%. In some embodiments, the ratio of the aspirator to the drying chamber is adjusted between 60% and 100%. In some embodiments, the ratio of the aspirator to the drying chamber is adjusted between 70% and 100%. In some embodiments, the ratio of the aspirator to the drying chamber is adjusted between 80% and 100%. In certain embodiments, the ratio of the aspirator is adjusted between 80% and 90%. In some embodiments, the ratio of the aspirator is less than 100%, or less than 95%, or less than 90%, or less than 85%, or less than 80%.

[0078] In some embodiments, the liquid flow through the inlet to the drying chamber is regulated by a pump set in the range of 10% to 50%. In some embodiments, the pump is set in the range of 20% to 40%. In some embodiments, the pump is set in the range of 10% to 30%. In some embodiments, the pump is set in the range of 20% to 30%. In some embodiments, the pump is set in the range of 30% to 50%. In some embodiments, the pump is set at 25%.

[0079] In some embodiments, the outlet temperature ranges from 20° C. to 70° C. In some embodiments, the outlet temperature ranges from 30° C. to 60° C. In some embodiments, the outlet temperature ranges from In some embodiments, the outlet temperature is between 20°C and 50°C. In some embodiments, the outlet temperature is between 30°C and 50°C. In some embodiments, the outlet temperature is between 40°C and 50°C. In some embodiments, the outlet temperature is between 45°C and 50°C.

[0080] Spray drying of mRNA-LNPs can be carried out using any suitable spray drying equipment. As known to those skilled in the art, a variety of spray drying equipment is commercially available and can be used to practice the present invention. Exemplary commercially available equipment suitable for the present invention includes, but is not limited to, the following: Anhydro MicraSpray Dryer B-290; Anhydro MicraSpray Dryer B-90 (manufactured by Buchi); Anhydro MicraSpray Dryer GMP; Anhydro MicraSpray Dryer Aseptic Series (manufactured by SPX FLOW), MDL-50 and MDL-015 (manufactured by Fujisaki Electric); Versatile Mini Sprayer Dryer GAS410 (manufactured by Yamato Scientific America); LSD-1500 Mini spray dryer, MSD-8 Multi-functional laboratory spray dryer; PSD-12 Precision pharmacy spray dryer (manufactured by Changzhou Xiandao Drying Equipment Co. Ltd); TALL FORM DRYER™; Multi-Stage Dryer; COMPACT DRYER™; FILTERMAT Spray Dryer; VERSATILE-SD™; Fluidized Spray Dryer; MOBILE MINOR™; SDMICRO™; PRODUCTION MINOR (manufactured by GEA Process Engineering), as well as many others. Convenient scale-up from laboratory to industrial manufacturing scale is also available from some of these manufacturers.

[0081] Spray-dried mRNA-loaded nanoparticles According to the present invention, spray-drying mRNA-loaded nanoparticles comprises adding a polymer to the mRNA and lipid mixture.In some embodiments, before adding the polymer, the lipid and mRNA are first mixed to pre-form the mRNA-loaded lipid nanoparticles.In some embodiments, the lipid, mRNA, and polymer are mixed simultaneously before spray-drying.In some embodiments, the method according to the present invention further comprises adding one or more excipients to the mixture before spray-drying.

[0082] mRNA-loaded lipid nanoparticles Any desired lipids can be mixed in any ratio suitable for encapsulating mRNA. In some embodiments, a suitable lipid solution comprises a cationic lipid, a non-cationic lipid, and / or a PEGylated lipid. In some embodiments, a suitable lipid mixture also comprises a cholesterol-based lipid. In some embodiments, mRNA-LNPs are first formed by mixing mRNA and lipids and spray-drying the mixture before mixing with polymers or other excipients.

[0083] In some embodiments, mRNA-LNPs are formed by mixing an mRNA solution with a lipid solution, where the mRNA solution and / or the lipid solution are heated to a predetermined temperature above ambient temperature prior to mixing (see U.S. Pat. No. 9,668,980, entitled "Encapsulation of messenger RNA," the disclosure of which is incorporated herein in its entirety).

[0084] In some embodiments, mRNA-LNPs are formed by mixing preformed lipid nanoparticles with mRNA (see U.S. Patent Application Publication No. 2018 / 0153822, the disclosure of which is incorporated herein by reference).

[0085] In some embodiments, the encapsulation efficiency of mRNA in lipid nanoparticles before spray drying is 70% or greater. In some embodiments, the encapsulation efficiency of mRNA in lipid nanoparticles before spray drying is 75% or greater. In some embodiments, the encapsulation efficiency of mRNA in lipid nanoparticles before spray drying is 80% or greater. In some embodiments, the encapsulation efficiency of mRNA in lipid nanoparticles before spray drying is 85% or greater. In some embodiments, the encapsulation efficiency of mRNA in lipid nanoparticles before spray drying is 86% or greater. In some embodiments, the encapsulation efficiency of mRNA in lipid nanoparticles before spray drying is 87% or greater. In some embodiments, the encapsulation efficiency of mRNA in lipid nanoparticles before spray drying is 88% or greater. In some embodiments, the encapsulation efficiency of mRNA in lipid nanoparticles before spray drying is 89% or greater. In some embodiments, the encapsulation efficiency of mRNA in lipid nanoparticles before spray drying is 90% or greater. In some embodiments, the encapsulation efficiency of mRNA in lipid nanoparticles before spray drying is 91% or greater. In some embodiments, the encapsulation efficiency of mRNA in lipid nanoparticles before spray drying is 92% or greater. In some embodiments, the encapsulation efficiency of mRNA in lipid nanoparticles before spray drying is 93% or greater. In some embodiments, the encapsulation efficiency of mRNA in lipid nanoparticles before spray drying is 94% or greater. In some embodiments, the encapsulation efficiency of mRNA in lipid nanoparticles before spray drying is 95% or greater. In some embodiments, the encapsulation efficiency of mRNA in lipid nanoparticles before spray drying is 96% or greater. In some embodiments, the encapsulation efficiency of mRNA in lipid nanoparticles before spray drying is 97% or greater. In some embodiments, the encapsulation efficiency of mRNA in lipid nanoparticles before spray drying is 98% or greater. In some embodiments, the encapsulation efficiency of mRNA in lipid nanoparticles before spray drying is 99% or greater.

[0086] In some embodiments, the encapsulation efficiency of mRNA by LNPs after spray drying a formulation of polymer and LNP-encapsulated mRNA is 70% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs after spray drying a formulation of polymer and LNP-encapsulated mRNA is 75% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs after spray drying a formulation of polymer and LNP-encapsulated mRNA is 80% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs after spray drying a formulation of polymer and LNP-encapsulated mRNA is 85% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs after spray drying a formulation of polymer and LNP-encapsulated mRNA is 86% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs after spray drying a formulation of polymer and LNP-encapsulated mRNA is 87% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs after spray drying a formulation of polymer and LNP-encapsulated mRNA is 88% or greater. In some embodiments, the encapsulation efficiency of the mRNA by the LNP after spray drying the formulation of the polymer and LNP-encapsulated mRNA is 89% or greater. In some embodiments, the encapsulation efficiency of the mRNA by the LNP after spray drying the formulation of the polymer and LNP-encapsulated mRNA is 90% or greater. In some embodiments, the encapsulation efficiency of the mRNA by the LNP after spray drying the formulation of the polymer and LNP-encapsulated mRNA is 91% or greater. In some embodiments, the encapsulation efficiency of the mRNA by the LNP after spray drying the formulation of the polymer and LNP-encapsulated mRNA is 92% or greater. In some embodiments, the encapsulation efficiency of the mRNA by the LNP after spray drying the formulation of the polymer and LNP-encapsulated mRNA is 93% or greater. In some embodiments, the encapsulation efficiency of the mRNA by the LNP after spray drying the formulation of the polymer and LNP-encapsulated mRNA is 94% or greater. In some embodiments, the encapsulation efficiency of the mRNA by the LNP after spray drying the formulation of the polymer and LNP-encapsulated mRNA is 95% or greater. In some embodiments, the encapsulation efficiency of the mRNA by the LNPs after spray drying the formulation of polymer and LNP-encapsulated mRNA is 96% or greater.In some embodiments, the mRNA in the LNPs after spray drying a formulation of polymer and LNP-encapsulated mRNA. The encapsulation efficiency of A is 97% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs after spray drying the formulation of polymer and LNP-encapsulated mRNA is 98% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs after spray drying the formulation of polymer and LNP-encapsulated mRNA is 99% or greater.

[0087] In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray drying the polymer and LNP-encapsulated mRNA formulation is 70% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray drying the polymer and LNP-encapsulated mRNA formulation is 75% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray drying the polymer and LNP-encapsulated mRNA formulation is 80% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray drying the polymer and LNP-encapsulated mRNA formulation is 85% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray drying the polymer and LNP-encapsulated mRNA formulation is 86% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray drying the polymer and LNP-encapsulated mRNA formulation is 87% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray drying the polymer and LNP-encapsulated mRNA formulation is 88% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray drying the polymer and LNP-encapsulated mRNA formulation is 89% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray drying the polymer and LNP-encapsulated mRNA formulation is 90% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray drying the polymer and LNP-encapsulated mRNA formulation is 91% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray drying the polymer and LNP-encapsulated mRNA formulation is 92% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray drying the polymer and LNP-encapsulated mRNA formulation is 93% or greater. In some embodiments, the encapsulation efficiency of mRNA by the LNPs both before and after spray drying the formulation of polymer and LNP-encapsulated mRNA is 94% or greater.In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray drying the polymer and LNP-encapsulated mRNA formulation is 95% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray drying the polymer and LNP-encapsulated mRNA formulation is 96% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray drying the polymer and LNP-encapsulated mRNA formulation is 97% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray drying the polymer and LNP-encapsulated mRNA formulation is 98% or greater. In some embodiments, the encapsulation efficiency of mRNA by LNPs both before and after spray drying the polymer and LNP-encapsulated mRNA formulation is 99% or greater.

[0088] In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 10% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 15% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 20% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 25% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 30% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 10% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 2 ...5% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 30% or more of the mass of the formulation before the spray-drying process. The mass of the NA formulation is 35% or more of the mass of the formulation before the spray drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray drying process is 40% or more of the mass of the formulation before the spray drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray drying process is 41% or more of the mass of the formulation before the spray drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray drying process is 42% or more of the mass of the formulation before the spray drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray drying process is 43% or more of the mass of the formulation before the spray drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray drying process is 44% or more of the mass of the formulation before the spray drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray drying process is 45% or more of the mass of the formulation before the spray drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 46% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 47% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 48% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 49% or more of the mass of the formulation before the spray-drying process. In some embodiments, the mass of the polymer and LNP-encapsulated mRNA formulation recovered from the spray-drying process is 50% or more of the mass of the formulation before the spray-drying process.

[0089] In some embodiments, the mRNA and lipids are mixed using a pump system that maintains a constant lipid / mRNA (N / P) ratio throughout the process and facilitates large-scale production. In some embodiments, the N / P ratio ranges from 1 to 20. In some embodiments, the N / P ratio is greater than 2, or greater than 3, or greater than 4, or greater than 5, or greater than 6, or greater than 7, or greater than 8, or greater than 9, or greater than 10, or greater than 11, or greater than 12, or greater than 13, or greater than 14, or greater than 15. In some embodiments, the N / P ratio is 17, or 18, or 19, or 20.

[0090] Suitable mRNA-loaded lipid nanoparticles may be produced in a variety of sizes. In some embodiments, the size of the mRNA-loaded lipid nanoparticles before spray drying is determined by the maximum diameter of the lipid nanoparticles. In some embodiments, the mRNA-loaded lipid nanoparticles have a size before spray drying of about 250 nm or less (e.g., about 225 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, or 50 nm or less). In some embodiments, suitable liposomes have a size in the range of about 10 to 250 nm (e.g., about 10 to 225 nm, 10 to 200 nm, 10 to 175 nm, 10 to 150 nm, 10 to 125 nm, 10 to 100 nm, 10 to 75 nm, or 10 to 50 nm). In some embodiments, the mRNA-loaded lipid nanoparticles have a pre-spray-drying size in the range of about 100-250 nm (e.g., about 100-225 nm, 100-200 nm, 100-175 nm, 100-150 nm). In some embodiments, the mRNA-loaded lipid nanoparticles have a pre-spray-drying size in the range of about 10-100 nm (e.g., about 10-90 nm, 10-80 nm, 10-70 nm, 10-60 nm, or 10-50 nm). In certain embodiments, the mRNA-loaded lipid nanoparticles have a pre-spray-drying size of less than about 100 nm.

