Compounds and methods for modulating PLP1

Compounds targeting PLP1 RNA and protein levels in cells provide a therapeutic option for leukodystrophies by reducing PLP1 expression, addressing the lack of effective treatments for Pelizaeus-Merzbacher disease and associated symptoms.

JP7799640B2Active Publication Date: 2026-01-15IONIS PHARMACEUTICALS INC
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2022581012
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-12-11
Filing Date
2021-06-29
Publication Date
2026-01-15
Estimated Expiration
2041-06-29

AI Technical Summary

Technical Problem

There are no effective treatments for leukodystrophies such as Pelizaeus-Merzbacher disease, which are caused by PLP1 mutations leading to PLP1 overexpression or misfolding, resulting in severe symptoms and premature death.

Method used

Development of compounds, methods, and pharmaceutical compositions that reduce the amount or activity of PLP1 RNA, including oligomeric compounds and modified oligonucleotides, to target and decrease PLP1 expression in cells, thereby ameliorating symptoms associated with leukodystrophies.

Benefits of technology

These compounds effectively reduce PLP1 RNA and protein levels, leading to improvements in symptoms like hypotonia, nystagmus, respiratory distress, and spasticity, offering a potential therapeutic approach for leukodystrophies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007799640000001
    Figure 0007799640000001
  • Figure 0007799640000002
    Figure 0007799640000002
  • Figure 0007799640000003
    Figure 0007799640000003
Patent Text Reader

Abstract

Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of PLP1 RNA in a cell or subject, and optionally reducing the amount of proteolipid protein 1 in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom or feature of a leukodystrophy, including hypotonia, nystagmus, optic atrophy, respiratory distress, motor delay, cognitive impairment, speech impairment, spasticity, ataxia, seizures, choroidal movement, and death. Such leukodystrophies include Pelizaeus-Merzbacher disease.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Sequence Listing This application is filed electronically with a Sequence Listing, which is provided as a file entitled BIOL0382WOSEQ_ST25.txt, created on June 22, 2021, and 456 Kb in size. The information in the electronic format of this Sequence Listing is incorporated herein by reference in its entirety.

[0002] Field Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of proteolipid protein 1 (PLP1) RNA in a cell or a subject, and in some cases, for reducing the amount of proteolipid protein 1 in a cell or a subject. Such compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom or feature of a leukodystrophy. Such symptoms and features include hypotonia, nystagmus, optic atrophy, respiratory distress, motor delay, cognitive impairment, language impairment, spasticity, ataxia, seizures, choroidal movement, and death. Such leukodystrophies include Pelizaeus-Merzbacher disease. [Background technology]

[0003] Pelizaeus-Merzbacher disease (PMD) is a severe, fatal, childhood, X-linked leukodystrophy associated with widespread loss or absence of myelination in the central nervous system. It is caused by duplications or sequence variants in the gene encoding proteolipid protein 1 (PLP1). Hundreds of PLP1 mutations have been identified, leading to toxic gain-of-function due to PLP1 misfolding and hypomyelination (Hobson, G., 2012, Semin. Neurol. 32, 62-67; Nevin, ZS, 2017, American J. Hum. Genetics 100, 617-634; Sima, AAF, et al., 2009, Acta Neuropathologica 118, 431-439). The majority of PMD cases are due to overexpression of otherwise normal PLP1 protein as a result of PLP1 duplication or triplication (Inoue, K., 2005, Neurogenetics 6, 1-16; Karim, SA, 2010, Glia 58, 1727-1738). PLP1 is expressed in myelin-forming oligodendrocytes and oligodendrocyte precursor cells (OPCs) in the central nervous system (CNS), where it accounts for approximately 50% of the total protein content of myelin, and in Schwann cells in the peripheral nervous system (PNS) (Klugman, W., et al., 1997, Neuron, 18 59-70; Harlow, DE, et al., 2014, J. Neurosci. 34, 1333-1343; Baumann, N., et al., 2001, Physiol. Rev. 81, 871-927).

[0004] Due to the genetic heterogeneity associated with PMD, symptoms and characteristics vary and are classified into two major categories: severe and standard. Severe (severe / early-onset) PMD is caused by mutations in PLP1, resulting in hypomyelination. This most severe form of PMD results in death in infancy, usually within the first few years of life, and presents with symptoms such as nystagmus, respiratory distress, extrapyramidal signs, laryngeal stridor, feeding difficulties, optic atrophy, seizures, and extreme neonatal hypotonia. Standard PMD, associated with PLP1 overexpression due to PLP1 duplication or triplication, presents before the age of one year with a continuation of motor delay, hypotonia, nystagmus, and / or early childhood motor delay, followed by the development of progressive spasticity, ataxia, and / or choroidal movements throughout adolescence and early adulthood. Other PMD phenotypes include transitional PMD, associated with PLP1 overexpression or PLP1 mutations, which combines clinical features of both standard and severe PMD. A less severe phenotype, spastic paraplegia type 2 (SPG2), develops later than standard PMD and is associated with mild, delayed-onset spasticity of the legs or a variety of mild peripheral neuropathy with minimal central nervous system deficits. Patients with PLP1 deletions ("null" patients) have significantly milder symptoms than patients with PLP1 mutations or duplications and can live to 40–60 years of age. There is no approved cure for PMD, and current treatments are primarily limited to palliative symptom management (Nevin, 2017; Inoue, 2005; Madry, J., et al., 2010, Neurol. Neurochir. Pol. 44, 511–515; Osorio, M.J., et al., 2017, Stem Cells 35, 311–315; Wang, P.J., et al., 2001, J. Clin. Neurophys. 18, 25–32).

[0005] Currently, there are no acceptable options for the treatment of leukodystrophies such as PMD. Accordingly, it is an object herein to provide compounds, methods, and pharmaceutical compositions for treating such diseases. Summary of the Invention

[0006] Provided herein are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of PLP1 RNA in a cell or animal, and in certain embodiments, for reducing the expression of proteolipid protein 1. In certain embodiments, the subject has a disease or disorder associated with overexpression of PLP1 or a mutation in PLP1. In certain embodiments, the subject has a leukodystrophy. In certain embodiments, the subject has Pelizaeus-Merzbacher disease. In certain embodiments, a compound useful for reducing the amount or activity of PLP1 RNA is an oligomeric compound. In certain embodiments, a compound useful for reducing the amount or activity of PLP1 RNA is a modified oligonucleotide. In certain embodiments, a compound useful for reducing the expression of proteolipid protein 1 is an oligomeric compound. In certain embodiments, a compound useful for reducing the expression of proteolipid protein 1 is a modified oligonucleotide.

[0007] Also provided is a method useful for ameliorating at least one symptom or characteristic of leukodystrophy. In certain embodiments, the leukodystrophy is Pelizaeus-Merzbacher disease. In certain embodiments, the symptom or characteristic includes hypotonia, nystagmus, optic atrophy, respiratory distress, motor delay, cognitive impairment, language impairment, spasticity, ataxia, seizures, or choroidal movement. DETAILED DESCRIPTION OF THE INVENTION

[0008] It should be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the use of the term "comprising" and other forms such as "comprises" and "includes" is not limiting. Furthermore, terms such as "element" or "component" include both elements and components comprising one unit and elements and components comprising two or more subunits, unless expressly stated otherwise.

[0009] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter of the invention described. All documents, or portions of documents, cited in this application, including but not limited to patents, patent applications, articles, books, papers, and GenBank, ENSEMBL, and NCBI reference sequence records, are expressly incorporated herein by reference in their entirety, as well as with respect to the portions of documents discussed herein.

[0010] definition Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, patent applications, published patent applications, and other publications and other data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0011] Unless otherwise indicated, the following terms have the following meanings:

[0012] definition As used herein, "2'-deoxynucleoside" refers to a nucleoside that includes a 2'-H(H) deoxyfuranosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside, which includes a 2'-β-D-deoxyribosyl sugar moiety having the β-D ribosyl configuration as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside may include a modified nucleobase or may include an RNA nucleobase (uracil).

[0013] As used herein, "2'-MOE" refers to a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. A "2'-MOE sugar moiety" refers to a sugar moiety having a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, the 2'-MOE sugar moiety is in the β-D-ribosyl configuration. "MOE" refers to O-methoxyethyl.

[0014] As used herein, "2'-MOE nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety.

[0015] As used herein, "2'-OMe" refers to a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. A "2'-O-methyl sugar moiety" or "2'-OMe sugar moiety" refers to a sugar moiety having a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, the 2'-OMe sugar moiety is in the β-D-ribosyl configuration.

[0016] As used herein, "2'-OMe nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.

[0017] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted sugar moiety. As used herein with respect to a sugar moiety, "2'-substituted" refers to a sugar moiety that includes at least one 2'-substituent other than H or OH.

[0018] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.

[0019] As used herein, "administering" means giving a pharmaceutical agent to a subject.

[0020] As used herein, "antisense activity" refers to any detectable and / or measurable change resulting from the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid compared to the target nucleic acid or target protein level in the absence of the antisense compound.

[0021] As used herein, "antisense compound" means an oligomeric compound capable of achieving at least one antisense activity.

[0022] As used herein with respect to treatment, "ameliorate" means an improvement in at least one symptom or characteristic compared to the same symptom or characteristic in the absence of treatment. In certain embodiments, the improvement is a decrease in the severity or frequency of the symptom or characteristic, or a delay in the onset or progression of the severity or frequency of the symptom or characteristic. In certain embodiments, the symptom or characteristic is one or more of hypotonia, nystagmus, optic atrophy, dyspnea, motor delay, cognitive impairment, language impairment, spasticity, ataxia, seizures, choroidal movement, and death.

[0023] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.

[0024] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

[0025] As used herein, "cerebrospinal fluid" or "CSF" means the fluid that fills the space around the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" means a prepared or manufactured fluid that has certain properties of cerebrospinal fluid.

[0026] As used herein, "cleavable moiety" means a bond or group of atoms that is cleaved under physiological conditions, eg, inside a cell, animal, or human.

[0027] As used herein with respect to oligonucleotides, "complementary" means that at least 70% of the nucleobases of an oligonucleotide, or one or more portions thereof, and another nucleic acid, or one or more portions thereof, are capable of hydrogen bonding with each other when the nucleobase sequences of the oligonucleotide and the other nucleic acid are aligned in reverse orientation. As used herein, "complementary nucleobases" means nucleobases that are capable of forming hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (C). mExamples of complementary bases include guanine (G) and guanine (C). Complementary oligonucleotides and / or target nucleic acids need not have complementary nucleobases at each nucleoside. Rather, some mismatches are permitted. As used herein with respect to an oligonucleotide or portion thereof, "fully complementary" or "100% complementary" means that an oligonucleotide or portion thereof is complementary to another oligonucleotide or target nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.

[0028] As used herein, "conjugate group" means a group of atoms directly or indirectly attached to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that joins the conjugate moiety to the oligonucleotide.

[0029] As used herein, "conjugate linker" means a single bond or group of atoms that comprises at least one bond that connects a conjugate moiety to an oligonucleotide.

[0030] As used herein, "conjugate moiety" means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

[0031] As used herein in the context of oligonucleotides, "contiguous" refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to each other in the sequence.

[0032] As used herein, "cEt" means a 4' to 2' bridge in place of the 2' OH group of the ribosyl sugar moiety, the bridge having the formula 4'-CH(CH3)-O-2', where the methyl group of the bridge is in the S configuration. A "cEt sugar moiety" is a bicyclic sugar moiety with a 4' to 2' bridge in place of the 2' OH group of the ribosyl sugar moiety, the bridge having the formula 4'-CH(CH3)-O-2', where the methyl group of the bridge is in the S configuration. "cEt" means tethered ethyl.

[0033] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt sugar moiety.

[0034] As used herein, "chiral enriched population" refers to a plurality of molecules of the same molecular formula, wherein the number or percentage of molecules in the population that contain a specific stereochemical configuration at a specific chiral center is greater than the number or percentage of molecules that would be expected to contain the same specific stereochemical configuration at the same specific chiral center in the population if that specific chiral center were stereo-random. A chiral enriched population of molecules with multiple chiral centers within each molecule may contain one or more stereo-random chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is a compound that includes a modified oligonucleotide.

[0035] As used herein, "chiral controlled" with respect to an internucleoside linkage means that the chirality at that linkage is enriched for a particular stereochemical configuration.

[0036] As used herein, a "deoxy region" refers to a region of 5 to 12 contiguous nucleotides, wherein at least 70% of the nucleosides are 2'-β-D-deoxynucleosides. In certain embodiments, each nucleoside is selected from 2'-β-D-deoxynucleosides, bicyclic nucleosides, and 2'-substituted nucleosides. In certain embodiments, the deoxy region supports RNase H activity. In certain embodiments, the deoxy region is the gap or an internal region of a gapmer.

[0037] As used herein, "gapmer" refers to a modified oligonucleotide comprising an internal region having multiple nucleosides that support RNase H cleavage, located between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may also be referred to as a "gap," and the external regions may also be referred to as "wings" or "wing segments." In certain embodiments, the internal region is a deoxy region. The position of the internal region or gap refers to the order of nucleosides in the internal region, counted starting from the 5' end of the internal region. Unless otherwise specified, "gapmer" refers to a sugar motif. In certain embodiments, each nucleoside in the gap is a 2'-β-D-deoxynucleoside. In certain embodiments, the gap contains one 2'-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, with the remainder of the nucleosides in the gap being 2'-β-D-deoxynucleosides. As used herein, the term "MOE gapmer" refers to a gapmer having a gap containing a 2'-β-D-deoxynucleoside and wings containing 2'-MOE nucleosides. As used herein, the term "mixed-wing gapmer" refers to a gapmer having wings containing modified nucleosides with at least two different sugar modifications. Unless otherwise indicated, a gapmer may contain one or more modified internucleoside linkages and / or modified nucleobases, and such modifications do not necessarily follow the gapmer pattern of sugar modifications.

[0038] As used herein, a "hotspot region" is a range of nucleobases on a target nucleic acid that is susceptible to oligomeric compound-mediated reduction in the amount or activity of the target nucleic acid.

[0039] As used herein, "hybridization" refers to the pairing or annealing of complementary oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common hybridization mechanism involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

[0040] As used herein, "internucleoside linkage" refers to a covalent bond between consecutive nucleosides in an oligonucleotide. As used herein, "modified internucleoside linkage" refers to any internucleoside linkage other than a phosphodiester internucleoside linkage. A "phosphorothioate internucleoside linkage" or "PS internucleoside linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.

[0041] As used herein, "leukodystrophy" means a disorder resulting from abnormalities in the myelin sheath of neurons.

[0042] As used herein, "linker nucleoside" means a nucleoside that directly or indirectly links an oligonucleotide to a conjugate moiety. The linker nucleoside is located within the conjugate linker of an oligomeric compound. A linker nucleoside is not considered part of the oligonucleotide portion of an oligomeric compound, even if it is adjacent to the oligonucleotide.

[0043] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes modifications such as substituents that do not form a bridge between two atoms of the sugar to form a second ring.

[0044] As used herein, "mismatch" or "non-complementary" means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned.

[0045] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0046] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-methylcytosine" is one of the modified nucleobases. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, a "nucleobase sequence" refers to the order of consecutive nucleobases in a nucleic acid or oligonucleotide, regardless of any sugar or internucleoside linkage modifications.

[0047] As used herein, "nucleoside" refers to a compound or fragment of a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each independently unmodified or modified. As used herein, "modified nucleoside" refers to a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides that do not contain a nucleobase. As used herein, "linked nucleosides" are nucleosides that are connected in a contiguous sequence (i.e., there are no additional nucleosides between the linked nucleosides).

[0048] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may or may not be paired with a second oligomeric compound that is complementary to the first oligomeric compound. A "single-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligomeric duplex" refers to a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound in an oligomeric duplex may be referred to as a "double-stranded oligomeric compound."

[0049] As used herein, "oligonucleotide" refers to a chain of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise specified, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modifications.

[0050] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administration to a subject. Certain such carriers allow the pharmaceutical composition to be formulated, for example, as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.

[0051] As used herein, "pharmaceutically acceptable salt" refers to a physiologically and pharmaceutically acceptable salt of a compound that retains the desired biological activity of the parent compound and does not impart undesired toxicological effects to the parent compound.

[0052] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition can include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in a particular cell line.

[0053] As used herein, "prodrug" refers to an ex vivo form of a therapeutic agent that is converted to a different form within the subject or its cells. Typically, conversion of the prodrug within the subject is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in the cells or tissues and / or by physiological conditions.

[0054] As used herein, "reducing the amount or activity" means a reduction or blocking of transcriptional expression or activity compared to the transcriptional expression or activity of an untreated or control sample, and does not necessarily indicate a complete loss of transcriptional expression or activity.

[0055] As used herein, "RNA" means RNA transcripts, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0056] As used herein, "RNAi compound" refers to an antisense compound that acts, at least in part, through RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, an RNAi compound regulates the amount, activity, and / or splicing of a target nucleic acid. The term RNAi compound excludes antisense compounds that act through RNase H.

[0057] As used herein with respect to oligonucleotides, "self-complementary" means an oligonucleotide that at least partially hybridizes to itself.

[0058] As used herein, "standard in vitro assay" means the assay described in Example 1 and reasonable modifications thereof.

[0059] As used herein, "standard in vivo assay" means the assay described in Example 5 and reasonable modifications thereof.

[0060] As used herein in the context of a population of molecules of the same molecular formula, a "sterically random chiral center" refers to a chiral center having a random stereochemical configuration. For example, in a population of molecules containing stereorandom chiral centers, the number of molecules having stereorandom chiral centers in the (S) configuration may be, but is not necessarily, the same as the number of molecules having stereorandom chiral centers in the (R) configuration. The stereochemical configuration of a chiral center is considered random if it is the result of a synthetic method not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0061] As used herein, "subject" means a human or non-human animal. The terms "subject" and "individual" are used interchangeably.

[0062] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H)β-D-ribosyl sugar moiety as found in RNA (an "unmodified RNA sugar moiety") or a 2'-H(H)β-D-deoxyribosyl sugar moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.

[0063] As used herein, "sugar surrogate" refers to a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as, for example, an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide. Modified nucleosides containing sugar surrogates can be incorporated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to complementary oligomeric compounds or target nucleic acids.

[0064] As used herein, "symptom or feature" means any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is apparent to the subject or a medical professional examining or testing the subject. In certain embodiments, the feature is apparent by invasive diagnostic testing, including but not limited to, post-mortem examination. In certain embodiments, the feature is apparent on an MRI scan of the brain.

[0065] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid that an antisense compound is designed to affect. Target RNA refers to an RNA transcript, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0066] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0067] As used herein, "terminal group" means a chemical group or group of atoms covalently attached to the end of an oligonucleotide.

[0068] As used herein, a "therapeutically effective amount" refers to an amount of an agent that confers a therapeutic effect on a subject, e.g., ameliorates a symptom or characteristic of a disease or disorder.

[0069] As used herein, "treating" means improving a disease or disorder in a subject by administering an oligomeric agent or oligomeric compound described herein. In certain embodiments, treating a subject improves symptoms compared to the same symptoms in the absence of treatment. In certain embodiments, treating reduces the severity or frequency of symptoms, or delays the onset of symptoms, slows the progression of symptoms, or slows the severity or frequency of symptoms.

