A method for predicting skin conditions using skin flora analysis
The method predicts TEWL using Malassezia fungi abundance ratios, addressing the lack of fungal flora analysis in existing methods, enabling accurate skin condition evaluation and improved skincare product development.
Patent Information
- Application Number
- JP2021179080
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2021-11-01
- Publication Date
- 2026-01-07
- Estimated Expiration
- 2041-11-01
AI Technical Summary
Existing methods for predicting skin conditions rely solely on bacterial flora analysis and lack sensitivity and quantitativeness, with no effective methods for evaluating skin conditions using fungal flora.
A method using the abundance ratio or difference in abundance ratio of specific Malassezia fungi in the fungal flora as an index to predict transepidermal water loss (TEWL), involving metagenomic analysis and regression equation-based prediction.
Enables simple, rapid, and accurate prediction of TEWL, allowing for the development of cosmetics and skincare products that improve skin conditions by maintaining a healthy skin flora balance.
Smart Images

Figure 0007795167000002 
Figure 0007795167000003 
Figure 0007795167000004
Abstract
Description
[Technical Field]
[0001] The present invention relates to a method for predicting transepidermal water loss (TEWL) using as an index the abundance ratio or difference in abundance ratio of a specific fungus in the normal skin fungal flora. [Background technology]
[0002] A variety of microorganisms known as resident skin flora inhabit human skin. Representative bacteria include the genera Cutibacterium and Staphylococcus, and representative fungi include the genus Malassezia (Non-Patent Document 1). However, the species and proportions of bacteria that make up the resident skin flora are thought to vary depending on various factors, such as skin condition, external stimuli, and individual differences.
[0003] Resident skin bacteria have various effects on skin function. For example, they have been reported to improve the skin's barrier function, preventing the invasion of pathogenic bacteria (Non-Patent Document 2), to moisturize the skin with Staphylococcus epidermidis (Non-Patent Document 3), and to produce ceramide with Staphylococcus thermophilus (Non-Patent Document 4). Furthermore, Cutibacterium acnes produces propionic acid and lactic acid to maintain a slightly acidic skin and prevent the proliferation of pathogenic bacteria (Non-Patent Document 5). On the other hand, because Cutibacterium acnes can also cause acne, an appropriate abundance ratio is considered desirable. Staphylococcus aureus and Corynebacterium bacteria are known to exacerbate the symptoms of atopic dermatitis (Non-Patent Document 6). Fungi of the genus Malassezia cause skin diseases such as Malassezia folliculitis, seborrheic dermatitis, and tinea versicolor (Non-Patent Document 7). Therefore, maintaining a healthy resident skin flora is important for maintaining healthy skin.
[0004] In recent years, agents for maintaining a good balance of normal skin flora have been reported. For example, Patent Document 1 describes that American oil palm fruit oil improves the balance of Propionibacterium acnes and reduces the genus Corynebacterium in users with a Simpson index of less than 0.7, thereby improving brown spots, skin texture, and wrinkles. Furthermore, Patent Document 2 reports that Korean ginseng extract and / or Chinese tangerine extract have the effect of promoting the bacterial count of Staphylococcus hominis and suppressing the bacterial count of Staphylococcus aureus, thereby alleviating the symptoms of atopic dermatitis and preventing or improving an increase in the number of pores, an increase in melanin, and an increase in the number of wrinkles.
[0005] Meanwhile, methods for predicting skin conditions using analysis of resident skin flora have been reported. For example, Patent Document 3 describes a method for predicting skin texture and wrinkles by analyzing all bacterial species that constitute the skin flora and their abundance ratios, and using the abundance ratio of the genus Corynebacterium among them as an index. Furthermore, Patent Document 4 reports that the amount of environmentally derived bacteria contained in the resident skin flora can be used to diagnose transepidermal water loss (TEWL), skin brightness, elasticity, age spots, keratinocyte moisture content, yellowness, unevenness, number of pores, erythema index, texture, sebum amount, number of wrinkles, melanin index, and bacterial diversity.
