Use of EphB4 as a target in screening drugs or models for increasing insulin sensitivity
By targeting EphB4 to inhibit its interaction with the insulin receptor and using CRISPR-Cas9 technology for tissue-specific knockout, new insulin sensitizers are developed to improve insulin sensitivity and glucose tolerance, addressing the limitations of existing TZD compounds.
Patent Information
- Application Number
- JP2022556565
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-03-17
- Filing Date
- 2020-12-30
- Publication Date
- 2026-01-13
- Estimated Expiration
- 2040-12-30
AI Technical Summary
Current insulin sensitizers, such as thiazolidinedione (TZD) compounds, are limited by side effects and cardiovascular risks, necessitating the development of new drugs or biological agents that can enhance insulin sensitivity without these drawbacks.
Targeting the erythropoietin-producing hepatocyte receptor B4 (EphB4) to inhibit its interaction with the insulin receptor, increase the level of phosphorylated Akt, and promote glucose tolerance, using CRISPR-Cas9 technology for tissue-specific knockout in mouse models.
EphB4 inhibition improves insulin sensitivity and glucose tolerance, offering a new approach to treat insulin resistance and related diseases, including diabetes, by enhancing insulin signaling and reducing receptor degradation.
Smart Images

Figure 0007797403000001 
Figure 0007797403000002 
Figure 0007797403000003
Abstract
Description
[Technical Field]
[0001] The present invention relates to the technical fields of protein and genetic engineering, and in particular to the use of EphB4, a novel target for the prevention and treatment of insulin resistance and related diseases. [Background technology]
[0002] In China, the incidence of diabetes is rapidly increasing due to changes in dietary habits and lifestyles. By 2010, the prevalence of diabetes among Chinese adults reached 11.6 percent, and the prediabetic population was as high as 50.1 percent. In 2015, the number of Chinese adults with diabetes reached 109.6 million, making China the country with the largest diabetic population in the world. Diabetes has now become a public health issue of widespread concern. Without timely intervention and treatment, type 2 diabetes can lead to cardiovascular disease, kidney disease, eye disease, and other diabetes-related metabolic syndromes, which have serious health implications and even threaten patients' lives.
[0003] Insulin secretion and its signaling regulation play important roles in glucose metabolism and homeostasis. Insulin resistance is one of the key pathological features of type 2 diabetes. Numerous studies have shown that insulin resistance, an important etiological factor in type 2 diabetes, is caused by various factors, including chronic tissue inflammation, blockage of insulin signaling, and disruption of the intestinal flora. In addition, increased insulin compensation occurs in the case of insulin resistance, leading to the development of hyperinsulinemia.
[0004] Currently, among drugs used in clinical diabetes treatment, thiazolidinedione (TZD) compounds are the only insulin sensitizers that can clearly improve insulin resistance. Their target of action is PPARγ, a superfamily of mammalian nuclear receptors. However, TZD drugs have been withdrawn from the market or are limited in use due to side effects such as weight gain and cardiovascular risks. Therefore, there are currently no effective insulin sensitizers available. In light of the above-mentioned problems, there is an urgent need to discover new insulin sensitizers to solve these existing problems. Summary of the Invention [Problem to be solved by the invention]
[0005] The technical problem solved by the present invention is to provide for its use in screening and preparation of biological agents or drugs that increase insulin sensitivity by targeting the erythropoietin-producing hepatocyte receptor B4.
[0006] Another technical problem solved by the present invention is to provide the use of erythropoietin-producing hepatocyte receptor B4 in the generation of insulin-sensitized mouse models. It has been specifically verified at the animal level that downregulating EphB4 expression in mouse models can improve the glucose tolerance and clearance ability of mice. [Means for solving the problem]
[0007] In order to solve the above technical problems, the present invention provides the following solutions: The first aspect of the technical solution of the present invention is to provide a use of erythropoietin-producing hepatocyte receptor B4 in screening or preparing biological agents or drugs for improving insulin sensitivity, wherein the erythropoietin-producing hepatocyte receptor B4 is used as a target.
[0008] Preferably, the biological or pharmaceutical agent is used to prevent, alleviate or treat insulin resistance or a disorder associated with insulin resistance.
[0009] Preferably, the insulin resistance or a disease associated with insulin resistance is diabetes, hyperinsulinemia, a lipid metabolism disorder, obesity, or glucose intolerance.