[0070] Specific Embodiments The present disclosure provides the following non-limiting numbered embodiments:

[0071] Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of said modified oligonucleotide is at least 85% complementary to an equal length portion of a PLP1 nucleic acid, and said modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0072] Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20 to 2155, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0073] 3. Consisting of linked nucleosides of embodiments 12 to 30, and an equal length portion of nucleobases 9198 to 9222 of SEQ ID NO: 2; an equal length portion of nucleobases 13702 to 13766 of SEQ ID NO: 2; an equal length portion of nucleobases 14037 to 14062 of SEQ ID NO: 2; Equal length portions of nucleobases 16761 to 16800 of SEQ ID NO: 2; an equal length portion of nucleobases 17558 to 17602 of SEQ ID NO: 2; Equal length portions of nucleobases 17615 to 17667 of SEQ ID NO: 2; Equal length portions of nucleobases 17853 to 17883 of SEQ ID NO: 2; an equal length portion of nucleobases 18097 to 18160 of SEQ ID NO:2; an equal length portion of nucleobases 18206 to 18237 of SEQ ID NO: 2; an equal length portion of nucleobases 18237 to 18340 of SEQ ID NO: 2; Equal length portions of nucleobases 18350 to 18387 of SEQ ID NO: 2; Equal length portions of nucleobases 18412 to 18469 of SEQ ID NO: 2; an equal length portion of nucleobases 18461 to 18506 of SEQ ID NO: 2; Equal length portions of nucleobases 18539 to 18579 of SEQ ID NO: 2; Equal length portions of nucleobases 18697 to 18727 of SEQ ID NO: 2; an equal length portion of nucleobases 18755 to 18793 of SEQ ID NO: 2; Equal length portions of nucleobases 18797 to 18819 of SEQ ID NO: 2; an equal length portion of nucleobases 18839 to 18862 of SEQ ID NO: 2; an equal length portion of nucleobases 18974 to 19021 of SEQ ID NO: 2; an equal length portion of nucleobases 19028 to 19080 of SEQ ID NO: 2; an equal length portion of nucleobases 19146 to 19173 of SEQ ID NO: 2; an equal length portion of nucleobases 19228 to 19253 of SEQ ID NO: 2; an equal length portion of nucleobases 19347 to 19393 of SEQ ID NO: 2; an equal length portion of nucleobases 19550 to 19523 of SEQ ID NO: 2; or 1. An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 19512 to 19534 of SEQ ID NO:2, The oligomeric compound, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0074] Embodiment 4. An oligomeric compound consisting of 12 to 30 linked nucleosides, and SEQ ID NOs: 1050, 1124, 2145, 2151, 2152, 2153; SEQ ID NOs: 36, 86, 114, 164, 191, 242, 269, 426, 523, 602, 691, 780; SEQ ID NOs: 89, 167, 245, 322, 323; SEQ ID NOs: 720, 808, 904, 937, 1058, 1097, 1184, 1278, 1340; SEQ ID NOs: 40, 41, 117, 118, 195, 196, 273, 274, 588, 690; SEQ ID NOs: 42, 43, 119, 120, 197, 198, 275, 276, 373, 460, 1431, 1542, 1645, 1850, 1965, 2109; SEQ ID NOs: 1451, 1499, 1543, 1654, 1733, 2154, 2155, SEQ ID NOs: 200, 420, 504, 620, 646, 709, 823, 980, 1029, 1149, 1196, 1253, 1323, 1423, 1476, 1605, 1613, 1728, 1832; SEQ ID NOs: 45, 46, 123, 124, 201, 202, 279, 280, 538, 562, 2091; SEQ ID NOs: 48, 49, 50, 51, 52, 53, 125, 126, 127, 128, 129, 130, 131, 203, 204, 205, 206, 207, 208, 281, 282, 283, 284, 285, 286, 414, 459, 485, 503, 579, 580, 693, 724, 840, 873, 911, 1034, 1081, 1125, 1159, 1318, 1413, 1513, 1548, 1672, 1701, 1794, 1868, 1958, 2002; SEQ ID NOs: 209, 287, 335, 439, 506, 606, 659, 1922, 2033, 2104; SEQ ID NOs: 784, 842, 869, 978, 1082, 1131, 1218, 1250, 1320, 1453, 1529, 1538, 1616, 1712, 1821; SEQ ID NOs: 54, 55, 132, 133, 210, 288, 419, 499, 564, 665, 764, 800, 881, 993, 1059, 1200, 1295, 1354, 1422, 1465, 1544, 1705, 1802, 2149; SEQ ID NOs: 338, 438, 525, 604, 658, 758, 813, 887, 977, 1043, 1108, 1199, 1258, 1336, 1395, 1514, 1557, 1668, 1697, 2089; SEQ ID NOs: 875, 934, 1047, 1110, 1229, 1243, 1373, 1438, 2146, 2147; SEQ ID NOs: 761, 798, 890, 946, 1022, 1120, 1198, 1293, 1358, 1398, 1463; SEQ ID NOs: 56, 134, 683, 718; SEQ ID NOs: 1610, 1663, 1702, 1786; SEQ ID NOs: 212, 1060, 1090, 1181, 1277, 1446, 1510, 1589, 1646, 1693, 1772, 2148; SEQ ID NOs: 57, 586, 666, 714, 812, 914, 951, 1052, 1138, 1162, 1248, 1363, 1455; SEQ ID NOs: 385, 416, 545, 621, 682, 1968, 2055, 2101, 2150; SEQ ID NOs: 363, 467, 541, 2008, 2111; SEQ ID NOs: 58, 59, 136, 213, 214, 291, 292, 383, 417, 519, 612, 671, 730, 900, 986, 1019, 1136, 1353, 1457, 1504, 1546, 2093; SEQ ID NOs: 398, 435, 2095, 2010, 2144; or a modified oligonucleotide having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleobases of a sequence selected from SEQ ID NOs: 1201, 1238, 1341, 1435; The oligomeric compound, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0075] Embodiment 5. The oligomeric compound of any of embodiments 1-4, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of SEQ ID NO:1 or SEQ ID NO:2, when measured across the entire nucleobase sequence of the modified oligonucleotide.

[0076] Embodiment 6. The oligomeric compound of any one of embodiments 1-5, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

[0077] Embodiment 7. The oligomeric compound of embodiment 6, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.

[0078] Embodiment 8. The oligomeric compound of embodiment 7, wherein the bicyclic sugar moiety comprises a 4'-2' bridge, and the 4'-2' bridge is selected from -CH2-O- and -CH(CH3)-O-.

[0079] Embodiment 9. The oligomeric compound of any one of Embodiments 6-8, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.

[0080] Embodiment 10 The oligomeric compound of embodiment 9, wherein said non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.

[0081] Embodiment 11. The oligomeric compound of any one of embodiments 6 to 10, wherein the modified oligonucleotide comprises at least one modified nucleoside that comprises a sugar surrogate.

[0082] Embodiment 12. The oligomeric compound of embodiment 11, wherein the sugar surrogate is any of morpholino, modified morpholino, PNA, THP, and F-HNA.

[0083] Embodiment 13. The oligomeric compound of any of embodiments 1-6 or 9-12, wherein the modified oligonucleotide does not contain a bicyclic sugar moiety.

[0084] Embodiment 14. The oligomeric compound of any one of embodiments 1 to 13, wherein the modified oligonucleotide is a gapmer.

[0085] Embodiment 15. The modified oligonucleotide comprises: a 5' region consisting of 1 to 7 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; a 3' region consisting of 1 to 7 linked 3' region nucleosides; 15. The oligomeric compound of any one of embodiments 1-14, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-deoxyfuranosyl sugar moiety.

[0086] Embodiment 16. The modified oligonucleotide comprises: a 5' region consisting of 5 linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of 5 linked 3' region nucleosides; 16. The oligomeric compound of embodiment 15, wherein each of the 5' region nucleosides and each of the 3' region nucleosides is a 2'-MOE nucleoside, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside.

[0087] Embodiment 17. The modified oligonucleotide comprises: a 5' region consisting of six linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of four linked 3' region nucleosides; 16. The oligomeric compound of embodiment 15, wherein each of the 5' region nucleosides and each of the 3' region nucleosides is a 2'-MOE nucleoside, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside.

[0088] Embodiment 18. The oligomeric compound of any one of embodiments 1 to 17, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0089] Embodiment 19. The oligomeric compound of embodiment 18, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.

[0090] Embodiment 20. The oligomeric compound of embodiment 18 or 19, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

[0091] Embodiment 21 The oligomeric compound of embodiment 18 or 20, wherein said modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0092] Embodiment 22 The oligomeric compound of any of embodiments 18, 20, or 21, wherein each internucleoside linkage is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0093] Embodiment 23 The oligomeric compound of embodiment 19, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0094] Embodiment 24. The modified oligonucleotide has an internucleoside linkage motif of soooossssssssssooss or soooooossssssssssoss, wherein: 23. The oligomeric compound of any of embodiments 1-18 or 20-22, wherein s is a phosphorothioate internucleoside linkage and o is a phosphodiester internucleoside linkage.

[0095] Embodiment 25. The oligomeric compound of any one of embodiments 1 to 24, wherein the modified oligonucleotide comprises at least one modified nucleobase.

[0096] Embodiment 26 The oligomeric compound of embodiment 25, wherein the modified nucleobase is 5-methylcytosine.

[0097] Embodiment 27. The oligomeric compound of any one of embodiments 1 to 26, wherein the modified oligonucleotide consists of 12 to 30, 12 to 22, 12 to 20, 14 to 18, 14 to 20, 15 to 17, 15 to 25, 16 to 18, 16 to 20, 17 to 20, 18 to 20, or 18 to 22 linked nucleosides.

[0098] Embodiment 28. The oligomeric compound of any one of embodiments 1 to 26, wherein the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides.

[0099] Embodiment 29. The oligomeric compound of embodiment 28, wherein the modified oligonucleotide consists of 20 linked nucleosides.

[0100] Embodiment 30. The oligomeric compound of embodiment 28, wherein the modified oligonucleotide consists of 18 linked nucleosides.

[0101] Embodiment 31. An oligomeric compound having the following chemical designation: m C es m C eo m C eo A eo A eo T ds A ds G ds A dsT ds T ds m C ds A ds A ds m C ds T eo A eo G es m C es m C e (Array No. 134); A es m C eo A eo m C eo A eo A ds m C ds T ds m C ds T ds T ds T ds A ds m C ds A ds A eo m C eo A es A es A e (Array No. 411); T es m C eo T eo m C eo m C eo A ds G ds A ds m C ds A ds T ds T ds T ds m C ds T ds G eo A eo T es G es m C e (Array No. 934); Ges T eo G eo T eo G eo T ds T ds A ds A ds A ds A ds T ds T ds G ds m C ds A eo A eo T es T es m C e (SEQ ID NO: 1238); A es T eo T eo G eo m C eo A ds A ds T ds T ds m C ds T ds A ds T ds A ds T ds m C eo A eo G es A es A e (SEQ ID NO: 2010); A es T eo G eo T eo G eo A ds T ds m C ds T ds A ds T ds A ds T ds m C ds A ds G eo G eo A es G es A e (SEQ ID NO: 1772); or A es m C eo m C eo A eo G eo A ds G ds G ds G ds m C ds m C ds A ds T ds m C ds T ds <\(0000168\)>C eo A eo G es G es T e (SEQ ID NO: 881) T es G eo T eo A eo G eo T ds A<000018\(0\)> m C ds A ds A ds A ds T ds m C ds T ds T ds T eo m C eo m C es T es T e (SEQ ID NO: 2101); G es m C eo A eo T eo m C eo A ds G ds A ds T ds G ds T ds T ds m C ds A ds T ds m C Note: It seems the original text might be some kind of sequence data. The translated text keeps the special tags and the line breaks as per the requirements. If there are any specific formatting or content-related issues in the original that need further clarification, it would be beneficial for a more accurate translation. Also, the "SEQ ID NO" is a common abbreviation in biological or technical contexts for "Sequence Identification Number".eo T eo m C es T es T e (SEQ ID NO: 1050); m C es m C eo T eo m C eo m C eo A ds T ds T ds m C ds m C ds T ds T ds T ds G ds T ds G eo A eo m C es T es T e (SEQ ID NO: 1449), In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, The oligomeric compound wherein o is a phosphodiester internucleoside linkage.

[0102] Embodiment 32. An oligomeric compound having the following chemical designation: T es G eo T eo A eo G eo T ds A ds m Cds A ds A ds A ds T ds m C ds T ds T ds T eo m C eo m C es T es T e (SEQ ID NO: 2101), A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, The oligomeric compound wherein o is a phosphodiester internucleoside linkage.

[0103] Embodiment 33. An oligomeric compound having the following chemical designation: A es m C eo A eo A eo A eo T eo m C ds T ds T ds T ds m C ds m C ds T ds T ds m C ds A ds A eo T es T es A e (SEQ ID NO: 682), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, The oligomeric compound wherein o is a phosphodiester internucleoside linkage.

[0104] Embodiment 34. An oligomeric compound having the following chemical designation: m C es A eo G eo A eo T eo G eo T ds T ds m C ds A ds T ds m C ds T ds m C ds T ds T ds m C eo A es m C es A e (SEQ ID NO: 1124), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, The oligomeric compound wherein o is a phosphodiester internucleoside linkage.

[0105] Embodiment 35. An oligomeric compound having the following chemical designation: m C es A eo T eo m C eo A eo G eo A ds T ds G ds T ds T ds m C ds A ds T ds m C ds T ds m C eo T es T es m C e (SEQ ID NO: 2145), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, The oligomeric compound wherein o is a phosphodiester internucleoside linkage.

[0106] Embodiment 36. The oligomeric compound of any one of embodiments 1 to 35, wherein the oligomeric compound is a single-stranded oligomeric compound.

[0107] Embodiment 37. The oligomeric compound of any one of embodiments 1 to 36, consisting of the modified oligonucleotide.

[0108] Embodiment 38. The oligomeric compound of any one of embodiments 1 to 36, further comprising a conjugate group.

[0109] Embodiment 39. The oligomeric compound of embodiment 38, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

[0110] Embodiment 40. The oligomeric compound of embodiment 38, wherein the conjugate group comprises a GalNAc cluster comprising 1 to 3 GalNAc ligands.

[0111] Embodiment 41 The oligomeric compound of embodiment 38 or 39, wherein the conjugate linker consists of a single bond.

[0112] Embodiment 42 The oligomeric compound of embodiment 39 or 41, wherein the conjugate linker is cleavable.

[0113] Embodiment 43. The oligomeric compound of embodiment 39 or 42, wherein the conjugate linker comprises 1 to 3 linker nucleosides.

[0114] Embodiment 44. The oligomeric compound of any of Embodiments 38-43, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide.

[0115] Embodiment 45. The oligomeric compound of any of Embodiments 38-43, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

[0116] Embodiment 46. The oligomeric compound of any one of embodiments 1-36 or 38-45, further comprising a terminal group.

[0117] Embodiment 47. The oligomeric compound of any one of embodiments 1-42 or 44-46, wherein the oligomeric compound does not comprise a linker nucleoside.

[0118] Embodiment 48. The oligomeric compound of any one of Embodiments 1 to 47, wherein said modified oligonucleotide of said oligomeric compound is a salt, and said salt is a sodium salt or a potassium salt.

[0119] Embodiment 49. The oligomeric compound of any one of embodiments 1 to 48, wherein the modified oligonucleotide is an RNAi compound.

[0120] Embodiment 50. An oligomeric duplex comprising an oligomeric compound according to any one of embodiments 1-35 or 37-49.

[0121] Embodiment 51. An antisense compound comprising or consisting of an oligomeric compound according to any one of embodiments 1 to 49 or an oligomeric duplex according to embodiment 50.

[0122] Embodiment 52. The following chemical structure: [ka] (SEQ ID NO: 2101) The modified oligonucleotide or a salt thereof according to the above.

[0123] Embodiment 53. The modified oligonucleotide of embodiment 52, which is a sodium salt or a potassium salt.

[0124] Embodiment 54. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 2101)

[0125] Embodiment 55. The following chemical structure: [ka] (SEQ ID NO: 682) The modified oligonucleotide or a salt thereof according to the above.

[0126] Embodiment 56. The modified oligonucleotide of embodiment 55, which is a sodium salt or a potassium salt.

[0127] Embodiment 57. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 682).

[0128] Embodiment 58. The following chemical structure: [ka] (SEQ ID NO: 1124) The modified oligonucleotide or a salt thereof according to the above.

[0129] Embodiment 59. The modified oligonucleotide of embodiment 58, which is a sodium salt or a potassium salt.

[0130] Embodiment 60. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 1124).

[0131] Embodiment 61. The following chemical structure: [ka] (SEQ ID NO: 2145) The modified oligonucleotide or a salt thereof according to the above.

[0132] Embodiment 62. The modified oligonucleotide of embodiment 61, which is a sodium salt or a potassium salt.

[0133] Embodiment 63. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 2145).

[0134] Embodiment 64. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1 to 49, an oligomeric duplex according to embodiment 50, an antisense compound according to embodiment 51, or a modified oligonucleotide according to any one of embodiments 52 to 63, and a pharmaceutically acceptable diluent or carrier.

[0135] Embodiment 65. The pharmaceutical composition of embodiment 64, comprising a pharmaceutically acceptable diluent, wherein said pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate buffered saline (PBS).

[0136] Embodiment 66 The pharmaceutical composition of embodiment 65, wherein the pharmaceutical composition consists essentially of the oligomeric compound or the modified oligonucleotide and aCSF.

[0137] Embodiment 67. The pharmaceutical composition of embodiment 65, wherein the pharmaceutical composition consists essentially of the oligomeric compound or the modified oligonucleotide and PBS.

[0138] Embodiment 68. A pharmaceutical composition comprising the modified oligonucleotide of any one of embodiments 52 to 63 and a pharmaceutically acceptable diluent.

[0139] Embodiment 69. The pharmaceutical composition of embodiment 68, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate buffered saline (PBS).

[0140] Embodiment 70. The pharmaceutical composition of embodiment 69, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and aCSF.

[0141] Embodiment 71. The pharmaceutical composition of embodiment 69, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and PBS.

[0142] Embodiment 72. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 32 to 35 and a pharmaceutically acceptable diluent.

[0143] Embodiment 73. The pharmaceutical composition of embodiment 72, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate buffered saline (PBS).

[0144] Embodiment 74. The pharmaceutical composition of embodiment 73, wherein the pharmaceutical composition consists essentially of the oligomeric compound and aCSF.

[0145] Embodiment 75. The pharmaceutical composition of embodiment 73, wherein the pharmaceutical composition consists essentially of the oligomeric compound and PBS.

[0146] Embodiment 76. A chirally enriched population of modified oligonucleotides according to any one of embodiments 52 to 63, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

[0147] Embodiment 77. The chirally enriched population of embodiment 76, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration.

[0148] Embodiment 78. The chirally enriched population of embodiment 76, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Rp) configuration.

[0149] Embodiment 79. The chirally enriched population of embodiment 76, wherein the population is enriched for modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

[0150] Embodiment 80. The chiral enriched population of embodiment 79, wherein the population is enriched for modified oligonucleotides having an (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage.

[0151] Embodiment 81. The chirally enriched population of embodiment 79, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

[0152] Embodiment 82. The chirally enriched population of embodiment 79, wherein the population is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configuration in the 5' to 3' direction.

[0153] Embodiment 83. The population of modified oligonucleotides of any of embodiments 52-63, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are sterically random.

[0154] Embodiment 84. A chirally enriched population of oligomeric compounds according to any of embodiments 32-35, wherein the population is enriched for oligomeric compounds comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

[0155] Embodiment 85. The chirally enriched population of embodiment 84, wherein said population is enriched for oligomeric compounds comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration.

[0156] Embodiment 86. The chirally enriched population of embodiment 84, wherein said population is enriched for oligomeric compounds comprising at least one specific phosphorothioate internucleoside linkage having an (Rp) configuration.

[0157] Embodiment 87. The chirally enriched population of embodiment 84, wherein said population is enriched for oligomeric compounds having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

[0158] Embodiment 88. The chiral enriched population of embodiment 87, wherein the population is enriched for oligomeric compounds having an (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage.

[0159] Embodiment 89. The chirally enriched population of embodiment 87, wherein the population is enriched for oligomeric compounds having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

[0160] Embodiment 90. The chirally enriched population of embodiment 87, wherein said population is enriched for oligomeric compounds having at least three consecutive phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configuration in the 5' to 3' direction.

[0161] Embodiment 91. The population of oligomeric compounds of any of embodiments 32-35, wherein all of the phosphorothioate internucleoside linkages of said modified oligonucleotides are sterically random.

[0162] Embodiment 92. A pharmaceutical composition comprising a chiral enriched population according to any of embodiments 76-82 or 84-90, or the population according to claim 83, or the population according to claim 91, and a pharmaceutically acceptable diluent.

[0163] Embodiment 93. The pharmaceutical composition of claim 92, wherein the pharmaceutically acceptable diluent is artificial CSF (aCSF) or phosphate buffered saline (PBS).

[0164] Embodiment 94. The pharmaceutical composition of claim 93, wherein the pharmaceutical composition consists essentially of the oligomeric compound or the modified oligonucleotide and artificial CSF (aCSF).

[0165] Embodiment 95. The pharmaceutical composition of embodiment 93, wherein the pharmaceutical composition consists essentially of the oligomeric compound or the modified oligonucleotide and PBS.

[0166] Embodiment 96. A method comprising administering to an animal a pharmaceutical composition according to any one of embodiments 64-75 or 92-95.