[0006] However, the above-mentioned prior art methods do not necessarily enable sensitive and quantitative evaluation of skin conditions. Furthermore, all of the methods rely on bacterial flora analysis, and there has been no method to predict skin conditions using fungal flora. [Prior art documents] [Patent documents]
[0007] [Patent Document 1] Japanese Patent Application Publication No. 2019-65004 [Patent Document 2] Patent Publication No. 2021-1160 [Patent Document 3] Japanese Patent Application Publication No. 2019-62887 [Patent Document 4] Japanese Patent Application Publication No. 2019-216652 [Non-patent literature]
[0008] [Non-Patent Document 1] J Dermatol, Vol.37, PP.786-792, 2010 [Non-patent document 2] Journal of the Japanese Dermatological Association, Vol. 115, pp. 977-984, 2005 [Non-patent document 3] J Dermatol Sci, Vol.79, PP.119-126, 2015 [Non-patent document 4] J Invest Dermatol, Vol.113, PP.98-106, 1999 [Non-patent document 5] Nature rev Microbiol, Vol.9, PP.244-253, 2011 [Non-patent document 6] Immunity, Vol.42, PP.756-766, 2015 [Non-Patent Document 7] Journal of Mycology, vol.47, PP.75-80, 2006 Summary of the Invention [Problem to be solved by the invention]
[0009] An object of the present invention is to identify bacteria that are highly correlated with skin condition from bacteria that constitute the normal skin flora, and to provide a method for predicting skin condition based on the abundance ratio of those bacteria. [Means for solving the problem]
[0010] The present inventors conducted metagenomic analysis using a next-generation sequencer to analyze the abundance ratios of bacteria and fungi that make up the resident skin flora of multiple subjects, and performed a correlation analysis of data on skin parameters measured using various measuring devices. As a result, they discovered a correlation between the abundance ratio or difference in abundance ratios of specific Malassezia fungi in the fungal flora of the resident skin flora and transepidermal water loss (TEWL), an index of skin roughness, and completed the present invention.
[0011] That is, the present invention includes the following inventions. [1] A method for predicting transepidermal water loss (TEWL), characterized by using the abundance ratio or difference in abundance ratio of fungi of the genus Malassezia in the normal skin fungal flora as an indicator. [2] A method for predicting transepidermal water loss (TEWL), comprising the steps of: (1) A step of creating a regression equation based on the correlation between the abundance ratio or the difference in abundance ratio of fungi of the genus Malassezia in the normal skin fungal flora and transepidermal water loss (TEWL). (2) A step of analyzing the abundance ratio or difference in abundance ratio of fungi of the genus Malassezia in the normal skin fungal flora of the subject. (3) Applying the analysis value of the abundance ratio or difference in abundance ratio of fungi of the genus Malassezia in the normal skin fungal flora of the subject obtained in the analysis of step (2) to the regression equation created in step (1) to obtain a predicted value of the transepidermal water loss (TEWL) of the subject. [3] The method described in [2], further comprising a step of comparing the predicted value with a predetermined standard score for transepidermal water loss (TEWL) to determine the subject's transepidermal water loss (TEWL) score. [4] The method according to any one of [1] to [3], wherein the fungus of the genus Malassezia is one or two species selected from Malassezia restricta and Malassezia sympodialis. [5] A beauty advice method that provides advice to improve skin condition using a predicted value of a subject's transepidermal water loss (TEWL) obtained by the method described in [2] or a transepidermal water loss (TEWL) score obtained by the method described in [3]. [Effects of the Invention]
[0012] The method of the present invention allows for simple, rapid, and accurate prediction of a subject's transepidermal water loss (TEWL). Therefore, the present invention makes it possible to explain the effects of cosmetic ingredients, cosmetic preparations, topical skin preparations, etc. on the skin in relation to their effects on the resident skin flora. Furthermore, the method of the present invention makes it possible to develop cosmetics, topical skin preparations, and active ingredients that improve the resident skin flora and improve rough skin (by suppressing transepidermal water loss). [Brief explanation of the drawings]
[0013] [Figure 1] This is a graph showing the relationship between transepidermal water loss (TEWL) in the anterior chest and the abundance (%) of Malassezia restricta in the normal skin fungal flora. [Figure 2] This is a graph showing the relationship between transepidermal water loss (TEWL) in the anterior chest and the abundance (%) of Malassezia sympodialis in the normal skin fungal flora. [Figure 3] This figure shows the relationship between transepidermal water loss (TEWL) in the anterior chest and the difference in the abundance ratio (%) of Malassezia restricta and Malassezia sympodialis in the normal skin fungal flora. DETAILED DESCRIPTION OF THE INVENTION
[0014] The method for predicting transepidermal water loss (TEWL) of the present invention is characterized in that it uses as an index the abundance ratio or difference in abundance ratio of fungi of the genus Malassezia in the normal skin fungal flora.