[0010] Preferably, the biological agent or drug is used to inhibit the interaction of EphB4 with the insulin receptor, or to increase the protein level of the insulin receptor or the level of phosphorylated Akt, or to improve glucose tolerance and clearance capacity.
[0011] The corresponding amino acid sequence of the insulin receptor is shown in NP_001073285.1 and constructed in the pCMV3 vector and fused to a flag tag for expression. The corresponding amino acid sequence of EPHB4 is shown in NP_004435.3 and constructed in the pCMV5 vector and fused to an HA tag. Interaction between the insulin receptor and EPHB4 was demonstrated in both directions under overexpression conditions.
[0012] In this study, the inventors discovered that there is an interaction between the endogenous insulin receptor and EPHB4 in HepG2 cells, and that the interaction between the endogenous insulin receptor and EPHB4 is also clearly demonstrated in hepatocytes differentiated from human pluripotent hepatocytes.The inventors also found that insulin stimulation can promote the interaction between the insulin receptor and EPHB4 in HepG2 cells.
[0013] We have provided evidence that EphB4 promotes the degradation of insulin receptor protein via the lysosomal pathway and that suppression of EphB4 increases the levels of phosphorylated Akt. Specifically, overexpression of EphB4 by adenoviral vectors in primary hepatocytes reduced the levels of phosphorylated Akt and insulin receptor protein. Furthermore, the drug LCA (also known as 3α-hydroxy-5β-cholanic acid, 3α-hydroxy-5β-cholestane-24-oic acid, 5β-cholestane-24-oic acid-3α-alcohol, molecular formula C) inhibited EphB4. 24 H 40 Suppression of EphB4 by treating primary mouse hepatocytes with O3 increased the levels of phosphorylated Akt. Treatment with proteasome and lysosomal pathway inhibitors, along with detection of its interaction with Rab7, provided evidence that EphB4 promotes insulin receptor degradation via the lysosomal pathway.
[0014] The second aspect of the technical solution of the present invention is to provide the use of erythropoietin-producing hepatocyte receptor B4 in generating an insulin-sensitized mouse model.
[0015] Preferably, a transgenic mouse in which the EphB4 gene is knocked out in a tissue-specific manner and LoxP sites are inserted into two flanking regions of the first exon is constructed using CRISPR-Cas9 technology, thereby providing an insulin-sensitized mouse model in which EphB4 is knocked out in a tissue-specific manner.
[0016] Preferably, said insulin-sensitized mouse model with EphB4 tissue-specific knockout has improved glucose tolerance and clearance capabilities. [Effects of the Invention]
[0017] The present invention discloses the use of erythropoietin-producing hepatocyte receptor B4 (EphB4) as a target for screening and preparing biological agents or drugs that enhance insulin sensitivity. Specifically, the insulin receptor-interacting protein EphB4 has been identified as a target for insulin sensitizers in the context of insulin signaling regulation, and for the first time, EphB4 has been found to interact with the insulin receptor. The present invention also demonstrates that this interaction can be promoted at the cellular level by insulin stimulation. EphB4 promotes the degradation of insulin receptor protein via the lysosomal pathway, demonstrating that inhibition of EphB4 can increase the level of phosphorylated Akt, which may provide a basis for insulin resistance in the setting of hyperinsulinemia. Furthermore, animal studies have demonstrated that knockdown of EphB4 can improve glucose tolerance and clearance in db / db mice, suggesting that inhibition of EphB4 can enhance insulin sensitivity and ameliorate insulin resistance. The present invention has identified a new target that can be used for the prevention and treatment of insulin resistance and related diseases, providing a new concept and target for diabetes treatment and antidiabetic drug screening. In addition, it is of great importance to overcome the shortcomings of existing drugs currently used to treat diabetes. [Brief explanation of the drawings]
[0018] In order to describe the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings that need to be used in the embodiments. The drawings described below are only some embodiments of the present invention, and it is obvious that those skilled in the art can obtain other drawings from them without any creative efforts.
[0019] [Figure 1] FIG. 1 shows the results of the interaction between insulin receptor and EphB4 obtained by immunoprecipitation experiments in the present invention. [Figure 2] FIG. 2 shows that EphB4 promotes the degradation of the insulin receptor in the present invention. [Figure 3]FIG. 3 shows that overexpression of EphB4 by adenoviral vectors suppresses insulin signaling in mice. [Figure 4] Figure 4 shows that downregulation of EphB4 expression by lentiviral vectors in db / db mice ameliorates insulin resistance in the present invention. [Figure 5] FIG. 5 shows that, in the present invention, liver-specific knockout of EphB4 improves insulin sensitivity in mice fed a high-fat diet. DETAILED DESCRIPTION OF THE INVENTION
[0020] Various preferred embodiments of the present invention are described in detail below, which should not be construed as limiting the present invention, but should be understood as providing a more detailed description of certain aspects, features, and implementations of the present invention.