[0167] Embodiment 97. A method for treating a disease or disorder associated with PLP1, comprising administering to a subject having or at risk of developing a disease associated with PLP1 a therapeutically effective amount of a pharmaceutical composition described in any of embodiments 64-75 or 92-95, thereby treating the disease or disorder associated with PLP1.

[0168] Embodiment 98. A method for reducing PLP1 protein in the CSF of a subject having or at risk of developing a disease or disorder associated with PLP1, wherein the PLP1 protein is reduced in the CSF by a therapeutically effective amount of a pharmaceutical composition described in any of embodiments 64-75 or 92-95.

[0169] Embodiment 99. The method of embodiment 97 or 98, wherein the disease or disorder associated with PLP1 is a neurodegenerative disease.

[0170] Embodiment 100. The method of any of embodiments 97-99, wherein the disease or disorder associated with PLP1 is a leukodystrophy.

[0171] Embodiment 101. The method of embodiment 100, wherein the leukodystrophy is PMD.

[0172] Embodiment 102. The method of embodiment 101, wherein the PMD is severe PMD, standard PMD, or accelerated PMD.

[0173] Embodiment 103 The method of embodiment 101, wherein the PMD is caused by overexpression of PLP1 protein.

[0174] Embodiment 104 The method of embodiment 101, wherein the PMD is caused by multiple copies of the PLP1 gene.

[0175] Embodiment 105. The method of embodiment 101, wherein the PMD is caused by expression of a duplicate copy of the PLP1 gene.

[0176] Embodiment 106. The method of any one of embodiments 100-105, wherein at least one symptom or feature of the leukodystrophy is ameliorated.

[0177] Embodiment 107. The method of embodiment 97 or 98, wherein the disease or disorder associated with PLP1 is SPG2.

[0178] Embodiment 108. The method of embodiment 107, wherein at least one symptom or characteristic of SPG2 is ameliorated.

[0179] Embodiment 109. The method of embodiment 106 or 108, wherein the symptom or feature is any of hypotonia, nystagmus, optic atrophy, dyspnea, motor slowness, cognitive impairment, language impairment, spasticity, ataxia, seizures, choroidal movement, and death.

[0180] Embodiment 110. The method of any of embodiments 96-109, wherein administering the modified oligonucleotide reduces hypotonia, nystagmus, optic atrophy, respiratory distress, motor slowing, cognitive impairment, language impairment, spasticity, ataxia, seizures, or choroidal movement, or delays death in the subject.

[0181] Embodiment 111. The method of any one of embodiments 96-110, wherein the pharmaceutical composition is administered to the central nervous system or systemically.

[0182] Embodiment 112. The method of embodiment 111, wherein the pharmaceutical composition is administered to the central nervous system or systemically.

[0183] Embodiment 113. The method of any of embodiments 96-110, wherein the pharmaceutical composition is administered intrathecally, systemically, subcutaneously, or intramuscularly.

[0184] Embodiment 114. A method for reducing PLP1 RNA in a cell, comprising contacting the cell with an oligomeric compound described in any one of Embodiments 1 to 49, an oligomeric duplex described in Embodiment 50, an antisense compound described in Embodiment 51, or a modified oligonucleotide described in any one of Embodiments 52 to 63, thereby reducing PLP1 RNA in the cell.

[0185] Embodiment 115. A method for reducing PLP1 protein in a cell, comprising contacting the cell with an oligomeric compound described in any one of embodiments 1 to 49, an oligomeric duplex described in embodiment 50, an antisense compound described in embodiment 51, or a modified oligonucleotide described in any one of embodiments 52 to 63, thereby reducing PLP1 protein in the cell.

[0186] Embodiment 116. The method of embodiment 114 or 115, wherein the cells are oligodendrocytes or oligodendrocyte precursor cells.

[0187] Embodiment 117. The method of embodiment 114 or 115, wherein the cells are Schwann cells or Schwann cell precursor cells.

[0188] Embodiment 118. The method of any one of embodiments 114 to 117, wherein the cell is in an animal.

[0189] Embodiment 119. The method of embodiment 96 or 118, wherein the animal is a human.

[0190] Embodiment 120. A method comprising administering to a subject the pharmaceutical composition of any of embodiments 68-71.

[0191] Embodiment 121. A method for treating a disease or disorder associated with PLP1, comprising administering to a subject having or at risk of developing a disease or disorder associated with PLP1 a therapeutically effective amount of a pharmaceutical composition described in any of embodiments 68 to 71, thereby treating the disease or disorder associated with PLP1.

[0192] Embodiment 122. The method of embodiment 121, wherein the disease associated with PLP1 is a neurodegenerative disease.

[0193] Embodiment 123. The method of embodiment 122, wherein the neurodegenerative disease is a leukodystrophy.

[0194] Embodiment 124. The method of embodiment 123, wherein the leukodystrophy is PMD.

[0195] Embodiment 125. The method of embodiment 124, wherein the PMD is severe PMD, standard PMD, or accelerated PMD.

[0196] Embodiment 126. The method of embodiment 124, wherein the PMD is caused by overexpression of PLP1 protein.

[0197] Embodiment 127. The method of embodiment 124, wherein the PMD is caused by multiple copies of the PLP1 gene.

[0198] Embodiment 128. The method of embodiment 124, wherein the PMD is caused by expression of a duplicate copy of the PLP1 gene.

[0199] Embodiment 129. The method of any of embodiments 122-128, wherein at least one symptom or feature of the neurodegenerative disease is ameliorated.

[0200] Embodiment 130. The method of embodiment 129, wherein the symptom or feature is any of hypotonia, nystagmus, optic atrophy, dyspnea, motor slowness, cognitive impairment, language impairment, spasticity, ataxia, seizures, choroidal movement, and death.

[0201] Embodiment 131. The method of any of embodiments 121-130, wherein administering the pharmaceutical composition reduces hypotonia, nystagmus, optic atrophy, dyspnea, motor slowness, cognitive impairment, language impairment, spasticity, ataxia, seizures, or choroidal movement, or delays death in the subject.

[0202] Embodiment 132. The method of any one of embodiments 120 to 131, wherein the subject is a human.

[0203] Embodiment 133. A method of reducing the expression of PLP1 in a cell, comprising contacting the cell with a modified oligonucleotide of any of embodiments 52 to 63.

[0204] Embodiment 134. The method of embodiment 133, wherein the cells are human cells.

[0205] Embodiment 135. Use of an oligomeric compound according to any one of embodiments 1 to 49, an oligomeric duplex according to embodiment 50, an antisense compound according to embodiment 51, or a modified oligonucleotide according to any one of embodiments 52 to 63 to reduce expression of PLP1 in a cell.

[0206] Embodiment 136. The use of embodiment 135, wherein the RNA level of PLP1 is reduced in the cell.

[0207] Embodiment 137. The use of embodiment 135, wherein the level of the PLP1 protein in the cell is reduced.

[0208] Embodiment 138. The use of any of embodiments 133 to 137, wherein the cells are oligodendrocytes or oligodendrocyte precursor cells.

[0209] Embodiment 139. The use of any of embodiments 133 to 137, wherein the cells are Schwann cells or Schwann cell precursor cells.

[0210] Specific oligonucleotides In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides composed of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. The modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA. That is, the modified oligonucleotides contain at least one modified nucleoside (a nucleoside containing a modified sugar and / or modified nucleobase) and / or at least one modified internucleoside linkage.

[0211] A. Certain modified nucleosides A modified nucleoside comprises a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.

[0212] 1. Specific sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substitutions that correspond to the substitutions of other types of substituted sugar moieties.

[0213] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring bearing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be at any position on the furanosyl, including, but not limited to, substituents at the 2', 4', and / or 5' positions. In certain embodiments, one or more of the non-bridging substituents on the non-bicyclic modified sugar moiety is branched. Examples of suitable 2'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE" or "O-methoxyethyl"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C1C 10 Alkoxy, O-C1~C 10Substituted alkoxy, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), or OCH2C(=O)-N(R m )(R n ), where each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10 Alkyl and 2'-substituents described in Cook et al., US Pat. No. 6,531,584, Cook et al., US Pat. No. 5,859,221, and Cook et al., US Pat. No. 6,005,087. Certain embodiments of these 2'-substituents can be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugar moieties include multiple non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties, as well as modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0214] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is selected from the group consisting of F, NH, N, OCF 3、 OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(R m )(R n )) wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10 It is alkyl.

[0215] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is F, OCF 3、 and a sugar moiety containing a non-bridging 2'-substituent selected from OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0216] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety comprising a non-bridging 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.

[0217] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by their isomeric configuration. For example, 2'-deoxyfuranosyl sugar moieties may have seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO 2019 / 157531, which is incorporated herein by reference. 2'-modified sugar moieties have an additional stereocenter at the 2'-position relative to the 2'-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of 16 possible isomeric configurations. 2'-modified sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified.

[0218] Certain modified sugar moieties include substituents that bridge two atoms of a furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. Nucleosides containing such bicyclic sugar moieties are called bicyclic nucleosides (BNAs), locked nucleosides, or conformationally restricted nucleotides (CRNs). Certain such compounds are described in U.S. Patent Publication No. 2013 / 0190383 and PCT Publication WO2013 / 036868. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring.Examples of such 4' to 2' bridging sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt" when in the S configuration), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (e.g., Seth et al., US 7,399,845, Bhat et al., US 7,569,686, Swayze et al., US 7,569,686). al., US 7,741,457, and Swayze et al., US 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., US 7,696,345, and Allerson et al., US 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., US 7,696,345, and Allerson et al., US 8,124,745), al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, for example, Seth et al., US Pat. No. 8,278,426), 4'-C(R. a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', wherein each R, R a , and R b are independently H, a protecting group, or C1-C 12 and alkyl (see, for example, Imanishi et al., US Pat. No. 7,427,672).

[0219] In certain embodiments, such a 4' to 2' bridge is -[C(R a )(R b )] n -, -[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-; During the ceremony, x is 0, 1, or 2, n is 1, 2, 3, or 4; Each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); Each J1 and J2 is independently H, C1 to C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 aminoalkyl, or a protecting group.

[0220] The particle size of the solvent was determined by Freier et al.,Nucleic Acids Research,1997,25(22),4429-4443,Albaek et al.,J.Org.Chem.,2006,71,7731-7740,Singh et al.,Chem.Commun.,1998,4,455-456;Koshkin et al al.,Tetrahedron,1998,54,3607-3630;Wahlestedt et al.,Proc.Natl.Acad.Sci.USA,2000,97,5633-5638;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,2219-2222;Singh et al al.,J.Org.Chem.,1998,63,10035-10039;Srivastava et al.,J.Am.Chem.Soc.,2007,129,8362-8379;Elayadi et al.,Curr.Opinion Invens.Drugs,2001,2,558-561;Braasch et al al.,Chem.Biol.,2001,8,1-7;Orum et al.,Curr.Opinion Mol.Ther.,2001,3,239-243;Wengel et al.,US7,053,207,Imanishi et al.,US6,268,490,Imanishi et al.US6,770,748,Imanishi et al al.,USRE44,779;Wengel et al.,US6,794,499,Wengel et al.,US6,670,461;Wengel et al.,US7,034,133,Wengel et al.,US8,080,644; al.,US7,572,582;In addition to Ramasamy et al.,US6,525,191,Torsten et al.,WO 2004 / 106356,Wengel et al.,WO 1999 / 014226;Seth et al.,WO 2007 / 134181;Seth et al.,US7,547,684;Seth et al.,US7,666,854;Seth et al.,US8,088,746;Seth et al.,US7,750,131;Seth et al.,US8,030,467;Seth et al. al.,US8,268,980;Seth et al.,US8,546,556;Seth et al.,US8,530,640;Migawa et al.,US9,012,421;Seth et al.,US8,501,805;Allerson et al.,US2008 / 0039618;and Migawa et al. See al.,US2015 / 0191727. In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration.

[0221] [ka] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that have demonstrated antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. In the illustrated embodiments of this specification, when the position of a particular bicyclic nucleoside (e.g., LNA or cEt) is specified, they are in the β-D configuration unless otherwise specified.

[0222] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2'-bridged sugars).

[0223] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur atom, a carbon atom, or a nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4'-sulfur atom and substitutions at the 2'-position (see, e.g., Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or the 5'-position.

[0224] In certain embodiments, the sugar surrogate comprises a ring with more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered ring tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA: [ka] ("F-HNA", see, e.g., Swayze et al., US 8,088,904; Swayze et al., US 8,440,803; Swayze et al., US 8,796,437; and Swayze et al., US 9,005,906; F-HNA can also be referred to as F-THP or 3'-fluorotetrahydropyran), and nucleosides including further modified THP compounds having the formula: [ka] wherein, independently for each of the modified THP nucleosides: Bx is a nucleobase moiety, T3 and T4 are each independently an internucleoside linking group linking the modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linking conjugate group, or a 5' or 3' terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; Each of R1 and R2 is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.

[0225] In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0226] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms and more than one heteroatom. For example, nucleosides containing morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510, and Summerton et al., US 5,698,685; Summerton et al., US 5,166,315; Summerton et al., US 5,185,444; and Summerton et al., US 5,034,506). As used herein, the term "morpholino" refers to a sugar surrogate having the following structure: [ka] In certain embodiments, morpholinos can be modified, for example, by adding or altering various substituents to the morpholino structure. Such sugar surrogates are referred to herein as "modified morpholinos."

[0227] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. CHem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in Manoharan et al., WO2011 / 133876.

[0228] Many other bicyclic and tricyclic sugars and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.

[0229] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotides comprise one or more nucleosides that contain unmodified nucleobases. In certain embodiments, modified oligonucleotides comprise one or more nucleosides that contain modified nucleobases. In certain embodiments, modified oligonucleotides comprise one or more nucleosides that do not contain a nucleobase, referred to as abasic nucleosides.

[0230] In certain embodiments, modified nucleobases are selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases are 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C≡C—CH3) uracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo In particular, 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Merigan et al., US 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0231] Publications that teach the preparation of certain of the above-mentioned and other modified nucleobases include Manoharan et al., US2003 / 0158403; Manoharan et al., US2003 / 0175906; Dinh et al., US4,845,205; Spielvogel et al., US5,130,302; Rogers et al., US5,134,066; Bischofberger et al., US5,175,273; Urdea et al., US5,367,066; Benner et al., US5,432,272; Matteucci et al., US5,434,257; Gmeiner et al., US5,457,187; Cook et al., US5,459,255; Froehler et al. al.,US5,484,908;Matteucci et al.,US5,502,177;Hawkins et al.,US5,525,711;Haralambidis et al.,US5,552,540;Cook et al.,US5,587,469;Froehler et al.,US5,594,121;Switzer et al. al.,US5,596,091;Cook et al.,US5,614,617;Froehler et al.,US5,645,985;Cook et al.,US5,681,941;Cook et al.,US5,811,534;Cook et al.,US5,750,692;Cook et al. al.,US5,948,903;Cook et al., US5,587,470; Cook et al., US5,457,191; Matteucci et al., US5,763,588; Froehler et al., US5,830,653; Cook et al., US5,808,027; Cook et al., US6,166,199; and Matteucci et al., US6,005,096.

[0232] 3. Specific modified internucleoside linkages In certain embodiments, the nucleosides of modified oligonucleotides may be linked to each other using any internucleoside linkage. Two major classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiesters containing phosphodiester linkages ("P(O2)=O") (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates ("P(O2)=S"), and phosphorodithioates ("HS-P=S"). Representative non-phosphorus-containing internucleoside linkages include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages can be used to alter, typically enhance, the nuclease resistance of oligonucleotides compared to naturally occurring phosphodiester internucleoside linkages. In certain embodiments, internucleoside linkages containing chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.

[0233] Representative internucleoside linkages having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages having a chiral center can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate internucleoside linkages of a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, where all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be produced using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate internucleoside linkage. Nevertheless, as will be appreciated by those skilled in the art, each individual phosphorothioate in each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in independently selected specific stereochemical configurations. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 65% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 70% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 80% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 90% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, for example, those described in Oka et al., JACS, 2003, 125, 8307, Wan et al., Nuc. Acid. Res., 2014, 42, 13456, and WO2017 / 015555.In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleobase: [ka] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be of stereo-random or specific stereochemical configuration.

[0234] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Additional neutral internucleoside linkages include nonionic linkages, including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonates, and amides (see, e.g., "Carbohydrate Modifications in Antisense Research"; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include nonionic linkages containing mixed N, O, S, and CH moieties.

[0235] B. Specific motifs In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising modified sugar moieties. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising modified nucleobases. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and otherwise modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif describes modifications to nucleobases that are independent of the sequence of the nucleobases).

[0236] 1. Specific glycomotifs In certain embodiments, oligonucleotides comprise one or more modified and / or unmodified sugar moieties arranged along the oligonucleotide or portions thereof in a defined pattern or sugar modification motif, which in certain instances includes, but is not limited to, any of the sugar modifications discussed herein.

[0237] In certain embodiments, modified oligonucleotides have a gapmer motif defined by two external regions, or "wings," and a central or internal region, or "gap." The three regions of a gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides, wherein at least a portion of the sugar moieties of each nucleoside in the wing differ from at least a portion of the sugar moieties of the nucleosides in the gap. Specifically, the sugar moieties of at least the nucleosides in each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) differ from the sugar moieties of the adjacent gap nucleosides, thereby defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are identical to each other. In certain embodiments, the gap contains one or more nucleosides having a sugar moiety that differs from the sugar moieties of one or more other nucleosides in the gap. In certain embodiments, the sugar motifs of the two wings are the same as each other (symmetric gapmers). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmers).

[0238] In certain embodiments, a gapmer wing comprises 1 to 6 nucleosides. In certain embodiments, each nucleoside in each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside in each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least three nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least four nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least five nucleosides in each wing of a gapmer comprise a modified sugar moiety.

[0239] In certain embodiments, the gapmer gap comprises 7 to 12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-deoxyribosyl sugar moiety. In certain embodiments, at least 6 nucleosides of the gapmer gap comprise a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a 2'-OMe sugar moiety.

[0240] In certain embodiments, the gapmer is a deoxygapmer. In certain embodiments, nucleosides on the gap side of each wing / gap junction comprise a 2'-deoxyribosyl sugar moiety, and nucleosides on the wing side of each wing / gap junction comprise a modified sugar moiety. In certain embodiments, at least six nucleosides of the gap of the gapmer comprise a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of the gap of the gapmer comprises a 2'-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of the gapmer comprises a modified sugar moiety. In certain embodiments, one nucleoside of the gap comprises a modified sugar moiety, and each remaining nucleoside of the gap comprises a 2'-deoxyribosyl sugar moiety.

[0241] In certain embodiments, a modified oligonucleotide comprises or consists of a portion having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside throughout the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises or consists of a portion having a fully modified sugar motif, wherein each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified nucleotide comprises the same 2' modification.

[0242] Herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [number of nucleosides in the 5'-wing] - [number of nucleosides in the gap] - [number of nucleosides in the 3'-wing]. Thus, a 5-10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap. When such nomenclature is followed by a specific modification, the modification is a modification of each sugar moiety in each wing, and the nucleosides in the gap contain a 2'-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2'-MOE nucleosides in the 5'-wing, 10 linked 2'-β-D-deoxynucleosides in the gap, and 5 linked 2'-MOE nucleosides in the 3'-wing. A 3-10-3 cEt gapmer consists of three linked cEt nucleosides in the 5'-wing, ten linked 2'-β-D-deoxynucleosides in the gap, and three linked cEt nucleosides in the 3'-wing. A 5-8-5 gapmer consists of five linked nucleosides with modified sugar moieties in the 5'-wing, eight linked 2'-β-D-deoxynucleosides in the gap, and five linked nucleosides with modified sugar moieties in the 3'-wing. A mixed wing gapmer has at least two different modified sugar moieties in the 5'- and / or 3'-wing. A 5-8-5 or 5-8-4 mixed wing gapmer has at least two different modified sugar moieties in the 5'- and / or 3'-wing.

[0243] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 6-10-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 4-10-6 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 4-8-6 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 6-8-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 5-8-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-7 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 7-10-3 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 5-8-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 5-9-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is an MOE gapmer of XYZ, where X and Z are independently selected from 1, 2, 3, 4, 5, 6, or 7 linked 2'-MOE nucleosides and Y is selected from 7, 8, 9, 10, or 11 linked deoxynucleosides.

[0244] In certain embodiments, modified oligonucleotides have the following sugar motifs (in 5' to 3' order): eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, or eeeeedyddddddddeeeee, where "d" represents a 2'-deoxyribosyl sugar moiety, "e" represents a 2'-MOE sugar moiety, and "y" represents a 2'-OMe sugar moiety.