[0015] The fungi of the genus Malassezia belong to the phylum Basidiomycota, class Exobasidiomycetes, order Malasseziales, and family Malasseziaceae, and are lipid-requiring. With the recent development of genetic analysis methods, research into the classification of fungal species in the genus Malassezia has progressed rapidly since around 2000, and the genus is now comprised of 14 species. Of these, nine species, namely, Malassezia dermatis, Malassezia furfur, Malassezia globosa, Malassezia japonica, Malassezia obtusa, Malassezia restricta, Malassezia slooffiae, Malassezia sympodialis, and Malassezia yamatoensis, are derived from human skin, and Malassezia restricta and Malassezia sympodialis are preferred as fungi of the genus Malassezia used as indicators in the method of the present invention. The number of species of Malassezia restricta and Malassezia sympodialis may be one or two.
[0016] In the method of the present invention, the "abundance ratio" refers to the proportion of at least one fungus species of the genus Malassezia in the normal skin fungal flora, and the "difference in abundance ratio" refers to the difference in the above proportion between two different fungi species of the genus Malassezia.
[0017] "Trans-Epidermal Water Loss (TEWL)" refers to the amount of water that evaporates unconsciously from the body through the stratum corneum, and is also called transepidermal water loss, insensible perspiration, or insensible perspiration. Trans-epidermal water loss (hereinafter simply referred to as "TEWL") is calculated per unit area (m 2 ) per unit time (h), that is, g / (m 2 TEWL is expressed as ≈h. TEWL is used as an index that reflects the barrier function, one of the important functions of the skin. A typical example is the observed increase in TEWL when the skin becomes rough, and generally, the moisture content of the stratum corneum and TEWL are inversely proportional.
[0018] As shown in the Examples below, there is a positive correlation between the abundance ratio (%) of Malassezia restricta in the normal skin fungal flora and TEWL (Figure 1), a negative correlation between Malassezia sympodialis and TEWL (Figure 2), and a positive correlation between the difference between the abundance ratio (%) of Malassezia restricta and the abundance ratio (%) of Malassezia sympodialis and TEWL (Figure 3). Therefore, the higher the percentage of Malassezia restricta present in a person, or the greater the difference between the percentage of Malassezia restricta present in a person and the percentage of Malassezia sympodialis present in a person, the higher the TEWL. Therefore, the percentage of Malassezia restricta present in a person's normal skin fungal flora, or the difference between the percentage of Malassezia restricta present in a person and the percentage of Malassezia sympodialis present in a person, can be used as an index to easily measure the TEWL. small numberConversely, the lower the proportion (%) of Malassezia sympodialis present in a person, the higher the TEWL. Therefore, the proportion (%) of Malassezia sympodialis present in the normal skin fungal flora can be used as an index to easily evaluate the TEWL. small number can be evaluated.
[0019] One embodiment of the method for predicting transepidermal water loss (TEWL) of the present invention includes: (1) creating a regression equation based on the correlation between the analytical value of the abundance ratio or difference in abundance ratio of fungi of the genus Malassezia in resident skin fungal flora and transepidermal water loss (TEWL); (2) analyzing the abundance ratio or difference in abundance ratio of fungi of the genus Malassezia in the resident skin fungal flora of a subject; and (3) applying the analytical value of the abundance ratio or difference in abundance ratio of fungi of the genus Malassezia in the resident skin fungal flora of the subject obtained in the analysis of step (2) to the regression equation created in step (1) to obtain a predicted value of transepidermal water loss (TEWL) of the subject.