[0091] Various alternative methods known in the art can be used to size liposome populations. One such size determination method is described in U.S. Patent No. 4,737,323, which is incorporated herein by reference. Sonication of a liposome suspension, either by bath sonication or probe sonication, can result in a liposome size of approximately 1000 nm in diameter. The size of the liposomes gradually decreases to small ULVs of less than about 0.05 micrometers. Homogenization is another method that utilizes shearing energy to fragment large liposomes into smaller ones. In a typical homogenization procedure, MLVs are recirculated using a standard emulsion homogenizer until a selected liposome size, typically about 0.1 to 0.5 micrometers, is observed. Liposome size can be calculated by quasi-electric light scattering (QELS) as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421-150 (1981) (incorporated herein by reference). The average liposome diameter can be reduced by sonicating the formed liposomes. Intermittent sonication cycles can be alternated with QELS assessment to guide efficient liposome synthesis.

[0092] Suitable mRNA-loaded lipid nanoparticles comprise one or more of cationic lipids, PEGylated lipids, non-cationic lipids, and cholesterol-based lipids.

[0093] cationic lipids As used herein, the term "cationic lipid" refers to any of a number of lipid and lipidoid species that have a net positive charge at a selected pH, such as physiological pH. Several cationic lipids have been described in the literature, and many are commercially available.

[0094] Suitable cationic lipids for use in the compositions and methods of the present invention include the cationic lipids described in International Patent Publication WO2010 / 144740, which is incorporated herein by reference.In certain embodiments, the compositions and methods of the present invention comprise cationic lipids, which have the following compound structure: (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate: [ka] and pharmaceutically acceptable salts thereof.

[0095] Other suitable cationic lipids for use in the compositions and methods of the present invention include the ionizable cationic lipids described in International Patent Publication WO2013 / 149140, which is incorporated herein by reference.In some embodiments, the compositions and methods of the present invention comprise a cationic lipid of one of the following formulas: [ka] or a pharmaceutically acceptable salt thereof, wherein R1 and R2 are each independently hydrogen. C1-C, optionally substituted, variably saturated or unsaturated 20 Alkyl, and optionally substituted, variably saturated or unsaturated C-C 20 acyl, wherein L and L are each independently hydrogen, optionally substituted C-C 30 Alkyl, optionally substituted variably unsaturated C-C 30 Alkenyl, and optionally substituted C-C 30alkynyl, wherein m and o are each independently selected from the group consisting of zero and any positive integer (e.g., m is 3), and wherein n is zero or any positive integer (e.g., n is 1). In certain embodiments, the compositions and methods of the present invention provide a cationic lipid (15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-15,18-dien-1-amine ("HGT5000"), having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include the cationic lipid (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-trien-1-amine ("HGT5001"), having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine ("HGT5002"), having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0096] Other suitable cationic lipids for use in the compositions and methods of the present invention include cationic lipids described as amino alcohol lipidoids in International Patent Publication WO2010 / 053572, which is incorporated herein by reference.In certain embodiments, the compositions and methods of the present invention comprise cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0097] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication WO2016 / 118725, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention comprise cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0098] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication WO2016 / 118724, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention comprise cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0099] Other suitable cationic lipids for use in the compositions and methods of the present invention include cationic lipids having the formula 14,25-ditridecyl 15,18,21,24-tetraaza-octatriacontane, and pharmaceutically acceptable salts thereof.

[0100] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publications WO2013 / 063468 and WO2016 / 205691, which are incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof, wherein RL Each instance of is independently an optionally substituted C-C 40 In certain embodiments, the compositions and methods of the present invention provide cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0101] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication WO2015 / 184256, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof, wherein each X is independently O or S; each Y is independently O or S; each m is independently 0 to 20; each n is independently 1 to 6; and each R Aare independently hydrogen, optionally substituted C alkyl, optionally substituted C alkenyl, optionally substituted C alkynyl, optionally substituted C carbocyclyl, optionally substituted 3-14 membered heterocyclyl, optionally substituted C aryl, optionally substituted 5-14 membered heteroaryl or halogen; and each R B are independently hydrogen, optionally substituted C1-50 alkyl, optionally substituted C2-50 alkenyl, optionally substituted C2-50 alkynyl, optionally substituted C3-10 carbocyclyl, optionally substituted 3-14 membered heterocyclyl, optionally substituted C6-14 aryl, optionally substituted 5-14 membered heteroaryl, or halogen. In certain embodiments, the compositions and methods of the invention provide a cationic lipid "Target 23" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0102] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication WO2016 / 004202, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid having the following compound structure: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid having the following compound structure: [ka] or a pharmaceutically acceptable salt thereof.

[0103] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in U.S. Provisional Patent Application No. 62 / 758,179, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof, wherein each R 1 and R 2 are independently H or C 1- C6 aliphatic, each m is independently an integer having a value of 1 to 4, each A is independently a covalent bond or arylene, and each L 1 are independently an ester, thioester, disulfide, or anhydride group, and each L 2 independently, C 2- C 10 is aliphatic, and each X 1 are independently H or OH, and each R 3 independently, C6-C 20 In some embodiments, the compositions and methods of the present invention comprise a cationic lipid of the following formula: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid of the following formula: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid of the following formula: [ka] or a pharmaceutically acceptable salt thereof.

[0104] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in J. McClellan, MCKing, Cell, 1999, 14, 149-152, which are incorporated herein by reference. 2010, 141, 210-217 and Whitehead et al., Nature Communications (2014) 5:4277. In certain embodiments, the cationic lipid of the compositions and methods of the present invention is a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0105] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication WO2015 / 199952, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0106] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication WO2017 / 004143, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0107] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication WO2017 / 075531, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof, wherein L 1 or L 2 One of the following is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -SS-, -C(=O)S-, -SC(=O)-, -NRa C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a -, or -NR a C(=O)O- Yes; another L 1 or L 2 -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -SS-, -C(=O)S-, SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a -or-NR a C(=O)O- or a direct bond; G 1 and G 2 are each independently unsubstituted C-C 12 Alkylene or C1-C 12 Alkenylene; G 3 is C1-C 24 Alkylene, C1-C 24 alkenylene, C3-C8 cycloalkylene, C3-C8 cycloalkenylene; R a is H or C1-C 12 alkyl; R 1 and R 2 are independently C6-C 24 Alkyl or C6-C 24 alkenyl; R 3 is H, OR 5 , CN, -C(=O)OR 4 , -OC(=O)R 4 or -NR 5 C(=O)R 4 and R 4 is C1-C 12 alkyl; R 5 is H or C1-C6 alkyl; and x is 0, 1, or 2.

[0108] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication No. 2017 / 117528, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0109] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication WO2017 / 049245, which is incorporated herein by reference. In some embodiments, the cationic lipid of the compositions and methods of the present invention is a compound of one of the following formulas: [ka] and pharmaceutically acceptable salts thereof. For any one of these four formulas, R4 is -(CH2) n Q and -(CH2) n CHQR, where Q is -OR, -OH, -O(CH2) nIn certain embodiments, the cationic lipid is selected from the group consisting of N(R), -OC(O)R, -CX, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)R, -N(H)S(O)R, -N(R)C(O)N(R), -N(H)C(O)N(R), -N(H)C(O)N(H)(R), -N(R)C(S)N(R), -N(H)C(S)N(R), -N(H)C(S)N(H)(R), and heterocycle, wherein n is 1, 2, or 3. In certain embodiments, the compositions and methods of the present invention provide a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0110] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publications WO2017 / 173054 and WO2015 / 095340, each of which is incorporated herein by reference.In certain embodiments, the compositions and methods of the present invention comprise cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0111] Other suitable cationic lipids for use in the compositions and methods of the present invention include cholesterol-based cationic lipids. In certain embodiments, the compositions and methods of the present invention provide imidazole cholesterol esters or "ICEs" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0112] Other suitable cationic lipids for use in the compositions and methods of the present invention include the cleavable cationic lipids described in International Patent Publication WO2012 / 170889, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise cationic lipids of the following formula: [ka] wherein R1 is selected from the group consisting of imidazole, guanidinium, amino, imine, enamine, optionally substituted alkylamino (e.g., alkylamino such as dimethylamino), and pyridyl; and wherein R2 is selected from the group consisting of one of the following two formulas: [ka] wherein R and R are each independently an optionally substituted variably saturated or unsaturated C-C 20 Alkyl and optionally substituted variably saturated or unsaturated C6-C 20 acyl, wherein n is 0 or any positive integer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more). In certain embodiments, the compositions and methods of the present invention provide a cationic lipid "HGT4001" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4002" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4003" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4004" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4005" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0113] Other suitable cationic lipids for use in the compositions and methods of the invention include the cleavable cationic lipids described in U.S. Provisional Application No. 62 / 672,194, filed May 16, 2018, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the invention comprise a cationic lipid having any of the general formulas or structures (1a)-(21a), (1b)-(21b), and (22)-(237) described in U.S. Provisional Application No. 62 / 672,194. In certain embodiments, the compositions and methods of the invention comprise a cationic lipid having a structure according to formula (I'): [ka] During the ceremony, Rx is independently -H, -L1-R1, or -L5A-L5B-B'; each of L1, L2, and L3 independently is a covalent bond, —C(O)—, —C(O)O—, —C(O)S—, or —C(O)NRL—; each L4A and L5A is independently -C(O)-, -C(O)O-, or -C(O)NRL-; each L4B and L5B is independently C1-C20 alkylene, C2-C20 alkenylene, or C2-C20 alkynylene; each B and B' is NR4R5 or a 5-10 membered nitrogen-containing heteroaryl; each R1, R2, and R3 is independently a C6-C30 alkyl, a C6-C30 alkenyl, or a C6-C30 alkynyl; each R4 and R5 is independently hydrogen, C1-C10 alkyl, C2-C10 alkenyl, or C2-C10 alkynyl; Each R is independently hydrogen, C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl.

[0114] In certain embodiments, the compositions and methods of the present invention provide a compound having the following structure: 2 / 672,194 Compound (139) containing cationic lipid: [ka] .

[0115] In some embodiments, the compositions and methods of the present invention comprise the cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride ("DOTMA") (Feigner et al. (Proc. Nat'l Acad.Sci.84,7413(1987); U.S. Patent No. 4,897,355, which is incorporated herein by reference.Other cationic lipids suitable for the compositions and methods of the present invention include, for example, 5-carboxyspermylglycinedioctadecylamide ("DOGS"), 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-l-propanaminium ("DOSPA") (Behr et al.Proc.Nat.'l Acad.Sci.86,6982(1989); U.S. Patent No. 5,171,678, U.S. Patent No. 5,334,761), l,2-dioleoyl-3-dimethylammonium-propane ("DODAP"), l,2-dioleoyl-3-trimethylammonium-propane ("DOTAP").