[0245] 2. Specific nucleobase motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or portions thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases of the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosine, and all other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0246] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3'-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides from the 3'-end of the oligonucleotide. In certain embodiments, the block is at the 5'-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides from the 5'-end of the oligonucleotide.

[0247] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside containing a modified nucleobase. In certain such embodiments, one nucleoside containing a modified nucleobase is located in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.

[0248] 3. Specific internucleoside linkage motifs In certain embodiments, oligonucleotides contain modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or portions thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereo-random phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and all internucleoside linkages within the gap are modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein at least one phosphodiester internucleoside linkage is not a terminal internucleoside linkage and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate internucleosides are sterically random. In certain embodiments, all of the phosphorothioate internucleoside linkages in the wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides comprising such internucleoside linkage motifs.

[0249] In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of soooossssssssssooss or soooooossssssssssoss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0250] C. A specific length The length of the oligonucleotide can be increased or decreased without loss of activity. For example, Woolf et al. (Proc. Natl. Acad. Sci. USA, 1992, 89:7305-7309, 1992) examined a series of oligonucleotides ranging from 13 to 25 nucleobases in length for their ability to induce cleavage of a target nucleic acid in an oocyte injection model. 25 nucleobase-long oligonucleotides with 8 or 11 mismatched bases near the end of the oligonucleotide were able to direct specific cleavage of the target nucleic acid, although to a lesser extent than oligonucleotides containing no mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.

[0251] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of linked nucleosides X through Y, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X is less than or equal to Y. For example, in certain embodiments, the oligonucleotides are 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13 ...3-20, 13-21, 13-22, 13-23, 13-24, 13-25, 13-26, 13-27, 13-28, 13-29, 12-30, 13-31, 13-32, 1 9, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 13-26, 13-27, 13-28, 13-29, 13-30, 14-15, 14-16, 14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, 14-25, 14-26, 14-27, 14-28, 14-29, 14-30, 15- 16, 15-17, 15-18, 15-19, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28, 15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16-29, 1 6-30, 17-18, 17-19, 17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27, 17-28, 17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 18-25, 18-26, 18-27, 18-28, 18-29, 18-30, 19-20, 19-21,19-22, 19-23, 19-24, 19-25, 19-26, 19-29, 19-28, 19-29, 19-30, 20-21, 20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23, 22-24, 22-25, 22-26, 22-27, 22- 28, 22-29, 22-30, 23-24, 23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked nucleosides.

[0252] In certain embodiments, the oligonucleotide consists of 16 linked nucleosides. In certain embodiments, the oligonucleotide consists of 17 linked nucleosides. In certain embodiments, the oligonucleotide consists of 18 linked nucleosides. In certain embodiments, the oligonucleotide consists of 19 linked nucleosides. In certain embodiments, the oligonucleotide consists of 20 linked nucleosides.

[0253] D. Certain Modified Oligonucleotides In certain embodiments, the above-described modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motif and overall length. In certain embodiments, each of these parameters is independent of the other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif can be modified or unmodified, and can or can not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages within the wing regions of a sugar gapmer can be the same or different from each other and can be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides can contain one or more modified nucleobases regardless of the gapmer pattern of sugar modification. Unless otherwise indicated, all modifications are independent of the nucleobase sequence.

[0254] E. Specific populations of modified oligonucleotides A population of modified oligonucleotides, in which all modified oligonucleotides in the population have the same molecular formula, can be a stereo-random population or a chiral enriched population. All chiral centers of all modified oligonucleotides are stereo-random in a stereo-random population. In a chiral enriched population, at least one specific chiral center is not stereo-random in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chiral enriched population are enriched for β-D ribosyl sugar moieties and all phosphorothioate internucleoside linkages are stereo-random. In certain embodiments, the modified oligonucleotides of a chiral enriched population are enriched for both β-D ribosyl sugar moieties in a specific stereochemical configuration and at least one specific phosphorothioate internucleoside linkage.

[0255] F. Nucleic Acid Sequence In certain embodiments, oligonucleotides (unmodified or modified) are further described by their nucleobase sequence. In certain embodiments, the oligonucleotides have a nucleobase sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or target nucleic acid. In certain such embodiments, a portion of the oligonucleotide has a nucleobase sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or target nucleic acid. In certain embodiments, the nucleobase sequence of a portion or the entire oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a nucleic acid, such as a second oligonucleotide or target nucleic acid.

[0256] I. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds comprising an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. A conjugate group comprises one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. A conjugate group may be attached to either or both ends of an oligonucleotide and / or any internal position. In certain embodiments, a conjugate group is attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to either or both ends of an oligonucleotide is a terminal group. In certain such embodiments, a conjugate group or terminal group is attached to the 3'-end and / or 5'-end of an oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached to the 3'-end of an oligonucleotide. In certain embodiments, a conjugate group is attached near the 3'-end of an oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached to the 5'-end of an oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.

[0257] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, an abasic nucleoside, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified.

[0258] A. Specific Conjugate Groups In certain embodiments, the oligonucleotide is covalently linked to one or more conjugate groups. In certain embodiments, the conjugate group modifies one or more properties of the linked oligonucleotide, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In certain embodiments, the conjugate group confers a new property to the linked oligonucleotide, such as a fluorophore or reporter group that allows detection of the oligonucleotide. Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantaneacetic acid, palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or N-acetylgalactosamine (GalNAc) cluster (e.g., WO2014 / 179620).

[0259] In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0260] In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0261] 1. Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

[0262] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazine, chlorothiazide, diazepine, indomethacin, barbiturate, cephalosporin, sulfa drug, antidiabetic, antibacterial, or antibiotic.

[0263] 2. Conjugate Linker The conjugate moiety is attached to the oligonucleotide via a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single bond (i.e., the conjugate moiety is directly attached to the oligonucleotide via a single bond). In certain oligomeric compounds, the conjugate moiety is attached to the oligonucleotide via a more complex conjugate linker, which includes one or more conjugate linker moieties, which are subunits that make up the conjugate linker. In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units, such as ethylene glycol, nucleoside, or amino acid units.

[0264] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amido, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amido, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amido groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0265] In certain embodiments, conjugate linkers, including those described above, are bifunctional linking moieties known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. Generally, bifunctional linking moieties contain at least two functional groups. One functional group is selected to bind to a specific site on the parent compound, and the other functional group is selected to bind to the conjugate group. Examples of functional groups used in bifunctional linking moieties include, but are not limited to, electrophilic groups for reacting with nucleophilic groups and nucleophilic groups for reacting with electrophilic groups. In certain embodiments, the bifunctional linking moiety contains one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0266] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 Including, but not limited to, alkynyl, where a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0267] In certain embodiments, a conjugate linker comprises 1 to 10 linker nucleosides. In certain embodiments, a conjugate linker comprises 2 to 5 linker nucleosides. In certain embodiments, a conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, a conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, a linker nucleoside is unmodified. In certain embodiments, a linker nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is typically desirable for the linker nucleosides to be cleaved from the oligomeric compound after reaching the target tissue. Therefore, the linker nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0268] As used herein, linker nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group containing a conjugate linker comprising linker nucleosides, these linker nucleosides are not counted in the length of the oligonucleotide and are not used to determine the percentage complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8 to 30 nucleosides and (2) a conjugate group containing 1 to 10 linker nucleosides adjacent to the nucleosides of the modified oligonucleotide. The total number of adjacent linked nucleosides in such an oligomeric compound is greater than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8 to 30 nucleosides but without a conjugate group. The total number of adjacent linked nucleosides in such an oligomeric compound is 30 or less. Unless otherwise specified, a conjugate linker comprises 10 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 5 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 3 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 2 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises only 1 linker nucleoside.

[0269] In certain embodiments, it is desirable for the conjugate group to be cleaved from the oligonucleotide. For example, in certain situations, oligomeric compounds containing certain conjugate moieties are more likely to be taken up by certain cell types, and after the oligomeric compound is taken up, it is desirable for the conjugate group to be cleaved to release the unconjugated or parent oligonucleotide. Therefore, certain conjugate linkers may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group of atoms containing at least one cleavable bond. In certain embodiments, the cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside the cell or in an intracellular compartment such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme such as a nuclease.

[0270] In certain embodiments, the cleavable bond is selected from among an amide bond, an ester bond, an ether bond, one or both ester bonds of a phosphodiester bond, a phosphate ester bond, a carbamate bond, or a disulfide bond. In certain embodiments, the cleavable bond is one or both ester bonds of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate or a phosphodiester bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0271] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, the one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside that is linked to either the 3'- or 5'-terminal nucleoside of the oligonucleotide by a phosphodiester internucleoside bond and covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate internucleoside bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0272] 3.Cell targeting part In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group has the general formula: [ka] In the formula, n is 1 to about 3, when n is 1, m is 0, when n is 2 or more, m is 1, j is 1 or 0, and k is 1 or 0.

[0273] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0274] In certain embodiments, the conjugate group comprises a cell-targeting moiety having at least one tethered ligand. In certain embodiments, the cell-targeting moiety comprises two tethered ligands covalently attached to a branching group. In certain embodiments, the cell-targeting moiety comprises three tethered ligands covalently attached to a branching group.

[0275] B. Specific end groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include, but are not limited to, 5'-phosphonates, including, but not limited to, 5'-vinylphosphonates. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or reverse nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleosides are abasic nucleosides.

[0276] III. Oligomeric Duplexes In certain embodiments, the oligomeric compounds described herein comprise an oligonucleotide having a nucleobase sequence complementary to the nucleobase sequence of a target nucleic acid. In certain embodiments, the oligomeric compound pairs with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex comprises a first oligomeric compound having a portion complementary to the target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and, optionally, a conjugate group, and (2) a second modified or unmodified oligonucleotide and, optionally, a conjugate group. One or both oligomeric compounds of the oligomeric duplex may comprise a conjugate group. The oligonucleotide of each oligomeric compound of the oligomeric duplex may comprise a non-complementary overhanging nucleoside.

[0277] IV. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to a target nucleic acid and produce at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, an antisense compound has antisense activity if it reduces the amount or activity of the target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, an antisense compound selectively affects one or more target nucleic acids. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acids to produce one or more desired antisense activities, but does not hybridize to one or more non-target nucleic acids, or does not hybridize to one or more non-target nucleic acids in a manner that results in significant undesired antisense activity.

[0278] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, described herein are antisense compounds that are sufficiently "DNA-like" to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the gap of a gapmer are tolerated.

[0279] In certain antisense activity, antisense compound or part of antisense compound is incorporated into RNA-induced silencing complex (RISC), which ultimately leads to the cleavage of target nucleic acid.For example, certain antisense compound leads to the cleavage of target nucleic acid by Argonaute.The antisense compound that is incorporated into RISC is RNAi compound.RNAi compound can be double-stranded (siRNA) or single-stranded (ssRNA).

[0280] In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in a change in the splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in the inhibition of binding interactions between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in a change in the translation of the target nucleic acid.

[0281] Antisense activity may be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity comprises observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of the nucleic acid or protein, and / or a change in the phenotype of a cell or subject.

[0282] V. Specific Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a portion complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA comprising intronic regions, exonic regions, and untranslated regions. In certain embodiments, the target nucleic acid is mature mRNA. In certain embodiments, the target nucleic acid is pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron.

[0283] A. Complementarity / Mismatch with Target Nucleic Acid It is possible to introduce mismatched bases without abolishing activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide also exhibited potent antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14-nucleobase oligonucleotides, as well as 28- and 42-nucleobase oligonucleotides composed of sequences of two or three tandem oligonucleotides, for their ability to terminate human DHFR translation in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, although to a lesser extent than the 28 or 42 nucleobase oligonucleotides.

[0284] In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a portion that is 100% or completely complementary to the target nucleic acid. In certain embodiments, the completely complementary portion is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleobases in length.

[0285] In certain embodiments, the oligonucleotide contains one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, such mismatches reduce antisense activity against the target, but further reduce activity against non-targets. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatches are specifically located within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatches are located at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 from the 5' end of the gap region. In certain embodiments, the mismatches are located at positions 1, 2, 3, 4, 5, or 6 from the 5' end of the 5' wing region or 3' wing region.

[0286] B.PLP1 In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide complementary to a target nucleic acid, wherein the target nucleic acid is a nucleic acid of PLP1. In certain embodiments, the nucleic acid of PLP1 has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession Number: NM_001128834.2) or SEQ ID NO: 2 (GENBANK Accession Number NC_000023.11, truncated from nucleotides 103773001 to 103795000).

[0287] In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2 reduces the amount of PLP1 RNA in the cell, and in certain embodiments, reduces the amount of PLP1 protein in the cell. In certain embodiments, contacting a cell with a modified oligonucleotide complementary to SEQ ID NO:1 or SEQ ID NO:2 reduces the amount of PLP1 RNA in the cell, and in certain embodiments, reduces the amount of PLP1 protein in the cell. In certain embodiments, the cell is in a test tube. In certain embodiments, the cell is in a subject. In certain embodiments, contacting a cell in a subject with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2 ameliorates one or more symptoms or characteristics of a leukodystrophy. In certain embodiments, the leukodystrophy is PMD. In certain embodiments, the symptom or characteristic is selected from hypotonia, nystagmus, optic atrophy, respiratory distress, motor delay, cognitive impairment, language impairment, spasticity, ataxia, seizures, or choroidal movement. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide.

[0288] In certain embodiments, oligomeric compounds complementary to SEQ ID NO: 1 or SEQ ID NO: 2 are capable of reducing the detectable amount of PLP1 RNA in a standard in vitro assay by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vitro. In certain embodiments, oligomeric compounds complementary to SEQ ID NO: 1 or SEQ ID NO: 2 are capable of reducing the amount of PLP1 protein detectable in a standard in vitro assay by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vitro. In certain embodiments, oligomeric compounds complementary to SEQ ID NO: 1 or SEQ ID NO: 2 can reduce the detectable amount of PLP1 RNA in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to standard in vivo assays. In certain embodiments, oligomeric compounds complementary to SEQ ID NO: 1 or SEQ ID NO: 2 can reduce the detectable amount of PLP1 protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to standard in vivo assays. In certain embodiments, oligomeric compounds complementary to SEQ ID NO: 1 or SEQ ID NO: 2 can reduce the detectable amount of PLP1 RNA in a subject's CSF by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 can reduce the detectable amount of PLP1 protein in a subject's CSF by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0289] C. Specific target nucleic acids in specific tissues In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is a cell or tissue comprising the central nervous system (CNS). Such tissues include the brain and spinal cord. In certain embodiments, the pharmacologically relevant tissue includes white matter tracts throughout the brain and spinal cord, including the corpus callosum, cortex, cerebellum, hippocampus, brainstem, striatum, and spinal cord. In certain embodiments, the pharmacologically relevant tissue includes the cortex, cerebellum, hippocampus, brainstem, and spinal cord. In certain embodiments, the pharmacologically relevant cells are oligodendrocytes and oligodendrocyte progenitor cells. In certain embodiments, the pharmacologically relevant cells are Schwann cells or Schwann cell progenitor cells.

[0290] VI. Certain Pharmaceutical Compositions In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, each of the one or more oligomeric compounds comprises a modified oligonucleotide. In certain embodiments, the pharmaceutical composition includes a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of sterile saline and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical-grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid ("artificial CSF" or "aCSF"). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical-grade.

[0291] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0292] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compounds and one or more excipients, hi certain such embodiments, the excipient is selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0293] In certain embodiments, the oligomeric compounds may be mixed with pharmaceutically acceptable active and / or inactive substances to prepare pharmaceutical compositions or formulations. The composition and method for formulating a pharmaceutical composition will depend on a number of criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0294] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharmaceutically acceptable salts of the oligomeric compounds, esters of the oligomeric compounds, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotides can provide (directly or indirectly) biologically active metabolites or residues thereof when administered to a subject, including a human. Thus, for example, the present disclosure is also directed to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, prodrugs include one or more conjugate groups attached to the oligonucleotide, where the conjugate groups are cleaved by endogenous nucleases in the body.

[0295] Lipid moieties are used in various ways in nucleic acid therapy. In certain such methods, nucleic acids such as oligomeric compounds are introduced into preformed liposomes or lipoplexes prepared from a mixture of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids. In certain embodiments, the lipid moiety is selected to increase the distribution of pharmaceutical agents to specific cells or tissues. In certain embodiments, the lipid moiety is selected to increase the distribution of pharmaceutical agents to adipose tissue. In certain embodiments, the lipid moiety is selected to increase the distribution of pharmaceutical agents to muscle tissue.

[0296] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those containing hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0297] In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents, including the oligomeric compounds provided herein, to a particular tissue or cell type, for example, in certain embodiments, pharmaceutical compositions comprise liposomes coated with tissue-specific antibodies.

[0298] In certain embodiments, the pharmaceutical compositions provided herein include a cosolvent system. Certain such cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such cosolvent systems are used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is a solution of 3 wt.% benzyl alcohol, 8 wt.% of the nonpolar surfactant Polysorbate 80™, and 65 wt.% polyethylene glycol 300 in absolute ethanol. The proportions of such cosolvent systems may be varied significantly without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of the cosolvent components may be varied; for example, other surfactants may be substituted for Polysorbate 80™; the fraction size of the polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinylpyrrolidone; or other sugars or polysaccharides may replace dextrose.

[0299] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intraneural, perineural, etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution, e.g., water, or a physiologically compatible buffer, e.g., Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients (e.g., ingredients that aid in solubility or act as preservatives) are included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, etc. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain formulatory agents such as suspending, stabilizing, and / or dispersing agents. Particular solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0300] Under certain conditions, certain compounds disclosed herein behave as acids. Such compounds may be depicted or described in a protonated (free acid) form or an ionized (salt) form associated with a cation, and aqueous solutions of such compounds exist in equilibrium between these forms. For example, the phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium between the free acid, anionic, and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, a particular oligonucleotide may have several such linkages, each of which is in equilibrium. Thus, an oligonucleotide in solution exists as a collection of each form, with multiple positions all in equilibrium. The term "oligonucleotide" is intended to include all such forms. Drawn structures necessarily represent a single form. Nevertheless, unless otherwise indicated, such drawings are intended to include corresponding forms as well. Herein, structures depicting the free acid of a compound followed by the term "or a salt thereof" explicitly include all such forms, whether fully or partially protonated, deprotonated, or associated with a cation. In some cases, one or more specific cations are identified.

[0301] In certain embodiments, the modified oligonucleotide or oligomeric compound is present in an aqueous solution containing sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in an aqueous solution containing potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.

[0302] Certain specific doses are described herein. The dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of a modified oligonucleotide or oligomeric compound in milligrams refers to the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As noted above, in aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for purposes of dose calculation, the modified oligonucleotide or oligomeric compound is assumed to exist as a solvent-free, sodium acetate-free, anhydrous free acid. For example, when a modified oligonucleotide or oligomeric compound is in a sodium-containing solution (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with Na+ ions. However, the mass of the protons still counts toward the dose weight, while the mass of the Na+ ions does not. Thus, for example, a 10 mg dose or dosage unit of Compound No. 1362458 is equivalent to the number of fully protonated molecules weighing 10 mg. This corresponds to 10.47 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1362458. And, for example, a 10 mg dose or dosage unit of Compound No. 1523605 is equal to the number of fully protonated molecules weighing 10 mg. This corresponds to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1523605. If an oligomeric compound contains a conjugate group, the mass of the conjugate group is included in the calculation of the dose of such oligomeric compound. If the conjugate group also contains an acid, the conjugate group is also assumed to be fully protonated for the purposes of calculating the dose.

[0303] VII. Specific Compositions 1. Compound No. 1363235 In certain embodiments, compound number 1363235 is characterized as a 5-10-5 MOE gapmer having the sequence (5' to 3') of TGTAGTACAAATCTTTCCTT (SEQ ID NO: 2101), wherein each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and wherein the nucleosides The internucleoside linkages of nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester internucleoside linkages, and the internucleoside linkages of nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0304] In certain embodiments, compound 1363235 is represented by the following chemical designation: T es G eo T eo A eo G eo T ds A ds m C ds A ds A ds A ds T ds m C ds T ds T ds T eo m C eo m C es T es T e (SEQ ID NO: 2101), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0305] In certain embodiments, compound 1363235 is represented by the following chemical structure: [ka] (SEQ ID NO: 2101). Structure 1. Compound number 1363235

[0306] In certain embodiments, the sodium salt of compound 1363235 is represented by the following chemical structure: [ka] (SEQ ID NO: 2101). Structure 2. Sodium salt of compound number 1363235

[0307] 2. Compound number 1523601 In certain embodiments, compound number 1523601 is characterized as a 6-10-4 MOE gapmer having the sequence (5' to 3') of ACAAATCTTTCCTTCAATTA (SEQ ID NO: 682), wherein each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside, and wherein nucleosides The internucleoside linkages of nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester internucleoside linkages, the internucleoside linkages of nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0308] In certain embodiments, compound number 1523601 is represented by the following chemical designation: A es m C eo A eo A eo A eo T eo m C ds T ds T ds T ds m C ds m C ds T ds T ds m C ds A ds A eo T es T es A e (SEQ ID NO: 682), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage.