[0020] In the method of the present invention, the number of subjects (hereinafter sometimes referred to as "reference subjects") in the sample population used to create the regression equation in step (1) is preferably as large as possible. While not particularly limited, the number is preferably at least 50 or more, and more preferably 100 or more. The age and sex of the reference subjects are not particularly limited, but the age distribution of the reference subjects is preferably similar across age groups. It is also preferable to create a database recording information on the abundance ratio or difference in abundance ratio of fungi of the genus Malassezia in the resident skin fungal flora of the reference subjects, as well as TEWL. This database may be updated by adding newly acquired analytical values for the abundance ratio or difference in abundance ratio of fungi of the genus Malassezia in the resident skin fungal flora of each subject, and predicted TEWL values.
[0021] In order to analyze the abundance ratio or difference in abundance ratio of fungi of the genus Malassezia in the normal skin fungal flora of a sample group, a sample containing normal skin fungal flora is collected from a reference subject. The skin from which the sample is collected can be any skin on the whole body of a human, but the skin from the seborrheic areas of the face (forehead, cheeks, chin, nose, etc.) and trunk (anterior chest, back, etc.) is preferred, and the skin from the anterior chest and back is more preferred.
[0022] Methods for collecting samples from the skin surface include swabbing with a cotton swab, scrubbing, tape stripping, and biopsy. The swabbing, scrubbing, and tape stripping methods are preferred because they are non-invasive. The collection solution used in the swabbing and scrubbing methods is distilled water, saline, or phosphate buffer containing surfactants such as polysorbate 80, polysorbate 20, or Triton X-100. Various commercially available adhesive tapes, including cellophane tape, can be used for tape stripping.
[0023] Methods for analyzing collected samples include culture, PCR, real-time PCR, quantitative reverse transcription-PCR (RT-PCR), and metagenomic analysis using next-generation sequencers (NGS). However, because Malassezia fungi are difficult to culture, non-culture methods such as PCR, real-time PCR, quantitative RT-PCR, or metagenomic analysis using NGS are preferred, with metagenomic analysis using NGS being even more preferred. Using NGS makes it possible to simultaneously analyze all fungal species that make up the normal skin fungal flora and their abundance ratios.
[0024] DNA can be extracted from collected samples using any nucleic acid extraction method known to those skilled in the art, such as phenol extraction, cetyltrimethylammonium bromide (CTAB) extraction, and alkaline SDS extraction. These methods may be modified as needed, or various DNA extraction kits available from reagent manufacturers may be used. Depending on the type of sample, filtration through a membrane filter or homogenization may be performed. Various DNA extraction kits available from reagent manufacturers, such as the DNeasy Plant mini Kit (Qiagen Inc.), may also be used. DNA extracted by these methods is preferably kept in a state suitable for use as a PCR template, for example, by dissolving it in an appropriate buffer and storing it at low temperature. After DNA extraction, purification procedures such as chloroform / isoamyl alcohol treatment, isopropanol precipitation, deproteinization with phenol / chloroform, and ethanol precipitation may be performed.
[0025] When performing metagenomic analysis using NGS, any gene region can be targeted, but it is preferable to use ribosomal gene regions. Examples of ribosomal gene regions include the 18S rRNA region, 28S rRNA region, 5.8S rRNA region, and the spacer region (internal transcribed spacer region: ITS region) before and after the 5.8S rRNA region. The ITS region is divided into ITS-1, located upstream of the 5.8S rRNA region, and ITS-2, located downstream.
[0026] TEWL can be measured using known methods, including open and closed systems. In the open system, a hollow cylindrical probe designed to have two humidity sensors positioned at regular intervals on the skin surface is applied to the skin, moisture content is measured at two points, and TEWL is calculated from the moisture concentration gradient on the skin surface using Fick's law. In the closed system, a sealed probe is applied to the skin surface, dry air or nitrogen gas is circulated over the skin surface within the probe, and TEWL is calculated from the moisture content of the collected gas. There is also a closed system method that does not require gas circulating; in this case, the moisture content within the sealed probe is continuously measured, and TEWL is estimated from the rate of increase.
[0027] The regression equation can be determined by linear regression analysis from the analytical values of the abundance ratio or difference in abundance ratio of fungi of the genus Malassezia in the normal skin fungal flora obtained from the above-mentioned sample population and the measured TEWL. Note that once the regression equation is created, it can be used by storing the regression equation in a computing device that predicts the TEWL of the subject.