[0116] Additional exemplary cationic lipids suitable for the compositions and methods of the present invention also include 1,2-distearyloxy-N,N-dimethyl-3-aminopropane ("DSDMA"); 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane ("DODMA"); 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane ("DLinDMA"); 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane ("DLenDMA"); N- Dioleyl-N,N-dimethylammonium chloride ("DODAC"), N,N-distearyl-N,N-dimethylammonium bromide ("DDAB"), N-(l,2-dimyrityloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide ("DMRIE"), 3-dimethylamino-2-(cholest-5-ene-3-beta-oxybutan-4-oxy)-l-(cis,cis-9,12-octadecadienooxy)propionate Pan ("CLinDMA"); 2-[5'-(cholest-5-ene-3-beta-oxy)-3'-oxapentoxy)-3-dimethyl ll-(cis,cis-9',l-2'-octadecadienooxy)propane ("CpLinDMA"); N,N-dimethyl-3,4-dioleyloxybenzylamine ("DMOBA"); 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane ("DOcarbDAP"); 2,3-dilinoleoyloxy- N,N-dimethylpropylamine ("DLinDAP"), l,2-N,N'-dilinoleylcarbamyl-3-dimethylaminopropane ("DLincarbDAP"); l,2-dilinoleylcarbamyl-3-dimethylaminopropane ("DLinCDAP"); 2,2-dilinoleyl-4-dimethylaminomethyl-[l,3]-dioxolane ("DLin-K-DMA"); 2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)- N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine ("Octyl-CLinDMA"); (2R)-2-((8-[(3beta)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine ("Octyl-CLinDMA(2R)"); (2S)-2 -((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)-N,fsl-dimethyl 3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine ("Octyl-CLinDMA(2S)"); 2,2-Dilinoleyl-4-dimethylaminoethyl-[l,3]-dioxolane ("DLin-K-XTC2-DMA"), and 2-(2,2-di((9Z,12Z)-octadeca-9,l (2-dien-1-yl)-l,3-dioxolan-4-yl)-N,N-dimethylethanamine ("DLin-KC2-DMA") (see International Publication No. WO 2010 / 042877; Semple et al., Nature Biotech. 28:172-176 (2010), which is incorporated by reference herein). (Heyes, J., et al., J Controlled Release 107:276-287 (2005); Morrissey, DV., et al., Nat. Biotechnol. 23(8):1003-1007 (2005); International Patent Publication No. WO 2005 / 121348). In some embodiments, one or more of the cationic lipids comprises at least one of an imidazole moiety, a dialkylamino moiety, or a guanidinium moiety.

[0117] In some embodiments, one or more cationic lipids suitable for the compositions and methods of the present invention include 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane ("XTC"); (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine ("ALNY-100") and / or 4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tetraazahexadecane-1,16-diamide ("NC98-5").

[0118] In some embodiments, the compositions of the present invention comprise one or more cationic lipids that constitute at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the total lipid content in the composition, e.g., measured by weight of lipid nanoparticles. In some embodiments, the compositions of the present invention comprise one or more cationic lipids that constitute at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 80% of the total lipid content in the composition, e.g., measured by mol% of lipid nanoparticles. In some embodiments, the compositions of the present invention comprise one or more cationic lipids that constitute about 30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipid content in the composition, e.g., measured by weight of the lipid nanoparticles. In some embodiments, the compositions of the present invention comprise one or more cationic lipids that constitute about 30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipid content in the composition, e.g., measured by mol% of the lipid nanoparticles.

[0119] In some embodiments, sterol-based cationic lipids can be used instead of or in addition to the cationic lipids described herein.Suitable sterol-based cationic lipids are dialkylamino-containing sterol-based cationic lipids, imidazole-containing sterol-based cationic lipids, and guanidinium-containing sterol-based cationic lipids.For example, certain embodiments are imidazole-containing sterol-based cationic lipids, as shown by the following structure (I): The present invention relates to compositions comprising one or more sterol-based cationic lipids, including sterols, such as imidazole cholesterol esters, or the "ICE" lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoate. In certain embodiments, lipid nanoparticles for delivery of RNA (e.g., mRNA) encoding functional proteins may comprise one or more imidazole-based cationic lipids, such as imidazole cholesterol ester, or the "ICE" lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoate, as shown by the following structures: [ka]

[0120] In some embodiments, the proportion of cationic lipid in the liposome can be greater than 10%, greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, or greater than 70%. In some embodiments, the cationic lipid(s) constitute about 30-50% by weight of the liposome (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%). In some embodiments, the cationic lipid (e.g., ICE lipid) constitutes about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, or about 80% by molar ratio of the liposome.

[0121] PEGylated lipids In some embodiments, a suitable lipid solution comprises one or more PEGylated lipids. For example, the use of polyethylene glycol (PEG)-modified phospholipids and derivatized lipids, such as derivatized ceramides (PEG-CER), including N-octanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)-2000] (C8 PEG-2000 ceramide), is also contemplated by the present invention. Contemplated PEG-modified lipids range in length from C6 to C8. 20 In some embodiments, the PEG-modified or PEGylated lipid is PEGylated cholesterol or PEG-2K. In some embodiments, particularly useful exchangeable lipids have shorter acyl chains (e.g., C 14 or C 18 ) is a PEG-ceramide.

[0122] The PEG-modified phospholipids and derivatized lipids may constitute at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 15%, or at least 20% of the total lipids in the liposome.

[0123] Non-cationic / Helper Lipids As used herein, the phrase "non-cationic lipid" means any neutral lipid, zwitterionic lipid, or anionic lipid. "Cationic lipid" refers to any of a number of lipid species that carry a net negative charge at a selected pH, such as physiological pH. Non-cationic lipids include, but are not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylethanolamine (P ... and mixtures thereof.

[0124] In some embodiments, non-cationic lipids may comprise at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% by weight or molar of the total lipids in a suitable lipid solution. In some embodiments, the non-cationic lipid(s) comprise about 20-50% (e.g., about 20-45%, about 20-40%, about 25-50%, about 25-45%, or about 25-40%) of the total lipids in a suitable lipid solution.

[0125] Cholesterol-based lipids In some embodiments, suitable lipid solution comprises one or more cholesterol-based lipids.For example, suitable cholesterol-based cationic lipids include, for example, DC-Choi (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine (Gao, et al. Biochem.Biophys.Res.Comm.179,280(1991); Wolf et al. BioTechniques 23,139(1997); U.S. Patent No. 5,744,335) or ICE.In some embodiments, cholesterol-based lipid(s) constitute at least about 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60% or 70% of the total lipid in suitable lipid solution by weight or molar ratio. In some embodiments, the cholesterol-based lipid(s) constitute about 20-50% (e.g., about 20-45%, about 20-40%, about 25-50%, about 25-45%, or about 25-40%) of the total lipids in a suitable lipid solution, by weight or molar.

[0126] The exemplary combination of cationic lipid, non-cationic lipid, cholesterol-based lipid and PEG-modified lipid is described in the example section.For example, suitable lipid solution can comprise cKK-E12, DOPE, cholesterol and DMG-PEG2K; C12-200, DOPE, cholesterol and DMG-PEG2K; HGT5000, DOPE, cholesterol and DMG-PEG2K; HGT5001, DOPE, cholesterol and DMG-PEG2K; cKK-E12, DPPC, cholesterol and DMG-PEG2K; C12-200, DPPC, cholesterol and DMG-PEG2K; HGT5000, DPPC, cholesterol and DMG-PEG2K; or HGT5001, DPPC, cholesterol and DMG-PEG2K.The selection of cationic lipid, non-cationic lipid and / or PEG-modified lipid comprising lipid mixture and the relative molar ratio of these lipids to each other are based on the characteristics of selected lipid and the properties and characteristics of the mRNA to be encapsulated. Further considerations include, for example, the degree of saturation of the alkyl chains of the selected lipid(s), as well as size, charge, pH, pKa, fusogenicity, and toxicity. Thus, the molar ratio can be adjusted accordingly.

[0127] Typically, the mRNA-loaded lipid nanoparticles comprise 0.1% to 30% of the total solids content of the spray-dried mixture. In some embodiments, the total solids content of the spray-dried mRNA-loaded nanoparticle composition is 0.5 to 20%. In some embodiments, the total solids content of the spray-dried mRNA-loaded nanoparticle composition is 2 to 20%. In some embodiments, the total solids content of the spray-dried mRNA-loaded nanoparticle composition is 2 to 15%. In some embodiments, the total solids content of the spray-dried mRNA-loaded nanoparticle composition is 2 to 10%.

[0128] polymer A variety of polymers can be used in spray-dried mRNA-LNPs according to the present invention. Typically, suitable polymers have low toxicity and are well tolerated over a wide range of concentrations. In some embodiments, suitable polymers are positively charged. Exemplary polymers include, but are not limited to, chitosan, polyesters, polyurethanes, polycarbonates, poly(lactic acid) (PLA), poly(lactic-co-glycolic acid) (PLGA), poly(q-caprolactone (PCL), polyamidoamines, poly(hydroxyalkyl L-asparagine), poly(hydroxyalkyl L-glutamine), poly(2-alkyloxazoline) acrylates, modified acrylate and methacrylate-based polymers, poly-N-(2-hydroxyl-propyl)methacrylamide, poly-2-(methacryloyloxy)ethyl phosphorylcholine, poly(2-(methacryloyloxy)ethyl phosphorylcholine), and poly(dimethylaminoethyl methylacrylate) (pDMAEMA).

[0129] In some embodiments, suitable polymers are polymethacrylate derivatives and include repeating units of monomers of the following structure: [ka] In the formula, R 1 are independently C1-C6 alkyl, and L 1 are independently C2-C6 alkylene, and R 1A and R 1B are each independently C1-C6 alkyl, and a is an integer from 1 to 500; R 2 are independently C1-C6 alkyl, and R 2A are independently C1-C6 alkyl, and b is an integer from 1 to 500; R 3 are independently C1-C6 alkyl, and R 3A is independently C1-C6 alkyl, and c is an integer of 1 to 500.

[0130] In some embodiments, the repeat unit may be represented by: [ka] In the formula, each R 4 are independent, R 2 or R 3 and each R 4A are independent, R 2A or R 3A and d is an integer from 1 to 500. In the above structure, L 1 may be -CH2CH2, and each R 1A and R 1B is methyl, and / or each R 1 , R 2 , and R 3 is methyl and / or R 2A is butyl, and R 3A is methyl.

[0131] In some embodiments, exemplary members of the polymer are represented by the following formula: [ka]

[0132] An exemplary member of this group is known by the trade name Eudragit. In some embodiments of the present invention, the polymer included in the spray-dried mRNA-LNP formulation is a Eudragit polymer. Eudragit forms a class of amorphous polymers or copolymers derived from esters of acrylic and methacrylic acid, whose properties are determined by functional groups. Individual Eudragit grades vary in the proportion of neutral, alkaline, or acid groups, and therefore in physicochemical properties. Some available forms are anionic, some cationic, and some neutral. In some embodiments, this type of polymer used with mRNA-LNP complexes for spray drying contains positively charged tertiary amine groups in the methacrylic acid backbone. They may complex with and encapsulate mRNA. They have higher Tg and excellent thermoplastic properties that aid spray drying. These polymers are insoluble at higher pHs and therefore may help protect mRNA from degradation in detergents. Eudragit polymers are approved for oral use by the U.S. Food and Drug Administration (FDA) and have been used in commercially available oral products for decades. These polymers have low toxicity and are well tolerated over a wide range of concentrations.

[0133] In some embodiments, the polymers used include the Eudragit class, which are insoluble at pH 5 or above. In some embodiments, this property of the polymers is used for oral delivery of active mRNA components so that the mRNA is not released into the saliva. One advantage of these polymers is that the functional polymers are insoluble in the mouth, allowing the active component and other components to be easily absorbed. The objective of this invention is to strongly mask the taste and odor of the excipients.

[0134] Thus, in some embodiments, these methacrylic acid derivative polymers described above are used to prepare formulations for stable spray-dried mRNA-LNP dry powders. In some embodiments, these methacrylic acid derivative polymers are used for sustained release of mRNA. In some embodiments, methacrylic acid derivative polymers that are insoluble at pH ≥ 5 are used for delivery of suitable mRNA to the gastrointestinal tract (GI). In some embodiments, methacrylic acid derivative polymers are used for delivery of suitable mRNA to the colon.

[0135] In some embodiments, the polymer comprises less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 15%, 12%, 10%, 9%, 8%, 7%, 6%, or 5% of the total weight of the dry powder. In some embodiments, the polymer comprises 1% to 60% of the total weight of the dry powder. In some embodiments, the polymer comprises about 1-90%, 10-90%, 20-90%, 10-50%, 1-20%, 2-15%, 3-12%, 1-10%, 2-9%, 3-8%, 1-7%, 2-6%, or 3-5% of the total weight of the dry powder.

[0136] Other excipients In some embodiments, sugars and other excipients are added to the mRNA-loaded nanoparticles and polymer mixture before spray drying.