[0309] In certain embodiments, compound 1523601 is represented by the following chemical structure: [ka] (SEQ ID NO: 682). Structure 3. Compound number 1523601

[0310] In certain embodiments, the sodium salt of compound 1523601 is represented by the following chemical structure: [ka] (SEQ ID NO: 682). Structure 4. Sodium salt of compound number 1523601

[0311] 3. Compound No. 1523605 In certain embodiments, compound number 1523605 is characterized as a 6-10-4 MOE gapmer having the sequence (5' to 3') of CAGATGTTCATCTCTTCACA (SEQ ID NO: 1124), wherein each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside, and wherein the nucleosides The internucleoside linkages of nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester internucleoside linkages, and the internucleoside linkages of nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0312] In certain embodiments, compound number 1523605 is represented by the following chemical notation: m C es A eo G eo A eo T eo G eo T ds T ds m C ds A ds T ds m C ds T ds m C ds T ds T ds m C eo A es m C es A e (SEQ ID NO: 1124), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0313] In certain embodiments, compound 1523605 is represented by the following chemical structure: [ka] (SEQ ID NO: 1124). Structure 5. Compound number 1523605

[0314] In certain embodiments, the sodium salt of compound 1523605 is represented by the following chemical structure: [ka] (SEQ ID NO: 1124). Structure 6. Sodium salt of compound number 1523605

[0315] 4. Compound No. 1523608 In certain embodiments, compound number 1523608 is characterized as a 6-10-4 MOE gapmer having the sequence (5' to 3') of CATCAGATGTTCATCTCTTC (SEQ ID NO: 2145), wherein each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside, and wherein the nucleosides The internucleoside linkages of nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester internucleoside linkages, and the internucleoside linkages of nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0316] In certain embodiments, compound number 1523608 is represented by the following chemical notation: m C es A eo T eo m C eo A eo G eo A ds T ds G ds T ds T ds m C ds A ds T ds m C ds T ds m C eo T es T es m C e (SEQ ID NO: 2145), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0317] In certain embodiments, compound 1523608 is represented by the following chemical structure: [ka] (SEQ ID NO: 2145). Structure 7. Compound number 1523608

[0318] In certain embodiments, the sodium salt of compound 1523608 is represented by the following chemical structure: [ka] (SEQ ID NO: 2145). Structure 8. Sodium salt of compound number 1523608

[0319] 5. Compound No. 1362445 In certain embodiments, compound number 1362445 is characterized as a 5-10-5 MOE gapmer having a sequence (5' to 3') of CCCAATAGATTCAACTAGCC (SEQ ID NO: 134), wherein each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and wherein nucleosides The internucleoside linkages of nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester internucleoside linkages, the internucleoside linkages of nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0320] In certain embodiments, compound number 1362445 is represented by the following chemical notation: m C es m C eo m C eo A eo A eo T ds A ds G ds A ds T ds T ds m C ds A ds A ds m C ds T eo A eo G es m C es m C e (SEQ ID NO: 134), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0321] 6. Compound No. 1362449 In certain embodiments, compound number 1362449 is characterized as a 5-10-5 MOE gapmer having the sequence (5' to 3') of ACACAACTCTTTACAACAAA (SEQ ID NO: 411), wherein each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and nucleosides 2- The internucleoside linkages of 3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester internucleoside linkages, the internucleoside linkages of nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0322] In certain embodiments, compound number 1362449 is represented by the following chemical designation: A es m C eo A eo m C eo A eo A ds m C ds T ds m C ds T ds T ds T ds A ds m C ds A ds A eo m C eo A es A es A e (SEQ ID NO: 411), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0323] 7. Compound No. 1362458 In certain embodiments, compound number 1362458 is characterized as a 5-10-5 MOE gapmer having the sequence (5' to 3') of TCTCCAGACATTTCTGATGC (SEQ ID NO: 934), wherein each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and wherein nucleosides The internucleoside linkages of nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester internucleoside linkages, the internucleoside linkages of nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0324] In certain embodiments, compound number 1362458 is represented by the following chemical designation: T es m C eo T eo m C eo m C eo A ds G ds A ds m C ds A ds T ds T ds T ds m C ds T ds G eo A eo T es G es m C e (SEQ ID NO: 934), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0325] 8. Compound No. 1362602 In certain embodiments, compound number 1362602 is characterized as a 5-10-5 MOE gapmer having the sequence (5' to 3') of GTGTGTTAAAATTGCAATTC (SEQ ID NO: 1238), wherein each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and wherein the nucleosides The internucleoside linkages of nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester internucleoside linkages, and the internucleoside linkages of nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0326] In certain embodiments, compound number 1362602 is represented by the following chemical designation: es T eo G eo T eo G eo T ds T ds A ds A ds A ds A ds T ds T ds G ds m C ds Aeo A eo T es T es m C e (SEQ ID NO: 1238), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0327] 9. Compound No. 1362842 In certain embodiments, compound number 1362842 is characterized as a 5-10-5 MOE gapmer having the sequence (5' to 3') of ATTGCAATTCTATATCAGAA (SEQ ID NO: 2010), wherein each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and wherein the nucleosides The internucleoside linkages of nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester internucleoside linkages, and the internucleoside linkages of nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0328] In certain embodiments, compound number 1362842 is represented by the following chemical designation: es T eo T eo G eo m C eo A ds A ds Tds T ds m C ds T ds A ds T ds A ds T ds m C eo A eo G es A es A e (SEQ ID NO: 2010), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0329] 10. Compound No. 1362892 In certain embodiments, compound number 1362892 is characterized as a 5-10-5 MOE gapmer having the sequence (5' to 3') of ATGTGATCTATATCAGGAGA (SEQ ID NO: 1772), wherein each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and wherein the nucleosides The internucleoside linkages of nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester internucleoside linkages, and the internucleoside linkages of nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0330] In certain embodiments, compound number 1362892 is represented by the following chemical designation: es T eo G eo T eo G eo A ds T ds m C ds T ds A ds T ds A ds T ds m C ds A ds G eo G eo A es G es A e (SEQ ID NO: 1772), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0331] 11. Compound No. 1363013 In certain embodiments, compound number 1363013 is characterized as a 5-10-5 MOE gapmer having a sequence (5' to 3') of ACCAGAGGGCCATCTCAGGT (SEQ ID NO: 881), wherein each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and wherein nucleosides The internucleoside linkages of nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester internucleoside linkages, the internucleoside linkages of nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0332] In certain embodiments, compound number 1363013 is represented by the following chemical designation: A es m C eo m C eo A eo G eo A ds G ds G ds G ds m C ds m C ds A ds T ds m C ds T ds m C eo A eo G es G es T e (SEQ ID NO: 881), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0333] 12. Compound No. 1363398 In certain embodiments, compound number 1363398 is characterized as a 5-10-5 MOE gapmer having the sequence (5' to 3') of GCATCAGATGTTCATCTCTT (SEQ ID NO: 1050), wherein each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and wherein the nucleosides The internucleoside linkages of nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester internucleoside linkages, and the internucleoside linkages of nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0334] In certain embodiments, compound 1363398 is represented by the following chemical designation: G es m C eo A eo T eo m C eo A ds G ds A ds T ds G ds T ds T ds m C ds A ds T ds m C eo T eo m C es T es T e (SEQ ID NO: 1050), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0335] 13. Compound No. 1363557 In certain embodiments, compound number 1363557 is characterized as a 5-10-5 MOE gapmer having the sequence (5' to 3') of CCTCCATTCCTTTGTGACTT (SEQ ID NO: 1449), wherein each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and wherein the nucleosides The internucleoside linkages of nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester internucleoside linkages, and the internucleoside linkages of nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0336] In certain embodiments, compound 1363557 is represented by the following chemical designation: m C es m C eo T eo m C eo m C eo A ds T ds T ds m C ds m C ds Tds T ds T ds G ds T ds G eo A eo m C es T es T e (SEQ ID NO: 1449), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0337] VIII. Specific Hotspot Areas In certain embodiments, the nucleobase ranges set forth below comprise hotspot regions of PLP1 nucleic acids. In certain embodiments, modified oligonucleotides complementary to portions of hotspot regions of PLP1 nucleic acids achieve an average of 50% or more reduction in PLP1 RNA in vitro in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to portions of hotspot regions of PLP1 nucleic acids achieve an average of 50% or more reduction in PLP1 RNA in vivo in a standard in vivo assay.

[0338] 1. Nucleic acid bases 9198 to 9222 of SEQ ID NO: 2 In certain embodiments, nucleobases 9198-9222 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 9198-9222 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3') of the gap.

[0339] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0340] The nucleic acid base sequences of SEQ ID NOs: 1050, 1124, 2145, 2151, 2152, and 2153 are complementary to a portion of nucleic acid bases 9198 to 9222 of SEQ ID NO:2.

[0341] The nucleobase sequences of compound numbers 1363398, 1363516, 1523604, 1523605, 1523606, 1523607, 1523608, and 1523609 are complementary to a portion of nucleobases 9198 to 9222 of SEQ ID NO:2.

[0342] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 9198-9222 of SEQ ID NO:2 achieve at least a 65% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 9198-9222 of SEQ ID NO:2 achieve an average of 71.5% reduction in PLP1 RNA in a standard in vitro assay.

[0343] 2. Nucleic acid bases 13702 to 13766 of SEQ ID NO: 2 In certain embodiments, nucleobases 13702-13766 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 13702-13766 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3') of the gap.

[0344] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0345] The nucleic acid base sequences of SEQ ID NOs: 36, 86, 114, 164, 191, 242, 269, 426, 523, 602, 691, and 780 are complementary to a portion of nucleic acid bases 13702 to 13766 of SEQ ID NO:2.

[0346] The nucleobase sequences of compound numbers 1218139, 1218140, 1218141, 1218142, 1218341, 1218342, 1218343, 1362839, 1363565, 1363589, 1363758, and 1364150 are complementary to a portion of nucleobases 13702 to 13766 of SEQ ID NO:2.

[0347] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 13702-13766 of SEQ ID NO:2 achieve at least a 60% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 13702-13766 of SEQ ID NO:2 achieve an average of 68.6% reduction in PLP1 RNA in a standard in vitro assay.

[0348] 3. Nucleic acid bases 14037 to 14062 of SEQ ID NO: 2 In certain embodiments, nucleobases 14037-14062 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 14037-14062 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0349] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0350] The nucleic acid base sequences of SEQ ID NOs: 89, 167, 245, 322, and 323 are complementary to a portion of nucleic acid bases 14037 to 14062 of SEQ ID NO:2.

[0351] The nucleic acid base sequences of compound numbers 1218352, 1218353, 1218354, 1362909, 1362866, 1218355, and 1218356 are complementary to a portion of nucleic acid bases 14037 to 14062 of SEQ ID NO:2.

[0352] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 14037-14062 of SEQ ID NO:2 achieve at least a 64% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 14037-14062 of SEQ ID NO:2 achieve an average of 79.9% reduction in PLP1 RNA in a standard in vitro assay.

[0353] 4. Nucleic acid bases 16761 to 16800 of SEQ ID NO: 2 In certain embodiments, nucleobases 16761-16800 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 16761-16800 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0354] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0355] The nucleic acid base sequences of SEQ ID NOs: 720, 808, 904, 937, 1058, 1097, 1184, 1278, and 1340 are complementary to a portion of nucleic acid bases 16761 to 16800 of SEQ ID NO:2.

[0356] The nucleic acid base sequences of compound numbers 1362547, 1362649, 1362825, 1363052, 1363131, 1363205, 1363559, 1363590, and 1363607 are complementary to a portion of nucleic acid bases 16761 to 16800 of SEQ ID NO:2.

[0357] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 16761-16800 of SEQ ID NO:2 achieve at least a 60% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 16761-16800 of SEQ ID NO:2 achieve an average of 70.7% reduction in PLP1 RNA in a standard in vitro assay.

[0358] 5. Nucleic acid bases 17558 to 17602 of SEQ ID NO: 2 In certain embodiments, nucleobases 17558-17602 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 17558-17602 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0359] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0360] The nucleic acid base sequences of SEQ ID NOs: 40, 41, 117, 118, 195, 196, 273, 274, 588, and 690 are complementary to a portion of nucleic acid bases 17558 to 17602 of SEQ ID NO: 2.

[0361] The nucleic acid base sequences of compound numbers 1218154, 1218155, 1218156, 1218157, 1218158, 1218159, 1218160, 1218161, 1363257, 1363439, and 1363756 are complementary to a portion of nucleic acid bases 17558 to 17602 of SEQ ID NO:2.

[0362] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 17558-17602 of SEQ ID NO:2 achieve at least a 62% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 17558-17602 of SEQ ID NO:2 achieve an average of 74.6% reduction in PLP1 RNA in a standard in vitro assay.

[0363] 6. Nucleic acid bases 17615 to 17667 of SEQ ID NO: 2 In certain embodiments, nucleobases 17615-17667 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 17615-17667 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0364] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0365] The nucleobase sequences of SEQ ID NOs: 42, 43, 119, 120, 197, 198, 275, 276, 373, 460, 1431, 1542, 1645, 1850, 1965, and 2109 are complementary to a portion of nucleobases 17615 to 17667 of SEQ ID NO: 2.

[0366] The nucleobase sequences of compound numbers 1218162, 1218163, 1218164, 1218165, 1218166, 1218167, 1218168, 1218169, 1362484, 1362497, 1362517, 1362591, 1362749, 1362970, 1363246, 1363342, 1363415, 1363474, 1363544, 1363725, and 1363736 are complementary to a portion of nucleobases 17615 to 17667 of SEQ ID NO:2.

[0367] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 17615-17667 of SEQ ID NO:2 achieve at least a 28% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 17615-17667 of SEQ ID NO:2 achieve an average of 74.4% reduction in PLP1 RNA in a standard in vitro assay.

[0368] 7. Nucleic acid bases 17853 to 17883 of SEQ ID NO: 2 In certain embodiments, nucleobases 17853-17883 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 17853-17883 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0369] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0370] The nucleobase sequences of SEQ ID NOs: 1451, 1499, 1543, 1654, 1733, 2154, and 2155 are complementary to a portion of nucleobases 17853 to 17883 of SEQ ID NO:2.

[0371] The nucleobase sequences of compound numbers 1362611, 1363392, 1363557, 1363795, 1364094, 1523610, 1523611, 1523612, and 1523613 are complementary to a portion of nucleobases 17853 to 17883 of SEQ ID NO:2.

[0372] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 17853-17883 of SEQ ID NO:2 achieve at least a 65% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 17853-17883 of SEQ ID NO:2 achieve an average of 73.5% reduction in PLP1 RNA in a standard in vitro assay.

[0373] 8. Nucleic acid bases 18097 to 18160 of SEQ ID NO: 2 In certain embodiments, nucleobases 18097-18160 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 18097-18160 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0374] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0375] The nucleobase sequences of SEQ ID NOs: 200, 420, 504, 620, 646, 709, 823, 980, 1029, 1149, 1196, 1253, 1323, 1423, 1476, 1605, 1613, 1728, and 1832 are complementary to a portion of nucleobases 18097 to 18160 of SEQ ID NO: 2.

[0376] The nucleobase sequences of compound numbers 1218175, 1362441, 1362447, 1362750, 1362769, 1362774, 1362926, 1362945, 1362957, 1362963, 1362967, 1363191, 1363253, 1363427, 1363489, 1363691, 1363993, 1364083, 1364097, and 1364099 are complementary to a portion of nucleobases 18097 to 18160 of SEQ ID NO:2.

[0377] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18097-18160 of SEQ ID NO:2 achieve at least a 53% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18097-18160 of SEQ ID NO:2 achieve an average of 70.1% reduction in PLP1 RNA in a standard in vitro assay.

[0378] 9. Nucleic acid bases 18206 to 18237 of SEQ ID NO: 2 In certain embodiments, nucleobases 18206-18237 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 18206-18237 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0379] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0380] The nucleobase sequences of 45, 46, 123, 124, 201, 202, 279, 280, 538, 562, and 2091 are complementary to a portion of nucleobases 18206 to 18237 of SEQ ID NO:2.

[0381] The nucleobase sequences of compound numbers 1218177, 1218178, 1218179, 1218180, 1218181, 1218182, 1218183, 1218184, 1362490, 1362584, 1362927, 1363103, 1363121, 1363314, and 1363983 are complementary to a portion of nucleobases 18206 to 18237 of SEQ ID NO:2.

[0382] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18206-18237 of SEQ ID NO:2 achieve at least a 64% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18206-18237 of SEQ ID NO:2 achieve an average of 81.8% reduction in PLP1 RNA in a standard in vitro assay.

[0383] 10. Nucleic acid bases 18237 to 18340 of SEQ ID NO: 2 In certain embodiments, nucleobases 18237-18340 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 18237-18340 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0384] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0385] The nucleobase sequences of SEQ ID NOs: 48, 49, 50, 51, 52, 53, 125, 126, 127, 128, 129, 130, 131, 203, 204, 205, 206, 207, 208, 281, 282, 283, 284, 285, 286, 414, 459, 485, 503, 579, 580, 693, 724, 840, 873, 911, 1034, 1081, 1125, 1159, 1318, 1413, 1513, 1548, 1672, 1701, 1794, 1868, 1958, and 2002 are complementary to a portion of nucleobases 18237 to 18340 of SEQ ID NO: 2.

[0386] Compound numbers: 1218186, 1218187, 1218188, 1218189, 1218190, 1218191, 1218192, 1218193, 1218194, 1218195, 1218196, 1218197, 1218198, 1218199, 1218200, 12182 01, 1218202, 1218203, 1218204, 1218205, 1218206, 1218207, 1218208, 1218209, 1218210, 1362429, 1362468, 1362571, 1362623, 1362659, 1362697, 1362699, 1 362710, 1362714, 1362723, 1362734, 1362821, 1362902, 1362924, 1362955, 1362977, 1363036, 1363051, 1363069, 1363149, 1363206, 1363269, 1363286, 13633 The nucleobase sequences of 55, 1363429, 1363518, 1363687, 1363748, 1363790, 1363856, 1363872, 1363884, 1364129, 1364227, and 1364246 are complementary to a portion of nucleobases 18237 to 18340 of SEQ ID NO:2.

[0387] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18237-18340 of SEQ ID NO:2 achieve at least a 44% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18237-18340 of SEQ ID NO:2 achieve an average of 70.9% reduction in PLP1 RNA in a standard in vitro assay.

[0388] 11. Nucleic acid bases 18350 to 18387 of SEQ ID NO: 2 In certain embodiments, nucleobases 18350-18387 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 18350-18387 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0389] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0390] The nucleobase sequences of SEQ ID NOs: 209, 287, 335, 439, 506, 606, 659, 1922, 2033, and 2104 are complementary to a portion of nucleobases 18350 to 18387 of SEQ ID NO: 2.

[0391] The nucleobase sequences of compound numbers 1218211, 1218212, 1362567, 1362579, 1362987, 1363166, 1363184, 1363310, 1363502, and 1363644 are complementary to a portion of nucleobases 18350 to 18387 of SEQ ID NO:2.

[0392] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18350-18387 of SEQ ID NO:2 achieve at least a 64% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18350-18387 of SEQ ID NO:2 achieve an average of 76.2% reduction in PLP1 RNA in a standard in vitro assay.

[0393] 12. Nucleic acid bases 18412 to 18469 of SEQ ID NO: 2 In certain embodiments, nucleobases 18412-18469 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 18412-18469 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position of the gap (5' to 3' order).

[0394] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0395] The nucleobase sequences of SEQ ID NOs: 784, 842, 869, 978, 1082, 1131, 1218, 1250, 1320, 1453, 1529, 1538, 1616, 1712, and 1821 are complementary to a portion of nucleobases 18412 to 18469 of SEQ ID NO: 2.