[0021] It should be understood that the terms used herein are intended only to describe particular embodiments and are not intended to limit the invention. In addition, it should be understood that the numerical ranges used herein also refer to each value between the upper and lower limits of that range. Narrower ranges between a stated value or value within a stated range and another stated value or value within a stated range are also encompassed within the invention. The upper and lower limits of such narrower ranges may individually be included or excluded within the range.
[0022] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as generally understood by one of ordinary skill in the art to which this invention relates. Only preferred methods and materials are described herein; however, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention. All documents mentioned in this document are incorporated by reference for the purpose of disclosing and describing the methods and / or materials related to the documents. In case of conflict with the incorporated documents, the contents of this document shall control.
[0023] Various modifications and variations can be made in the specific embodiments of the invention without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and embodiments herein are illustrative only.
[0024] The terms "comprise," "have," "contain," "include," and the like are all open-ended terms, i.e., terms meaning inclusion without limitation.
[0025] Embodiment 1 1. Research methods and technological paths In this study, we combined cell and animal models, using HEK293T cells, HepG2 cells, primary hepatocytes, C57BL / 6J mice, db / db mice, and an insulin-sensitized animal model of EphB4 liver-specific knockout mice (EphB4 LKO), respectively, and collected cell or tissue samples for each study.
[0026] The main methods used were real-time quantitative PCR, Western blotting, and glucose and insulin tolerance tests in mice.
[0027] 2. Experimental Materials Transfection reagent Lipo3000 was purchased from Invitrogene Corporation. InsR, EphB4, Akt, and pAkt antibodies were purchased from Cell Signaling Technology (item numbers: #3025, #14960, #4685, and #4060). Western blotting was performed at a ratio of 1:1000–2000, and protein immunoprecipitation was performed at a ratio of 1:100.
[0028] Adenoviruses overexpressing EphB4, lentiviruses with knockdown of EphB4 expression, and their corresponding control viruses were constructed and packaged by Shanghai Genechem Corporation. The correlation sequence: EphB4 shRNA sequence is 5'-GTTATGATCCTCACGGAAT-3', and the control shRNA sequence is 5'-TTCTCCGAACGTGTCACGT-3'.
[0029] The inhibitors MG132 (S2619), chloroquine (S4157), and LCA (S4003) were purchased from Selleck Chemicals. Ammonium chloride (A9434) was purchased from Sigma Company.
[0030] For the glucose tolerance test and insulin tolerance test, the blood glucose of the mice was measured using a Roche superior gold extraction type glucose meter and corresponding blood glucose test strips.
[0031] The primer sequences used for real-time quantitative PCR are as follows: EphB4-F:TATGCCACGATACGCTTCACC; EphB4-R:AGCTTCGCTCTCGTAATAGAAGA; 36B4-F:AGATTCGGGATATGCTGTTGGC; 36B4-R:TCGGGTCCTAGACCAGTGTTC.
[0032] The relevant sequences of tissue-specific knockout EphB4 transgenic mice constructed by CRISPR-Cas9 are as follows: The target sequences of CRISPR-Cas9 were 5'-GCCCGAGATCTTTACTCCCCGGG-3' and 5'-TTCTGGGCTGATCAAAGTGTGGG-3', and the corresponding sequences of sgRNA were 5'-CTATTTCTAGCTCTAAAACGGGGAGTAAAGATCTCGGGCCTATAGTGAGTCGTATTA-3' and 5'-CTATTTCTAGCTCTAAAACACACTTTGATCAGCCCAGCCTATAGTGAGTCGTATT-3'.
[0033] The PCR primer pairs for genotyping were as follows: forward, 5'-AGTTCCTCCAAGTCCCCTAACACC-3', 5'-CGCGCACTGGTGAAAATCCC-3', the wild-type size was 287 bp, and the mutant size was 372 bp; reverse, 5'-GGAGAATCTGGGGAGTGGGACA-3', 5'-ACTCTCCTTTTTTGCTGGGCAAAAT-3', the wild-type size was 318 bp, and the mutant size was 410 bp.