[0137] sugar Various sugars can be added to the mixture before spray drying.It is intended that sugars provide stabilization during dehydration.The exemplary sugars suitable for formulation are selected from the group consisting of glucose, fructose, galactose, mannose, sorbose, lactose, sucrose, cellobiose, trehalose, raffinose, starch, dextran, maltodextrin, cyclodextrin, linoleic acid, xylitol, sorbitol, lactitol and mannitol.

[0138] In some embodiments, the preferred sugar is lactose and / or mannitol. In some embodiments, the preferred sugar is mannitol. In some embodiments, mannitol is added at a concentration of about 1-10%. In some embodiments, mannitol is added at a concentration of about 2-10%. In some embodiments, mannitol is added at a concentration of about 3-10%. In some embodiments, mannitol is added at a concentration of about 4-10%. In some embodiments, mannitol is added at a concentration of about 5-10%.

[0139] In some embodiments, the preferred sugar is trehalose, hi some embodiments, both mannitol and trehalose are added.

[0140] surfactants In some embodiments, surfactants are used as excipients. The surfactants increase the surface tension of the composition. In some embodiments, surfactants used in the spray-dried mRNA-lipid composition include CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate), phospholipids, phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, octaethylene glycol monododecyl ether, pentaethylene glycol monododecyl ether, Triton X-100, cocamide monoethanolamine, cocamide diethanolamine, glycerol monostearate, glycerol monolaurate, sorbitan moonolaureate, sorbitan monostearate, Tw In some embodiments, the surfactant is selected from the group consisting of Tween 20, Tween 40, Tween 60, Tween 80, alkyl polyglucosides, and poloxamers. In some embodiments, the surfactant is a poloxamer.

[0141] Various other excipients may be included in the spray-dried formulation, including, but not limited to, various polyesters, polyurethanes, poly(ester amides), poly(orthoesters), polyanhydrides, poly(anhydride-co-imides), polyphosphoesters, polyphosphazenes, amino acids, collagen, chitosan, cyclodextrins, polysaccharides, maltodextrin, albumin, various sugars, surfactants, buffers, and salts.

[0142] dry powder The dry powder prepared according to the present invention comprises a plurality of spray-dried particles. Residual moisture content, aerosol performance, and physicochemical stability are important parameters of spray-dried pharmaceuticals. This is determined by the sample weight loss after heating and drying using the following formula: Moisture content%=[(SW b -SW a ) / SW b ]×100% In the ceremony, SW b is the sample weight before heating, and SW a is the sample weight after heating. A Perkin Elmer TGA 7 (Perkin Elmer) is an example of a commercially used instrument with associated software for measuring residual moisture in nanoparticles.

[0143] Generally, to ensure the uniformity of the dosage of the active pharmaceutical ingredient of the formulation, the acceptable particle size distribution range is maintained.Especially for pulmonary delivery, the particles of dry powder formulation affect the distribution and deposition of aerosol in the respiratory system.In many cases, for the effective absorption and distribution of therapeutic components, particle deposition in large conducting airways is preferred.Very fine particle aerosol, for example, particles with a diameter of less than 1 micrometer, can be deposited in the periphery, for the effective absorption by specific cells in the lung, such as smooth muscle, for the active pharmaceutical ingredient to function as a bronchodilator.

[0144] The primary particle size distribution of spray-dried particles is measured by dynamic light scattering, expressed as the Z-average. The Z-average is calculated from the intensity-weighted distribution of particle diameters, also known as the cumulative size, and is given by the equation: D z =ΣS i / Σ(S i / D i ) and S i is the scattering intensity from particle "i", and D i is the diameter of the particle. In addition to these parameters, the fine course fraction of the particle is defined.

[0145] The polydispersity index (PDI), on the other hand, is a measure of the distribution of molecular weights in a given particle sample.

[0146] Zeta potential is a measure of the magnitude of electrostatic or charge repulsion / attraction between particles and is one of the fundamental parameters known to affect stability. It provides detailed insight into the causes of dispersion, aggregation, or flocculation and can be applied to improve the formulation of dispersions, emulsions, and suspensions. ZP indicates the degree of repulsion between adjacent particles and similarly charged particles in a dispersion. A high ZP indicates high charged particles. Generally, a high ZP (negative or positive) prevents particle aggregation due to electrical repulsion and electrically stabilizes nanoparticle dispersions. On the other hand, if the ZP is low, the attractive forces exceed the repulsive forces, and the dispersion will coagulate or aggregate. Zeta potential can be measured by photon correlation spectroscopy using available instrumentation systems, such as the Zetasizer Nano (Malvern Instruments).

[0147] The sphericity of a nanoparticle is a measure of how closely the particle reassembles into spheres. It can be measured by the Waddell equation and is denoted by Ψ, which is determined as follows: [ka] The size distribution and shape or sphericity of spray-dried mRNA-lipid formulations can be measured by scanning electron microscopy (SEM), transmission electron microscopy, or the change in electrical resistance imposed by the particles in a fluid by Coulter counter.

[0148] Finally, mRNA content and / or integrity is assessed by HPLC or Northern blot analysis. In some embodiments, mass spectrometry and other relevant spectrophotochemical analyses are performed to assess the stability, integrity, and quality of mRNA nanoparticle formulations.

[0149] The spray-dried mRNA lipid nanoparticles of the present invention contain less than 10% moisture (w / w). In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention may retain less than about 9% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention may retain less than about 8% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention may retain less than about 7% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention may retain less than about 6% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention may retain less than about 5% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention may retain less than about 4% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention may retain less than about 3% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention may retain less than about 2% moisture. In some embodiments, the spray-dried mRNA lipid nanoparticles of the present invention may retain less than about 1% moisture. In some embodiments, the moisture content of the spray-dried mRNA-LNP formulation is less than 5%.

[0150] Spray-dried mRNA LNP formulations are provided herein, wherein the mRNA-lipid nanoparticles are heterogeneously sized with a fine fraction (fnfr) of less than 10 μm. In some embodiments, the fnfr of the mRNA-LNP dry powder particles of the present invention is in the range of 1-10 μm. The optimal Z-average for mRNA-LNP spray-dried samples can be ≦10 μm. In some embodiments, the Z-average of mRNA-LNP spray-dried samples is ≦8 μm. In some embodiments, the Z-average of mRNA-LNP spray-dried samples is ≦5 μm. In some embodiments, the Z-average of mRNA-LNP spray-dried samples should be in the range of 0.01-10 μm. In some embodiments, the Z-average of mRNA-LNP spray-dried samples should be in the range of 0.1-10 μm. In some embodiments, the Z-average of mRNA-LNP spray-dried samples should be in the range of 0.1-5 μm. In some embodiments, the Z-average of mRNA-LNP spray-dried samples should be in the range of 0.1-3 μm. In some embodiments, the Z-average of the mRNA-LNP spray-dried sample should be in the range of 0.1-5 μm.

[0151] In some embodiments, the mRNA lipid nanoparticles comprise a Z-average of less than 200 nm before spray drying. In some embodiments, the mRNA lipid nanoparticles comprise a Z-average of less than 180 nm before spray drying. In some embodiments, the mRNA lipid nanoparticles comprise a Z-average of less than 150 nm before spray drying. In some embodiments, the mRNA lipid nanoparticles comprise a Z-average of less than 120 nm before spray drying. In some embodiments, the mRNA lipid nanoparticles comprise a Z-average of less than 100 nm before spray drying. In some embodiments, the mRNA lipid nanoparticles comprise a Z-average of less than 50 nm before spray drying.

[0152] In some embodiments, the mRNA-lipid nanoparticles have a diameter of less than 5000 nm after spray drying. In some embodiments, the mRNA lipid nanoparticles comprise a Z-average of less than 4000 nm after spray drying. In some embodiments, the mRNA lipid nanoparticles comprise a Z-average of less than 3000 nm after spray drying. In some embodiments, the mRNA lipid nanoparticles comprise a Z-average of less than 2000 nm after spray drying. In some embodiments, the mRNA lipid nanoparticles comprise a Z-average of less than 1000 nm after spray drying. In some embodiments, the mRNA lipid nanoparticles comprise a Z-average of less than 500 nm after spray drying. In some embodiments, the mRNA lipid nanoparticles comprise a Z-average of less than 500 nm after spray drying. In some embodiments, the mRNA lipid nanoparticles comprise a Z-average of less than 300 nm after spray drying. In some embodiments, the mRNA lipid nanoparticles comprise a Z-average of less than 2 ... nm after spray drying. In some embodiments, the mRNA lipid nanoparticles comprise a Z-average of less than 50 nm after spray drying. In some embodiments, the mRNA-lipid nanoparticles comprise a Z-average of less than 10 nm after spray drying.

[0153] Dry powder formulations of mRNA-LNPs are provided herein, wherein the mean sphericity of the mRNA-LNP particles ranges from 0.7 to 1. In some embodiments, the mean sphericity of the mRNA-lipid nanoparticles is greater than 0.7, or greater than 0.8, or greater than 0.9.

[0154] In some embodiments, the zeta potential value of the nanoparticles for the present application is between +30 mV and -30 mV. In some embodiments, the zeta potential value of the nanoparticles is between +20 mV and -30 mV. In some embodiments, the zeta potential value of the nanoparticles is between +10 mV and -30 mV. In some embodiments, the zeta potential value of the nanoparticles is between 0 mV and -30 mV. In some embodiments, the zeta potential value of the nanoparticles is between -10 mV and -30 mV. In some embodiments, the zeta potential value of the nanoparticles is between -20 mV and -30 mV. In some embodiments, the zeta potential value of the nanoparticles is between +20 mV and -30 mV. In some embodiments, the zeta potential value of the nanoparticles is between -20 mV and -30 mV. In some embodiments, the zeta potential value of the nanoparticles is about -30 mV and the polydispersity index is less than about 0.3.

[0155] In some embodiments, provided mRNA-LNP dry powder formulations contain up to 30%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, or 2% mRNA by total dry powder weight. In some embodiments, the mRNA comprises 1-6%, 1-5%, 1-4%, 1-3%, 2-10%, 2-9%, 2-8%, 2-7%, 2-6%, 2-5%, 2-10%, 2-15%, 2-20%, or 2-30% of the total dry powder weight.

[0156] stability Spray-dried mRNA-LNP formulations are provided that are stable when stored under various conditions. As used herein, the term "stable" refers to mRNA that retains greater than 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% integrity after storage. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen (-20°C), at 4°C, or at room temperature for more than one year. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen (-20°C), at 4°C, or at room temperature for more than 11 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen (-20°C), at 4°C, or at room temperature for more than 10 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen (-20°C), at 4°C, or at room temperature for more than 9 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein can be stored frozen (-20°C), at 4°C, or at room temperature for more than 8 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen at -20°C, 4°C, or room temperature for more than 7 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen at -20°C, 4°C, or room temperature for more than 6 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen at -20°C, 4°C, or room temperature for more than 5 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen at -20°C, 4°C, or room temperature for more than 4 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen at -20°C, 4°C, or room temperature for more than 3 months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen (-20°C), at 4°C, or at room temperature for more than two months. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen (-20°C), at 4°C, or at room temperature for more than one month.

[0157] In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen (-20°C), 4°C, or at room temperature for more than 8 weeks. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen (-20°C), 4°C, or at room temperature for more than 7 weeks. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen (-20°C), 4°C, or at room temperature for more than 6 weeks. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen (-20°C), 4°C, or at room temperature for more than 5 weeks. In some embodiments, the mRNA-LNP dry powder formulations provided herein are stable when stored frozen (-20°C), 4°C, or at room temperature for more than 4 weeks.

[0158] messenger RNA Any mRNA can be formulated using the present invention. As used herein, mRNA is a type of RNA that transmits information from DNA to ribosomes to translate the encoded protein. mRNA can be synthesized by any of a variety of known methods. For example, mRNA according to the present invention can be synthesized via in vitro transcription (IVT). Briefly, IVT is typically carried out using a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may contain DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNAse I, pyrophosphatase, and / or an RNAse inhibitor. The exact conditions will vary depending on the specific application.

[0159] The present invention can be used to formulate mRNAs of various lengths. In some embodiments, the present invention can be used to deliver in vitro synthesized mRNAs of lengths of about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or 20 kb or more. In some embodiments, the present invention can be used to deliver in vitro synthesized mRNAs of lengths ranging from about 1 to 20 kb, about 1 to 15 kb, about 1 to 10 kb, about 5 to 20 kb, about 5 to 15 kb, about 5 to 12 kb, about 5 to 10 kb, about 8 to 20 kb, or about 8 to 15 kb.