[0396] The nucleobase sequences of compound numbers 1362519, 1362535, 1362684, 1362724, 1362885, 1363026, 1363457, 1363648, 1363838, 1363887, 1363933, 1364125, 1364192, 1364197, and 1364255 are complementary to a portion of nucleobases 18412 to 18469 of SEQ ID NO:2.

[0397] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18412-18469 of SEQ ID NO:2 achieve at least a 67% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18412-18469 of SEQ ID NO:2 achieve an average of a 75% reduction in PLP1 RNA in a standard in vitro assay.

[0398] 13. Nucleic acid bases 18461 to 18506 of SEQ ID NO: 2 In certain embodiments, nucleobases 18461-18506 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 18461-18506 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0399] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0400] The nucleobase sequences of SEQ ID NOs: 54, 55, 132, 133, 210, 288, 419, 499, 564, 665, 764, 800, 881, 993, 1059, 1200, 1295, 1354, 1422, 1465, 1544, 1705, 1802, and 2149 are complementary to a portion of nucleobases 18461 to 18506 of SEQ ID NO: 2.

[0401] Compound numbers: 1218213, 1218214, 1218215, 1218216, 1218217, 1218218, 1362618, 1362620, 1362632, 1362704, 1362718, 1362815, 1363013, 1363023, 1363128, 1363328, 1 The nucleobase sequences of 363400, 1363431, 1363519, 1363533, 1363570, 1363709, 1363762, 1363975, 1364180, 1523591, 1523592, and 1523593 are complementary to a portion of nucleobases 18461 to 18506 of SEQ ID NO:2.

[0402] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18461-18506 of SEQ ID NO:2 achieve at least a 40% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18461-18506 of SEQ ID NO:2 achieve an average of a 69.7% reduction in PLP1 RNA in a standard in vitro assay.

[0403] 14. Nucleic acid bases 18539 to 18579 of SEQ ID NO: 2 In certain embodiments, nucleobases 18539-18579 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 18539-18579 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0404] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0405] The nucleobase sequences of SEQ ID NOs: 338, 438, 525, 604, 658, 758, 813, 887, 977, 1043, 1108, 1199, 1258, 1336, 1395, 1514, 1557, 1668, 1697, and 2089 are complementary to a portion of nucleobases 18539 to 18579 of SEQ ID NO: 2.

[0406] The nucleobase sequences of compound numbers 1362619, 1362637, 1362652, 1362830, 1362901, 1363079, 1363118, 1363143, 1363145, 1363146, 1363176, 1363193, 1363287, 1363422, 1363451, 1363569, 1363592, 1363611, 1363796, and 1363860 are complementary to a portion of nucleobases 18539 to 18579 of SEQ ID NO:2.

[0407] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18539-18579 of SEQ ID NO:2 achieve at least a 62% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18539-18579 of SEQ ID NO:2 achieve an average of 68.8% reduction in PLP1 RNA in a standard in vitro assay.

[0408] 15. Nucleic acid bases 18697 to 18727 of SEQ ID NO: 2 In certain embodiments, nucleobases 18697-18727 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 18697-18727 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0409] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0410] The nucleobase sequences of SEQ ID NOs: 875, 934, 1047, 1110, 1229, 1243, 1373, 1438, 2146, and 2147 are complementary to a portion of nucleobases 18697 to 18727 of SEQ ID NO:2.

[0411] The nucleobase sequences of compound numbers 1362458, 1362696, 1362878, 1363179, 1363351, 1363697, 1364107, 1364147, 1523584, 1523586, and 1523587 are complementary to a portion of nucleobases 18697 to 18727 of SEQ ID NO:2.

[0412] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18697-18727 of SEQ ID NO:2 achieve at least a 66% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18697-18727 of SEQ ID NO:2 achieve an average of 77.7% reduction in PLP1 RNA in a standard in vitro assay.

[0413] 16. Nucleic acid bases 18755 to 18793 of SEQ ID NO: 2 In certain embodiments, nucleobases 18755-18793 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 18755-18793 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0414] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0415] The nucleobase sequences of SEQ ID NOs: 761, 798, 890, 946, 1022, 1120, 1198, 1293, 1358, 1398, and 1463 are complementary to a portion of nucleobases 18755 to 18793 of SEQ ID NO: 2.

[0416] The nucleobase sequences of compound numbers 1362575, 1362680, 1362698, 1362856, 1363019, 1363172, 1363357, 1363391, 1363591, 1363639, and 1363889 are complementary to a portion of nucleobases 18755 to 18793 of SEQ ID NO:2.

[0417] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18755-18793 of SEQ ID NO:2 achieve at least a 65% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18755-18793 of SEQ ID NO:2 achieve an average of 77.7% reduction in PLP1 RNA in a standard in vitro assay.

[0418] 17. Nucleic acid bases 18797 to 18819 of SEQ ID NO: 2 In certain embodiments, nucleobases 18797-18819 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 18797-18819 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0419] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0420] The nucleic acid base sequences of SEQ ID NOs: 56, 134, 683, and 718 are complementary to a portion of nucleic acid bases 18797 to 18819 of SEQ ID NO: 2.

[0421] The nucleic acid base sequences of compound numbers 1218221, 1218222, 1362445, 1362612, 1363478, and 1363656 are complementary to a portion of nucleic acid bases 18797 to 18819 of SEQ ID NO:2.

[0422] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18797-18819 of SEQ ID NO:2 achieve at least a 65% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18797-18819 of SEQ ID NO:2 achieve an average of 75.4% reduction in PLP1 RNA in a standard in vitro assay.

[0423] 18. Nucleic acid bases 18839 to 18862 of SEQ ID NO: 2 In certain embodiments, nucleobases 18839-18862 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 18839-18862 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0424] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0425] The nucleobase sequences of SEQ ID NOs: 1610, 1663, 1702, and 1786 are complementary to a portion of nucleobases 18839 to 18862 of SEQ ID NO:2.

[0426] The nucleic acid base sequences of compound numbers 1363076, 1362712, 1363649, and 1364195 are complementary to a portion of nucleic acid bases 18839 to 18862 of SEQ ID NO:2.

[0427] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18839-18862 of SEQ ID NO:2 achieve at least a 66% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18839-18862 of SEQ ID NO:2 achieve an average of 72.8% reduction in PLP1 RNA in a standard in vitro assay.

[0428] 19. Nucleic acid bases 18974 to 19021 of SEQ ID NO: 2 In certain embodiments, nucleobases 18974-19021 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 18974-19021 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0429] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0430] The nucleobase sequences of SEQ ID NOs: 212, 1060, 1090, 1181, 1277, 1446, 1510, 1589, 1646, 1693, 1772, and 2148 are complementary to a portion of nucleobases 18974 to 19021 of SEQ ID NO: 2.

[0431] The nucleobase sequences of compound numbers 1218223, 1362460, 1362600, 1362805, 1362892, 1363007, 1363316, 1363581, 1363642, 1363664, 1363773, 1363984, 1523588, 1523589, and 1523590 are complementary to a portion of nucleobases 18974 to 19021 of SEQ ID NO:2.

[0432] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18974-19021 of SEQ ID NO:2 achieve at least a 54% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18974-19021 of SEQ ID NO:2 achieve an average of 71.5% reduction in PLP1 RNA in a standard in vitro assay.

[0433] 20. Nucleic acid bases 19028 to 19080 of SEQ ID NO: 2 In certain embodiments, nucleobases 19028-19080 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 19028-19080 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position of the gap (5' to 3' order).

[0434] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0435] The nucleobase sequences of SEQ ID NOs: 57, 586, 666, 714, 812, 914, 951, 1052, 1138, 1162, 1248, 1363, and 1455 are complementary to a portion of nucleobases 19028 to 19080 of SEQ ID NO: 2.

[0436] The nucleobase sequences of compound numbers 1218225, 1362492, 1362565, 1362817, 1362846, 1363141, 1363160, 1363346, 1363453, 1363550, 1363765, 1363835, 1363883, and 1364201 are complementary to a portion of nucleobases 19028 to 19080 of SEQ ID NO:2.

[0437] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 19028-19080 of SEQ ID NO:2 achieve at least a 58% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 19028-19080 of SEQ ID NO:2 achieve an average of 73.5% reduction in PLP1 RNA in a standard in vitro assay.

[0438] 21. Nucleic acid bases 19146 to 19173 of SEQ ID NO: 2 In certain embodiments, nucleobases 19146-19173 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 19146-19173 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0439] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0440] The nucleobase sequences of SEQ ID NOs: 385, 416, 545, 621, 682, 1968, 2055, 2101, and 2150 are complementary to a portion of nucleobases 19146 to 19173 of SEQ ID NO: 2.

[0441] The nucleobase sequences of compound numbers 1362670, 1363235, 1363627, 1363734, 1363940, 1364008, 1364066, 1523601, 1523602, and 1523603 are complementary to a portion of nucleobases 19146 to 19173 of SEQ ID NO:2.

[0442] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 19148-19173 of SEQ ID NO:2 achieve at least a 54% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 19146-19173 of SEQ ID NO:2 achieve an average of 77.3% reduction in PLP1 RNA in a standard in vitro assay.

[0443] 22. Nucleic acid bases 19228 to 19253 of SEQ ID NO: 2 In certain embodiments, nucleobases 19228-19253 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 19228-19253 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0444] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0445] The nucleobase sequences of SEQ ID NOs: 363, 467, 541, 2008, and 2111 are complementary to a portion of nucleobases 19228 to 19253 of SEQ ID NO:2.

[0446] The nucleic acid base sequences of compound numbers 1364015, 1363882, 1363157, 1363485, and 1362808 are complementary to a portion of nucleic acid bases 19228 to 19253 of SEQ ID NO:2.

[0447] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 19228-19253 of SEQ ID NO:2 achieve at least a 69% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 19228-19253 of SEQ ID NO:2 achieve an average of 77.4% reduction in PLP1 RNA in a standard in vitro assay.

[0448] 23. Nucleic acid bases 19347 to 19393 of SEQ ID NO: 2 In certain embodiments, nucleobases 19347-19393 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 19347-19393 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0449] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0450] The nucleobase sequences of SEQ ID NOs: 58, 59, 136, 213, 214, 291, 292, 383, 417, 519, 612, 671, 730, 900, 986, 1019, 1136, 1353, 1457, 1504, 1546, and 2093 are complementary to a portion of nucleobases 19347 to 19393 of SEQ ID NO: 2.

[0451] The nucleobase sequences of compound numbers: 1218227, 1218228, 1218229, 1218230, 1218231, 1218232, 1218233, 1362526, 1362624, 1362677, 1362685, 1362799, 1362806, 1363094, 1363419, 1363425, 1363472, 1363499, 1363597, 1363628, 1363681, 1363744, 1363759, 1363800, and 1364257 are complementary to a portion of nucleobases 19347 to 19393 of SEQ ID NO:2.

[0452] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 19347-19393 of SEQ ID NO:2 achieve at least a 52% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 19347-19393 of SEQ ID NO:2 achieve an average of 71.6% reduction in PLP1 RNA in a standard in vitro assay.

[0453] 24. Nucleic acid bases 19500 to 19523 of SEQ ID NO: 2 In certain embodiments, nucleobases 19500-19523 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 19500-19523 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0454] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0455] The nucleobase sequences of SEQ ID NOs: 398, 435, 2095, 2010, and 2144 are complementary to a portion of nucleobases 19500 to 19523 of SEQ ID NO:2.

[0456] The nucleobase sequences of compound numbers 1362842, 1363110, 1363153, 1363982, 1523594, and 1523595 are complementary to a portion of nucleobases 19500 to 19523 of SEQ ID NO:2.

[0457] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 19500-19523 of SEQ ID NO:2 achieve at least a 62% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 19500-19523 of SEQ ID NO:2 achieve an average of 69.5% reduction in PLP1 RNA in a standard in vitro assay.

[0458] 25. Nucleic acid bases 19512 to 19534 of SEQ ID NO: 2 In certain embodiments, nucleobases 19512-19534 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 19512-19534 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motif eeeeeddddddddddeeeee or eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, the gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3' order) of the gap.

[0459] In certain embodiments, all of the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") internucleoside linkages and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order as follows: sooooossssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0460] The nucleobase sequences of SEQ ID NOs: 1201, 1238, 1341, and 1435 are complementary to a portion of nucleobases 19512 to 19534 of SEQ ID NO:2.

[0461] The nucleic acid base sequences of compound numbers 1362602, 1363268, 1363452, and 1363678 are complementary to a portion of nucleic acid bases 19512 to 19534 of SEQ ID NO:2.

[0462] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 19512-19534 of SEQ ID NO:2 achieve at least a 63% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 19512-19534 of SEQ ID NO:2 achieve an average of an 80% reduction in PLP1 RNA in a standard in vitro assay.

[0463] Non-limiting disclosure and incorporation by reference Each of the literature and patent publications cited herein is hereby incorporated by reference in its entirety.

[0464] While the specific compounds, compositions, and methods described herein have been described in detail based on specific embodiments, the following examples are intended to serve merely to illustrate, but not to limit, the compounds described herein. Each of the references, GenBank accession numbers, etc., described in this application is incorporated herein by reference in its entirety.

[0465] Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" as appropriate, in practice, these sequences may be modified with any combination of chemical modifications. Those skilled in the art will readily understand that designations such as "RNA" or "DNA" to describe modified oligonucleotides are, in certain instances, arbitrary. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base may be described as a DNA with a modified sugar (a 2'-OH in place of the single 2'-H of DNA) or as an RNA with a modified base (thymine (methylated uracil) in place of the uracil of RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including, but not limited to, such nucleic acids with modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG," whether modified or unmodified, includes, but is not limited to, those having the sequence "AUCGAUCG," and those compounds that contain RNA bases, such as those that have some DNA bases and some RNA bases, such as "AUCGATCG," as well as any oligomeric compound having such a nucleobase sequence, including, but not limited to, those having some DNA bases and some RNA bases, such as "AT m CGAUCG" (however, m C denotes a cytosine base bearing a methyl group at the 5-position).

[0466] Certain compounds described herein (e.g., modified oligonucleotides) contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined with respect to absolute stereochemistry as (R) or (S), as α or β for sugar anomers, or as (D) or (L) for amino acids, etc. Compounds provided herein depicted or described as having a particular stereoisomeric configuration include only the compound shown. Compounds provided herein depicted or described with undefined stereochemistry include all such possible isomers, including stereochemically random and optically pure forms thereof, unless otherwise specified. Similarly, all cis-trans isomers and tautomers of the compounds herein are included unless otherwise specified. Oligomeric compounds described herein include chirally pure or enriched mixtures as well as racemic mixtures. For example, oligomeric compounds having multiple phosphorothioate internucleoside linkages include compounds in which the chirality of the phosphorothioate internucleoside linkages is controlled or random. Unless otherwise specified, the compounds described herein are intended to include the corresponding salt forms.

[0467] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds herein containing hydrogen atoms include: 1 Isotopic substitutions encompassed by the compounds herein include all possible deuterium substitutions for each H hydrogen atom. 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S,34 S, 35 S, or 36 Examples of suitable isotope substitutions include, but are not limited to, S. In certain embodiments, non-radioactive isotope substitutions may confer new properties to oligomeric compounds that are beneficial for use as therapeutic or research tools. In certain embodiments, radioactive isotope substitutions may make the compounds suitable for research or diagnostic purposes, such as imaging. [Example]

[0468] The following examples illustrate, but do not limit, specific embodiments of the present disclosure. Furthermore, when specific embodiments are provided, the inventors intend the general application of these specific embodiments. For example, the disclosure of an oligonucleotide having a specific motif provides rational support for other oligonucleotides having that motif or a similar motif. Similarly, for example, if a specific high-affinity modification is found at a specific position, other high-affinity modifications at the same position are also considered appropriate unless otherwise indicated.

[0469] Example 1: Effect of 5-10-5 MOE gapmer-modified oligonucleotides on human PLP1 RNA in a single dose in vitro Modified oligonucleotides complementary to human PLP1 nucleic acid were designed and their effects on PLP1 RNA in vitro were examined at a single dose. The modified oligonucleotides were tested in a series of experiments under the same culture conditions, with the results of each experiment presented in separate tables below.

[0470] The modified oligonucleotides in the table below are 5-10-5 MOE gapmers. The gapmers are 20 nucleosides long, with a central gap segment consisting of 10 2'-β-D-deoxynucleosides and 5' and 3' wing segments each consisting of 5 2'-MOE nucleosides. The sugar motif of the gapmer is (5' to 3') eeeeeddddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. The internucleoside linkages throughout each modified oligonucleotide are phosphorothioate internucleoside linkages. Each cytosine residue is 5-methylcytosine.

[0471] "Start site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "Stop site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to either the human PLP1 mRNA (GENBANK Accession Number: NM_001128834.2), designated herein as SEQ ID NO: 1, or the human PLP1 genomic sequence (GENBANK Accession Number: NC_000023.11, truncated from nucleotides 103773001-103795000), designated herein as SEQ ID NO: 2, or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0472] Cultured SK-MEL-28 cells were treated with modified oligonucleotides at a concentration of 7,000 nM using electroporation at a density of 20,000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and PLP1 RNA levels were measured by quantitative real-time RT-PCR. PLP1 RNA levels were measured using human PLP1 primer probe set RTS35092 (forward sequence CTGATGCCAGAATGTATGGTGT, herein designated SEQ ID NO: 11; reverse sequence AGGTGGAAGGTCATTTGGAAC, herein designated SEQ ID NO: 12; probe sequence TGCAGATGGACAGAAGGTTGGAGC, herein designated SEQ ID NO: 13). PLP1 RNA levels were normalized to total RNA content measured with RIBOGREEN®. The reduction of PLP1 RNA is presented in the following table as the percentage of PLP1 RNA (% UTC) compared to the amount in untreated control cells. Each table represents the results of an individual assay plate. Values ​​marked with an (*) symbol indicate that the modified oligonucleotide is complementary to the amplicon region of the primer-probe set. Additional assays may be used to measure the potency and effectiveness of modified oligonucleotides complementary to the amplicon region. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5]

[0473] Example 2: Effect of 5-10-5 MOE gapmer-modified oligonucleotides on human PLP1 RNA in vitro, single dose Modified oligonucleotides complementary to human PLP1 nucleic acid were designed and their effects on PLP1 RNA levels in vitro were examined. The modified oligonucleotides were tested in a series of experiments using the same culture conditions, with the results of each experiment presented in separate tables below.