[0028] In the method of the present invention, the subject in step (2) is any subject for whom TEWL is to be predicted, such as a customer of an aesthetic salon or a cosmetics retailer. The abundance ratio or difference in abundance ratio of fungi of the genus Malassezia in the normal skin fungal flora can be analyzed according to the method described above. While the method for collecting samples from the subject to be analyzed can also be the same as the method described above, it is preferable to collect samples from the skin of the face, such as the forehead or cheek, by wiping with a cotton swab (swab method) from the viewpoint of ease and minimal invasiveness.
[0029] In step (3), the predicted value of the TEWL of the subject is determined by applying the analytical value of the abundance ratio or difference in abundance ratio of fungi of the genus Malassezia in the subject's normal skin fungal flora to a pre-created regression equation.
[0030] The predicted TEWL value of the subject may be compared with a predetermined TEWL standard score to determine the TEWL score of the subject. The TEWL standard score may be set, for example, by classifying the TEWL of the reference subject into three categories (high, medium, and low), with a score of 3 points for a case in which the TEWL is classified into the high category, a score of 2 points for a case in which the TEWL is classified into the medium category, and a score of 1 point for a case in which the TEWL is classified into the low category. The TEWL standard score may also be associated with skin condition. Here, "skin condition" refers to a skin condition related to the barrier function of the stratum corneum, as reflected in TEWL, and includes, for example, stratum corneum moisture content (moisture), rough skin, inflammation, firmness, wrinkles, sagging, skin texture, etc. As an example of a standard score for TEWL related to skin condition, a score of 3 indicates high stratum corneum moisture content, moisturized, no rough skin, and good skin condition; a score of 2 indicates medium stratum corneum moisture content, some moisture and rough skin, and medium skin condition; and a score of 1 indicates low stratum corneum moisture content, insufficient moisture, rough skin, and poor skin condition.
[0031] The present invention also provides a beauty advice method that uses at least one of the predicted TEWL value or TEWL score of a subject obtained as described above to give advice to improve skin condition. For example, the advice may involve a beauty consultant or the like providing cosmetics or skin care methods to improve stratum corneum moisture content, rough skin, etc., according to the predicted TEWL value or TEWL score of the subject. [Example]
[0032] The present invention will be explained in more detail below with reference to examples, but the present invention is not limited to these examples.
[0033] Example 1 The study was conducted in accordance with the ethical guidelines for clinical research and the ethical principles set out in the Declaration of Helsinki, after the subjects provided written informed consent.
[0034] Sixty subjects (30 men and 30 women) were included in this study, with the anterior chest area being the test site. Skin resident fungi were sampled using a cotton swab soaked in Tris-EDTA (TE) buffer containing 0.05% (w / v) polysorbate 80. DNA was extracted from the collected samples using the GenCheck DNA extraction reagent (Fasmac). Metagenomic analysis was performed using NGS Miseq (Illumina) to analyze the fungi that make up the skin resident fungal flora and their abundance ratios. Reagents for metagenomic analysis followed the manufacturer's protocol, and the ITS-1 region was used as the target. The ITS-1 primers used were the ITS-1-F and ITS-1-R primers listed below.
[0035] ITS-1-F primer: CTTGGTCATTTAGAGGAAGTAA (SEQ ID NO: 1) ITS-1-R primer: GTTCAAAGAYTCGATGATTCAC (SEQ ID NO: 2)
[0036] Transepidermal water loss (TEWL) was measured using a Tewameter TMHex (Courage+Khazaka) after subjects rested for 60 minutes.
[0037] A scatter plot was created with the percentage of Malassezia restricta in the analyzed skin fungal flora on the Y-axis and TEWL on the X-axis, and a linear regression equation was calculated based on this scatter data. The scatter plot, regression line, correlation coefficient, and regression equation are shown in Figure 1.
[0038] A scatter plot was created with the percentage of Malassezia sympodialis in the analyzed skin normal fungal flora on the Y-axis and TEWL on the X-axis, and a linear regression equation was calculated based on this scatter data. The scatter plot, regression line, correlation coefficient, and regression equation are shown in Figure 2.
[0039] A scatter plot was created with the difference between the abundance ratio (%) of Malassezia restricta and the abundance ratio (%) of Malassezia sympodialis in the analyzed normal skin fungal flora on the Y-axis and TEWL on the X-axis, and a linear regression equation was calculated based on this scatter data. The scatter plot, regression line, correlation coefficient, and regression equation are shown in Figure 3.