[0160] The present invention can be used to formulate unmodified mRNA or mRNA containing one or more modifications that generally enhance stability. In some embodiments, the modifications include: Modified nucleotides, modified sugar phosphate backbones, and 5' and / or 3' untranslated regions (UTRs).

[0161] In some embodiments, modifications of mRNA may include modifications of nucleotides of the RNA. Modified mRNA according to the present invention may include, for example, backbone modifications, sugar modifications, or base modifications. In some embodiments, mRNA may be synthesized from natural nucleotides and / or nucleotide analogs (modified nucleotides), including, but not limited to, purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), as well as nucleotide analogs such as 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, and N6-isopentenyl-adenine. 1-amino-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydrouracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio- Uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester uryl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queuosine, beta-D-mannosyl-queuosine, wybutoxosine, and modified nucleotide analogs or derivatives of purines and pyrimidines, such as phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine.The preparation of such analogs is known to those skilled in the art from, for example, U.S. Pat. No. 4,373,071, U.S. Pat. No. 4,401,796, U.S. Pat. No. 4,415,732, U.S. Pat. No. 4,458,066, U.S. Pat. No. 4,500,707, U.S. Pat. No. 4,668,777, U.S. Pat. No. 4,973,679, U.S. Pat. No. 5,047,524, U.S. Pat. No. 5,132,418, U.S. Pat. No. 5,153,319, U.S. Pat. No. 5,262,530, and U.S. Pat. No. 5,700,642, the disclosures of which are incorporated herein by reference in their entirety.

[0162] In some embodiments, mRNA may comprise RNA backbone modification. Typically, backbone modification is a modification that chemically modifies the backbone phosphate of the nucleotide contained in RNA. Exemplary backbone modifications typically include, but are not limited to, modifications from the group consisting of methyl phosphonate, methyl phosphoramidite, phosphoramidite, phosphorothioate (e.g., cytidine 5'-O-(1-thiophosphate)), boranophosphate, positively charged guanidinium group, etc., which means replacing phosphodiester bond with other anionic group, cationic group, or neutral group.

[0163] In some embodiments, the mRNA may contain sugar modifications. Exemplary sugar modifications are chemical modifications of the sugar of a nucleotide, including, but not limited to, 2'-deoxy-2'-fluoro-oligoribonucleotide (2'-fluoro-2'-deoxycytidine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate), 2'-deoxy-2'-deamine-oligoribonucleotide (2'-amino-2'-deoxycytidine 5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate), 2'-O-alkyloligoribonucleotide, 2'-deoxy-2'-C-alkyloligoribonucleotide (2'-O-methylcytidine 5'-triphosphate, 2'-methyluridine 5'-triphosphate), 2'-O-methyl-2'-methyluridine 5'-triphosphate, 2'-O-methyl- ... and sugar modifications selected from the group consisting of 2'-C-alkyl oligoribonucleotides, and their isomers (2'-aracytidine 5'-triphosphate, 2'-arauidine 5'-triphosphate), or azidotriphosphates (2'-azido-2'-deoxycytidine 5'-triphosphate, 2'-azido-2'-deoxyuridine 5'-triphosphate).

[0164] In some embodiments, mRNA may contain a modification of the base of a nucleotide (base modification). Modified nucleotides containing base modifications are also called base-modified nucleotides. Examples of such base-modified nucleotides include, but are not limited to, 2-amino-6-chloropurine riboside 5'-triphosphate, 2-aminoadenosine 5'-triphosphate, 2-thiocytidine 5'-triphosphate, 2-thiouridine 5'-triphosphate, 4-thiouridine 5'-triphosphate, 5-aminoallylcytidine 5'-triphosphate, 5-aminoallyluridine 5'-triphosphate, 5-bromocytidine 5'-triphosphate, 5-bromouridine 5'-triphosphate, 5-iodocytidine 5'-triphosphate, 5-iodouridine 5'-triphosphate, 5-methylcytidine 5'-triphosphate, 5-methyluridine 5'-triphosphate, 6-azacytidine 5'-triphosphate, 5-aminoallyl ur ...aminoallyl uridine 5'-triphosphate, 5-aminoallyl uridine 5'-triphosphate, 5-aminoallyl uridine 5'-triphosphate, 5-aminoallyl uridine 5'-triphosphate, 5-aminoallyl uridine 5'-triphosphate, 5-aminoally uridine 5'-triphosphate, 6-azauridine 5'-triphosphate, 6-chloropurine riboside 5'-triphosphate, 7-deazaadenosine 5'-triphosphate, 7-deazaguanosine 5'-triphosphate, 8-azaadenosine 5'-triphosphate, 8-azidoadenosine 5'-triphosphate, benzimidazole riboside 5'-triphosphate, N1-methyladenosine 5'-triphosphate, N1-methylguanosine 5'-triphosphate, N6-methyladenosine 5'-triphosphate, O6-methylguanosine 5'-triphosphate, pseudouridine 5'-triphosphate, puromycin 5'-triphosphate, or xanthosine 5'-triphosphate.

[0165] mRNA synthesis typically involves the addition of a "cap" to the 5' end and a "tail" to the 3' end. The presence of the cap is important for conferring resistance to nucleases found in most eukaryotic cells. The presence of the "tail" serves to protect the mRNA from exonuclease degradation.

[0166] Thus, in some embodiments, the mRNA comprises a 5' cap structure. The 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates; then, guanosine triphosphate (GTP) is added to the terminal phosphate via a guanylyltransferase to generate a 5'-5' inverted triphosphate bond; and then, the 7-nitrogen of guanine is methylated by a methyltransferase. 2'-O-methylation can also occur at the first and / or second base after the 7-methylguanosine triphosphate residue. Examples of cap structures include, but are not limited to, m7GpppNp-RNA, m7GpppNmp-RNA, and m7GpppNmpNmp-RNA (where m represents a 2'-O-methyl residue).

[0167] In some embodiments, the mRNA comprises a 3' tail structure. The tail structure typically comprises a poly(A) tail and / or a poly(C) tail. The poly(A) tail or poly(C) tail on the 3' end of the mRNA typically comprises at least 50 adenosine or cytosine nucleotides, at least 150 adenosine or cytosine nucleotides, at least 200 adenosine or cytosine nucleotides, at least 250 adenosine or cytosine nucleotides, at least 300 adenosine or cytosine nucleotides, at least 350 adenosine or cytosine nucleotides, at least 400 adenosine or cytosine nucleotides, at least 450 adenosine or cytosine nucleotides, at least 500 adenosine or cytosine nucleotides, at least 550 adenosine or cytosine nucleotides, at least 600 adenosine nucleotides. adenosine or cytosine nucleotides, at least 650 adenosine or cytosine nucleotides, at least 700 adenosine or cytosine nucleotides, at least 750 adenosine or cytosine nucleotides, at least 800 adenosine or cytosine nucleotides, at least 850 adenosine or cytosine nucleotides, at least 900 adenosine or cytosine nucleotides, at least 950 adenosine or cytosine nucleotides, or at least 1 kb of adenosine or cytosine nucleotides, respectively.In some embodiments, the poly-A tail or poly-C tail each comprises between about 10 and 800 adenosine or cytosine nucleotides (e.g., between about 10 and 200 adenosine or cytosine nucleotides, between about 10 and 300 adenosine or cytosine nucleotides, between about 10 and 400 adenosine or cytosine nucleotides, between about 10 and 500 adenosine or cytosine nucleotides, between about 10 and 550 adenosine or cytosine nucleotides, between about 10 and 600 adenosine or cytosine nucleotides, between about 50 and 600 adenosine or cytosine nucleotides, between about 100 and 600 adenosine or cytosine nucleotides, between about 150 and 600 adenosine or cytosine nucleotides, between about 200 and 300 adenosine or cytosine nucleotides, between about 200 and 300 adenosine or cytosine nucleotides, between about 300 and 400 adenosine or cytosine nucleotides, between about 10 and 500 adenosine or cytosine nucleotides, between about 10 and 550 adenosine or cytosine nucleotides, between about 10 and 600 adenosine or cytosine nucleotides, between about 50 and 600 adenosine or cytosine nucleotides, between about 100 and 600 adenosine or cytosine nucleotides, between about 150 and 600 adenosine or cytosine nucleotides, between about 200 and 300 adenosine or cytosine nucleotides, between about The poly(A) tail may be 600 adenosine or cytosine nucleotides, about 250-600 adenosine or cytosine nucleotides, about 300-600 adenosine or cytosine nucleotides, about 350-600 adenosine or cytosine nucleotides, about 400-600 adenosine or cytosine nucleotides, about 450-600 adenosine or cytosine nucleotides, about 500-600 adenosine or cytosine nucleotides, about 10-150 adenosine or cytosine nucleotides, about 10-100 adenosine or cytosine nucleotides, about 20-70 adenosine or cytosine nucleotides, or about 20-60 adenosine or cytosine nucleotides. In some embodiments, the tail structure comprises a combination of poly(A) tails and poly(C) tails of various lengths as described herein. In some embodiments, the tail structure comprises at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% adenosine nucleotides.In some embodiments, the tail structure comprises at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% cytosine nucleotides.

[0168] In some embodiments, the mRNA comprises a 5' and / or 3' untranslated region. In some embodiments, the 5' untranslated region comprises one or more elements that affect mRNA stability or translation, for example, iron-responsive elements.

[0169] In some embodiments, the 3' untranslated region comprises one or more of a polyadenylation signal, a binding site for a protein that affects the positional stability of an mRNA in a cell, or one or more binding sites for an miRNA.

[0170] Exemplary 5' and / or 3' untranslated sequences can be derived from stable mRNA molecules (e.g., globin, actin, GAPDH, tubulin, histones, or citric acid cycle enzymes) to increase the stability of the sense mRNA molecule. For example, the 5' untranslated sequence can include a partial sequence or fragment of the CMV immediate early 1 (IE1) gene to improve nuclease resistance and / or improve the half-life of the polynucleotide. To further stabilize the polynucleotide, a 5' untranslated sequence can be derived from a CMV immediate early 1 (IE1) gene or fragment thereof to improve nuclease resistance and / or improve the half-life of the polynucleotide. Inclusion of the sequence or a fragment thereof in the 3' end or untranslated region of a polynucleotide (e.g., mRNA) is also contemplated. Generally, these modifications include modifications made to improve the stability and / or pharmacokinetic properties (e.g., half-life) of polynucleotides compared to their unmodified counterparts, e.g., to improve the resistance of such polynucleotides to in vivo nuclease digestion.

[0171] The mRNA construct design can be designated as X-coding sequence-Y. Exemplary X and Y nucleotide sequences are as follows: X(5' untranslated sequence) = GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG (SEQ ID NO: 1) Y(3' untranslated sequence) = CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU (SEQ ID NO: 2) or GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU (SEQ ID NO: 3)

[0172] While mRNA resulting from an in vitro transcription reaction is desirable in some embodiments, other sources of mRNA are contemplated within the scope of the present invention, including mRNA produced from bacteria, fungi, plants, and / or animals.

[0173] In some embodiments, the preferred mRNA sequence is an mRNA sequence encoding the human cystic fibrosis transmembrane receptor, cystic fibrosis transmembrane conductance regulator CFTR (hCFTR) protein. In some embodiments, the preferred mRNA sequence is codon-optimized for efficient expression in human cells. Detailed descriptions embodying the preparation and optimization of CFTR mRNA for therapeutic delivery are described in U.S. Patent Application No. 15 / 981,757, filed May 16, 2018, the disclosure of which is incorporated herein in its entirety.

[0174] Pharmaceutical Formulations and Therapeutic Uses The pharmaceutical compositions of the dry powder formulations of the present invention can be used in a variety of therapeutic applications. To facilitate in vivo delivery, the dry powder formulations described herein may be combined with one or more additional pharmaceutical carriers, targeting ligands, or stabilizing reagents. In some embodiments, one or more additional pharmaceutical carriers may be added to the formulation before spray drying. In some embodiments, one or more additional pharmaceutical carriers may be added to the formulation using post-insertion techniques into the dry powder formulation (i.e., after spray drying). Formulation techniques and drug administration can be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., (latest edition).