[0474] The modified oligonucleotides in the table below are 5-10-5 MOE gapmers. The gapmers are 20 nucleosides long, with a central gap segment consisting of 10 2'-β-D-deoxynucleosides and 5' and 3' wing segments each consisting of five 2'-MOE-modified nucleosides. The sugar motif of the gapmer (5' to 3') is eeeeeddddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. The internucleoside linkage motif (5' to 3') of the gapmer is "soooosssssssssssooss," where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

[0475] "Start site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "Stop site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to either human PLP1 mRNA (SEQ ID NO: 1) or human PLP1 genomic sequence (SEQ ID NO: 2), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0476] Cultured SK-MEL-28 cells were treated with modified oligonucleotides at a concentration of 4,000 nM using electroporation at a density of 20,000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and PLP1 RNA levels were measured by quantitative real-time RT PCR. PLP1 RNA levels were measured using the human PLP1 primer probe set RTS35092, as described in Example 1 above. PLP1 RNA levels were normalized to total RNA content measured with RIBOGREEN®. PLP1 RNA reduction is presented in the table below as the percentage of PLP1 RNA (% UTC) compared to the amount in untreated control cells. Each table represents the results of an individual assay plate. Values ​​marked with an "*" indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of modified oligonucleotides complementary to the amplicon region. [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6] [Table 5-7] [Table 6-1] [Table 6-2] [Table 6-3] Table 6-4 Table 6-5 Table 7-1 Table 7-2 Table 7-3 Table 7-4 Table 7-5 Table 7-6 Table 7-7 Table 8-1 Table 8-2 Table 8-3 Table 8-4 Table 8-5 Table 9-1 Table 9-2 Table 9-3 Table 9-4 Table 9-5 Table 10-1 Table 10-2 Table 10-3 Table 10-4 Table 10-5 Table 11-1 Table 11-2 Table 11-3 Table 11-4 Table 11-5 Table 12-1 Table 12-2 Table 12-3 Table 12-4 Table 12-5 Table 13-1 Table 13-2 Table 13-3 Table 13-4 Table 13-5 Table 13-6 Table 13-7 Table 14-1 Table 14-2 Table 14-3 Table 14-4 Table 14-5 Table 14-6 Table 14-7 Table 15-1 Table 15-2 Table 15-3 Table 15-4 Table 15-5 Table 15-6 Table 15-7 Table 15-8 Table 16-1 Table 16-2 Table 16-3 Table 16-4 Table 16-5 Table 16-6 Table 16-7 Table 17-1 Table 17-2 Table 17-3 Table 17-4 Table 17-5 Table 18-1 Table 18-2 Table 18-3 Table 18-4 Table 18-5 Table 19-1 Table 19-2 Table 19-3 Table 19-4 Table 19-5 Table 20-1 Table 20-2 Table 20-3 Table 20-4 Table 20-5 Table 21-1 Table 21-2 Table 21-3 Table 21-4 Table 21-5 Table 22-1 Table 22-2 Table 22-3 Table 22-4 Table 22-5 Table 23-1 Table 23-2 Table 23-3 Table 23-4 Table 23-5 Table 24-1 Table 24-2 Table 24-3 Table 24-4 Table 24-5 Table 24-6 Table 24-7 Table 24-8 Table 25-1 Table 25-2 Table 25-3 Table 25-4 Table 25-5 Table 26-1 Table 26-2 Table 26-3 Table 26-4 Table 26-5 Table 27-1 Table 27-2 Table 27-3 [Table 27-4] [Table 27-5] [Table 28-1] [Table 28-2] [Table 28-3] [Table 28-4] [Table 28-5]

[0477] Example 3: Effect of modified oligonucleotides on human PLP1 RNA in vitro, multiple doses Modified oligonucleotides selected from the above examples were tested at various doses in SK-MEL-28 cells. SK-MEL-28 cells cultured at a density of 20,000 cells per well were transfected using electroporation with the modified oligonucleotides at the concentrations specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and PLP1 RNA levels were measured by quantitative real-time RT PCR. RNA levels were measured as described above using human PLP1 primer probe set RTS35092. PLP1 RNA levels were normalized to total RNA content measured with RIBOGREEN®. Modified oligonucleotides were tested in a series of experiments using the same culture conditions, and the results of each experiment are presented in a separate table below. PLP1 RNA reduction as a percentage of PLP1 RNA amount (% UTC) compared to that of untreated control cells is presented in the table below.

[0478] Use linear regression on a log / linear plot of the data in Excel to determine the 50% inhibitory concentration (IC) of each modified oligonucleotide. 50 ) was calculated and is also presented in the table below. [Table 29] [Table 30] [Table 31] [Table 32] [Table 33] [Table 34] [Table 35] [Table 36] [Table 37] [Table 38] [Table 39]

[0479] Example 4: Design of modified oligonucleotides complementary to human PLP1 nucleic acids Modified oligonucleotides complementary to human PLP1 nucleic acids were designed as set forth in the table below. "Start site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "Stop site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described hereinabove), SEQ ID NO: 2 (described hereinabove), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular nucleic acid sequence.

[0480] The modified oligonucleotides in Table 40 are 6-10-4 MOE gapmers. The gapmers are 20 nucleosides in length, where the sugar motif for the gapmer is (5' to 3') eeeeeeddddddddddeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The gapmers have an internucleoside linkage motif (5' to 3') soooooossssssssssoss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 40-1] [Table 40-2]

[0481] Example 5: Activity of modified oligonucleotides complementary to human PLP1 in transgenic mice Modified oligonucleotides selected from the above examples were tested in a human BAC wild-type PLP1 transgenic mouse model. A bacterial artificial chromosome (BAC) subclone carrying the human Plp1 gene, including downstream and upstream regulatory elements, was identified. Whole-gene sequencing confirmed the presence of the human genomic region corresponding to the current NCBI refseq assembly GRCh38.p13, ChrX sequence NC_000023.11, at positions 103776506..103792619. The BAC subclone was introduced into the Taconic Biosciences C57BL / 6N Tac ES cell line via pronuclear injection. The cell line C57BL / 6NTac-Tg(PLP1)1483Tac-17235 was generated and used in these experiments. Human Plp1 mRNA expression was found in the brain and spinal cord.

[0482] process PLP1 transgenic mice were divided into groups of two mice each. Each mouse received a single intracerebroventricular (ICV) bolus injection of 100 μg of modified oligonucleotide. Groups of 3–5 mice received PBS as a negative control.

[0483] RNA analysis After two weeks of treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue, spinal cord, and / or cerebellum for RTPCR analysis. PLP1 RNA levels were measured using human primer probe set RTS48932 (forward sequence TGCACCAGTCATCAGCTATTC, herein designated SEQ ID NO: 14; reverse sequence AGACTGAAATCTGGGAGCTATTC, herein designated SEQ ID NO: 15; probe sequence AGGTCTCAAACTCTTTCTGCCTGTCC, herein designated SEQ ID NO: 16). Results are presented as the percentage of PLP1 RNA compared to the PBS control, normalized to mouse GAPDH. GAPDH was amplified using primer probe set mGapdh_LTS00102 (forward sequence GGCAAATTCAACGGCACAGT, herein designated SEQ ID NO: 17; reverse sequence GGGTCTCGCTCCTGGAAGAT, herein designated SEQ ID NO: 18; probe sequence AAGGCCGAGAATGGGAAGCTTGTCATC, herein designated SEQ ID NO: 19).

[0484] As shown in the table below, treatment with modified oligonucleotides resulted in a reduction of PLP1 RNA (% control) compared to the PBS control. [Table 41] [Table 42] [Table 43] [Table 44] [Table 45] [Table 46] [Table 47] [Table 48] [Table 49]

[0485] Example 6: Efficacy of modified oligonucleotides complementary to human PLP1 in transgenic mice Selected modified oligonucleotides from the above examples were tested in the human BAC wild-type PLP1 transgenic mouse model (described herein above).

[0486] process PLP1 transgenic mice were divided into groups of four. Each mouse received a single intracerebroventricular (ICV) bolus injection of modified oligonucleotides at the doses shown in the table below. A group of four mice received PBS as a negative control.

[0487] RNA analysis After two weeks of treatment, mice were sacrificed, and RNA was extracted from spinal cord and cortical brain tissue for RTPCR analysis. PLP1 RNA levels were measured using human primer probe sets RTS48932 (described above) and RTS48933 (forward sequence CCCTAACTCAGCCAACCTTAC, herein designated SEQ ID NO: 5; reverse sequence CACCCTGTTTCTCTTCCCTAAC, herein designated SEQ ID NO: 6; probe sequence AGGGAGCGTAGAATCTGTGTAGACGA, herein designated SEQ ID NO: 7). Results are presented as the percentage of human PLP1 RNA compared to the PBS control, normalized to mouse GAPDH. GAPDH was amplified using primer probe set mGapdh_LTS00102 (described above).

[0488] Dose-response and tissue concentration-response data were analyzed using Microsoft Excel (v14.4) and GraphPad Prism software (v8.2.0, San Diego, CA). 50Values ​​were calculated from log-transformed dose and individual animal PLP1 mRNA levels using a custom equation, Motulsky: Agonist vs. Response - Variable Slope (4 parameters) Y = Nadir + (Top - Nadir) / (1 + (10^logEC50 / X)^Hill slope), with the following constraints: Nadir > 0, Top = 100, Hill slope < -1 and > -2.

[0489] As shown in the table below, treatment with modified oligonucleotides resulted in a dose-dependent reduction of PLP1 RNA compared to the PBS control. [Table 50]

[0490] Example 7: Dose-dependent inhibition of human PLP1 by modified oligonucleotides in SK-MEL-28 cells Modified oligonucleotides selected from the above examples were tested at various doses in SK-MEL-28 cells (American Type Culture Collection). SK-MEL-28 cells cultured at a density of 20,000 cells per well were transfected using electroporation with the modified oligonucleotides at the concentrations specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and PLP1 RNA levels were measured by quantitative real-time RT PCR. PLP1 RNA levels were measured by quantitative real-time RT PCR using the human primer probe set RTS35092 described in Example 1 above. PLP1 RNA levels were normalized to human GAPDH amplified with primer probe set RTS104 (forward sequence GAAGGTGAAGGTCGGAGTC, herein designated SEQ ID NO: 8; reverse sequence GAAGATGGTGATGGGATTTC, herein designated SEQ ID NO: 9; probe sequence CAAGCTTCCCGTTCTCAGCC, herein designated SEQ ID NO: 10).