[0040] As shown in Figure 1, the abundance ratio (%) of Malassezia restricta and TEWL showed a positive correlation (y = 7.9x + 12.7, R = 0.46), and as shown in Figure 2, the abundance ratio (%) of Malassezia sympodialis and TEWL showed a negative correlation (y = -12.8x + 53.7, R = -0.56). Furthermore, as shown in Figure 3, there was a positive correlation between the difference in the abundance ratio (%) of Malassezia restricta and Malassezia sympodialis and TEWL (Figure 3: y=20.6x-41.3, R=0.58), and the correlation coefficient was higher than when Malassezia restricta or Malassezia sympodialis were used alone.
[0041] These results suggest that it is possible to predict TEWL, an index of skin roughness, based on the percentage of Malassezia restricta or Malassezia sympodialis in the normal skin fungal flora, and the difference between them.
[0042] Example 2 Six subjects (three men and three women) were tested, with the anterior chest region being the test site. As in Example 1, metagenomic analysis was performed using NGS Miseq (Illumina) to determine the abundance ratios (%) of Malassezia restricta and Malassezia sympodialis among the fungi in the samples. The difference between these values was applied to the formula calculated in Figure 3 to determine the predicted TEWL value. The results are shown in Table 1 below.
[0043] [Table 1]
[0044] As shown in Table 1, the predicted TEWL value calculated from the difference between the abundance ratio (%) of Malassezia restricta and the abundance ratio (%) of Malassezia sympodialis was equivalent to the actually measured TEWL value.
[0045] These results demonstrate that TEWL can be predicted based on the difference between the abundance ratio (%) of Malassezia restricta and the abundance ratio (%) of Malassezia sympodialis in the normal skin fungal flora, and that the accuracy of this prediction is demonstrated. [Industrial Applicability]
[0046] The present invention can be used to develop agents for improving normal skin flora, and cosmetics, topical skin preparations, and active ingredients that have the effect of improving skin conditions.
Claims
1. A method for predicting transepidermal water loss (TEWL), characterized by using as an index the abundance ratio of Malassezia restricta, the abundance ratio of Malassezia sympodialis, or the difference between the abundance ratio of Malassezia restricta and the abundance ratio of Malassezia sympodialis in the normal fungal flora of the skin.
2. A method for predicting transepidermal water loss (TEWL), comprising the steps of: (1) A step of creating a regression equation based on the correlation between the analyzed value of the abundance ratio of Malassezia restricta, the abundance ratio of Malassezia sympodialis, or the difference between the abundance ratio of Malassezia restricta and the abundance ratio of Malassezia sympodialis in the normal skin fungal flora, and transepidermal water loss (TEWL). (2) A step of analyzing the abundance ratio or difference in abundance ratio of fungi of the genus Malassezia in the normal skin fungal flora of the subject. (3) A step of applying the analyzed values of the abundance ratio of Malassezia restricta, the abundance ratio of Malassezia sympodialis, or the difference between the abundance ratio of Malassezia restricta and the abundance ratio of Malassezia sympodialis in the normal skin fungal flora of the subject obtained by the analysis in step (2) to the regression equation created in step (1) to obtain a predicted value of the transepidermal water loss (TEWL) of the subject.
3. 3. The method of claim 2, further comprising comparing the predicted value with a predetermined transepidermal water loss (TEWL) standard score to determine the subject's transepidermal water loss (TEWL) score.
4. A beauty advice method in which a beauty consultant presents the subject's transepidermal water loss (TEWL) score determined by the method of claim 3 and a standard TEWL score associated with the subject's skin condition, and provides advice on cosmetics or skin care methods to improve the skin condition.
Citation Information
Patent Citations
Traditional Chinese medicine composition for adjusting scalp micro-ecology balance, and preparation method and application thereof
CN110585283A
Method of discrimination among skin type by skin physiological index
JP2010088654A
Diagnostic method of skin condition and screening method, based on bacteria index
JP2018099184A
Method of predicting skin condition using skin resident flora analysis
JP2019062887A
Skin normal flora improving agent and cosmetic or skin external preparation containing the same
JP2019065004A