[0175] The dry powder formulations described herein can be administered in powder form, or alternatively, after reconstitution in vivo.Suitable administration routes for the formulations described herein include oral administration, rectal administration, vaginal administration, transmucosal administration, pulmonary administration, including intratracheal administration or inhalation administration, or intestinal administration, parenteral delivery, including intradermal injection, transdermal (topical) injection, intramuscular injection, subcutaneous injection, intramedullary injection, as well as intrathecal, direct intracerebroventricular, intravenous, intraperitoneal, or intranasal. In certain embodiments, intramuscular administration is into a muscle selected from the group consisting of skeletal muscle, smooth muscle, and cardiac muscle. In some embodiments, this administration results in delivery of the nucleic acid into muscle cells. In some embodiments, this administration results in delivery of the nucleic acid into hepatocytes (i.e., liver cells).

[0176] The pharmaceutical formulations of the present invention can be administered in a local rather than systemic manner, for example, by directly injecting the pharmaceutical formulation into the targeted tissue, preferably in a sustained-release formulation. Local delivery can be achieved in various ways depending on the targeted tissue. Examples of tissues to which the delivered mRNA can be delivered and / or expressed include, but are not limited to, the lung, liver, kidney, heart, spleen, serum, brain, skeletal muscle, lymph nodes, skin, and / or cerebrospinal fluid. In several embodiments, the targeted tissue is the liver. For example, an aerosol containing a composition of the present invention can be inhaled (for nasal, tracheal, or bronchial delivery). In some embodiments, the compositions of the present invention can be delivered using a metered-dose inhaler. In some embodiments, the compositions of the present invention can be reconstituted and atomized for delivery. In some embodiments, the compositions of the present invention can be injected at the site of injury, disease manifestation, or pain. In some embodiments, the compositions of the present invention can be provided in a lozenge for oral, tracheal, or esophageal application. In some embodiments, the compositions of the present invention can be provided in liquid, tablet, or capsule form for administration to the stomach or intestine. In some embodiments, the compositions of the present invention may be provided in the form of a suppository for rectal or vaginal application, hi some embodiments, the compositions of the present invention may be delivered to the eye by the use of creams, drops, or even injections.

[0177] In some embodiments, the dry powder formulation of the present invention is reconstituted into a liquid solution and atomized for delivery. Atomization can be achieved by any atomizer known in the art. Atomizers convert liquids into mist, which can be more easily inhaled into the lungs. Atomizers are effective for infants, children, and adults. Atomizers can atomize high doses of inhaled medication. Typically, the atomizers used in the present invention include a removable mouthpiece.

[0178] In some embodiments, the dry powder formulations described herein may be used to deliver therapeutically effective amounts of mRNA for the treatment of various diseases or disorders. For example, the dry powder formulations prepared by spray drying according to the present invention may be administered orally, nasally, tracheally, or via the lungs or routes for the treatment of lung-related disorders such as cystic fibrosis. In some embodiments, the dry powder formulations are administered by inhalation. In some embodiments, the formulations are administered by metered-dose inhalers. In some embodiments, the dry powder formulations are administered by nasal spray. In some embodiments, the dry powder formulations are rehydrated and administered as intravenous infusion, injection, oral infusion, nasal infusion, and any other application readily apparent to those skilled in the art.

[0179] The present invention can be used to treat a variety of other lung-related diseases, disorders, and conditions. In some embodiments, the stable dry powder formulations of the present invention are useful for treating one or more of the following diseases or disorders: asthma; COPD; emphysema; primary ciliary dyskinesia with or without situs inversus (CILD1) or Kartagener syndrome; pulmonary fibrosis; Birt-Hogg-Dube syndrome; hereditary hemorrhagic telangiectasia; alpha-1 antitrypsin deficiency; cytochrome b-positive granulomatous disease (CGD, radiographic); cytochrome b-positive granulomatous disease, autosomal recessive; surfactant deficiency, pulmonary surfactant dysbolism 1, pulmonary surfactant dysbolism type 2, pulmonary surfactant dysbolism type 3; respiratory distress syndrome of prematurity; pulmonary viral diseases, including tuberculosis, influenza, and respiratory syncytial virus (RSV).

[0180] Thus, in certain embodiments, the present invention provides a method for delivering or administering a medicament to the lung or lung cells of a subject. The present invention provides methods for producing dry powder compositions containing full-length mRNA encoding a peptide or polypeptide for use in the treatment thereof. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding the cystic fibrosis transmembrane conductance regulator (CFTR) protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding the ATP-binding cassette subfamily A member 3 protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding the dynein axoneme intermediate chain 1 protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding the dynein axoneme heavy chain 5 (DNAH5) protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding the alpha-1-antitrypsin protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding the forkhead box P3 (FOXP3) protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding one or more surfactant proteins, such as one or more of surfactant A protein, surfactant B protein, surfactant C protein, and surfactant D protein.

[0181] In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding peptides or polypeptides for delivery to or use in treating the liver or liver cells of a subject. Such peptides and polypeptides may include those associated with urea cycle disorders, lysosomal storage disorders, glycogen storage disorders, amino acid metabolism disorders, lipid metabolism or fibrotic disorders, methylmalonic acidemia, or any other metabolic disorder for which delivery of enriched full-length mRNA to or treatment of the liver or liver cells provides the benefit of a dry powder.

[0182] In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding a protein associated with a urea cycle disorder. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an ornithine transcarbamylase (OTC) protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an argininosuccinate synthetase 1 protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding a carbamoyl phosphate synthetase I protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an argininosuccinate lyase protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an arginase protein.

[0183] In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding a protein associated with a lysosomal storage disorder. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an alpha-galactosidase protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding a glucocerebrosidase protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an iduronate-2-sulfatase protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an iduronidase protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding an N-acetyl-alpha-D-glucosaminidase protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding a heparan N-sulfatase protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding a galactosamine-6 ​​sulfatase protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding a beta-galactosidase protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding a lysosomal lipase protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding an arylsulfatase B (N-acetylgalactosamine-4-sulfatase) protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding transcription factor EB (TFEB).

[0184] In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding a protein associated with a glycogen storage disorder. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an acid alpha-glucosidase protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding a glucose-6-phosphatase (G6PC) protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding a liver glycogen phosphorylase protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding a muscle phosphoglycerate mutase protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding a glycogen debranching enzyme.

[0185] In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNAs encoding proteins related to amino acid metabolism. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNAs encoding phenylalanine hydroxylase enzymes. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNAs encoding glutaryl-CoA dehydrogenase enzymes. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNAs encoding propionyl-CoA carboxylase enzymes. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNAs encoding oxalase alanine-glyoxylaminotransferase enzymes.

[0186] In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding a protein related to lipid metabolism or fibrotic disorders. In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding an mTOR inhibitor. In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding an ATPase phospholipid transport 8B1 (ATP8B1) protein. In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding one or more NF-kappa B inhibitors, such as one or more of I-kappa B alpha, interferon-related developmental regulator 1 (IFRD1), and sirtuin 1 (SIRT1). In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding a PPAR-gamma protein or Methods are provided for producing dry powder compositions having full-length mRNA encoding active variants.

[0187] In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding a protein associated with methylmalonic acidemia. For example, in certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding a methylmalonyl-CoA mutase protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding a methylmalonyl-CoA epimerase protein.

[0188] In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA that can be delivered to the liver or for its treatment, providing the benefits of the dry powder. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding the ATP7B protein, also known as Wilson disease protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding the porphobilinogen deaminase enzyme. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding one or more coagulation enzymes, such as Factor VIII, Factor IX, Factor VII, and Factor X. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding the human hemochromatosis (HFE) protein.

[0189] In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for delivery to or use in treating the cardiovascular structures or cells of a subject. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding a vascular endothelial growth factor A protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding a relaxin protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding a bone morphogenetic protein-9 protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding a bone morphogenetic protein-2 receptor protein.

[0190] In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for delivery to or use in treating a subject's muscle or muscle cells. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding a dystrophin protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding a frataxin protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for delivery to or use in treating a subject's cardiac muscle or cardiac muscle cells. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding a protein that regulates one or both of potassium and sodium channels in muscle tissue or muscle cells. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding a protein that regulates Kv7.1 channels in muscle tissue or muscle cells. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding a protein that regulates Nav1.5 channels in muscle tissue or muscle cells.

[0191] In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding a peptide or polypeptide for delivery to or use in treating the nervous system or nervous system cells of a subject. For example, in certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding survival motor neuron 1 protein. For example, in certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding survival motor neuron 2 protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding frataxin protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding ATP-binding cassette subfamily D member 1 (ABCD1) protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding CLN3 protein.

[0192] In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for delivery to or use in the treatment of a subject's blood or bone marrow or blood or bone marrow cells. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding beta globin protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding Bruton's tyrosine kinase protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding one or more clotting enzymes, such as Factor VIII, Factor IX, Factor VII, and Factor X.

[0193] In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for delivery to or use in treating a subject's kidney or kidney cells. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding type IV collagen alpha 5 chain (COL4A5) protein.

[0194] In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for delivery to or use in treating a subject's eye or ocular cells. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding ATP-binding cassette subfamily A member 4 (ABCA4) protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding retinoschisin protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding retinal pigment epithelium-specific 65 kDa (RPE65) protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding 290 kDa centrosomal protein (CEP290).

[0195] In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for use in delivering or treating a vaccine for a subject or cells of a subject. For example, in certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding an antigen from an infectious agent, such as a virus. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding an antigen from influenza virus. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding an antigen from respiratory syncytial virus. In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding an antigen from rabies virus. In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding an antigen from cytomegalovirus. In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding an antigen from rotavirus. In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding an antigen from a hepatitis virus, such as hepatitis A virus, hepatitis B virus, or hepatitis C virus. In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding an antigen from human papillomavirus. In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding an antigen from a herpes simplex virus, such as herpes simplex virus type 1 or herpes simplex virus type 2. In certain embodiments, the present invention provides a method for producing a dry powder composition having a full-length mRNA encoding an antigen from a human immunodeficiency virus, such as human immunodeficiency virus type 1 or human immunodeficiency virus type 2. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an antigen from a human metapneumovirus. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an antigen from a human parainfluenza virus, such as human parainfluenza virus type 1, human parainfluenza virus type 2, or human parainfluenza virus type 3. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an antigen from a malaria virus. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an antigen from a Zika virus.In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding antigens from Chikungunya virus.

[0196] In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding an antigen associated with a subject's cancer or an antigen identified from the subject's cancer cells. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding an antigen determined from a subject's own cancer cells, i.e., for providing a personalized cancer vaccine. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding an antigen expressed from a mutant KRAS gene.

[0197] In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an antibody. In certain embodiments, the antibody may be a bispecific antibody. In certain embodiments, the antibody may be part of a fusion protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an antibody against OX40. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an antibody against VEGF. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an antibody against tissue necrosis factor alpha. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an antibody against CD3. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an antibody against CD19.

[0198] In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding an immunomodulator. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding interleukin-12. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding interleukin-23. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding interleukin-36 gamma. In certain embodiments, the present invention provides methods for producing dry powder compositions having full-length mRNA encoding one or more constitutively active variants of the stimulator of interferon genes (STING) protein.

[0199] In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an endonuclease. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding an RNA-guided DNA endonuclease protein, such as a Cas9 protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding a meganuclease protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding a transcription activator-like effector nuclease protein. In certain embodiments, the present invention provides methods for producing dry powder compositions having a full-length mRNA encoding a zinc finger nuclease protein.

[0200] The present invention can be used to treat a variety of other diseases, disorders, and conditions for which sustained release of mRNA formulations is required. Examples include diseases for which mRNA delivery to the gastrointestinal tract is useful. Such diseases include, but are not limited to, apolipoprotein E deficiency, inflammatory bowel disease, or Crohn's disease; adhesion G protein-coupled receptor VI deficiency; type 2 von Willebrand disease; nephrolithiasis, calcium oxalate-associated CAON; and maturity-onset diabetes of the young (MID-8).