[0491] The reduction of PLP1 RNA as a percentage of the amount of PLP1 RNA compared to that of untreated control cells (%UTC) is presented in the table below. The 50% inhibitory concentration (IC) of each modified oligonucleotide was calculated using GraphPad Prism 6 software. 50 ) was calculated and is also presented in the table below. 50 Values ​​were calculated from dose and PLP1 RNA levels by least squares fitting to the equation: log(inhibitor) vs. normalized response-variable slope, Y=100 / (1+10^((LogIC50-X)*Hill slope)). [Table 51] In one aspect, the present invention may be as follows. [Embodiment 1] An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide is at least 85% complementary to an equal length portion of a PLP1 nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. [Aspect 2] An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence consisting of 12 to 30 linked nucleosides and comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20 to 2155, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. [Embodiment 3] Consists of 12 to 30 linked nucleosides, and an equal length portion of nucleobases 9198 to 9222 of SEQ ID NO: 2; an equal length portion of nucleobases 13702 to 13766 of SEQ ID NO: 2; an equal length portion of nucleobases 14037 to 14062 of SEQ ID NO: 2; Equal length portions of nucleobases 16761 to 16800 of SEQ ID NO: 2; an equal length portion of nucleobases 17558 to 17602 of SEQ ID NO: 2; Equal length portions of nucleobases 17615 to 17667 of SEQ ID NO: 2; Equal length portions of nucleobases 17853 to 17883 of SEQ ID NO: 2; an equal length portion of nucleobases 18097 to 18160 of SEQ ID NO:2; an equal length portion of nucleobases 18206 to 18237 of SEQ ID NO: 2; an equal length portion of nucleobases 18237 to 18340 of SEQ ID NO: 2; Equal length portions of nucleobases 18350 to 18387 of SEQ ID NO: 2; Equal length portions of nucleobases 18412 to 18469 of SEQ ID NO: 2; an equal length portion of nucleobases 18461 to 18506 of SEQ ID NO: 2; Equal length portions of nucleobases 18539 to 18579 of SEQ ID NO: 2; Equal length portions of nucleobases 18697 to 18727 of SEQ ID NO: 2; an equal length portion of nucleobases 18755 to 18793 of SEQ ID NO: 2; Equal length portions of nucleobases 18797 to 18819 of SEQ ID NO: 2; an equal length portion of nucleobases 18839 to 18862 of SEQ ID NO: 2; an equal length portion of nucleobases 18974 to 19021 of SEQ ID NO: 2; an equal length portion of nucleobases 19028 to 19080 of SEQ ID NO: 2; an equal length portion of nucleobases 19146 to 19173 of SEQ ID NO: 2; an equal length portion of nucleobases 19228 to 19253 of SEQ ID NO: 2; an equal length portion of nucleobases 19347 to 19393 of SEQ ID NO: 2; an equal length portion of nucleobases 19550 to 19523 of SEQ ID NO: 2; or 1. An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 19512 to 19534 of SEQ ID NO:2, The oligomeric compound, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. [Aspect 4] Consists of 12 to 30 linked nucleosides, and SEQ ID NOs: 1050, 1124, 2145, 2151, 2152, 2153; SEQ ID NOs: 36, 86, 114, 164, 191, 242, 269, 426, 523, 602, 691, 780; SEQ ID NOs: 89, 167, 245, 322, 323; SEQ ID NOs: 720, 808, 904, 937, 1058, 1097, 1184, 1278, 1340; SEQ ID NOs: 40, 41, 117, 118, 195, 196, 273, 274, 588, 690; SEQ ID NOs: 42, 43, 119, 120, 197, 198, 275, 276, 373, 460, 1431, 1542, 1645, 1850, 1965, 2109; SEQ ID NOs: 1451, 1499, 1543, 1654, 1733, 2154, 2155, SEQ ID NOs: 200, 420, 504, 620, 646, 709, 823, 980, 1029, 1149, 1196, 1253, 1323, 1423, 1476, 1605, 1613, 1728, 1832; SEQ ID NOs: 45, 46, 123, 124, 201, 202, 279, 280, 538, 562, 2091; SEQ ID NOs: 48, 49, 50, 51, 52, 53, 125, 126, 127, 128, 129, 130, 131, 203, 204, 205, 206, 207, 208, 281, 282, 283, 284, 285, 286, 414, 459, 485, 503, 579, 580, 693, 724, 840, 873, 911, 1034, 1081, 1125, 1159, 1318, 1413, 1513, 1548, 1672, 1701, 1794, 1868, 1958, 2002; SEQ ID NOs: 209, 287, 335, 439, 506, 606, 659, 1922, 2033, 2104; SEQ ID NOs: 784, 842, 869, 978, 1082, 1131, 1218, 1250, 1320, 1453, 1529, 1538, 1616, 1712, 1821; SEQ ID NOs: 54, 55, 132, 133, 210, 288, 419, 499, 564, 665, 764, 800, 881, 993, 1059, 1200, 1295, 1354, 1422, 1465, 1544, 1705, 1802, 2149; SEQ ID NOs: 338, 438, 525, 604, 658, 758, 813, 887, 977, 1043, 1108, 1199, 1258, 1336, 1395, 1514, 1557, 1668, 1697, 2089; SEQ ID NOs: 875, 934, 1047, 1110, 1229, 1243, 1373, 1438, 2146, 2147; SEQ ID NOs: 761, 798, 890, 946, 1022, 1120, 1198, 1293, 1358, 1398, 1463; SEQ ID NOs: 56, 134, 683, 718; SEQ ID NOs: 1610, 1663, 1702, 1786; SEQ ID NOs: 212, 1060, 1090, 1181, 1277, 1446, 1510, 1589, 1646, 1693, 1772, 2148; SEQ ID NOs: 57, 586, 666, 714, 812, 914, 951, 1052, 1138, 1162, 1248, 1363, 1455; SEQ ID NOs: 385, 416, 545, 621, 682, 1968, 2055, 2101, 2150; SEQ ID NOs: 363, 467, 541, 2008, 2111; SEQ ID NOs: 58, 59, 136, 213, 214, 291, 292, 383, 417, 519, 612, 671, 730, 900, 986, 1019, 1136, 1353, 1457, 1504, 1546, 2093; SEQ ID NOs: 398, 435, 2095, 2010, 2144; or 1. An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleobases of a sequence selected from SEQ ID NOs: 1201, 1238, 1341, 1435, The oligomeric compound, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. [Aspect 5] An oligomeric compound according to any one of Aspects 1 to 4, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO: 2 when measured across the entire nucleobase sequence of the modified oligonucleotide. [Aspect 6] The oligomeric compound according to any one of Aspects 1 to 5, wherein the modified oligonucleotide comprises at least one modified nucleoside that comprises a modified sugar moiety. [Aspect 7] The oligomeric compound of Aspect 6, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety. [Aspect 8] The oligomeric compound of Aspect 7, wherein the bicyclic sugar moiety comprises a 4'-2' bridge, and the 4'-2' bridge is selected from -CH2-O- and -CH(CH3)-O-. [Aspect 9] The oligomeric compound according to any one of Aspects 6 to 8, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety. [Aspect 10] The oligomeric compound of Aspect 9, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety. [Aspect 11] The oligomeric compound according to any one of Aspects 6 to 10, wherein the modified oligonucleotide comprises at least one modified nucleoside that comprises a sugar surrogate. [Aspect 12] The oligomeric compound of Aspect 11, wherein the sugar surrogate is any one of morpholino, modified morpholino, PNA, THP, and F-HNA. [Aspect 13] The oligomeric compound of any one of Aspects 1 to 6 or 9 to 12, wherein the modified oligonucleotide does not contain a bicyclic sugar moiety. [Aspect 14] The oligomeric compound according to any one of Aspects 1 to 13, wherein the modified oligonucleotide is a gapmer. [Aspect 15] the modified oligonucleotide is a 5' region consisting of 1 to 7 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; a 3' region consisting of 1 to 7 linked 3' region nucleosides; 15. The oligomeric compound of any one of Aspects 1 to 14, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-deoxyfuranosyl sugar moiety. [Aspect 16] The modified oligonucleotide is a 5' region consisting of 5 linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of 5 linked 3' region nucleosides; 16. The oligomeric compound of embodiment 15, wherein each of the 5' region nucleosides and each of the 3' region nucleosides is a 2'-MOE nucleoside, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside. [Aspect 17] The modified oligonucleotide is a 5' region consisting of six linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of four linked 3' region nucleosides; 16. The oligomeric compound of embodiment 15, wherein each of the 5' region nucleosides and each of the 3' region nucleosides is a 2'-MOE nucleoside, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside. [Aspect 18] The oligomeric compound according to any one of Aspects 1 to 17, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage. [Aspect 19] The oligomeric compound of Aspect 18, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage. [Embodiment 20] The oligomeric compound of embodiment 18 or 19, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage. [Aspect 21] The oligomeric compound of Aspect 18 or Aspect 20, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage. [Embodiment 22] The oligomeric compound of any of embodiments 18, 20, or 21, wherein each internucleoside linkage is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage. [Embodiment 23] The oligomeric compound of embodiment 19, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage. [Aspect 24] The oligomeric compound of any of Aspects 1 to 18 or 20 to 22, wherein the modified oligonucleotide has an internucleoside linkage motif of soooossssssssssooss or soooooossssssssssoss, where s is a phosphorothioate internucleoside linkage and o is a phosphodiester internucleoside linkage. [Aspect 25] The oligomeric compound according to any one of Aspects 1 to 24, wherein the modified oligonucleotide comprises at least one modified nucleobase. [Aspect 26] The oligomeric compound of Aspect 25, wherein the modified nucleobase is 5-methylcytosine. [Aspect 27] The oligomeric compound according to any one of Aspects 1 to 26, wherein the modified oligonucleotide consists of 12 to 30, 12 to 22, 12 to 20, 14 to 18, 14 to 20, 15 to 17, 15 to 25, 16 to 18, 16 to 20, 17 to 20, 18 to 20, or 18 to 22 linked nucleosides. [Aspect 28] The oligomeric compound of any one of Aspects 1 to 26, wherein the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides. [Aspect 29] The oligomeric compound of Aspect 28, wherein the modified oligonucleotide consists of 20 linked nucleosides. [Aspect 30] The oligomeric compound of Aspect 28, wherein the modified oligonucleotide consists of 18 linked nucleosides. [Embodiment 31] An oligomeric compound having the following chemical representation: m C es m C eo m C eo A eo A eo T ds A ds G ds A ds T ds T ds m C ds A ds A ds m C ds T eo A eo G es m C es m C e (SEQ ID NO: 134); A es m C eo A eo m C eo A eo A ds m C ds Tds m C ds T ds T ds T ds A ds m C ds A ds A eo m C eo A es A es A e (SEQ ID NO: 411); T es m C eo T eo m C eo m C eo A ds G ds A ds m C ds A ds [[ID=5​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​eo m C eo A ds A ds T ds T ds m C ds T ds A ds T ds A ds T ds m C eo A eo G es A es A e (SEQ ID NO:2010); A es T eo G eo T eo G eo A ds T ds m C ds T ds A ds T ds A ds T ds m C ds A ds G eo G eo A es G es A e (SEQ ID NO: 1772); or A es m C eo m C eo A eo G eo A ds G ds G ds G ds m C ds m C ds A ds T ds m C ds T ds m C eo A eo G es G es T e (SEQ ID NO: 881) T es G eo T eo A eo G eo T ds A ds m C ds A ds A ds A ds T ds m C ds T ds T ds T eo m C eo m C es T es T e (SEQ ID NO: 2101); G es m C eo A eo T eo m C eo A ds G ds A ds T ds G ds T ds T ds m C ds A ds T ds m C eo T eo m C es T es T e (SEQ ID NO: 1050); m C es m C eo T eo m C eo m C eo A ds T ds ​​​​​​​​​​​​​​​ds T ds G eo A eo m C es T es T e (SEQ ID NO: 1449), In the notation, A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, The oligomeric compound wherein o is a phosphodiester internucleoside linkage. [Embodiment 32] An oligomeric compound having the following chemical representation: T es G eo T eo A eo G eo T ds A ds m C ds A ds A ds A ds T ds m C ds T ds T ds T eo m C eo m C es T es T e (SEQ ID NO: 2101), A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, The oligomeric compound wherein o is a phosphodiester internucleoside linkage. [Embodiment 33] An oligomeric compound having the following chemical representation: A es m C eo A eo A eo A eo T eo m C ds T ds T ds T ds m C ds m C ds T ds T ds m C ds A ds A eo T es T es A e (SEQ ID NO: 682), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, The oligomeric compound wherein o is a phosphodiester internucleoside linkage. [Embodiment 34] An oligomeric compound having the following chemical representation: m C es A eo G eo A eo T eo G eo T ds T dsm C ds A ds T ds m C ds T ds m C ds T ds T ds m C eo A es m C es A e (SEQ ID NO: 1124), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, The oligomeric compound wherein o is a phosphodiester internucleoside linkage. [Embodiment 35] An oligomeric compound having the following chemical representation: m C es A eo T eo m C eo A eo G eo A ds T ds G ds T ds T ds m C ds A ds T ds m C ds T ds m C eo T es T es m C e (SEQ ID NO: 2145), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, The oligomeric compound wherein o is a phosphodiester internucleoside linkage. [Aspect 36] The oligomeric compound according to any one of Aspects 1 to 35, wherein the oligomeric compound is a single-stranded oligomeric compound. [Aspect 37] The oligomeric compound according to any one of Aspects 1 to 36, which consists of the modified oligonucleotide. [Aspect 38] The oligomeric compound according to any one of Aspects 1 to 36, further comprising a conjugate group. [Aspect 39] The oligomeric compound according to aspect 38, wherein the conjugate group comprises a conjugate moiety and a conjugate linker. [Aspect 40] The oligomeric compound of Aspect 38, wherein the conjugate group comprises a GalNAc cluster comprising 1 to 3 GalNAc ligands. [Aspect 41] The oligomeric compound of aspect 38 or 39, wherein the conjugate linker consists of a single bond. [Aspect 42] The oligomeric compound according to aspect 39 or 41, wherein the conjugate linker is cleavable. [Aspect 43] The oligomeric compound of Aspect 39 or 42, wherein the conjugate linker comprises one to three linker nucleosides. [Aspect 44] The oligomeric compound according to any one of Aspects 38 to 43, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide. [Aspect 45] The oligomeric compound according to any one of Aspects 38 to 43, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide. [Aspect 46] The oligomeric compound according to any one of Aspects 1 to 36 or 38 to 45, further comprising a terminal group. [Aspect 47] The oligomeric compound according to any one of Aspects 1 to 42 or 44 to 46, wherein the oligomeric compound does not contain a linker nucleoside. [Aspect 48] The oligomeric compound according to any one of Aspects 1 to 47, wherein the modified oligonucleotide of the oligomeric compound is a salt, and the salt is a sodium salt or a potassium salt. [Aspect 49] The oligomeric compound according to any one of Aspects 1 to 48, wherein the modified oligonucleotide is an RNAi compound. [Aspect 50] An oligomeric duplex comprising the oligomeric compound according to any one of aspects 1 to 35 or 37 to 49. [Aspect 51] An antisense compound comprising the oligomeric compound according to any one of Aspects 1 to 49 or the oligomeric duplex according to Aspect 50, or consisting of said oligomeric compound or said oligomeric duplex. [Aspect 52] The following chemical structure: [ka] The modified oligonucleotide or a salt thereof according to the above. [Embodiment 53] The modified oligonucleotide according to embodiment 52, which is a sodium salt or a potassium salt. [Embodiment 54] A modified oligonucleotide according to the following chemical structure: [ka] [Embodiment 55] The following chemical structure: [ka] The modified oligonucleotide or a salt thereof according to the above. [Embodiment 56] The modified oligonucleotide according to embodiment 55, which is a sodium salt or a potassium salt. [Embodiment 57] A modified oligonucleotide according to the following chemical structure: [ka] [Embodiment 58] The following chemical structure: [ka] The modified oligonucleotide or a salt thereof according to the above. [Embodiment 59] The modified oligonucleotide according to embodiment 58, which is a sodium salt or potassium salt. [Embodiment 60] A modified oligonucleotide according to the following chemical structure: [ka] [Aspect 61] The following chemical structure: [ka] The modified oligonucleotide or a salt thereof according to the above. [Embodiment 62] The modified oligonucleotide according to embodiment 61, which is a sodium salt or a potassium salt. [Embodiment 63] A modified oligonucleotide according to the following chemical structure: [ka] [Aspect 64] A pharmaceutical composition comprising an oligomeric compound according to any one of aspects 1 to 49, an oligomeric duplex according to aspect 50, an antisense compound according to aspect 51, or a modified oligonucleotide according to any one of aspects 52 to 63, and a pharmaceutically acceptable diluent or carrier. [Aspect 65] A pharmaceutical composition according to Aspect 64, comprising a pharmaceutically acceptable diluent, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate buffered saline (PBS). [Aspect 66] The pharmaceutical composition described in Aspect 65, wherein the pharmaceutical composition consists essentially of the oligomeric compound or the modified oligonucleotide and aCSF. [Aspect 67] The pharmaceutical composition described in Aspect 65, wherein the pharmaceutical composition consists essentially of the oligomeric compound or the modified oligonucleotide and PBS. [Aspect 68] A pharmaceutical composition comprising the modified oligonucleotide according to any one of Aspects 52 to 63 and a pharmaceutically acceptable diluent. [Aspect 69] A pharmaceutical composition described in Aspect 68, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate buffered saline (PBS). [Aspect 70] The pharmaceutical composition described in Aspect 69, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and aCSF. [Aspect 71] The pharmaceutical composition described in Aspect 69, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and PBS. [Aspect 72] A pharmaceutical composition comprising the oligomeric compound according to any one of Aspects 32 to 35 and a pharmaceutically acceptable diluent. [Aspect 73] The pharmaceutical composition described in Aspect 72, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate buffered saline (PBS). [Aspect 74] The pharmaceutical composition described in Aspect 73, wherein the pharmaceutical composition consists essentially of the oligomeric compound and aCSF. [Aspect 75] The pharmaceutical composition of Aspect 73, wherein the pharmaceutical composition consists essentially of the oligomeric compound and PBS. [Aspect 76] A chirally enriched population of modified oligonucleotides described in any one of aspects 52 to 63, wherein the population is enriched for modified oligonucleotides containing at least one specific phosphorothioate internucleoside linkage having a specific stereochemical configuration. [Embodiment 77] The chirally enriched population of embodiment 76, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration. [Embodiment 78] The chirally enriched population of embodiment 76, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Rp) configuration. [Embodiment 79] The chirally enriched population of embodiment 76, wherein the population is enriched for modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage. [Aspect 80] The chiral enriched population described in embodiment 79, wherein the population is enriched for modified oligonucleotides having an (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage. [Embodiment 81] The chiral enriched population of embodiment 79, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages. [Embodiment 82] The chirally enriched population of embodiment 79, wherein the population is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configuration in the 5' to 3' direction. [Aspect 83] A population of modified oligonucleotides described in any one of Aspects 52 to 63, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are sterically random. [Embodiment 84] A chiral enriched population of oligomeric compounds according to any one of embodiments 32 to 35, wherein the population is enriched for oligomeric compounds comprising at least one specific phosphorothioate internucleoside linkage having a specific stereochemical configuration. [Embodiment 85] The chirally enriched population of embodiment 84, wherein the population is enriched for oligomeric compounds comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration. [Embodiment 86] The chirally enriched population of embodiment 84, wherein the population is enriched for oligomeric compounds comprising at least one specific phosphorothioate internucleoside linkage having an (Rp) configuration. [Embodiment 87] The chirally enriched population of embodiment 84, wherein the population is enriched for oligomeric compounds having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage. [Embodiment 88] A chiral enriched population according to embodiment 87, wherein the population is enriched for oligomeric compounds having an (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage. [Embodiment 89] The chirally enriched population of embodiment 87, wherein the population is enriched for oligomeric compounds having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages. [Embodiment 90] The chirally enriched population of embodiment 87, wherein the population is enriched for oligomeric compounds having at least three consecutive phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configuration in the 5' to 3' direction. [Aspect 91] The population of oligomeric compounds of any one of Aspects 32 to 35, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are sterically random. [Aspect 92] A pharmaceutical composition comprising a chiral enriched population according to any one of aspects 76 to 82 or 84 to 90, or a population according to aspect 83, or a population according to aspect 91, and a pharmaceutically acceptable diluent. [Aspect 93] A pharmaceutical composition described in Aspect 92, wherein the pharmaceutically acceptable diluent is artificial CSF (aCSF) or phosphate buffered saline (PBS). [Aspect 94] The pharmaceutical composition described in Aspect 93, wherein the pharmaceutical composition consists essentially of the oligomeric compound or the modified oligonucleotide and artificial CSF (aCSF). [Aspect 95] The pharmaceutical composition of Aspect 93, wherein the pharmaceutical composition consists essentially of the oligomeric compound or the modified oligonucleotide and PBS. [Aspect 96] A method comprising administering to an animal a pharmaceutical composition described in any one of aspects 64 to 75 or 92 to 95. [Aspect 97] A method for treating a disease or disorder associated with PLP1, comprising administering a therapeutically effective amount of a pharmaceutical composition described in any of embodiments 64 to 75 or 92 to 95 to a subject having or at risk of developing a disease associated with PLP1, thereby treating the disease or disorder associated with PLP1. [Aspect 98] A method for reducing PLP1 protein in the CSF of a subject having or at risk of developing a disease or disorder associated with PLP1, the method comprising reducing PLP1 protein in the CSF using a therapeutically effective amount of a pharmaceutical composition described in any of aspects 64 to 75 or 92 to 95. [Aspect 99] A method according to aspect 97 or 98, wherein the disease or disorder associated with PLP1 is a neurodegenerative disease. [Aspect 100] A method according to any one of aspects 97 to 99, wherein the disease or disorder associated with PLP1 is leukodystrophy. [Aspect 101] The method described in aspect 100, wherein the leukodystrophy is PMD. [Aspect 102] The method described in aspect 101, wherein the PMD is any one of severe PMD, standard PMD, and accelerated PMD. [Aspect 103] The method described in aspect 101, wherein the PMD is caused by overexpression of PLP1 protein. [Aspect 104] The method described in aspect 101, wherein the PMD is caused by multiple copies of the PLP1 gene. [Aspect 105] The method described in aspect 101, wherein the PMD is caused by expression of a duplicated copy of the PLP1 gene. [Aspect 106] A method according to any one of aspects 100 to 105, wherein at least one symptom or feature of the leukodystrophy is improved. [Aspect 107] A method according to aspect 97 or 98, wherein the disease or disorder associated with PLP1 is SPG2. [Aspect 108] The method described in aspect 107, wherein at least one symptom or characteristic of SPG2 is improved. [Aspect 109] The method described in aspect 106 or 108, wherein the symptom or characteristic is any of hypotonia, nystagmus, optic atrophy, respiratory distress, motor slowing, cognitive impairment, language impairment, spasticity, ataxia, seizures, choroidal movement, and death. [Embodiment 110] A method described in any of embodiments 96 to 109, wherein administering the modified oligonucleotide reduces hypotonia, nystagmus, optic atrophy, respiratory distress, motor slowing, cognitive impairment, language impairment, spasticity, ataxia, seizures, or choroidal movement in a subject, or delays death. [Aspect 111] A method according to any one of aspects 96 to 110, wherein the pharmaceutical composition is administered to the central nervous system or systemically. [Aspect 112] The method of aspect 111, wherein the pharmaceutical composition is administered to the central nervous system or systemically. [Aspect 113] A method according to any one of aspects 96 to 110, wherein the pharmaceutical composition is administered intrathecally, systemically, subcutaneously, or intramuscularly. [Embodiment 114] A method for reducing PLP1 RNA in a cell, comprising contacting the cell with an oligomeric compound described in any one of embodiments 1 to 49, an oligomeric duplex described in embodiment 50, an antisense compound described in embodiment 51, or a modified oligonucleotide described in any one of embodiments 52 to 63, thereby reducing PLP1 RNA in the cell. [Embodiment 115] A method for reducing PLP1 protein in a cell, comprising contacting the cell with an oligomeric compound described in any one of embodiments 1 to 49, an oligomeric duplex described in embodiment 50, an antisense compound described in embodiment 51, or a modified oligonucleotide described in any one of embodiments 52 to 63, thereby reducing PLP1 protein in the cell. [Embodiment 116] A method according to embodiment 114 or embodiment 115, wherein the cells are oligodendrocytes or oligodendrocyte precursor cells. [Embodiment 117] A method according to embodiment 114 or embodiment 115, wherein the cell is a Schwann cell or a Schwann cell precursor cell. [Aspect 118] A method described in any one of aspects 114 to 117, wherein the cell is present in an animal. [Aspect 119] The method of aspect 96 or 117, wherein the animal is a human. [Aspect 120] A method comprising administering to a subject the pharmaceutical composition described in any one of aspects 68 to 71. [Aspect 121] A method for treating a disease or disorder associated with PLP1, comprising administering a therapeutically effective amount of a pharmaceutical composition described in any of aspects 68 to 71 to a subject having or at risk of developing a disease or disorder associated with PLP1, thereby treating the disease or disorder associated with PLP1. [Aspect 122] The method described in aspect 121, wherein the disease associated with PLP1 is a neurodegenerative disease. [Aspect 123] The method described in aspect 122, wherein the neurodegenerative disease is a leukodystrophy. [Aspect 124] The method described in aspect 123, wherein the leukodystrophy is PMD. [Aspect 125] The method described in aspect 124, wherein the PMD is any one of severe PMD, standard PMD, and accelerated PMD. [Aspect 126] The method described in aspect 124, wherein the PMD is caused by overexpression of PLP1 protein. [Aspect 127] The method described in aspect 124, wherein the PMD is caused by multiple copies of the PLP1 gene. [Aspect 128] The method described in aspect 124, wherein the PMD is caused by expression of a duplicated copy of the PLP1 gene. [Aspect 129] A method described in any one of aspects 122 to 128, wherein at least one symptom or characteristic of the neurodegenerative disease is improved. [Aspect 130] The method described in Aspect 129, wherein the symptom or characteristic is any of hypotonia, nystagmus, optic atrophy, respiratory distress, motor slowness, cognitive impairment, language impairment, spasticity, ataxia, seizures, choroidal movement, and death. [Aspect 131] A method described in any of aspects 121 to 130, wherein administering the pharmaceutical composition reduces hypotonia, nystagmus, optic atrophy, respiratory distress, motor slowing, cognitive impairment, language impairment, spasticity, ataxia, seizures, or...

Claims

1. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 16 to 30 linked nucleosides and having a nucleobase sequence comprising at least 16 contiguous nucleobases of SEQ ID NO: 1124, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

2. The oligomeric compound described in claim 1, wherein the modified oligonucleotide has a nucleic acid base sequence comprising at least 17 consecutive nucleic acid bases of SEQ ID NO: 1124.

3. An oligomeric compound described in claim 1 or 2, wherein the modified oligonucleotide has a nucleic acid base sequence comprising at least 18 consecutive nucleic acid bases of SEQ ID NO: 1124.

4. An oligomeric compound described in any one of claims 1 to 3, wherein the modified oligonucleotide has a nucleic acid base sequence comprising at least 19 consecutive nucleic acid bases of SEQ ID NO: 1124.

5. An oligomeric compound described in any one of claims 1 to 4, wherein the modified oligonucleotide has a nucleic acid base sequence comprising 20 consecutive nucleic acid bases of SEQ ID NO: 1124.

6. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 16 to 30 linked nucleosides and having a nucleobase sequence comprising at least 16 contiguous nucleobases complementary to an equal length portion of nucleobases 9198 to 9222 of SEQ ID NO:2, The above oligomeric compound, wherein said modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

7. The oligomeric compound described in claim 6, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 17 consecutive nucleobases complementary to an equal length portion of nucleobases 9198 to 9222 of SEQ ID NO:

2.

8. An oligomeric compound described in claim 6 or 7, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 18 consecutive nucleobases complementary to an equal length portion of nucleobases 9198 to 9222 of SEQ ID NO:

2.

9. An oligomeric compound described in any one of claims 6 to 8, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 19 consecutive nucleobases complementary to an equal length portion of nucleobases 9198 to 9222 of SEQ ID NO:

2.

10. An oligomeric compound described in any one of claims 6 to 9, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 9198 to 9222 of SEQ ID NO:

2.

11. 11. The oligomeric compound of any one of claims 1 to 10, wherein the modified oligonucleotide has a nucleobase sequence that is at least 90% complementary to the nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO: 2, when measured over the entire nucleobase sequence of the modified oligonucleotide.

12. An oligomeric compound described in any one of claims 1 to 11, wherein the modified oligonucleotide has a nucleic acid base sequence that is at least 95% complementary to the nucleic acid base sequence of SEQ ID NO: 1 or SEQ ID NO: 2 when measured across the entire nucleic acid base sequence of the modified oligonucleotide.

13. An oligomeric compound described in any one of claims 1 to 12, wherein the modified oligonucleotide has a nucleic acid base sequence that is 100% complementary to the nucleic acid base sequence of SEQ ID NO: 1 or SEQ ID NO: 2 when measured across the entire nucleic acid base sequence of the modified oligonucleotide.

14. The modified sugar moiety is a) is a bicyclic sugar moiety; or b) a bicyclic sugar moiety, wherein the bicyclic sugar moiety comprises a 4'-2' bridge, and the 4'-2' bridge is -CH 2 -O- and -CH(CH 3 )-O-; or c) is a non-bicyclic modified sugar moiety; or d) a non-bicyclic modified sugar moiety, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety; or e) is a sugar substitute; or f) sugar surrogates, including morpholinos, modified morpholinos, PNAs, THPs, and F - either HNA; The oligomeric compound according to any one of claims 1 to 13.

15. 15. The oligomeric compound of any one of claims 1 to 14, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

16. 16. The oligomeric compound of any one of claims 1 to 15, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

17. The oligomeric compound of any one of claims 1 to 16, wherein the modified oligonucleotide comprises at least one modified nucleobase.

18. 18. The oligomeric compound of claim 17, wherein the modified nucleobase is 5-methylcytosine.

19. The modified oligonucleotide is a) 16 to 20 linked nucleosides; or b) 18 to 20 linked nucleosides; or c) 18 to 22 linked nucleosides; or d) 20 linked nucleosides; The oligomeric compound according to any one of claims 1 to 18, consisting of

20. 20. The oligomeric compound of any one of claims 1 to 19, wherein the oligomeric compound comprises a conjugate group.

21. The chemical structure below: 【Chemistry 1】 The modified oligonucleotide or a salt thereof according to the above.

22. 22. The modified oligonucleotide of claim 21, which is a sodium salt or a potassium salt.

23. Modified oligonucleotides according to the following chemical structure: 【Chemistry 2】

24. An oligomeric compound having the following chemical designation: m C es A eo G eo A eo T eo G eo T ds T ds m C ds A ds T ds m C ds T ds m C ds T ds T ds m C eo A es m C es A e (SEQ ID NO: 1124), wherein: A is an adenine nucleobase; m C is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; The above oligomeric compound wherein o is a phosphodiester internucleoside linkage.

25. A population of oligomeric compounds according to any one of claims 1 to 20 and 24, or a population of modified oligonucleotides according to any one of claims 21 to 23, wherein all of the phosphorothioate internucleoside linkages are sterically random.

26. A pharmaceutical composition comprising an oligomeric compound according to any one of claims 1 to 20 and 24, a modified oligonucleotide according to any one of claims 21 to 23, a population of oligomeric compounds according to claim 25, or a population of modified oligonucleotides according to claim 25, and a pharmaceutically acceptable diluent.

27. 27. The pharmaceutical composition of claim 26, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate buffered saline (PBS).

28. 28. The pharmaceutical composition of claim 27, wherein the pharmaceutical composition consists of or consists essentially of said oligomeric compound or said modified oligonucleotide and aCSF.

29. 28. The pharmaceutical composition of claim 27, wherein the pharmaceutical composition consists of or consists essentially of said oligomeric compound or said modified oligonucleotide and PBS.

30. 28. The pharmaceutical composition of claim 27, wherein the pharmaceutical composition consists of or consists essentially of said population of oligomeric compounds or said population of modified oligonucleotides and aCSF.

31. 28. The pharmaceutical composition of claim 27, wherein the pharmaceutical composition consists of or consists essentially of the population of oligomeric compounds or the population of modified oligonucleotides and PBS.

Citation Information

Patent Citations

  • Compound, method, and pharmaceutical composition for regulating PLP1 expression

    WO2021261538A1