[0034] Statistical analysis: Values are expressed as the mean and plus or minus standard deviation, and differences between two populations were determined by the Student-Newman-Keuls test.
[0035] 3. Experimental methods and results 3.1 Co-immunoprecipitation HEK293T cells and human hepatoma HepG2 cells were cultured in DMEM medium containing 10% fetal bovine serum and streptomycin and penicillin (Gibco, 15140-122) in a 37°C, 5% CO2 incubator. For co-immunoprecipitation experiments, the expression plasmids pCMV5-EphB4-HA and pCMV3-flag-InsR were transfected into the cells at 70%-80% confluence using the Lipo3000 transfection reagent. Cells were then harvested 30-36 hours after transfection. Direct cleavage of endogenous proteins requires insulin stimulation; cells were stimulated with 10 nM insulin for 30 minutes before harvest. After lysing and harvesting, antibodies corresponding to the target proteins were added at the recommended antibody ratios and rotated in a 4°C refrigerator for 5-12 hours. After rinsing, protein-protein interactions were detected by Western blotting.
[0036] The results showed that flag-tagged insulin receptor (flag-InsR) and HA-tagged EphB4 (EphB4-HA) were overexpressed in HEK293T cells, and the interaction between insulin receptor and EphB4 could be detected by co-immunoprecipitation assay (as shown in Figure 1, panels A and B).
[0037] Endogenous interaction between EphB4 and insulin receptor was also detected in HepG2 cells and human pluripotent hepatocyte-induced hepatocytes (Fig. 1C and D). Furthermore, HepG2 cells were treated with insulin (10 nM insulin) for 30 minutes, and then the interaction between them was detected by immunoprecipitation. The results showed that insulin stimulation could promote the interaction between insulin receptor and EphB4.
[0038] The above results indicate that there is an interaction between EphB4 and the insulin receptor under both overexpression and endogenous conditions, and that insulin stimulation can enhance this interaction.
[0039] 3.2 Increase in phosphorylated Akt levels by EphB4 inhibitors Mice were anesthetized by intraperitoneal injection of an anesthetic, and then the abdominal cavity was opened. Type 4 collagenase (Sigma, C5138) was injected via the portal vein, allowing fluid to drain from the inferior vena cava. After the liver tissue was thoroughly digested, it was suspended in DMEM medium, passed through a 70 μm diameter cell sieve, and centrifuged to obtain primary hepatocytes. The cells were resuspended in complete medium and dispersed in Petri dishes or plates. After allowing the cells to adhere, they were treated overnight with LCA (10 μM and 20 μM). The cells were stimulated with 10 nM insulin for 20 minutes before harvesting, and then the level of phosphorylated Akt was detected by Western blotting.
[0040] The results showed that treating primary mouse hepatocytes with the Eph signaling inhibitor lithocholic acid (LCA) was able to increase the level of phosphorylated Akt (as shown in Figure 2C).
[0041] 3.3 Overexpression of EphB4 reduces the levels of phosphorylated Akt and insulin receptor Mice were anesthetized by intraperitoneal injection of an anesthetic. The abdominal cavity was then opened, and type 4 collagenase (Sigma, C5138) was injected through the portal vein, allowing fluid to drain through the inferior vena cava. After sufficient digestion, the liver tissue was suspended in DMEM medium, passed through a 70 μm diameter cell sieve, and then centrifuged at 50 × g to obtain primary hepatocytes. After washing twice with DMEM medium, the cells were resuspended in complete medium and dispersed in Petri dishes or culture plates. After allowing the cells to adhere to the wall, primary hepatocytes were infected with an adenovirus containing EphB4 to overexpress EphB4. The cells were infected with adenovirus at an MOI of 100. The infected cells were cultured for 16 hours, harvested, and subjected to Western blot analysis.
[0042] The results showed that overexpression of EphB4 could reduce the levels of phosphorylated Akt and insulin receptor protein in primary hepatocytes (as shown in Figure 2A).