[0201] The present invention can be used to treat a variety of other diseases, disorders, or conditions in which targeted delivery of mRNA formulations to tissues or organs may be beneficial, which may be tailored by the association of a polymer suitable for the purpose, with or without the association of a specific targeting moiety. [Example]

[0202] While certain compounds, compositions, and methods of the present invention have been specifically described in accordance with certain embodiments, the following examples serve merely to illustrate the invention and are not intended to be limiting thereof.

[0203] Example 1. mRNA-LNP dry powder formulation recovered from spray drying In this example, LNP-encapsulated mRNA formulations were prepared with and without polymer and spray-dried. The results show that LNP-encapsulated mRNA formulations prepared with polymers result in unexpectedly high recovery rates from the spray-drying process compared to the same mRNA-LNP formulations prepared without polymers.

[0204] In particular, two of the LNP-encapsulated mRNA formulations (mRNA encoding firefly luciferase (FFL), and formulations designated FFL-F1 and FFL-F2, respectively) were prepared without or with polymer, each with their respective compositions listed in Table 1. To prepare these formulations for spray drying, FFL mRNA was first mixed with lipid nanoparticles (LNPs) using a gear pump to encapsulate the mRNA within the LNPs. For the "with polymer" samples, the polymer solution was then mixed with the mRNA-LNPs using a gear pump. The solutions were then spray-dried as shown in the diagrammatic representation of the apparatus in Figure 1. The following conditions were used for spray drying: inlet temperature 90°C, 50°F, 100°C, 150°F, 200°C, 100°F, 200°C, 250°F, 300°C, 400°C, 500°C, 600°C, 800°C, 900°C, 1000°C, 1500°C, 1000°C, 1500°C, 2000°C, 2 ... 0°C, aspirator percentage 85%, pump percentage 25%, and outlet temperature 46-50°C. [Table 1]

[0205] result The spray-drying process for each LNP-mRNA formulation without polymer was unsuccessful. In each case, as described in Table 1 (bottom) and shown in Figure 2, material clumped in the spray dryer, clogging various compartments of the spray dryer and resulting in little or no material recovery. However, the same two LNP-mRNA formulations prepared with polymer were successfully spray-dried, yielding greater than 40% recovery of material from the spray-drying process, as described in Table 1 (bottom) and shown in Figure 2.

[0206] The effect of spray drying on encapsulation efficiency and nanoparticle size (Z-average) was measured before and after the spray-drying process, and the values ​​are shown in Table 1 (bottom). For LNP-mRNA formulations prepared with polymer, encapsulation efficiency was found to be unchanged in material before and after spray-drying, and nanoparticle size increased from before to after spray-drying. For LNP-mRNA formulations prepared without polymer, these measurements could not be determined due to the failure of the spray-drying process to produce any substantial material.

[0207] Example 2. Integrity and stability of mRNA dry powder formulations In this example, two mRNA formulations encoding argininosuccinate synthetase or ASS1 mRNA were prepared and evaluated for long-term stability. In particular, one mRNA formulation was prepared without LNPs but with a polymer (ASS1-F1). A second mRNA formulation was prepared that included a P+ polymer (ASS-F2). Each formulation is further described in Table 2.

[0208] For the ASS1-F1 formulation, mRNA was directly mixed with the polymer using a gear pump. For the ASS1-F2 formulation, to encapsulate mRNA within LNPs, mRNA was first mixed with lipid nanoparticles (LNPs) using a gear pump, and then the polymer solution was mixed with the mRNA-LNPs using a gear pump. The final formulations were concentrated, and mannitol was added to each formulation. The solutions were then spray-dried, as shown in the diagrammatic representation of the apparatus in Figure 1. The following conditions were used for spray drying: inlet temperature 90 °C, aspirator percentage 85%, pump percentage 25%, and outlet temperature 46-50 °C. [Table 2]

[0209] Encapsulation efficiency and nanoparticle size. The effect of spray drying on encapsulation efficiency was measured before and after drying. In this example, the encapsulation efficiency of LNP-encapsulated mRNA in the polymer-containing formulation was 75.28 ± 1.43 before the process and 81.85 ± 0.44 after, indicating that the spray drying process did not negatively affect encapsulation efficiency. The average nanoparticle size before and after spray drying was 99.4 ± 1.3 and 426 ± 12, respectively.

[0210] Integrity and stability of mRNA dry powder. LNP-encapsulated mRNA in a polymer-containing formulation. resulted in unexpectedly high integrity and stability of mRNA after spray drying, even when stored at refrigerated temperatures (4° C.) or frozen at −20° C. for various periods of time. The integrity and stability of the mRNA described below was assessed by spectrophotometric analysis, e.g., capillary electrophoresis (CE), and gel electrophoresis, e.g., Northern blot analysis.

[0211] Figures 3 and 4 serve as illustrative controls for analysis of mRNA integrity. In particular, Figure 3 shows intact mRNA assessed by CE (left panel) and gel electrophoresis (right panel). In the left panel, intact mRNA appears as a single spectrophotometric peak (shaded), while in the right panel, intact mRNA appears as a single band corresponding to the expected molecular size of the mRNA. The single peak and single band indicate intact mRNA and the absence of degradation products, respectively. Similarly, Figure 4 shows mRNA before spray drying and extracted from LNPs (i.e., extracted for the purposes of performing CE and gel electrophoresis analysis on the mRNA), confirming that extraction of mRNA from LNPs does not produce significant mRNA degradation products. Comparison of the CE peaks and gel bands in Figure 4 with those in Figure 3 indicates that the process used to extract mRNA from LNPs does not produce significant mRNA degradation products.

[0212] Aliquots of spray-dried ASS1-F1 or ASS1-F2 formulations were stored at either 4°C or -20°C, and samples were removed and reconstituted at various time points to assess mRNA integrity by CE and gel electrophoresis. Specifically, the mRNA integrity of dry powder ASS1 mRNA-LNPs formulated with polymer (ASS1-F2) was assessed at 2 and 4 weeks after spray drying and storage at either 4°C or -20°C, and the mRNA integrity of dry powder ASS1 mRNA (no LNPs) formulated with polymer (ASS1-F1) was assessed at 3 and 5 weeks after spray drying and storage at either 4°C or -20°C.

[0213] Figures 5 and 6 show the mRNA integrity of dry powder ASS1 mRNA-LNPs formulated with a polymer (ASS1-F2) and stored at 4°C or -20°C for two weeks, respectively. Figures 5 and 6 each show a single CE peak (left panel) and a single gel band (right panel), indicating that the ASS1 mRNA remains intact at both temperatures. Figure 7 further shows the superposition of the two peaks of ASS1 mRNA (from Figures 5 and 6), indicating that the mRNA remains intact regardless of storage temperature. These data demonstrate that spray-dried formulations of mRNA-lipid nanoparticles containing polymers remain stable for at least two weeks over a range of storage temperatures, such as at or up to about -20°C, or at or up to about 4°C.

[0214] Figures 8 and 9 show the mRNA integrity of dry powder ASS1 mRNA-LNPs formulated with a polymer (ASS1-F2) and stored at 4°C or -20°C for 4 weeks, respectively. Both Figures 8 and 9 show a single CE peak (left panel) and a single gel band (right panel), indicating that ASS1 mRNA remains intact at both temperature conditions. These data demonstrate that spray-dried formulations of mRNA-lipid nanoparticles containing polymers remain stable for at least 4 weeks over a wide range of storage temperatures, for example, at or up to about -20°C, or at or up to about 4°C.

[0215] Figures 10 and 11 show the mRNA content of dry powder ASS1 mRNA (without LNP) formulated with polymer (ASS1-F1) and stored at 4°C or -20°C for 3 weeks, respectively. As shown in Figures 10 and 11, ASS1-F1 mRNA remained intact without degradation at both temperature conditions. Figure 12 shows an overlay of the CE peaks of ASS1 mRNA (from Figures 10 and 11), with the perfect alignment of the CE peaks indicating the absence of mRNA degradation. This indicates that spray-dried formulations of mRNA with polymer (without LNP encapsulation) remain stable for at least 3 weeks over a wide range of storage temperatures, for example, at or up to about -20°C, or at or up to about 4°C.

[0216] Figures 13 and 14 show the mRNA integrity of dry powder ASS1 mRNA (without LNP) formulated with polymer (ASS1-F1) and stored at 4°C or -20°C for 5 weeks, respectively. As shown in Figures 13 and 14, ASS1-F1 mRNA remained intact without degradation at both temperature conditions. This indicates that spray-dried formulations of mRNA with polymer (without LNP encapsulation) remain stable for at least 5 weeks over a wide range of storage temperatures, for example, at or up to about -20°C, or at or up to about 4°C.

[0217] Surprisingly, for both the dry powder ASS1 mRNA-LNPs formulated with polymer (ASS1-F2) and the dry powder ASS1 mRNA (no LNPs) formulated with polymer (ASS1-F1), the integrity of the mRNA was maintained for extended periods at elevated storage temperatures, e.g., refrigerated storage (approximately 4°C).

[0218] Example 3. One-step method for mRNA encapsulation in lipid-polymer nanoparticles In this example, lipids, mRNA, and polymers were prepared in a single step to produce lipid-polymer-encapsulated mRNA nanoparticles (polymer-containing formulations ASS1-F3 and ASS1-F4). This contrasts with Examples 1 and 2, in which LNP-encapsulated mRNA nanoparticles were prepared first, and then polymer was added to the formulation. Additionally, reference formulations were prepared by the same process but did not include polymer in the nanoparticles or formulation (polymer-free formulations ASS1-F3 and ASS1-F4).

[0219] Specifically, lipids and polymers (or simple lipids in control formulations) were dissolved in ethanol and mixed with the mRNA solution using a gear pump. Four different formulations were prepared. The first and second formulations (ASS1-F3 without polymer and ASS1-F3 with polymer) were prepared with cKK-E12 as the cationic lipid, either with or without polymer. The third and fourth formulations (ASS1-F4 without polymer and ASS1-F4 with polymer) were prepared with ICE (imidazole cholesterol ester) as the cationic lipid, either with or without polymer. ASS1-F3 with polymer and ASS1-F4 with polymer contained Eudragit as the polymer. All four formulations contained nanoparticle-encapsulated mRNA encoding ASS1. Each formulation was concentrated and mannitol was added. All formulations are further described in Table 3. Each formulation was spray-dried using the conditions described in Example 1. [Table 3]

[0220] result The spray drying process for the formulations without polymer (ASS1-F3 without polymer and ASS-F4 without polymer) was unsuccessful. In both cases, material clumped in the spray dryer, clogging various sections of the spray dryer, resulting in little or no material recovery, as shown in Table 3 (bottom), which shows a 1±2% recovery for each formulation without polymer. However, these same two formulations prepared with polymer in nanoparticles (ASS1-F3 with polymer and ASS-F4 with polymer) were successfully spray dried, yielding greater than 35% and nearly 40% recovery of material from the spray drying process, respectively, as shown in Table 3.

[0221] The effect of spray drying on the encapsulation efficiency and nanoparticle size (Z-average) for formulations prepared with polymer in nanoparticles was measured before and after the spray drying process and the values ​​are shown in Table 3 (bottom). For each lipid-polymer-mRNA nanoparticle, the encapsulation efficiency did not change significantly before or after spray drying, and the nanoparticle size was found to increase from before to after spray drying. For formulations prepared without polymer, these measurements could not be determined due to the failure of the spray drying process to produce any substantial material.

[0222] These results demonstrate, inter alia, that the addition of a polymer to lipid nanoparticles encapsulating mRNA allows the mRNA-encapsulated lipid nanoparticles to be successfully spray-dried, in contrast to the same lipid nanoparticles without mRNA, which were not successfully spray-dried.

[0223] Example 4. One-step method for mRNA encapsulation in lipid-polymer nanoparticles In this example, the polymer PLGA was mixed with lipids and mRNA in a single step to produce lipid-PLGA encapsulated mRNA nanoparticles.