[0043] 3.4 EphB4 promotes degradation of the insulin receptor via the lysosomal pathway Insulin receptor (insulin receptor with a flag tag) and EphB4 (EphB4 with an HA tag) were co-expressed in HEK293T cells. GFP was co-transfected as a reference for the heterologous proteins. Cells were treated with the proteasomal degradation pathway inhibitor MG132 (10 μM), the lysosomal degradation pathway inhibitor ammonium chloride (5 mM), and chloroquine (10 μM) for 8 hours. Cells were harvested, and the protein levels of flag-InsR were detected by Western blotting (Figure 2B). The lysosomal degradation pathway inhibitors ammonium chloride and chloroquine could partially abrogate the promoting effect of EphB4 on insulin receptor degradation, indicating that EphB4 promotes insulin receptor degradation via the lysosomal pathway. Concurrently, comparing the interaction between InsR and the late endocytic body marker protein Rab7 with or without co-expression of EphB4, we found that co-expression of EphB4 could promote the interaction between InsR and Rab7, indicating that EphB4 promotes the entry of InsR into late endocytic bodies and subsequently into degradative lysosomes (Fig. 2D).
[0044] The results showed that EphB4 promoted the degradation of InsR via the lysosomal degradation pathway (as shown in Figure 2D ).
[0045] 3.5 Overexpression of EphB4 interferes with glucose and insulin tolerance in C57 mice fed a normal diet Mice fed a normal diet were overexpressed with adenovirus via tail vein injection. The dose of adenovirus injection was 2.5E+7 PFU (PFU: plaque-forming units) without affecting the mouse's body weight. One week after injection, glucose tolerance and insulin tolerance were analyzed, and tissues were then harvested. The mice were fasted for 6 hours before tissue collection, and some of the mice were first injected with insulin (0.5 U / kg) and then sacrificed 5 minutes later. The level of phosphorylated Akt was detected by Western blotting.
[0046] The results showed that overexpression of EphB4 reduced the glucose tolerance and clearance ability of mice (as shown in Figure 3, panels A, B, and C).
[0047] Western blotting results showed that overexpression of EphB4 reduced insulin sensitivity in mouse liver tissue (as shown in Figure 3, panels D and E, where E is the result of grayscale statistical analysis of D, and the calculated value is the grayscale ratio of phosphorylated Akt to the corresponding Akt, *p<0.05).
[0048] 3.6 Knocking down EphB4 expression can improve glucose and insulin tolerance in db / db mice Using lentivirus as a vector, shRNA targeting the EphB4 gene was injected via the tail vein of diabetic db / db mice, knocking down EphB4 expression in db / db mice without affecting their body weight. Each mouse was injected with adenovirus at a dose of 2e+7 PFU. Two weeks after injection, glucose tolerance and insulin tolerance were analyzed.
[0049] The results showed that knocking down EphB4 expression in db / db mice significantly improved the glucose tolerance and clearance abilities of the mice (as shown in Figure 4, panels B and D).
[0050] 3.7 Knocking down EphB4 expression can improve hyperinsulinemia-induced insulin resistance Primary hepatocytes from mice with low EphB4 expression were isolated and treated with high-concentration insulin (100 nM) for 6 hours to generate insulin-resistant hepatocytes, followed by treatment with low-concentration insulin (10 nM) for 20 minutes. Afterwards, the cells were harvested and the levels of phosphorylated Akt were measured.
[0051] The results showed that knocking down EphB4 expression could ameliorate the insulin-resistant state of hepatocytes induced by high concentrations of insulin (as shown in Figure 4C ).
[0052] 3.8 Liver-specific knockout of EphB4 can improve glucose tolerance and clearance in mice
[0053] Using Biocytogen's technology platform, transgenic mice carrying LoxP sites flanking exon 1 of the EphB4 gene for tissue-specific knockout were constructed using CRISPR-Cas9 technology. The specific procedure was as follows: the target sequence of mouse EphB4 in the genome was amplified and sequenced, a CRISPR / Cas9 vector plasmid targeting the target sequence was designed and constructed, and its activity was detected using the company's in-house kit. A targeting vector for conditional knockout of the EphB4 gene was designed and constructed by selecting highly active sgRNA / Cas9 target site sequences (see "Materials" for details). The sgRNA / Cas9 mRNA and targeting vector were injected into the pronuclei of mouse fertilized eggs, which were then implanted into the oviducts of surrogate mice. After birth, the genotype of the F0 mice with a conditional knockout of the EphB4 gene was identified, and F1 mice with a conditional knockout of the EphB4 gene were obtained. The F1 mice were identified and their genotype was confirmed by PCR, Southern blotting hybridization, and sequencing. The F1 mice were then crossed with mice expressing Cre recombinase specifically in the liver (Alb-Cre mice), and the resulting offspring were self-crossed to obtain liver-specific knockout EphB4 mice. Liver and muscle tissues of the mice were examined by real-time quantitative PCR and Western blotting. The mice were fed a high-fat diet and underwent glucose and insulin tolerance tests.