[0224] Specifically, lipids and PLGA (or just lipids in control formulations) were dissolved in a 1:2 mixture of ethanol and acetonitrile and mixed with the ASS1 mRNA solution using a gear pump. The final formulation was concentrated in 5% mannitol and then spray-dried. The following conditions were used for spray-drying: inlet temperature 90 °C, aspirator percentage 85%, pump percentage 25%, and outlet temperature 46-50 °C. The formulations are further described in Table 4. [Table 4]

[0225] result The spray drying process of the formulation prepared with PLGA polymer in nanoparticles resulted in successful spray drying and recovery of material from the spray drying process.

[0226] Example 5. In vivo delivery of spray-dried mRNA formulations In this example, a spray-dried formulation, FFL-F1 containing a polymer (described in Example 1), was administered to mice both as a dry powder and dissolved in a liquid, and mRNA expression in the administered formulation was detected by both approaches.

[0227] In particular, in one approach, a dry powder formulation of polymer-containing FFL-F1 was administered to mice at a dose of 1 mg using a dry powder insufflation device, model DP-4M. 24 hours after dry powder administration, the FFL substrate luciferin was administered using a microspray, and in vivo luciferase expression was detected by a bioluminescence assay. The results are shown in Figure 15A.

[0228] In the second approach, polymer-containing FFL-F1 was dissolved in water at a concentration of 20 mg / ml and administered via microspray at a volume of 50 microliters per mouse for a 1 mg dose. Twenty-four hours after administration, the FFL substrate luciferin was administered via microspray, and in vivo luciferase expression was detected by a bioluminescence assay. The results are shown in Figure 15B.

[0229] These results demonstrate that mRNA encapsulated within LNPs in a polymer-containing formulation maintains activity after spray drying. These results also demonstrate that spray-dried LNP-encapsulated mRNA can be administered directly as a dry powder to provide protein expression in vivo.

[0230] Example 6. CFTR mRNA Lipid-Polymer Nanoparticle Dry Powder Formulation In this example, the cystic fibrosis conductance regulator protein (CFTR), or mRNA encoding CFTR mRNA, was successfully encapsulated within lipid-polymer nanoparticles and spray-dried into a stable dry powder.

[0231] Specifically, to prepare lipid-polymer nanoparticles encapsulating CFTR-mRNA, the PEG-modified lipids, cationic lipids, and polymers listed in Table 5 below were dissolved in 150 mL of ethanol and mixed with CFTR-mRNA (0.05 g in 600 mL of 1 mM citrate buffer, pH 4.5, 1 mM sodium chloride, 150 mM sodium chloride) using a gear pump. Next, 37.5 g of mannitol was dissolved at 5% weight / volume, and the resulting 750 mL of CFTR-mRNA solution (20% ethanol) was encapsulated within the lipid-polymer nanoparticles. The resulting mixture was then spray-dried in a Buchi spray dryer using the following spray drying conditions: 90 °C inlet temperature, 90% aspirator ratio, 25% pump ratio, and 46-50 °C outlet temperature. [Table 5]

[0232] To quantitatively determine the integrity of CFTR mRNA in the lipid-polymer nanoparticles after spray drying, CFTR mRNA was precipitated from the nanoparticles by mixing and dissolving the nanoparticles in ethanol with an RNA precipitation buffer containing guanidine thiocyanate, N-lauroylsarcosine, and sodium citrate, pH 6.5. The precipitated mRNA was further isolated and purified using an RNeasy silica membrane (Qiagen) and then redissolved in RNAse-free water. The purified mRNA was evaluated by capillary electrophoresis using a Fragment Analyzer (Agilent) according to the manufacturer's published instructions. Briefly, appropriate volumes of intercalating dye and RNA separation gel were mixed and loaded into the instrument. The capillary conditioning buffer was diluted to the required concentration and loaded onto the conditioning fluid line. Inlet buffer, rinse buffer, and storage buffer were added to the well plate. The samples were added to the designated location. Extracted and control mRNA were diluted to 150 ng / μL using formamide loading buffer and then denatured by heating to 70°C for 5 minutes and immediately cooling. Samples were further diluted using dilution markers according to the manufacturer's instructions and run on a fragment analyzer using the relevant separation method.

[0233] As described in the examples above, LNP-mRNA formulations without additional polymers in the formulation were unable to be successfully spray-dried. In particular, the LNP-mRNA material aggregated in the spray dryer, clogging various compartments of the spray dryer, resulting in little or no recovery of LNP-mRNA material. As the examples above demonstrate, this failure of successfully spray-dried LNP-mRNA materials can be overcome by adding a polymer to the LNP formulation, either by including a polymer in the lipids so that it is present during the nanoparticle-making and mRNA-encapsulation steps, or alternatively, by adding the polymer to the formulation after the lipid nanoparticle-making and mRNA-encapsulation steps. Here, CFTR-mRNA encapsulated within lipid nanoparticles was successfully spray-dried with the addition of a polymer, specifically a Eudragit polymer. Specifically, a Eudragit polymer was included in the lipid mixture prior to the nanoparticle-making and mRNA-encapsulation steps, resulting in lipid-polymer nanoparticle-encapsulated CFTR-mRNA. Successfully spray-dried CFTR-mRNA lipid-polymer nanoparticles were also evaluated for integrity using capillary electrophoresis (CE) analysis. Figures 16A1-A6 show exemplary CE chromatograms of the CFTR-mRNA peak integrity before and after spray drying, demonstrating that the integrity of the CFTR-mRNA remains intact after spray drying in the lipid-polymer. Figures 16A1-A3 show control CFTR mRNA that was not spray-dried or encapsulated, while Figures 16A4-A6 show CFTR mRNA extracted from the spray-dried formulation.

Claims

1. 1. A dry powder formulation for delivering messenger RNA (mRNA) comprising a plurality of spray-dried particles, each particle comprising: Lipid nanoparticles (LNPs) encapsulating one or more mRNAs, each mRNA encoding a protein or peptide; and comprising one or more polymers, wherein each LNP comprises one or more lipids; and the one or more polymers are selected from the group consisting of chitosan, polylactic acid (PLA), poly(lactic-co-glycolic acid) (PLGA), poly(q-caprolactone) (PCL), polyamidoamine, polyester, polycarbonate, poly(hydroxyalkyl L-asparagine), poly(hydroxyalkyl L-glutamine), poly(2-alkyloxazoline)acrylate, modified acrylate and polymethacrylate based polymers, poly-N-(2-hydroxypropyl)methacrylamide, poly-2-(methacryloyloxy)ethylphosphorylcholine, and poly(dimethylaminoethylmethylacrylate) (pDMAEMA); The dry powder formulation.

2. 10. The dry powder formulation of claim 1, the one or more polymers are present in one or more LNPs encapsulating the one or more mRNAs; the one or more mRNAs have greater than or equal to 90% integrity; or The one or more mRNAs maintain 90% or more integrity when stored at or below room temperature for 6 months or more. The dry powder formulation.

3. A dry powder formulation as described in claim 1, wherein at least 20% of the plurality of spray-dried particles are fine particles having a volume median diameter of less than 5 μm.

4. 10. The dry powder formulation of claim 1, the one or more polymers constitute at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the combined weight of the lipid and polymer; the one or more polymers constitute about 10-90%, 10-80%, 10-70%, 10-60%, 10-50%, 10-40%, 10-30%, 10-20%, 15-20%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, or 15-90% of the combined weight of the lipid and polymer; or the one or more polymers constitute no more than 90%, 80%, 70%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, or 20% of the combined weight of the lipid and polymer; The dry powder formulation.

5. 10. The dry powder formulation of claim 1, wherein the one or more polymers comprises a polymethacrylate-based polymer.

6. 10. The dry powder formulation of claim 1, wherein the one or more polymers comprises PLGA.

7. 10. The dry powder formulation of claim 1, wherein the one or more lipids comprise a cationic lipid.

8. A dry powder formulation as described in claim 7, wherein the cationic lipid constitutes approximately 25 to 50% by mole of the total lipids in the LNP.

9. 8. The dry powder formulation of claim 7, wherein the cationic lipid is selected from the group consisting of C12-200, DOTAP (1,2-dioleyl-3-trimethyammonium propane), DODAP (1,2-dioleyl-3-dimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA, DLin-KC2-DMA, HGT4003, cKK-E12, OF-02, ICE (imidazole cholesterol ester), and combinations thereof.

10. 10. The dry powder formulation of claim 9, wherein the cationic lipid is cKK-E12, ICE, or OF-02.

11. 10. The dry powder formulation of claim 1, wherein the one or more lipids comprise a PEG-modified lipid.

12. A dry powder formulation as described in claim 11, wherein the PEG-modified lipid constitutes approximately 1 to 15% by mole of the total lipid in the LNP.

13. 10. The dry powder formulation of claim 1, wherein the one or more lipids comprise a neutral lipid or a cholesterol-based lipid.

14. 10. The dry powder formulation of claim 1, further comprising at least one sugar selected from the group consisting of monosaccharides, disaccharides, polysaccharides, glucose, fructose, galactose, mannose, sorbose, lactose, sucrose, cellobiose, trehalose, raffinose, starch, dextran, maltodextrin, cyclodextrin, inulin, xylitol, sorbitol, lactitol, and mannitol.

15. 10. The dry powder formulation of claim 1, further comprising a pharmaceutically acceptable excipient selected from the group consisting of esters, urethanes, phosphoesters, phosphazenes, amino acids, collagen, chitosan, polysaccharides, albumin, surfactants, buffers, salts, and combinations thereof.

16. 16. The dry powder formulation of claim 15, wherein the surfactant is selected from the group consisting of CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate), phospholipids, phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, octaethylene glycol monododecyl ether, pentaethylene glycol monododecyl ether, Triton X-100, cocamide monoethanolamine, cocamide diethanolamine, glycerol monostearate, glycerol monolaurate, sorbitan monoonolaureate, sorbitan monostearate, Tween 20, Tween 40, Tween 60, Tween 80, alkyl polyglucosides, and poloxamers.

17. 17. The dry powder formulation of any one of claims 1 to 16 for use in a method for delivering mRNA for in vivo expression, the method comprising: reconstituting the dry powder formulation into a reconstituted liquid solution; and administering the reconstituted liquid solution to a subject in need thereof; The dry powder formulation comprising:

18. 18. The dry powder formulation of claim 17, wherein the subject has cystic fibrosis.

19. 19. The dry powder formulation of claim 18, wherein the protein encoded by the mRNA is CFTR.

20. 18. The dry powder formulation of claim 17, wherein the protein encoded by the mRNA is OTC.

21. The dry powder formulation of any one of claims 1 to 16 for treating a disease or disorder in a patient.

22. 22. The dry powder formulation of claim 21, wherein the disease or disorder is selected from cystic fibrosis; asthma; COPD; emphysema; primary ciliary dyskinesia with or without situs inversus (CILD1) or Kartagener syndrome; pulmonary fibrosis; Birt-Hogg-Dube syndrome; hereditary hemorrhagic telangiectasia; alpha-1 antitrypsin deficiency; cytochrome b positive granulomatous disease (CGD, X-lined); cytochrome b positive granulomatous disease, autosomal recessive; surfactant deficiency, pulmonary surfactant metabolism type 1, pulmonary surfactant metabolism type 2, pulmonary surfactant metabolism type 3; respiratory distress syndrome of prematurity; pulmonary viral diseases including tuberculosis, influenza, and respiratory syncytial virus (RSV).

23. 1. A method for producing a dry powder formulation, the method comprising: providing a mixture comprising one or more messenger RNAs (mRNAs), one or more lipids, and a polymer; and spray drying the mixture to form a plurality of spray-dried particles; Including, wherein each spray-dried particle comprises one or more nanoparticles encapsulating one or more mRNAs; each nanoparticle comprises one or more lipids; and the polymer is selected from the group consisting of chitosan, poly(lactic acid) (PLA), poly(lactic-co-glycolic acid) (PLGA), poly(q-caprolactone) (PCL), polyamidoamine, polyester, polycarbonate, poly(hydroxyalkyl L-asparagine), poly(hydroxyalkyl L-glutamine), poly(2-alkyloxazoline)acrylate, modified acrylate and polymethacrylate based polymers, poly-N-(2-hydroxyl-propyl)methacrylamide, poly-2-(methacryloyloxy)ethylphosphorylcholine, and poly(dimethylaminoethylmethylacrylate) (pDMAEMA); The method.

Images