[0054] Similarly, after fasting the mice for 6 hours, some mice were injected with insulin and sacrificed 5 minutes later, and the levels of phosphorylated Akt in the liver tissue of the mice were detected.
[0055] Results: Real-time quantitative PCR detection showed that EphB4 mRNA levels in liver tissue were significantly decreased, but there were no significant changes in kidney, white adipose tissue, and muscle tissue (as shown in Figure 5, Panel A), and EphB4 protein levels were also significantly decreased.
[0056] Under high-fat diet conditions, EphB4 LKO mice exhibited superior glucose tolerance and clearance capabilities compared with control mice (Figure 5B and C). Furthermore, the levels of phosphorylated Akt were higher in the liver tissue of knockout mice (Figure 5E). Figure 5F shows the results of a grayscale analysis of Figure 5E, and the calculated values are the ratios of phosphorylated Akt to the corresponding Akt grayscale levels.
[0057] The above-described embodiments only illustrate preferred embodiments of the present invention and do not limit the scope of the present invention. Any modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the design concept of the present invention shall fall within the scope of protection determined by the claims of the present invention. The present invention includes the following aspects: <Aspect 1> 1. Use of erythropoietin-producing hepatocyte receptor B4 in screening for or preparing a biological agent or drug for increasing insulin sensitivity, comprising: The erythropoietin-producing hepatocyte receptor B4 is used as a target. use. <Aspect 2> 2. The use of aspect 1, wherein the biological or pharmaceutical agent is used to prevent, alleviate, or treat insulin resistance or a disorder associated with insulin resistance. <Aspect 3> The use according to aspect 2, wherein the insulin resistance or a disease associated with insulin resistance is diabetes, hyperinsulinemia, a lipid metabolism disorder, obesity, or glucose intolerance. <Aspect 4> The use of any one of aspects 1 to 3, wherein the biological agent or drug is used to inhibit the interaction of EphB4 with insulin receptor, or to increase insulin receptor protein levels or phosphorylated Akt levels, or to improve glucose tolerance and clearance capacity. <Aspect 5> Use of erythropoietin-producing hepatocyte receptor B4 in generating an insulin-sensitized mouse model. <Aspect 6> The use according to embodiment 5, wherein a transgenic mouse in which the EphB4 gene has been knocked out in a tissue-specific manner and LoxP sites have been inserted into two flanking parts of the first exon is constructed using CRISPR-Cas9 technology, thereby obtaining an insulin-sensitized mouse model in which EphB4 has been knocked out in a tissue-specific manner. <Aspect 7> The use according to embodiment 6, wherein said insulin-sensitized mouse model with EphB4 tissue-specific knockout has improved glucose tolerance and clearance capabilities. <Aspect 8> 8. The use according to aspect 6 or 7, wherein the tissue is liver.
Claims
1. 1. A method for producing an insulin-sensitized mouse model, comprising knocking out the EphB4 gene in a mouse; The insulin-sensitized mouse model with EphB4 tissue-specific knockout has improved glucose tolerance and clearance capabilities; and the tissue is the liver; method.
2. 2. The method of claim 1, wherein a transgenic mouse in which the EphB4 gene is knocked out in a tissue-specific manner and LoxP sites are inserted into two flanking regions of the first exon is constructed using CRISPR-Cas9 technology, thereby obtaining an insulin-sensitized mouse model in which EphB4 is knocked out in a tissue-specific manner.
3. an insulin-sensitized mouse model in which the EphB4 gene has been knocked out; The insulin-sensitized mouse model with EphB4 tissue-specific knockout has improved glucose tolerance and clearance capabilities; and the tissue is the liver; Insulin-sensitized mouse model.
4. 4. The insulin-sensitized mouse model of claim 3, wherein a transgenic mouse in which the EphB4 gene is knocked out in a tissue-specific manner and LoxP sites are inserted into two flanking regions of the first exon is constructed using CRISPR-Cas9 technology, thereby obtaining an insulin-sensitized mouse model in which EphB4 is knocked out in a tissue-specific manner.
Citation Information
Patent Citations
Artery- and vein-specific proteins and uses therefor
WO1999052541A2
Uses for EPH receptor antagonists and agonists to treat vascular disorders
WO2000030673A1